ANNALS OF ANIMAL SCIENCE - izoo.krakow.pl

ANNALSOF ANIMAL SCIENCE

NATIONAL RESEARCH INSTITUTE OF ANIMAL PRODUCTIONVol. 8 KRAKÓW 2008 No. 1

EDITORIAL BOARD

Jędrzej Krupiński (Chairman) — Kraków-Balice,Franciszek Brzóska — Kraków-Balice,Josef Bula — Nitra,Krystyna Małgorzata Charon — Warszawa,Clas Elwinger — Uppsala,Tibor Gere — Gyöngyös,Kay-Uwe Götz — Poing-Grub,Ingemar Gustavsson — Uppsala,Eugeniusz Herbut — Kraków-Balice,Dymitr Kalisiewicz — Olsztyn,Juliusz Książkiewicz — Kraków-Balice,Andrzej Potkański — Poznań,Marian Różycki — Kraków-Balice,Jiři Rubeš — Brno,Yasuo Shioya — Ibaraki,Ryszard Słomski — Poznań,Zdzisław Smorąg — Kraków-Balice,Vasyl Vlizlo — Lviv,Jacek Wójtowski — Poznań

EDITORIAL STAFF

Editor-in-Chief — Ewa SłotaDeputy Editors-in-Chief — Mariusz Pietras, Juliusz KsiążkiewiczSecretary — Katarzyna SkupniewiczEditing — Magdalena Bielska, Danuta Dobrowolska, Jerzy Pilawski, Katarzyna SkupniewiczCover design — Beata Barszczewska-Wojda

Address of Editorial Office — Instytut Zootechniki — Państwowy Instytut Badawczy,ul. Sarego 2, 31-047 Kraków, Poland

The “Annals of Animal Science” are derived from the journal“Roczniki Naukowe Zootechniki” which has been published since 1974

This publication was supported by the Ministry of Science and Higher Education

© Copyright by National Research Institute of Animal Production

PL ISSN 1642-3402

Ann. Anim. Sci., Vol. 8, No. 1 (2008) 3 – 11

COMPARISON OF DAIRY PERFORMANCE OF MONTBELIARDEAND BLACK-AND-WHITE COWS HOUSED

IN THE SAME ENVIRONMENTAL CONDITIONS

M a r c i n G o ł ę b i e w s k i , P i o t r B r z o z o w s k i

Division of Cattle Breeding, Department of Animal Science,Warsaw University of Life Sciences, Ciszewskiego 8, 02-786 Warszawa, Poland

AbstractThe purpose of the study was to compare the dairy traits of Montbeliarde and Black-and-White cows based on milk samples and lactation yields. The milk, fat and protein yields as well as solids, fat, protein, lactose and urea content in milk were analysed. There were no statistical differences between the milk, fat and protein yields in the milk of both breeds during 305-day lactations. Higher protein content was observed in the milk of Montbeliarde cows (3.57%) than Black-and-White cows (3.49%) (P≤0.01). Highly significant differences were reported during milk sample analysis. Higher daily milk production was found in Black-and-White cows (20.01 kg) than in Montbeliarde cows (18.5 kg). Higher fat content was observed in the milk of Black-and-White cows (0.19%). Consider-ably higher protein (0.08%) and lactose (0.06%) content was observed in the milk of Montbeliarde cows.

Key words: milk performance, Montbeliarde cows, Black-and-White cows

Over 94% of performance recorded cows in Poland are of the Black-and-White breed, with other breeds accounting for a small proportion of the cow population. French Montbeliarde cattle are a lesser-known dairy breed raised in Poland (UPRa, Montbeliarde, 2006). The first heifers of this breed were imported to Poland in 1995 and three years later the first group of Montbeliarde cows was performance record-ed. Montbeliarde cattle are a dual-purpose breed that has become popular in Poland thanks to many advantages.

The Polish literature provides little information on the evaluation of Montbeliarde cows. Despite the rapid increase in the population of Montbeliarde cows evaluated in Poland, there is little information on the acclimatization of this French breed to the Polish environment (Trela, 2003). The comparison of dairy performance of these two breeds raised in the same environmental conditions made it possible to assess the pre-disposition of Montbeliarde cows to Polish production systems.

M. Gołębiewski and P. Brzozowski4

Material and methods

The study was carried out on 170 Black-and-White and 200 Montbeliarde cows. The animals were kept on the same farm, in the loose-housing system. Cows of both breeds were divided into four feeding groups (two for dry cows and two for milking cows). Total mixed ration was the only feeding system.

The daily ration for cows with daily milk production up to 25 kg, fat concentration 4.2% and protein concentration 3.5% was 22.2 kg of maize silage, 4.3 kg of lucerne silage, 4.3 kg of grass silage, 6.4 kg of sugar beet pulp silage, 3 kg of rape protein concentrate, 2.5 kg of oat grain, 1.5 kg of maize grain, 0.5 of soy protein concentrate, 0.150 kg of Bestermine Lacto HP, and 0.1 kg of pasture limestone.

The daily ration for cows with daily milk production up to 35 kg, fat concentra-tion 4.2% and protein concentration 3.5% was 21.2 kg of maize silage, 8.3 kg of grass silage, 7.5 kg of sugar beet pulp silage, 2.5 kg of rape protein concentrate, 2 kg of oat grain, 1 kg of maize grain, 0.5 of soy protein concentrate, 0.150 kg of Bestermine Lacto HP, 0.1 kg of pasture limestone and 6.3 kg of concentrate of 1199 KDF 18% BASIC GR.

The daily ration for dry cows was 7 kg of hay, 15 kg of grass silage, 5 kg of maize silage and 0.150 kg of Bestermine EB-MIX for cows in the first stage of the dry pe-riod (first five weeks), and 16.7 kg of maize silage, 3.2 kg of lucerne silage, 3.2 kg of grass silage, 4.8 kg of sugar beet pulp silage, 2.3 kg of rape protein concentrate, 1.9 kg of oat grain, 1 kg of maize grain and 0.1 kg of Bestermine Lacto HP for cows in the second stage of the dry period (last three weeks before calving).

Milk yield data from the first two lactations came from milk recording conducted during 2002–2004.

Test-day data were used to prepare 14-day interval specifications. This information was used to draw lactation curves and figures of fat and protein content in the cow’s milk in both the first and second lactation. Lactation persistency indices were estimat-ed from average milk yields in the milk samples. The data were analysed statistically with the Statistical Package for the Social Sciences software (SPSS,1989–2003) using multifactorial analysis of variation. The U Test was used to find statistical differences between curves on the figures. The first model was used to analyse milk, fat and protein yield in 305-day lactation. In this model, breed effect, age at first parturition effect, lactation effect, year-season of parturition effect and the interaction between breed and first parturition were taken into consideration.

As regards the test data of milk samples analysed in Models 2 and 3, Model 2 was used to compare daily milk yields and milk composition of Montbeliarde and Black-and-White cows. This model accounted for breed effect, lactation effect, stage of lac-tation effect (lactation divided into 22 two-week intervals), and breed and lactation interaction. The third model was used to obtain records for figures prepared separately for the breeds and lactations. Model 3 accounted for age at first parturition effect, year and season of parturition effect, and stage of lactation effect (lactation divided into 22 two-week intervals).

Dairy performance of Montbeliarde and Black-and-White cows 5

Results

Comparison of average milk, fat and protein yields in a 305-day lactation of Montbeliarde and Black-and-White cows did not show any statistical differences (Table 1). Significantly higher protein content was observed in Montbeliarde milk (0.192%) with similar fluctuations in both breed groups.

Table 1. Least square means (LSM) and standard error (SE) for dairy traits of Black-and-White and Montbeliarde cows in 305-day lactations

TraitMontbeliarde breed Black-and-White breed Total Statistical

significanceLSM SE LSM SE LSM SE

305-day milk production (kg)

5693.58 218.74 5833.13 217.65 5763.35 201.47 ns

Fat (kg) 245.79 9.34 253.65 9.29 249.72 8.61 ns

Fat (%) 4.31 0.06 4.37 0.06 4.34 0.06 ns

Protein (kg) 202.59 7.46 198.26 7.42 200.43 6.87 ns

Protein (%) 3.56 0.04 3.37 0.04 3.47 0.04 xx

xx – P≤0.01.ns – non-significant.

Figure 1. Age at first parturition and breed interaction’s influence on protein and fat yield

A highly significant interaction effect between age at first parturition and breed on fat and protein yield in the studied herd was observed (Figure 1). Fat and protein yield in milk increased with the age at first parturition. Montbeliarde cows calving beyond 946 days of age had lower concentrations of fat and protein than those of cows calving earlier.


Table 2. Least square means (LSM) and standard error (SE) for daily milk performance traits of Montbeliarde and Black-and-White cows

TraitMontbeliarde breed Black-and-White breed Total Statistical

significanceLSM SE LSM SE LSM SE

Milk (kg) 18.50 0.09 20.01 0.13 19.26 0.08 xx

Fat (%) 4.27 0.01 4.46 0.02 4.37 0.01 xx

Protein (%) 3.57 0.01 3.49 0.08 3.53 0.01 xx

Lactose (%) 4.96 0.00 4.90 0.01 4.98 0.01 xx

Solids (%) 13.59 0.02 13.64 0.02 13.62 0.01 nsxx – P≤0.01.ns – non-significant.

Highly significant differences were reported between Black-and-White and Mont-beliarde cows for daily performance data. The Black-and-White cows had higher milk production (20.01 kg) compared to Montbeliarde cows (18.50 kg). Compared to Black-and-White cows, Montbeliarde cows had lower fat concentration in milk, the differences being highly significant (P≤0.01). In the milk of Montbeliarde cows, protein content was 3.57% and lactose level 4.96%. Both the protein and lactose con-centration in the milk of Montbeliarde cows was statistically higher than in Black-and-White cows (P≤0.01).

Comparison of the milk curves in the first lactation (Figure 2) showed that average daily milk yield of Black-and-White cows was higher than that of Montbeliarde cows, especially in the first and last stages of lactation. The lactation curve for Black-and-White cows was less regular in shape compared to that for Montbeliarde cows. Black-and-White primiparas achieved peak daily milk production (26.7 kg) between 45 and 65 days of lactation. From 60 days of lactation, milk production started to decrease slowly. Between 105 and 120 days, Black-and-Whites produced 3.5 kg less milk. Af-ter 200 days, production decreased by a further 3 kg. At the end of the lactation, the cows yielded about 15 kg of milk per day. The persistency index was 87%. Montbe-liarde primiparas had more regular lactation and the persistency index value was 94%. Montbeliardes did not have as high production during the lactation peak. Between the 45th and 60th day their daily milk yield was lower than in Black-and-White cows at the same time (about 4.2 kg). The decrease in milk production in the first 100 days of lactation was also slowed in Montbeliardes. The decrease in milk yield between 100 and 200 days of lactation, which amounted to 3 kg of milk a day, was slightly higher.

Similar differences in the shape of curves were observed during the second lacta-tion (Figure 3). Black-and-White cows were characterized by a more regular curve of milk during the second lactation. The persistency index was 70% in Montbeliarde cows and 75% in Black-and-White cows. The highest decrease in milk production during the second lactation was observed during the first 100 days after the production peak. Montbeliarde cows with a peak yield of 25 kg produced 6.5 kg less milk on day 120. The peak yield of Black-and-White cows was higher and amounted to 26 kg a day and decreased to 20.2 kg a day at 120 days of lactation.


Figure 2. Lactation curve of Montbeliarde and Black-and-White cows (first lactation)

Figure 3. Lactation curve of Montbeliarde and Black-and-White cows (second lactation)

Figures 4, 5, 6, 7 show the curves of fat and milk concentration in milk during the first and second lactation. Montbeliarde heifers had higher fat content in milk be-tween 60 and 75 days (4.48%) than Black-and-White heifers (3.9%) (Figure 4). Such


a considerable difference might be associated with the higher milk yield of Black-and-White cows during that time. At the end of lactation higher fat concentration was observed in the milk of Black-and-White cows, with highly significant differences. During the second lactation, both breeds were characterized by similar fat content (4%). Similar to the first lactation, Black-and-White cows produced milk with higher fat concentration after 150 days of the second lactation (Figure 5).

Figure 4. Curves of fat content in milk of Montbeliarde and Black-and-White cows (first lactation)

Figure 5. Curves of fat content in milk of Montbeliarde and Black-and-White cows (second lactation)


In both lactations, the decrease in fat content at the beginning of lactation was followed by an increase in fat content during the rest of the lactation (Figures 4 and 5).

Similar correlations were noted when protein concentration was analysed (Figures 6 and 7). Because of the negative correlation between milk production and protein content in milk, Montbeliarde heifers produced milk richer in protein (0.43%) than their age mates (Figure 6). In the second lactation, Black-and-White cows had higher protein concentration from day 150. Between 150 and 210 days, the difference was statistically significant (Figure 7).

Figure 6. Curves of protein content in milk of Montbeliarde and Black-and-White cows (first lactation)

Figure 7. Curves of protein content in milk of Montbeliarde and Black-and-White cows (second lactation)


Both breeds of cows showed a much more regular concentration of protein com-pared to the concentration of fat in both lactations. Protein content was increasing during the next stages of lactation (Figures 6 and 7).

Discussion

Data from the Polish Animal Breeding Centre reports (Polberg and Pośniak-Sobczyńska, 2006) on the evaluation of cows in 2006 showed that milk production of Montbeliarde cows was slightly higher than in Black-and-White cows (only 674 kg). Average milk yield of the whole population of Black-and-White and Montbeliarde cows was higher than the production of the animals studied. In 2005, milk production was 6550 kg for Black-and-White cows and 6951 for Montbeliarde cows. The whole population of Black-and-White cows had higher fat concentration (4.2%) than in the studied herd. There were no differences in protein concentration between those two populations.

Similar results were reported by Trela (2003) for a dairy herd in Grabina. In 2001, Black-and-White cows in this farm produced 6572 kg of milk in a 305-day lacta-tion with 4.14% of fat and 3.24% of protein in milk. Montbeliarde cows in the herd were characterized by higher milk yield (6706 kg) with lower fat content (3.99%) and 3.38% of protein in milk. Dillon et al. (2003) also reported the same results for different breeds of cattle. Black-and-White cows had the highest yield of milk, fat, protein and lactose, whereas Montbeliardes produced milk with significantly higher protein and lactose content. In addition, the incidence of the κ-casein BB variant in the French breed was much greater than in the Holstein-Friesian breed. Montbeliarde cows tended to be higher producers of milk fat acids, especially fat CLA (18.45 mg/kg) compared to the other breeds examined (Lawless et al., 1999). Holstein-Friesian cows also had lower pregnancy rates than Montbeliarde cows (Dillon et al., 2006).

The fat to protein ratio has recently become a more popular parameter (Agabriel et al., 1993). The milk of Montbeliarde cows is more useful for milk processing because of the lower fat to protein ratio (1.210). The same ratio in the milk of Black-and-White cows amounted to 1.300.

The lactation persistency index of above 80% was already achieved in the first lactation of the cows studied. The corresponding persistency index for Montbeliarde and HF cows was 85% and 88.6%, respectively (Dillon et al., 2003).

According to Verdier et al. (1995), the milk of Montbeliarde cows has the most favourable cheese-making characteristics, especially when compared with Holsteins.

In spite of the lower milk yield than in Black-and-White cows, Montbeliardes had favourable milk composition and lactation persistency. These advantages predispose them for use in Poland, especially on less intensive farms where the high potential of Black-and-White cows cannot be used.


References

A g a b r i e l C., C o u l o n J., M a r t y G., B o n a i t i B. (1993). Changes in fat and protein concentration in farms with high milk production. J. Dairy Sci., 76: 734–741.

D i l l o n P., B u c k l e y P., O ’ C o n n o r D., H e g a r t y D., R a t h M. (2003). A comparison of different dairy cow breeds on a seasonal grass-based system of milk production. Milk production, live weight, body condition score and DM intake. Livest. Prod. Sci., 83: 21–33.

D i l l o n P., S n i j d e r s S., B u c k l e y P., H a r r i s B., O ’ C o n n o r D., M e e J. (2003). A comparison of different dairy cow breeds on a seasonal grass-based system of milk production. Reproduction and survival. Livest. Prod. Sci., 83: 35–42.

L a w l e s s F., S t a n t o n C., E s c o p P., D e v e r y R., D i l l o n P., M u r p h y J. (1999). Influence of breed on bovine milk cis-9, trans-11-conjugated linoleic acid content. Livest. Prod. Sci., 62: 43–49.

P o l b e r g A., P o ś n i a k - S o b c z y ń s k a J. (2006). Wyniki i oceny wartości użytkowej bydła ras mle- cznych za 2005 r. Chów bydła, 6: 8–24.

T r e l a J. (2003). Aklimatyzacja i niektóre wskaźniki produkcyjne bydła rasy Montbeliarde w Polsce. Zesz. Nauk. Prz. Hod., 67: 67–77.

Ve r d i e r I., C o u l o n J., P r a d e l P., B e r d a g u e J. (1995). Effect of forage type and cow breed on the characteristic of matured Saint-Nectaire cheeses. Lait, 75: 523–533.

Accepted for printing 8 II 2008

MARCIN GOŁĘBIEWSKI, PIOTR BRZOZOWSKI

Porównanie użytkowości mlecznej krów rasy Montbeliarde i czarno-białej w tych samych warunkach środowiskowych

STRESZCZENIE

Celem badań było porównanie mleczności krów rasy Montbeliarde i czarno-białej na podstawie danych z próbnych udojów oraz wydajności laktacyjnych. Porównano wydajność mleka, tłuszczu i białka, zawartość suchej masy, tłuszczu, białka i laktozy oraz poziom mocznika w mleku. Nie stwierdzono statystycznie istotnych różnic w wydajności mleka, tłuszczu i białka u krów obu ras w laktacji 305-dniowej. Zawartość białka była wyższa w mleku krów rasy Montbeliarde (3,57%) niż krów cb (3,49%) (P≤0,01). Wysoko istotne różnice wykazano w użytkowości mlecznej krów obu ras, gdy analizie poddano wyniki uzyskane w próbnych udojach. Krowy cb charakteryzowały się wyższą dzienną produkcją mleka (20,01 kg) niż krowy rasy Montbeliarde (18,50 kg). Wyższą zawartością tłuszczu w mleku charakteryzowały się krowy czarno-białe (o 0,19%). Zdecydowanie wyższą zawartość białka (o 0,08%) i laktozy (o 0,06%) stwierdzono w mleku krów rasy Montbeliarde.

COMPARISON OF gROWTH AND DEVELOPMENT IN COWS OF DIFFERENT MEAT BREEDS IN THE WESTERN POMERANIA AREA

BASED ON PARAMETERIzED RESULTS

J e r z y W ó j c i k , R e n a t a P i l a r c z y k , A d a m J a s i ń s k i , D a w i d P i ł a t

Department of Ruminant Science, Agricultural University,Doktora Judyma 10, 71-460 Szczecin, Poland

AbstractThe growth and development of different breeds of beef cattle, kept in semi-intensive and intensive systems in the Western Pomerania area, were compared based on parameterized traits. The body weight of the breeds that were previously considered to represent different frame sizes tended to even out. The evaluation of body weight, frame size, muscularity, calving ease, milk yield and weight gains, performed according to a scoring key, showed that Hereford and Red Angus cows were sig-nificantly better for most of the analysed traits (P≤0.01). The resultant total score also showed the superiority of these breeds over the other breeds. It was found that regardless of breeding intensity, the beef breeds of cattle evaluated based on the current scoring key were given scores that seem nonobjective in light of the results obtained. It is suggested that the current scoring key should be changed.

Key words: beef cattle, breeds, parameterized traits, scoring key

The beef cattle population is consistently growing, as is the number of cows evaluated. Meat performance in Poland is currently tested in approx. 16,000 purebred cows (PZHiPBM, 2006), with the majority being Limousin (43%), Hereford (20%) and Charolais (18%) breeds. The number of Simmental (6%), Angus (6%) and Sa- lers (4%) cows tested is also growing rapidly. Because different breeds of beef cattle raised in Poland show considerable differences in body weight, frame size and other traits, these breeds have been compared using appropriate scores (parameterization). It seems, however, that the current scoring key should be modified because of the recent changes in body size, frame size and body weight.

Sullivan et al. (1999) showed that genetic differences between breeds and relative ranks of individual breeds have changed over the recent decades due to differences in genetic trends. These trends for growth rate were higher for lighter breeds, which caused the differences between the breeds to decrease with time. In the genetic selec-tion of breeds with average frame size, the emphasis was on improved growth rate,


J. Wójcik et al.14

and in the genetic selection of breeds with large frame size, the emphasis was placed on calving ease and reduced body weight of calves postpartum (Núñez-Dominguez et al., 1993).

The aim of the study was to evaluate and compare the growth and development of beef cattle breeds raised in the semi-intensive and intensive systems based on parameterized traits.


The study was carried out in the Western Pomerania area on two farms in which cattle were housed in the intensive (farm I) and semi-intensive systems (farm II).

On farm I, Red Angus (n = 361), Salers (n = 96), Hereford (n = 83), Limousin (n = 280) and Simmental cattle (n = 226) were investigated. The production system used on the farm was characterized by year-round housing of animals without build-ings and maximum use of grasslands and rearing of calves with mothers to 6–9 months of age. The calves and cows of all the analysed breeds were fed and kept in the same way. The breeding and production system assumed that the cows of all breeds should calve in the winter and early spring months, which is why cows and heifers were subjected to oestrus synchronization in early April. Inseminations were performed between April and July. From June to mid-July, the herds were joined by the bulls designed to mate empty cows. The cows calved from December to next April under wooden shelters surrounded by bales of straw on three sides. After calving, cows with their calves were combined into groups and stayed in the outside yard, where they could take cover from the rain or snow under a shelter. The cows were fed ensiled hay, hay and mineral feed outdoors from deep wooden troughs and drinkers. From the time they were combined into groups, calves had access to CJ concentrate and crushed oats and used hay given to mothers. From May to the end of October, cows with calves stayed on the pasture all day long, and went into the outside yards for the night. Calf feeding was based on mother’s milk, pasture and concentrate. From November to calving, cows stayed on the roofless outside yards with wind shelter from straw bales. Every day they went into adjacent rapeseed or Italian ryegrass fields. They were fed extra hay, straw, wilted silage with mineral feed, and had access to salt licks.

On farm II, Charolais (n = 53), Simmental (n = 34) and Hereford (n = 83) cattle were investigated. In the summer, cattle stayed on pasture all day long, and during the night and in unfavourable weather conditions, they used permanent outside yards next to the buildings. Calves received concentrate feed up to 2 months of age. Cows were fed green forage in combination with barley straw. In the winter, calves, young cattle up to 1 year old and calved cows were fed grass silage, and calves received an extra mixture of cereals: barley, oats and triticale. Cows were mated naturally or insemi-nated. Bulls were exposed to cows from the beginning of the grazing period to the end of August. Insemination was carried out in winter and early spring. The calving season peaked from mid-February to March. After birth, calves were closed in a pen with their mother for one week to accustom them to her and to using colostrum ad libitum, and were then let loose. They stayed with the mothers until approx. 7 months of age.

Comparison of growth and development in cows of different meat breeds 15

Table 1. Scoring key for evaluation of cows (after first calving) used in herds of beef cattle (PZHiPBM)

Red Angus, Hereford Limousin Salers Simmental Charolais Points

Body weight (after weaning of calf from first calving) – max. 15 pts.

>600 >630 >670 >680 >690 15

571–600 601–630 641–670 651–680 661–690 12–14

541–570 571–600 611–640 621–650 631–660 9–11

511–540 541–570 581–610 591–620 601–630 6–8

461–510 491–540 531–580 541–590 551–600 4–5

Frame size (height at sacrum/chest circumference) – max. 15 pts.*

134/198 141/200 148/202 147/205 148/210 15

131/195 138/197 154/199 144/202 145/207 13–14

128/192 135/194 142/196 141/199 142/204 10–12

125/189 132/191 139/193 138/196 139/201 7–9

122/186 129/188 136/190 135/193 136/198 4–6*the mean from two evaluations is used in the calculations

Weight gain until weaning (210 days) – max. 20 pts. (±50g)

1000 1100 1150 1150 1200 20

950 1050 1100 1100 1150 17–19

900 1000 1050 1050 1100 14–16

800 900 950 950 1000 11–13

700 800 850 850 900 8–10Below lower range of values

Milk yield – max. 10 pts.

>2000 >2200 >2400 >2400 >2400 10

1801–2000 2001–2200 2201–2400 2201–2400 2201–2400 8–9

1601–1800 1801–2000 2001–2200 2001–2200 2001–2200 6–7

1401–1600 1601–1800 1801–2000 1801–2000 1801–2000 4–5

1201–1400 1401–1600 1601–1800 1601–1800 1601–1800 2–3

Conformation (skeleton) score – max. 20 pts. Muscularity– max. 10 pts.

95–100 20 Excellent 9–10

86–94 17–19 Very good 7–8

80–85 14–16 Good 5–6

76–79 11–13 Adequate 3–4

70–75 8–10 Poor 1–2

below 5Parturition score – max. 10 pts.

Natural without human assistance – cat. I 10With a little human assistance – cat. II a 8–9With assistance of humans (several people) and mechanical aids – cat. II b 6–7Complicated (assistance of veterinary doctor) – cat. III 4–5Very difficult (without permanent injuries) – cat. IV a 1–3Very difficult, causing permanent injury of the cow or calf – cat. IV b 0

J. Wójcik et al.16

Cows were evaluated and compared between the first calving and weaning of calves.

During 1997–2003, the breeds evaluated according to the scoring key were ana-lysed for:

· height at sacrum and chest circumference of cows after weaning of calves,· age at first calving,· body weight of mothers after weaning calves from the first calving,· estimated milk yield of mothers (Dz.U. 47, 1999),OMM = (weaning weight of calf * 1700)/age of calf· daily gains of heifers and bulls from birth to weaning, standardized for 210 days

of age (Dz.U. 47, 1999),Daily gain = (MC210 – MCur)/210· degree of calving ease,· muscularity and body conformation of cows.Scoring was done with the current scoring key (Table 1) used in herds of beef

cattle. Data were collected based on breeding records obtained during registration of cows in herd books.

The data were analysed statistically using one-way analysis of variance, estimated using Statistica PL software. The significance of differences between the groups was calculated using Duncan’s test. Parameterized values were scored and evaluated with the Kruskal-Wallis test, and the Mann-Whitney U test was used to compare the breeds for certain traits.

Results

On farm I (Table 2), the greatest height at sacrum of all the breeds evaluated was characteristic of Salers and Simmental cows. Hereford cows had a similar height at sacrum to Limousin cows, while Red Angus cows were significantly (P≤0.01) lower than the other breeds. Simmental cows were characterized by a significantly (P≤0.01) greater chest circumference compared to the other breeds, and Red Angus cows had a significantly lower (P≤0.01) chest circumference. Similar measurements were found in Salers, Hereford and Limousin cows. The highest daily gains of calves from birth to 210 days of age were also found in Simmental and Salers cows, and they were signifi-cantly (P≤0.01) greater than in the other breeds. Simmental and Hereford heifers were the first to calve. Simmental cows were also characterized by significantly (P≤0.01) greater body weight after weaning of calves from first calving.

The body weight of the breeds that were previously considered to represent dif-ferent frame sizes tended to even out. This particularly concerned the Hereford breed, which increased frame size and body weight. The evaluation of body weight, frame size, muscularity, calving ease, milk yield and weight gains, performed according to a scoring key, showed that Hereford and Red Angus cows were significantly better for most of the analysed traits (P≤0.01). The resultant total score also showed the superio-rity of these breeds over the other breeds. It is worth noting the low scores found in Simmental and Salers cows.


Tabl

e 2.

Par

amet

ers o

f gro

wth

and

dev

elop

men

t and

scor

ing

of b

reed

s on

farm

I

Para

met

erR

ed A

ngus

Sale

rsH

eref

ord

Lim

ousi

nSi

mm

enta

lM

ean

SDM

ean

SDM

ean

SDM

ean

SDM

ean

SDH

eigh

t at s

acru

m (

cm)

133.

1 A

2.5

139.

6 B

3.8

136.

2 C

3.0

136.

3 C

2.4

137.

3 D

1.9

Che

st c

ircum

fere

nce

(cm

)18

9.7

A4.

519

2.0

C4.

819

1.0

C4.

419

2.7

C5.

119

5.3

B4.

7B

ody

wei

ght o

f cow

s afte

r firs

t cal

ving

(kg)

544.

2 A

41.7

573.

3 C

41.0

567.

2 C

49.9

572.

3 C

43.0

593.

8 B

41.9

Age

of c

ows a

t firs

t cal

ving

(mon

ths)

28.1

b5.

628

.4 a

b4.

927

.6 b

4.4

29.4

a4.

527

.4 b

3.8

Milk

yie

ld o

f cow

s (kg

)19

16.7

A21

0.7

2066

.5 B

215.

919

01.9

A10

7.5

2028

.4 B

125.

421

77.7

C21

0.3

Dai

ly w

eigh

t gai

n of

cal

ves f

rom

birt

h to

wea

ning

(g

)98

6 C

114.

810

84 A

114.

398

0 C

49.0

1027

B78

.011

81 D

131.

8B

ody

wei

ght (

pts)

9.0

B3.

46.

3 C

2.49

10.7

A2.

899.

0 B

3.5

6.9

C3.

14Fr

ame

size

(pts

)11

.4 A

2.4

8.9

C3.

211

.8 A

2.2

10.8

B2.

68.

1 C

2.6

Dai

ly g

ain

of c

alve

s (pt

s)17

.0 A

2.5

16.5

C2.

818

.3 A

2.0

15.6

B3.

116

.1 C

3.3

Milk

yie

ld (p

ts)

8.4

A1.

16.

3 C

1.6

8.4

A1.

17.

8 B

1.3

6.4

C1.

6C

onfo

rmat

ion

(pts

)13

.9 A

1.9

14.7

B1.

414

.3 A

1.2

15.1

B1.

713

.4 C

1.9

Mus

cula

rity

(pts

)6.

8 B

1.5

7.1

AB

1.2

6.8

B1.

37.

2 A

1.2

6.8

B1.

5Pa

rturit

ion

(pts

)9.

80.

459.

90.

369.

81.

429.

80.

529.

80.

54O

vera

ll sc

ore

(pts

)77

.4 A

10.7

69.9

C9.

080

.0 A

8.1

75.2

B11

.467

.4 C

11.4

A, B

, C…

– d

iffer

ent l

ette

rs in

row

s den

ote

stat

istic

ally

sign

ifica

nt d

iffer

ence

s at P

≤0.0

1.a,

b, …

– d

iffer

ent l

ette

rs in

row

s den

ote

stat

istic

ally

sign

ifica

nt d

iffer

ence

s at P

≤0.0

5.

J. Wójcik et al.18

On farm II (Table 3), in accordance with the expectations, Charolais cows were characterized by the greatest chest circumference, while in Simmental and Hereford cows chest circumference was significantly (P≤0.01) lower. The height at sacrum was similar in all the analysed cows except Hereford cows, in which it was significantly (P≤0.01) lower.

Table 3. Parameters of growth and development and scoring of breeds on farm II

ParameterCharolais Hereford Simmental

Mean SD Mean SD Mean SDHeight at sacrum (cm) 136.3 A 2.20 134.0 B 3.41 136.3 A 2.41Chest circumference (cm) 200.5 A 3.57 189.6 B 3.38 195.6 C 3.46Body weight of cows after first calving (kg) 614.8 A 29.47 551.3 B 39.99 583.6 C 23.92Age of cows at first calving (months) 35.5 4.93 35.3 4.31 33.5 8.10Milk yield of cows (kg) 2038.7 A 148.59 1879.0 B 89.66 2171.3 C 116.34Daily weight gain of calves from birth to weaning (g) 998 A 82.21 855 B 50.27 1069 C 57.07Body weight (pts) 7.3 A 2.53 9.9 B 3.48 5.6 C 1.95Frame size (pts) 5.62 A 2.31 10.48 B 2.46 6.13 A 2.73Daily gain of calves (pts) 10.6 A 2.89 16.4 B 1.89 15.1 C 2.58Milk yield (pts) 5.85 A 1.62 8.32 B 0.77 7.25 C 1.16Conformation (pts) 14.7 A 1.62 13.8 B 1.73 11.7 C 2.36Muscularity (pts) 6.62 A 1.30 6.01 B 1.08 4.81 C 1.40Parturition (pts) 10 0 10 0 10 0Overall score (pts) 60.6 A 7.94 75.0 B 8.96 60.8 A 9.34

A, B, C… – different letters in rows denote statistically significant differences at P≤0.01.

The evaluation of cows’ milk yield after first calving showed significantly (P≤0.01) lower milk yield in Hereford cows and, as expected, significantly (P≤0.01) higher milk yield of Simmental cows, including in comparison with Charolais cows. The estimated milk yield values corresponded with the body weight gains obtained by calves from birth to weaning. The highest daily gains were obtained by Simmental calves, being significantly greater than those of the other breeds, followed by Cha-rolais calves, and significantly lower in Hereford calves. Because during the grazing period calves did not receive extra concentrates, the weight gains obtained are considered good. The body weight of the cows and their age at first calving show that their rearing was not intensive enough. The evaluation of body weight, frame size, daily gains of calves, milk yield, body conformation and muscularity, performed according to a scoring key, show that the Hereford breed was significantly (P≤0.01) better. Poor results were found in the Charolais and Simmental breeds (just over 60 points in total), while Hereford cows scored above 75 points.


Discussion

The body weight of cows after first calving and the height at sacrum and chest circumference are affected by calving age and management system. Litwińczuk et al. (2000) reports that Hereford cows calving at approx. 22 months of age weighed only 382.9 kg, had height at sacrum of 121.8 cm and chest circumference of 168.1 cm, while the cows calving at approx. 34 months of age weighed 507.7 kg with 131.3 cm height at sacrum and 189.6 cm chest circumference. Trela and Supera (1999) showed that Limousin cows calving at 31.2 months of age weighed 560 kg with 138 cm height at sacrum and 196 cm chest circumference. Litwińczuk et al. (2000), after Marshall et al. (1990), Morrison et al. (1992) and DeRouen et al. (1994), showed that the dif-ferences in the age at first conception of beef heifers in particular regions result from the use of different management systems, feed quality, and the possibility of adjusting different breeds to particular environmental conditions.

It is worth noting that the body weights of the analysed beef cows tended to even out. In the present study, the mean body weight after the first calving was 544.2 kg in Red Angus cows and 567.2 and 551.3 kg in Hereford cows. In earlier studies (Mar-lowe and Morrow, 1985; Field et al., 1988; Sacco et al., 1990), the body weight ranged from 411 to 510 kg in Angus cows aged 2 to 7 years and from 402 to 523 kg in Here- ford cows. Later studies by Gregory et al. (1992, 1995) showed an increase in the mean body weight, which ranged from 428 to 579 kg in Hereford cows aged 2 to 7 years and from 423 to 557 kg in Angus cows. Arango et al. (2004) reported the mean body weight of 466 and 523 kg in Angus cows aged 2 and 3 years, respectively, and of 476 and 545 kg in Hereford cows. Studies conducted over 1997-2002 showed that the body weights of intensively reared beef cows tended to even out (Pilarczyk, 2004). The mean body weights of cows found after the weaning of calves from the first and sixth calving were 534.5 and 685 kg in Red Angus, 554.4 and 692.5 kg in Hereford, 535.1 and 695.2 kg in Salers, 569.9 and 684.1 kg in Limousin, and 578.3 and 662.5 kg in Simmental cows, respectively. The evaluation of beef cows (PZHiPBM, 2006) in the Pomerania region showed that the mean body weights of cows tended to even out even more and the body weights of Hereford and Red Angus continued to increase. The mean body weight after first calving was 572 kg in Hereford, 565 kg each in Red Angus, Charolais, Limousin and Salers, and 580 kg in Simmental cows. This is reflected in the results for the whole of Poland from 2006 (PZHiPBM, 2007), without the classification into regions: Red Angus 570 kg, Charolais 570 kg, Hereford 543 kg, Limousin 552 kg and Simmental 522 kg. In the Pomerania region, these values were: Red Angus 570 kg, Charolais 501 kg, Hereford 570 kg, Limousin 567 kg and Simmental 511 kg.

The evaluation of EPD breeding value in the USA during 1970-1984 showed that the greatest progress in the body weight of calves at birth, weaning and 365 days of age was made for the Hereford and Angus breeds. The progress obtained in the other breeds was smaller. A decrease in body weight after birth was achieved in Simmental and Charolais cattle. This shows the different goals of selection in individual breeds. Improved growth rate and frame size were the most important goals in the Angus and Hereford breeds, while the selection of Simmental cattle was aimed to reduce the in-

J. Wójcik et al.20

cidence of difficult births (by decreasing the body weight of calves after birth) while maintaining positive trends for body weight at weaning and at 365 days (Notter and Cundiff, 1991). Sullivan et al. (1999) showed that the body weight of Hereford cat-tle increased during 1985-1995, and now this breed is characterized by greater body weight at 365 days of age compared to the Limousin breed, and it is predicted that by 2017 Angus cattle may achieve higher body weight at 365 days of age compared to both Charolais and Simmental cattle. Smaller progress during 1970-1984 was ob-tained for milk yield. Positive trends were only found for Hereford and Angus breeds, which shows that less attention was paid to improving milk yield in the other breeds.

McMorris and Wilton (1986) and Arango et al. (2002) showed that calf rearing efficiency is affected most by the milk yield and body weight of cows. Clutter and Nielsen (1987) and Minick et al. (2001) reported that the milk yield of cows deter-mines calf weight gains in 60%, and high-yielding cows rear calves that are heavier at weaning. In the present study, Simmental cows were characterized by the greatest milk yield. Likewise, Litwińczuk and Król (2002) reported the greatest milk yield in Simmental cows, followed by Limousin, and by far the lowest milk yield in Hereford cows. The milk of Simmental cows was characterized by the greatest solids and fat content. Hereford cows also achieved the lowest milk yield in a study by Stenzel et al. (2001), and greater milk yield was characteristic of Angus and Limousin cows. Earlier studies by Fiss and Wilton (1992) and Gregory et al. (1992) confirm that the highest milk yield is characteristic of Simmental cows, with markedly poorer results obtained by Hereford cows.

The higher milk yield of Simmental, Charolais and Salers cows compared to the other breeds resulted in better body weights of their calves up to 210 days of age. Similar findings are reported by other authors. Núñez-Dominguez et al. (1993) found the highest body weights at 200 days of age in Simmental and Salers calves, with poorer results obtained by Angus and Limousin calves. Later studies confirmed that in addition to Charolais and Blonde d’Aquitaine, the Simmental breed shows the high-est rate of growth (Jakubec et al., 2003; Přibyl et al., 2003; Krupa et al., 2005). In Czech studies (Jakubec et al., 2003) carried out with the 8 most popular breeds of beef cattle, the lowest body weight at 210 days of age and daily weight gains were obtained by Hereford calves and the highest by Charolais, Simmental and Blonde d’Aquitaine calves, with good results obtained by Angus calves. Přibyl et al. (2003) found the highest body weights at 120, 210 and 365 days of age in Charolais and Sim-mental calves. Likewise, in Slovakian studies (Krupa et al., 2005) Simmental calves achieved the highest daily weight gains, and Hereford and Limousin calves the low-est. Comparison of the rearing results of Simmental and Charolais calves showed that Simmental calves achieved significantly higher body weight at 210 days of age and significantly higher daily gains despite their significantly lower body weight at birth (Przysucha and Grodzki, 2004).

The results obtained show that modern breeds of beef cattle are characterized by similar body weight, frame size, and other traits evaluated using a scoring key. Here- ford and Angus cows, while showing similar body weight and frame size to Sim-mental, Charolais and Salers cows, receive much higher scores because according to the scoring key used in Poland they are still considered to be much lighter breeds


despite the changes that took place in the breeding and selection of beef cattle across the world. Because of the changes in frame size and body dimensions, especially in Hereford cattle, it seems necessary to modify the current scoring key. It was found that regardless of rearing intensity, the most common beef cattle breeds in the Western Pomerania area, evaluated according to the current scoring key, received the scores that seem biased in light of the results obtained. It is stressed that the current scoring key should be changed because it gives preference to the breeds that were previously considered to be of medium frame size but have now considerably increased their frame size and body weight due to intensive selection (Hereford, Red Angus). Be-cause of this, the scores of fastest growing breeds such as Simmental, Charolais and Salers are underestimated.

References

A r a n g o J.A., C u n d i f f L.V., V l e c k L.D. v a n (2002). Breed comparisons of Angus, Charolais, Here- ford, Jersey, Limousin, Simmental, and South Devon for weight, weight adjusted for body condition score, height, and body condition score of cows. J. Anim. Sci., 80: 3123–3132.

A r a n g o J.A., C u n d i f f L.V., V l e c k L.D. v a n (2004). Comparisons of Angus, Charolais, Galloway, Hereford, Longhorn, Nellore, Piedmontese, Salers, and Shorthorn breeds for weight, weight adjusted for body condition score, height, and condition score of cows. J. Anim. Sci., 82: 74-84.

C l u t t e r A.C., N i e l s e n M.K. (1987). Effect of level of beef cow milk production on pre- and post-weaning calf growth. J. Anim. Sci., 64: 1313–1322.

D e R o u e n S., F r a n k e D., M o r r i s o n D., W y a t t W., C o m m b s D., W h i t e T., H u n r e s P., G r e e n e B. (1994). Prepartum body condition and weight influences on reproductive performance of first-calf beef cows. J. Anim. Sci., 72: 1119–1125.

Dz. U. 47 (1999). Rozporządzenie Ministra Rolnictwa i Gospodarki Żywnościowej w sprawie zakresu i metod prowadzenia oceny wartości użytkowej i hodowlanej zwierząt oraz sposobu oznakowania i identyfikacji zwierząt do celów hodowlanych.

F i e l d T.G., B r i n k s J.S., T a y l o r R.E., T a t u m J.D. (1988). Estimation of genetic parameters for mature weight in Hereford females. Proc. West. Sect. Am. Soc. Anim. Sci., 39: 30–32.

F i s s C.F., W i l t o n J.W. (1992). Contribution of breed, cow weight, milk yield to the traits of heifers and cows in four beef breeding systems. J. Anim. Sci., 70: 3683–3696.

G r e g o r y K.E., C u n d i f f L.V., K o c h R.M. (1992). Breed effects and heterosis in advanced genera-tions of composite populations on actual weight, adjusted weight, hip height, and condition score of beef cows. J. Anim. Sci., 70: 1742 – 1754.

G r e g o r y K.E., C u n d i f f L.V., K o c h R.M. (1995). Genetic and phenotypic (co)variances for pro-duction traits of female populations of purebred and composite beef cattle. J. Anim. Sci., 73: 2235–2242.

J a k u b e c V., S c h l o t e W., Ř í h a J., M a j z l í k I. (2003). Comparison of growth traits of eight beef cattle breeds in the Czech Republic. Arch. Tierz., 46, 2: 143-153.

K r u p a E., O r a v c o v á M., P o l á k P., H u b a J., K r u p o v á Z. (2005). Factors affecting growth traits of beef cattle breeds raised in Slovakia. Czech J. Anim. Sci., 50: 14–21.

L i t w i ń c z u k Z., J a n k o w s k i P., S t a n e k P. (2000). Wzrost i rozwój pierwiastek bydła mięsnego w zależności od wieku przy pierwszym wycieleniu. Zesz. Nauk. AR Wrocław, 375: 151-156.

L i t w i ń c z u k Z., K r ó l J. (2002). The yield and composition of beef cows’ milk and the results of calf rearing. Anim. Sci. Pap. Rep., 20, Suppl., 1: 199–204.

M a r l o w e T.J., M o r r o w G.A. (1985). Heritabilities and phenotypic, genetic and environmental cor-relations for weight, grade and condition of Angus cows. J. Anim. Sci., 60: 82–88.

M a r s h a l l D., M i n g u i a n g W., F r e k i n g B. (1990). Relative calving date of first-calf heifers as related to production efficiency and subsequent reproductive performance. J. Anim. Sci., 68: 1812–1823.

J. Wójcik et al.22

M c M o r r i s M.R., W i l t o n J.W. (1986). Breeding system, cow weight and milk yield effects on various biological variables in beef production. J. Anim. Sci., 63: 1361– 372.

M i n i c k J.A., B u c h a n a n D.S., R u p e r t S.D. (2001). Milk production of crossbred daughters of high- and low-milk EPD Angus and Hereford bulls. J. Anim. Sci., 79: 1386–1393.

M o r r i s o n D., F e a z e l J., B a g l e y C., B l o u i n D. (1992). Postweaning growth and reproduction of beef heifers exposed to calve at 24 or 30 months of age in spring and fall seasons. J. Anim. Sci., 70: 622–630.

N o t t e r D.R., C u n d i f f L.V. (1991). Across-breed expected progeny differences: Use of within-breed expected progeny differences to adjust breed evaluations for sire sampling and genetic trend. J. Anim. Sci., 69: 4763–4776.

N ú ñ e z - D o m i n g u e z R., V l e c k L.D. v a n , Cundiff L.V. (1993). Breed comparisons for growth traits adjusted for within–breed genetic trend using expected progeny differences. J. Anim. Sci., 71: 1419–1428.

P i l a r c z y k R. (2004). Ocena przebiegu zmian i porównanie użytkowania rozpłodowego i niektórych cech macierzyńskich krów oraz wyników odchowu cieląt różnych ras bydła mięsnego utrzymywanych w systemie bezbudynkowym. Rozpr. dokt., AR Szczecin.

Polski Związek Hodowców i Producentów Bydła Mięsnego (2006). Ocena wartości użytkowej bydła ras mięsnych. Wyniki za rok 2005. Wyd. PZHiPBM Warszawa.

Polski Związek Hodowców i Producentów Bydła Mięsnego (2007). Ocena wartości użytkowej bydła ras mięsnych. Wyniki za rok 2006. Wyd. PZHiPBM Warszawa.

P ř i b y l J., M i s z t a l I., P ř i b y l o v á J., Š e b a K. (2003). Multiplebreed, multiple-traits evaluation of beef cattle in the Czech Republic. Czech J. Anim. Sci., 48: 519–532.

P r z y s u c h a T., G r o d z k i H. (2004). The influence of selected factors on growth rate of Charolais and Simmental calves. EJPAU, 7: 1.

S a c c o R.E., B a k e r J.F., C a r t w r i g h t T.C., L o n g C.R., S a n d e r s J.O. (1990). Measurements at calving for straightbred and crossbred cows of diverse types. J. Anim. Sci., 68: 3103–3108.

S t e n z e l R., C h a b u z W., J a n k o w s k i P., M r o c z e k A. (2001). Wstępne wyniki badań dotyczące rozrodu oraz odchowu cieląt w stadach mięsnych. Zesz. Nauk. Prz. Hod., 55: 221–227.

S u l l i v a n P.G., W i l t o n J.W., M i l l e r S.P., B a n k s L.R. (1999). Genetic trends and overlap de-rived from multiple-breed genetic evaluations of beef cattle for growth traits. J. Anim. Sci., 77: 2019–2027.

T r e l a J., S u p e r a K. (1999). Aklimatyzacja i niektóre wskaźniki produkcyjności bydła rasy Limousine importowanego z Francji do Polski. Zesz. Nauk. Prz. Hod., 44: 413–419.

Accepted for printing 11 VII 2007

JERZy WóJCIK, RENATA PILARCZyK, ADAM JASIńSKI, DAWID PIŁAT

PORÓWNANIE WZROSTU I ROZWOJU KRÓW RÓŻNYCH RAS BYDŁA MIĘSNEGONA TERENIE POMORzA zACHODNIEgO NA PODSTAWIE WYNIKÓW

SPARAMETRYzOWANYCH

STRESZCZENIE

W pracy porównano wzrost i rozwój różnych ras bydła mięsnego utrzymywanych w systemie półintensywnym oraz intensywnym na terenie Pomorza Zachodniego na podstawie cech sparametry-zowanych. Zaobserwowano tendencję do wyrównywania się masy ciała ras uważanych do tej pory za różnokalibrowe. Oceny masy ciała, kalibru, umięśnienia, łatwości porodów, mleczności oraz przyrostów dokonane według klucza bonitacyjnego wykazały w zakresie większości analizowanych cech istotną (P≤0,01) przewagę krów ras Hereford i Red Angus. Wynikająca z tego ocena sumaryczna wykazała również przewagę krów tych ras nad pozostałymi rasami. Stwierdzono, że bez względu na intensywność chowu rasy bydła mięsnego oceniane na podstawie obowiązującego klucza bonitacyjnego otrzymały oceny, które w świetle uzyskanych wyników wydają się nieobiektywne. Zasugerowano zmianę aktualnie

POLYMORPHISM OF SELECTED MICROSATELLITE DNA SEqUENCES IN POLISH MERINO SHEEP AND THE EVALUATION

OF THEIR SUITABILITY FOR PARENTAgE CONTROL

M a ł g o r z a t a N a t o n e k - W i ś n i e w s k a , T a d e u s z R y c h l i k

Department of Animal Immuno- and Cytogenetics,National Research Institute of Animal Production, 32-083 Balice n. Kraków, Poland

AbstractThe aim of the study was to characterize the genetic structure of Polish Merino sheep based on the polymorphism of microsatellite DNA sequences and to establish if these markers are suitable for parentage control. The study involved 62 sheep, randomly selected from a flock of the Pawłowice Experimental Station (Wielkopolskie province). A total of 63 alleles were identified. The effective number of alleles and the degree of heterozygosity, calculated based on the frequency of particular alleles, averaged 0.6486 and 0.6255, respectively. The combined probability of parentage exclusion, determined from 8 microsatellite loci analysed, was 99.62%. The possible introduction of microsatellite polymorphism for sheep parentage control in Poland in the future would have to be preceded by studies involving different sheep breeds. The aim of these studies should be to determine the ap-propriate set of highly polymorphic microsatellite markers, which would show incorrect parentage assignments with a high degree of probability.

Key words: sheep, microsatellite DNA sequences, parentage control

Individual identification and parentage control of farm animals, which have long been carried out based on genetically determined erythrocyte antigens and serum pro-teins, have recently been extended to include the analysis of animal markers with polymorphic DNA sequences. The possibility of using DNA polymorphism in parentage control was studied especially in horses (Gralak et al., 1998; Marklund et al., 1994) and cattle (Heyen and Brem, 1997; Lubieniecka et al., 2001; Peelman et al., 1998), and to a lesser extent in sheep (Achmann et al., 1998). Sheep parentage control in Poland is routinely performed based on the analysis of erythrocyte antigen polymorphism in 6 blood group systems and the polymorphism of serum protein (transferrin) and erythrocytes (haemoglobin). Current research is focused on the possibility of using the polymorphism of microsatellite DNA sequences for parentage control, which is expected to increase the detection of animals with incorrect parentage assignment. Previous studies involved Berrichonne du cher (Rychlik et al., 2003), Wrzosówka


M. Natonek-Wiśniewska and T. Rychlik24

(Radko et al., 2006; Rychlik et al., 2006) and Coloured Merino sheep (Rychlik et al., 2007).

The aim of the present research is to characterize the polymorphism of microsatel-lite DNA sequences and to establish if these markers are suitable for parentage control in Polish Merino sheep, which are the most populous breed in Poland of the wool and meat type (approx. 40% of the national population).


Microsatellite polymorphism studies involved 62 sheep (7 flock rams, 25 ewes and 30 offspring) from a flock of Polish Merino sheep belonging to the Pawłowice Experimental Station (Wielkopolskie province).

The isolation of genomic DNA using proteinase K was followed by the amplifica-tion of sequences from selected loci by means of PCR using fluorescently labelled starters.

The International Society for Animal Genetics have recommended the loci ana-lysed (HSC, INRA63, OARFCB11, MAF214, OARAE129, CRSD247, OARCP49, OARFCB304) in comparison tests. The sequences of the starters used were taken from http://www.thearkdb.org. The markers were amplified in one reaction mixture whose composition, determined by the present authors, was as follows: 10 × PCR buffer – 1 µl; dNTP’s (10 mM) – 0.4 µl; MgCl2 (25mM) – 1.2 µl; DMSO – 0.5 µl; Polymerase TaqGold – 0.4 µl; starter (F+R)OARCP0049 – 0.1 µl, starter (F+R)OARFCB0011 – 0.3 µl, starter (F+R)OARAE129 – 0.4 µl, starter (F+R)MAF214 – 1 µl, starter (F+R)HSC – 0.6 µl, starter (F+R)CSRD247 – 0.8 µl, starter (F+R)INRA0063 – 0.4 µl, starter (F+R)OARFCB0304 – 0.3 µl, where the concentration of each starter is 10 pM/µl. The thermal programme included preliminary denaturation at 95°C × 12’, followed by 31 cycles (95°C × 20’’ – 63°C × 1’ – 72°C × 1’) and final elongation at 72°C × 5’.

The PCR products obtained were separated on a 4% polyacrylamide gel using an ABI PRISM 377 sequencer. The results of electrophoretic separation were analysed using Gene Scan 2.1 software and the alleles identified were sized using Genotyper 2.0 software.

The data obtained were used to calculate the number of alleles identified at particu-lar loci, the degree of heterozygosity (H), the polymorphic information content (PIC) and the probability of exclusion (PE) for every locus. Statistical analysis also included the mean heterozygosity (Hc), the mean polymorphic information content (PICc) and the combined probability of exclusion (PEc).

Results

A total of 63 alleles occurred in the analysed population, with most alleles found for markers INRA63 (12 alleles) and MAF214 (11 alleles). For the other markers, the number of alleles identified ranged from 2 for OARFCB11 to 10 for HSC. The

Polymorphism of microsatellite DNA sequences in Polish Merino sheep 25

frequency of alleles identified at particular loci was rather variable and ranged from 0.0175 to 0.2983 for HSC, from 0.0142 to 0.3857 for INRA63, from 0.0143 to 0.9857 for OARFCB11, from 0.6178 to 0.0294 for OARFCB304, from 0.0142 to 0.3571 for OARCP49, from 0.3335 to 0.0166 for CRSD247, from 0.0144 to 0.4 for OARAE129, and from 0.0142 to 0.3858 for MAF214. H and PIC values were calculated based on the frequency of the alleles identified in the analysed loci.

The highest degree of heterozygosity (0.8383) was established for locus HSC, and was slightly lower (0.7024–0.7817) for the loci INRA63, OARFCM49, CSRD247, OARAE129 and MAF214. For the locus OARFCB304, H value was 0.5665. The low degree of heterozygosity (0.0218) was only characteristic of the locus OARFCB11, in which only 2 alleles were identified. The polymorphic information content for in-dividual loci followed a similar pattern (Table 1). The highest PIC value (above 0.8) was identified for locus HSC. PIC value was above 0.7 for the loci INRA63, OAR-FCM49, CSRD247 and MAF214, and slightly lower for OARAE129 (0.6535) and OARFCB304 (0.5258). The lowest PIC value (0.0278) was characteristic of the locus OARFCB11.

Table 1. The allele polymorphism of microsatellite loci in Polish Merino sheep

Loci Range (bp) No.of alleles H PIC PE

HSC 267–301 10 0.8383 0.8211 0.6868INRA63 169–207 12 0.7817 0.7585 0.6038OARFCB11 122–148 2 0.0218 0.0278 0.0103OARFCB304 148–190 5 0.5665 0.5258 0.3426OARFCM49 82–140 9 0.7444 0.706 0.5267CSRD247 209–261 7 0.7954 0.7695 0.6118OARAE129 135–165 7 0.7024 0.6535 0.4631MAF214 181–265 11 0.7386 0.7022 0.5289

Discussion

Microsatellite DNA markers – due to their high frequency in the genome (with over 1800 microsatellite sequences identified so far in sheep), the high degree of poly-morphism and the relatively simple and rapid identification using PCR and analysis of the amplification product in a DNA sequencer – have become the most numerous class of genetic markers that have found wide application in analysis of genetic varia-tion in different breeds of sheep (Arranz et al., 1998; Zamorano et al., 1998; Tomasco et al., 2002; Cerit et al., 2004).

In the present study, the polymorphism of microsatellite DNA markers was evalu-ated at 8 selected loci. Most of these showed a high degree of heterozygosity, as evi-denced by the coefficient of heterozygosity and the polymorphic information content obtained. Only the OARFCB11 locus was characterized by low polymorphism. The

M. Natonek-Wiśniewska and T. Rychlik26

mean degree of heterozygosity for all the loci analysed was 0.6486 and the mean degree of polymorphism was 0.6255. For comparison, the mean heterozygosity was 0.7007 for Coloured Merino (Rychlik et al., 2007), 0.7110 for Wrzosówka (Radko et al., 2006), and 0.7551 for Berrichonne du cher sheep (Rychlik et al., 2003).

The polymorphic information content for the Polish Merino breed was slightly lower than the PICc calculated for Berrichonne du cher (0.72) (Rychlik et al., 2003) and higher than the PIC calculated for Wrzosówka sheep (0.699) (Radko et al., 2006).

The suitability of particular genetic markers for parentage verification is measured by the probability of parentage exclusion (PE). The probability of exclusion estimated for each of the 8 loci analysed is given in Table 1. The highest values were obtained for HSC (0.6868) and CSRD247 (0.6118), the loci characterized by the highest poly-morphism. The lowest value (0.0103) was established for the locus OARFCB11. The PE determined based on the 8 microsatellite loci analysed was 0.9962, which means that incorrect parentage can be determined with 99.62% accuracy. In earlier studies, the PE value was 0.998 for Berrichonne du cher (Rychlik et al., 2003) and 0.9998 for Wrzosówka sheep (Radko et al., 2006).

The high polymorphism of selected microsatellite DNA sequences, established in the present study, and the probability of incorrect parentage assignment, calcu-lated based on these markers, show that they are highly suitable for sheep parentage control. A limited suitability for parentage control was only shown for the locus OARFCB11, in which only two alleles were found. The possible introduction of mi-crosatellite polymorphism for sheep parentage control in Poland in the future would have to be preceded by more extensive studies involving different sheep breeds, with the aim of determining an appropriate set of highly polymorphic loci that would show incorrect parentage assignments with a high degree of probability.

References

A c h m a n n R., B r e m G. (1998). Parentage control in Austrian domestic mountain sheep (Ovis aries) using DNA microsatellite analysis. Anim. Genet., 29: 12–13.

A r r a n z J., B a y o n Y., S a n P r i m i t i v o F. (1998). Genetic relationships among Spanish sheep using microsatellites. Anim. Genet., 29: 435–440.

C e r i t H., A l t i n e l A., E l m a z O., A v a n u s K. (2004). Polymorphism evaluation of various genomic loci in the Kivircik sheep breed of Turkey. Turk. J. Vet. Anim. Sci., 28: 415–425.

G r a l a k B., K u r y ł J., Ł u k a s z e w i c z M., Ż u r k o w s k i M. (1998). Applicability of nine microsatel-lite DNA sequences eleven polymorphic blood protein and enzyme systems for the parentage control in Polish Arabian and Thoroughbred horse. Anim. Sci. Pap. Rep., 16: 209–218.

H e y e n D.W., B e e v e r J.E., Da Y., E v e r t R.E., G r e e n C., B a t e s S.R.E., Z i e g l e J.S., L e w i n H.A. (1997). Exclusion probabilities of 22 bovine microsatellite markers in fluorescent mul-tiplexes for semiautomated parentage testing. Anim. Genet., 28: 21-27.

L u b i e n i e c k a J., G r z y b o w s k i G., L u b i e n i e c k i K. (2001). Multipleksowe układy reakcji PCR stosowane do badań polimorfizmu mikrosatelitów u bydła. XIV Zjazd Polskiego Towarzystwa Gene-tycznego. Poznań 11–13.06.2001, s. 250.

M a r k l u n d S., E l l e g r e n H., E r i k s s o n S., S a n d b e r g K., A n d e r s s o n L. (1994). Parentage testing and linkage analysis in the horse using a set of highly polymorphic microsatellites. Anim. Genet., 25: 19–23.

P e e l m a n L.J., M o r t i a u x F., Z e v e r e n A. v a n , D a n s e r c o e r A., M o m m e n s G., C o o p m a n F., B o u q u e t Y., B u r n y A., R e n a v i l l e R., P o r t e t e l l e D. (1998). Evaluation of

Polymorphism of microsatellite DNA sequences in Polish Merino sheep 27

the genetic variability of 23 bovine microsatellite markers in four Belgian cattle breeds. Anim. Genet., 29: 161–167.

R a d k o A., R y c h l i k T., S ł o t a E. (2006). Genetyczna charakterystyka owcy rasy wrzosówka na pod-stawie 14 markerów mikrosatelitarnych DNA. Med. Wet., 62 (9): 1073–1075.

R y c h l i k T., R a d k o A., D u n i e c M. (2003). Ocena przydatności polimorfizmu niektórych markerów genetycznych w kontroli rodowodów owiec. Med. Wet., 59 (11): 1016–1018.

R y c h l i k T., D u n i e c M., K o ś c i e l n y M. (2006). Ocena zmian w strukturze genetycznej owiec rasy Wrzosówka w oparciu o badania grup krwi oraz polimorficznych wariantów białek. Rocz. Nauk. Zoot., 33, 1: 31–40.

R y c h l i k T., N a t o n e k - W i ś n i e w s k a M., P a k u l s k i T. (2007). Characteristics of the genetic struc-ture of a Coloured Merino genetic reserve flock based on the polymorphism of class I and II genetic markers. Ann. Anim. Sci., Suppl., 1: 59–62.

T o m a s c o I., W l a s i u k G., L e s s a E.P. (2002). Evaluation of polymorphism in ten microsatellite loci in Uruguayan sheep. Genet. Mol. Biol., 25: 37–41.

Z a m o r a n o M.J., R u i t e r J., T o w n s e n d S., C r u i c k s h a n k R., B r u f o r d M., B y r n e K., R o d e -r o A., Ve g a - P l a t y J.L. (1998). Polimorfismos de DNA en Las Razas Ovinas Merino y Churra Lebrijana. Arch. Zoot., 47: 267–272.

Accepted for printing 16 VIII 2007

MAŁGORZATA NATONEK-WIśNIEWSKA, TADEUSZ RyCHLIK

POLIMORFIzM WYBRANYCH SEKWENCJI MIKROSATELITARNYCH DNA U OWIEC RASY MERYNOS POLSKI ORAZ OCENA ICH PRZYDATNOŚCI

W KONTROLI RODOWODÓW

STRESZCZENIE

Celem badań było scharakteryzowanie struktury genetycznej Merynosa Polskiego na podstawie poli-morfizmu sekwencji mikrosatelitarnych DNA oraz sprawdzenie przydatności tych markerów do kontroli rodowodów. Badaniami objęto 62 losowo wybrane owce pochodzące ze stada Zootechnicznego Zakładu Doświadczalnego Pawłowice (woj. wielkopolskie).

Ogółem zidentyfikowano 63 allele. Na podstawie częstości występowania poszczególnych alleli obliczono efektywną liczbę alleli oraz stopień heterozygotyczności. średnie wartości tych wskaźników wynoszą odpowiednio: 0.6486 i 0.6255. Całkowite prawdopodobieństwo wykluczenia ojcostwa wyzna- czone w oparciu o 8 analizowanych loci mikrosatelitarnych wynosiło 99,62%. Ewentualne wprowadze-nie w przyszłości w Polsce polimorfizmu mikrosatelitarnego do kontroli pochodzenia owiec należałoby poprzedzić badaniami na różnych rasach owiec. Badania te powinny mieć na celu wyznaczenie odpo- wiedniego zestawu wysoko polimorficznych markerów mikrosatelitarnych, które gwarantowałyby wysokie prawdopodobieństwo wskazania błędów w rodowodach.


OPTIMIzATION OF PCR-RFLP TECHNIqUE FOR ANALYSIS OF SOME GENES IN THE RACCOON DOG (Nyctereutes procyoNoides

GRAY 1834)**

B r y g i d a ś l a s k a , G r a ż y n a J e ż e w s k a

Department of Biological Bases of Animal Production, Agricultural University, Akademicka 13, 20-049 Lublin, Poland

AbstractBecause of the occurrence in various farm animal species of the esr1, GHr, GH1 and iGF1 gene polymorphism that affects productive traits, and the lack of data on the tools that could be used to identify the restriction polymorphism of these genes in the raccoon dog, it is important to explore the possibility of using restriction enzymes for the genes coding proteins that are known to take part in physiological processes. The objective of the study was to optimize the conditions of the PCR-RFLP reaction for analysis of the GH1, GHr, iGF1 and esr1 genes in the raccoon dog population. After isolation of DNA, PCR-RFLP was performed on the following four fragments of the raccoon dog genes: esr1 (estrogen receptor 1), GHr (Growth Hormone receptor), GH1 (Growth Hormone 1), and iGF1 (insulin-like Growth Factor 1), using selected restriction enzymes. The course of PCR-RFLP was optimized. The enzymes that can be used for restriction analysis of raccoon dog genes are BsuRI, BseGI and TaqI for the esr1 gene fragment; HinfI and AluI for GHr; HpaII, Hin6I, BsuRI, HinfI, TaqI and Bsp143II for GH1 (with more than one restriction site in the case of HpaII and HinfI); and HpaII, Hin6I and BseGI for iGF1. The present results of restriction analysis show the possibility of using selected restriction enzymes in genetic analyses of the raccoon dog. Because this type of study has never been conducted on raccoon dogs, the present findings could provide a basis for identifying gene restriction polymorphism, which can significantly affect the economi-cally important traits in raccoon dogs.

Key words: Nyctereutes procyonoides, restrictive enzymes, PCR-RFLP, genes

Raccoon dogs (Nyctereutes procyonoides) are one of the Canidae species raised on fur farms. The first important attempts at raccoon dog breeding were made in Finland in the 1970s. In Poland, raccoon dogs have been bred for almost 30 years. Because of the relatively short period of raccoon dog breeding, the available literature is limited in data on the raccoon dog genome, and contains no information on the tools that could be used to identify restriction polymorphism of raccoon dog genes using restric-tion enzymes. Therefore it is important to identify the possibility of using restriction

*This study was supported by the Ministry of Scientific Research and Information Technology during 2004–2006 as research project no. 2 P06D 006 26.

B. Ślaska and G. Jeżewska30

enzymes for the genes coding proteins that are known to take part in physiological processes, such as ESR1 (Estrogen Receptor 1), GHR (Growth Hormone Receptor), GH1 (Growth Hormone 1), and IGF1 (Insulin-like Growth Factor 1) (Dybus, 2002; Greco et al., 1993; Shoba et al., 2001; Zwierzchowski et al., 1995; Zwierzchowski et al., 2001; Zych et al., 2005). Zych et al. (2005) report that many of the candidate genes that potentially determine milk and meat traits in cows have been identified, with many of these coding functional proteins that belong to a very complex hormonal system known as the somatotropic axis (GH/GHR/IGF1).

In addition, it is important to explore the relationship between gene restriction polymorphism and productive and functional traits of the raccoon dog, because once identified, these relationships can be used in breeding work and thus contribute to tan-gible financial benefits on raccoon dog farms. The identification of alleles responsible for conformation traits and functional traits can be carried out using the GH1, GHR, IGF1 and ESR1 gene polymorphism, as is the case for other farm animal species.

The aim of the study was to optimize the PCR-RFLP reaction conditions to ana-lyse the GH1, GHR, IGF1 and ESR1 genes in the raccoon dog population.


From a three-generational population of 208 raccoon dogs born on a nucleus farm in south-eastern Poland, a total of 17 animals (all animals of the foundation stock representing the F0 generation) were analysed. Blood was taken from each live ani-mal into sterile tubes (Medlab) containing K2EDTA anticoagulant. DNA was isolated from whole peripheral blood using the QIAamp DNA Blood Mini Kit (QIAGEN). PCR-RFLP (Restriction Fragment Length Polymorphism) reaction was carried out for the following four gene fragments of the raccoon dog: ESR1 (Estrogen Receptor 1), GHR (Growth Hormone Receptor), GH1 (Growth Hormone 1), and IGF1 (Insulin-like Growth Factor 1) using Fermentas restriction enzymes (Table 1). A total of 544 analyses were performed for the gene fragments studied (Table 1).

Table 1. Number of analyses* performed in the raccoon dog population studied

Restriction enzymeGene

TotalESR1 GHR GH1 IGF1n* n n n

HpaII (MspI) 17 17 17 17 68Hin6I (HhaI) 17 17 17 17 68BsuRI (HaeIII) 17 17 17 17 68HinfI 17 17 17 17 68BseGI (FokI) 17 17 17 17 68TaqI 17 17 17 17 68SmaI 17 17 17 17 68Bsp143II (HaeII) 17 17 34Eco88I (AvaI) 17 17AluI 17 17

Total 136 153 136 119 544

Optimization of PCR-RFLP technique for analysis of raccoon dog genes 31

The starters used (Table 2) and the PCR (Polymerase Chain Reaction) reaction conditions were described in the literature for the domestic dog (Canis familiaris) genome using a modified version of the method reported by ślaska et al. (2005).

Table 2. Starter sequences of the analysed loci

Locus Forward Primer Reverse PrimerESR1 GGGTGGGCGGGGTCCTCTGGAGATG GGCTGAACCAGCTCCCTGTCAGCA GHR AGATCTCCTCAAGGAAGGAAAATTA AAGGATGTTAAGTGATTTCTCATGGGH1 GCAGTTTCTCAGCAGGGTCT GATGCCCAGCAACTAGAAGGIGF1 AGCCCACAGGGTACGGCTC CTTCTGAGCCTTGGGCATGTC

The initial PCR-RFLP reaction was carried out by incubating a mixture of 10 µL of PCR product, 1 µL of buffer and 1 µL of restriction enzyme (each at a concentra-tion of 10 units/µL). The results were visualized in 2.5% agarose gel (using a loading buffer containing bromophenol blue). Gels were analysed under UV light (Transilu-minator) and archived. GeneRuler 50bp DNA Ladder (Fermentas) was used as the DNA fragment size marker. For restrictase Bsp143II (HaeII), restriction analysis was performed on two of the four genes (GHR and GH1), restrictase Eco88I (AvaI) was used to cut a ESR1 gene fragment, while the suitability of AluI was verified only for the GHR gene. In the case of the three restriction enzymes mentioned above, reaction conditions were only determined for those gene fragments, which in other animal spe-cies were analysed for the effect of concrete restriction polymorphism on productive traits.

Results

In the available literature there are no data on the tools that could be used to identify the restriction polymorphism of the raccoon dog using restrictases. Therefore, PCR-RFLP conditions for restrictases presented in Table 1 were optimized for analysis of the GH1, GHR, IGF1 and ESR1 genes in the raccoon dog population. PCR-RFLP was performed by incubating a mixture of 10 µL of PCR product, 1 µL of buffer, and 1 µL of restriction enzyme (each at a concentration of 10 units/µL) at a temperature depending on the restriction enzyme used. According to the restriction enzyme used, incubation temperature for all of the four fragments of the raccoon dog genes was 30°C (SmaI), 37°C (AluI, MspI, HinfI, Eco88I, BsuRI, Hin6I and Bsp143II), 55°C (BseGI) and 65°C (TaqI) (values given by the manufacturer). After many attempts, incubation time was set at 4 h for all of the restrictases for the GH1 gene and 3 h for the other gene fragments.

Table 3 and Figures 1 and 2 show the results of gene restriction analysis performed in the raccoon dogs. A fragment of the ESR1 gene (Estrogen Receptor 1) was cut by the restriction enzymes BsuRI, BseGI and TaqI. The digestion products of the GHR (Growth Hormone Receptor) gene were obtained only when two restrictases (HinfI and AluI) were used for cutting.


Table 3. Lengths of DNA segments obtained after PCR-RFLP reaction for the gene fragments analysed in the raccoon dog genome

Restriction enzymeLength of DNA fragments (bp)*

ESR1250

GHR200

GH1800

IGF1190

HpaII (MspI) 250 200 450200150

12070

Hin6I (HhaI) 250 200 700100

16030

(HaeIII) 20050

200 400 200

HinfI 250 12080

300250150100

200

BseGI (FokI) 18070

200 200 13060

TaqI 20050

200 500300

200

SmaI 250 200 200 200Bsp143II (HaeII) NA 200 500

300NA

Eco88I (AvaI) 250 NA NA NAAluI NA 120

80NA NA

* approximate values.NA – not analysed.

The GH1 (Growth Hormone 1) gene was susceptible to cutting by as many as six out of the eight restriction enzymes (HpaII, Hin6I, BsuRI, HinfI, TaqI and Bsp143II) used in the study, although there was more than one restriction site for HpaII and HinfI (Table 3). IGF1 (Insulin-like Growth Factor 1) digestion products were obtained when HpaII, Hin6I and BseGI were used for digestion during cutting. As regards the other restrictases, no sequences complementary to the sequences identified by the enzymes used occurred in the gene fragments studied.


Figure 1. Electrophoregram of the PCR-RFLP reaction for IGF1 gene fragment in the raccoon dog genome using restriction enzymes MspI (3–7) and Hin6I (10–14) (1 and 8 – size marker,

2 and 9 – undigested fragment of the IGF1 gene)

Figure 2. Electrophoregram of the PCR-RFLP reaction for ESR1 gene fragment in the raccoon doggenome using restriction enzyme HaeIII (2–7 and 9–14) (8 – size marker,

1 and 15 – undigested fragment of the ESR1 gene)

Discussion

PCR-RFLP markers are one of the most commonly used markers of DNA genetic variation. They enable polymorphism to be accurately detected, especially in coding DNA regions. PCR-RFLP markers identify the differences in DNA structure result-


ing from point mutations at restrictive sites of the genome. An indisputable advan-tage of these markers is their codominant nature, or the possibility of detecting both dominant and recessive forms of alleles at one locus. The PCR-RFLP technique is also characterized by the low cost of analysis. Thanks to these advantages, the mark-ers find wide application in the population studies. Above all, they are used to identify genetic variation at the intra- and between-population level in many animal species. The identification of appropriate traits at molecular level is of enormous importance in selection and breeding.

The present experiment was important in that it determined the conditions of the PCR-RFLP reaction for analysis of the GH1, GHR, IGF1 and ESR1 genes in the popu-lation of the raccoon dog, which belongs to the Canidae family. Because the available literature contains no studies on PCR-RFLP in raccoon dogs, the results obtained can be used for finding the polymorphism of the genes investigated in the study, and for finding how it is related to the economically important productive traits of raccoon dogs.

According to Fredholm and Wintero (1995), the analyses of genetic markers showed a very high level of conservation for the sequences in the Canidae family. This demonstrates that it is possible to use a well-characterized genome of a single species (e.g. a fox) to study the dog genome. In the genetic analyses of Canidae fur animals (common fox, arctic fox, raccoon dog), the results of studies with the domes-tic dog (Canis familiaris) have been used with great success. However, because no research has been conducted in the dog to find point mutations affecting body weight or hair coat structure, canine studies cannot be used when searching for the genetic polymorphism of economically important productive traits in fur animals. Because this type of research was not conducted in the common fox and arctic fox populations, the available literature contains no data on the PCR-RFLP reaction that could facili-tate the search for gene polymorphism in the raccoon dog. The present study forms a methodical basis for developing raccoon dog genome studies.

Studies on the genes mentioned in the present paper have been carried out in vari-ous farm animal species of considerable economic importance, but they have never been developed as regards methodology in raccoon dogs. In the other species of ani-mals, the genes analysed in the present study (ESR1, GHR, GH1, IGF1) are con-sidered as candidate genes responsible for economically important productive traits, such as the rate of growth, milk and meat traits, carcass composition, rate of sexual maturation, and the gamete-formation process in different species of farm animals (Burton et al., 1994; Dybus, 2002; Greco et al., 1993; Parmentier et al., 1999; Shoba et al., 2001; Zwierzchowski et al., 1995; Zwierzchowski et al., 2001; Zych et al., 2005). The somatotropin gene polymorphism was reported as early as 1971 by Seavey et al. The effect of this polymorphism on milk and meat traits of the cows was also investigated by Dybus (2002), Grochowska et al. (2001 a, 2001 b), and Schlee et al. (1994). Dybus (2002) used a method developed by Schlee et al. (1994) to determine the rela-tionship between the polymorphism of the bovine growth hormone gene (GH-AluI) and the milk traits of Black-and-White cattle. Grochowska et al. (2001 a) showed the polymorphism of the bovine growth hormone gene (GH) that was related to carcass traits in bulls. Grochowska et al. (2001 b), who analysed the level of GH and IGF-I,


concluded that these traits are heritable in young dairy cattle and are dependent on the GH gene polymorphism. In our study, the AluI enzyme did not cut the GH1 gene frag-ment in the raccoon dog. Likewise, some relationships were found in pigs between productive traits and animal genotypes at the GH locus, such as carcass fatness (Knorr et al., 1997). Meanwhile, Knorr et al. (1997) showed that productive traits and GH genotype are not related in the wild boar and Pietrain pig crossbreds.

Maj et al. (2006) reported that GHR-AluI polymorphism affects the productive traits of Black-and-White cattle. In our study, the AluI enzyme in the growth hormone receptor gene of raccoon dogs also identified one restriction site and cut the gene frag-ment into two segments.

ESR is one of the genes that control reproduction in pigs. First studies by Roth-schild et al. (1996) revealed a relationship between the estrogen receptor gene and litter size. Zych et al. (2005) reports that the genes controlling polygenic traits, such as milk or meat production, are relatively difficult to identify.

The optimization of the PCR-RFLP reaction makes it possible to study the coding parts of the raccoon dog genome. The present results of restriction analysis suggest the possibility of using selected restriction enzymes for genetic analyses of this animal species. This type of study has never been conducted for raccoon dogs, so the present findings could provide a basis for identifying the polymorphism of the genes that can significantly affect the economically important traits in raccoon dogs.

References

B u r t o n J.L., M c b r i d e B.W., B l o c k E., G l i m m D.R. K e n n e l l y J.J. (1994). A review of bovine growth hormone. Can. J. Anim. Sci., 74: 167–201.

D y b u s A. (2002). Associations between Leu/Val polymorphism of growth hormone gene and milk pro-duction traits in Black and White cattle. Archiv. Anim. Breed., 45 (5): 421–428.

F r e d h o l m M., W i n t e r o A.K. (1995). Variation of short tandem repeats within and between species belonging to the Canidae family. Mamm. Gen., 6: 11–18.

G r e c o T.L., D u e l l o T.M., G o r s k i J. (1993). Estrogen receptors, estradiol, and diethylstilbestrol in early development: the mouse as a model for the study of estrogen receptors and estrogen sensitivity in embryonic development of male and female reproductive tracts. Endocr. Rev., 14 (1): 59–71.

G r o c h o w s k a R., K u n d e n A., Z w i e r z c h o w s k i L., O p r z a d e k J. (2001 a). Association be-tween gene polymorphism of growth hormone and carcass traits in dairy bulls. Anim. Sci., 72 (3): 441–447.

G r o c h o w s k a R., S o r e n s e n P., Z w i e r z c h o w s k i L., S n o c h o w s k i M., L o v e n d a h l P. (2001 b). Genetic variation in stimulated GH release and in IGF-I of young dairy cattle and their as-sociations with the leucine/valine polymorphism in the GH gene. J. Anim. Sci., 79: 470–476.

K n o r r C., M o s e r G., M ü l l e r E., G e l d e r m a n n H. (1997). Associations of GH gene variants with performance traits in F2 generations of European wild boar, Piétrain and Meishan pigs. Anim. Genet., 28: 124–128.

M a j A., O p r z ą d e k J., D y m n i c k i E., Z w i e r z c h o w s k i L. (2006). Association of the polymor-phism in the 5’-noncoding region of the bovine growth hormone receptor gene with meat production traits in Polish Black-and-White cattle. Meat Sci., 72: 539–544.

P a r m e n t i e r I., P o r t e t e l l e D., G e n g l e r N., P r a n d i A., B e r t o z z i C., V l e u r i c k L., G i l s o n R., R e n a v i l l e R. (1999). Candidate gene markers associated with somatotropic axis and milk selection. Domest. Anim. Endocrinol., 17: 139–148.

R o t h s c h i l d M., J a c o b s o n C., Va s k e D., T u g g l e C., Wa n g L., S h o r t T., E c k a r d t G., S a -s a k i S., V i n c e n t A., M c L a r e n D., S o u t h w o o d O., v a n d e r S t e e n H., M i l e h a m A.,


P l a s t o w G. (1996). The estrogen receptor locus is associated with a major gene influencing litter size in pigs. Proc. Natl. Acad. Sci. USA, 93, p. 201.

S c h l e e P., G r a m l R., R o t t m a n n O., P i r c h n e r F. (1994). Influence of growth-hormone genotypes on breeding values of Simmental bulls. J. Anim. Breed. Genet., 111: 253–256.

S e a v e y B.K., S i n g h R.N.P., L e w i s U.J., G e s h w i n d I.I. (1971). Bovine growth hormone: evidence for two allelic forms. Biochem. Biophys. Res. Commun., 43: 189–195.

S h o b a L.N., N e w m a n M., L i u W., L o w e W.L. Jr. (2001). LY 294002, an Inhibitor of Phosphatidylino-sitol 3-Kinase, Inhibits GH-Mediated Expression of the IGF-I Gene in Rat Hepatocytes. Endocrinology, 142 (9): 3980–3986.

ś l a s k a B., J e ż e w s k a G., Z i ę b a G. (2005). Preliminary results of application of chosen DNA sequence primers of Canis familiaris in amplification of Nyctereutes procyonoides genom parallelis loci. Rocz. Nauk. Pol. Tow. Zoot., 1, 2: 253–260.

Z w i e r z c h o w s k i L., Ż e l a z o w s k a B., G r o c h o w s k a R. (1995). Genotyping of α-casein and growth hormone alleles in Polish Black-and-White and Piemontese cattle using PCR-RFLP technique. Anim. Sci. Pap. Rep., 13: 13–20.

Z w i e r z c h o w s k i L., O p r z ą d e k J., D y m n i c k i E., D z i e r z b i c k i P. (2001). An association of growth hormone, α-casein, β-lactoglobulin, leptin and Pit-1 loci polymorphism with growth rate and carcass traits in beef cattle. Anim. Sci. Pap. Rep., 19: 65–77.

Z y c h S., S z a t k o w s k a I., D y b u s A. (2005). Oś somatotropowa (GH/GHR/IGF-1) i jej rola w kontroli procesu laktacji u bydła. Med. Wet., 61 (8): 857–860.

Accepted for printing 4 X 2007

BRyGIDA śLASKA, GRAŻyNA JEŻEWSKA

Optymalizacja techniki PCR-RFLP do analizy wybranych genów u jenota(Nyctereutes procyonoides Gray 1834)

STRESZCZENIE

Ze względu na występowanie u różnych gatunków zwierząt gospodarskich polimorfizmu genów: ESR1, GHR, GH1, IGF1, wpływającego na cechy użytkowe, oraz brak danych dotyczących narzędzi pracy do poznawania polimorfizmu restrykcyjnego tych genów u jenota, ważną rzeczą jest poznanie możliwości użycia enzymów restrykcyjnych w przypadku genów kodujących białka o stwierdzonym udziale w procesach fizjologicznych. Celem pracy była optymalizacja warunków przebiegu reakcji PCR-RFLP do analizy genów: GH1, GHR, IGF1 i ESR1 w populacji jenota. Po wyizolowaniu DNA reakcję PCR-RFLP przeprowadzono dla następujących czterech fragmentów genów jenota: ESR1 (Estrogen Re-ceptor 1), GHR (Growth Hormone Receptor), GH1 (Growth Hormone 1), IGF1 (Insulin-like Growth Fac-tor 1) z wykorzystaniem wybranych enzymów restrykcyjnych. Przeprowadzono optymalizację warunków przebiegu reakcji PCR-RFLP. Do analizy restrykcyjnej genów jenota mogą być wykorzystane następujące enzymy: BsuRI, BseGI i TaqI w przypadku fragmentu genu ESR1; HinfI i AluI dla GHR; HpaII, Hin6I, BsuRI, HinfI, TaqI i Bsp143II dla GH1 (w przypadku HpaII oraz HinfI występowało więcej niż jedno miejsce restrykcyjne); HpaII, Hin6I i BseGI w przypadku IGF1. Przedstawione w pracy wyniki analizy restrykcyjnej wskazują na możliwość wykorzystania wybranych enzymów restrykcyjnych w analizach ge-netycznych jenotów. Badania tego rodzaju nie były prowadzone w odniesieniu do omawianego gatunku, więc przedstawione wyniki mogą stanowić podstawę poznawania polimorfizmu restrykcyjnego genów, który może w sposób znaczący wpływać na ważne z ekonomicznego punktu widzenia cechy jenotów.

LAPAROSCOPIC TRANSFER OF GOAT 6-, 8-CELL EMBRYOSPRODUCED iN Vitro

L u c y n a K ą t s k a - K s i ą ż k i e w i c z , J o l a n t a O p i e l a , B o ż e n n a R y ń s k a , J a r o s ł a w W i e c z o r e k , M i r o s ł a w C e g ł a , Z d z i s ł a w S m o r ą g

Department of Biotechnology of Animal Reproduction,National Research Institute of Animal Production, 32-083 Balice n. Kraków, Poland

AbstractThe aim of the study was to establish the conditions for in vitro production of goat embryos by in vitro maturation and fertilization of follicular oocytes recovered from the ovaries using laparoscopic ovum pick-up (LOPU) as well as to determine developmental potential of embryos in vitro and in vivo following laparoscopic embryo transfer (LET). A total number of 47 cumulus-oocyte com-plexes was used for in vitro maturation and fertilization (IVF) with frozen-thawed caprine sperm of a single male. After IVF, the zygotes were cultured for 24 h and delivered 29 (61.7%) embryos. Out of 17 embryos co-cultured with Vero cells, 6 (35.3%) reached the blastocyst stage. Twelve embryos at the 6- to 8-cell stage were laparoscopically transferred to 2 synchronized recipients and 1 of them became pregnant giving birth to a goat after 152 days of pregnancy. The presented methods of oocyte recovery, in vitro embryo production and transfer allow obtaining normal offspring.

Key words: goat, LOPU, IVP, LET

Investigations on in vitro embryo production (IVP) in goats have been developed over the past decade (Cognie, 1999; Crozet et al., 2000; Han et al., 2006; Jiménez-Macedo et al., 2005, 2006; Kątska, 2002; Kątska-Książkiewicz et al., 2004, 2007; Rodriguez-González et al., 2002, 2003; Urdaneta et al., 2003; Wang et al., 2002). However, in spite of the progress, IVP in goats and other farm animals is affected by several factors, and the quality of IVP embryos is inferior to those produced in vivo. Such a conclusion can be drawn on the basis of results showing frequent failure values of up to 60% of in vitro mature (IVM) and in vitro fertilized (IVF) oocytes to reach the blastocyst stage in vitro, both in goats and in other mammalian species (Cognie, 1999; Galli et al., 2003; Han et al., 2006; Kątska-Książkiewicz et al., 2004, 2005, 2007; Nedambale et al., 2006; Pujol et al., 2004).

Efficiency of IVP is affected by several factors. One of them is a method of oocyte recovery. In our earlier experiments (Kątska, 2002; Kątska-Książkiewicz et al., 2004, 2007) cumulus-oocyte complexes (COCs) used for IVP were recovered from


L. Kątska-Książkiewicz et al.38

slaughtered donors by slicing of ovarian surface. The slicing has appeared to be more efficient in comparison with aspiration for recovering a high number of COCs (14.7 ± 4.7/animal). Recovery rates of COCs could be increased to 24.5 ± 8.6/animal by stimulation of follicular growth with FSH (Kątska-Książkiewicz et al., 2004).

An alternative approach to maximizing the donor usage is to collect COCs from live animals using non-invasive technique. Recently extensive work has been pub-lished concerning laparoscopic ovum pick-up (LOPU) in adult goats (Baldassarre et al., 2003; Urdaneta et al., 2003) and in prepubertal animals (Jiménez-Macedo et al., 2005, 2006; Rodriguez-González et al., 2003). However, to our knowledge laparo-scopic transfer of early stage embryos to uterus (LET) has never been applied in goats.

Immature oocytes in goat, as those of other mammals, regardless of method of their recovery, are routinely selected for in vitro maturation (IVM) by visual assess-ment of morphological features. COCs used for IVM should be surrounded by dense, compact layers of cumulus cells. However, when LOPU for COCs recovery is ap-plied, the number of COCs fulfilling expected morphological criteria is rather limited due to the loss of some cumulus layers in a consequence of aspiration. Moreover, recovery rate of COCs by LOPU is approximately 50% lower in comparison to slicing of ovarian surface. Therefore, the conditions for IVP of goat COCs recovered by LOPU should be modified in comparison to standard IVP method (Kątska, 2002; Kątska-Książkiewicz et al., 2004, 2007).

The aim of the study was to establish the conditions for in vitro production of goat embryos by in vitro maturation and fertilization of follicular oocytes recovered from the ovaries using LOPU as well as to determine developmental potential of embryos in vitro and in vivo following laparoscopic embryo transfer.


Animals and housing The experiment was carried out in October 2006, during the reproductive season

of goats, which in Poland takes place in the spring and autumn. A total of three LOPU sessions were performed on 12 goats. The donors were crossbred goats of predomi-nantly dairy type, originating from southern Poland, aged 1 to 4.5 years, and in good body condition. Two goats, approximately 1 year old, were used as recipients of IVP embryos. All animals were housed indoors, with free access to good quality hay and water and provided additionally with 0.3 kg per day of the feed mixture supplemented with barley.

Treatment of donor animalsTo increase the number of growing ovarian follicles goats were synchronized for

estrus by treatment with intravaginal sponges impregnated with 45 mg fluorogestone acetate (Chrono-gest, Intervet, Holland) for 12 to 14 days and treated with 180 mg NIH-FSH (Folltropin, Vetrepharm, Canada Inc.), in four doses twice a day (50, 50, 40, 40 mg), for 2 days before sponge removal (Kątska-Książkiewicz et al., 2004, 2007).

Let of goat IVP embryos 39

The COCs were recovered by LOPU 24 h after the last injection of FSH (i.e. 12 h after sponge removal). Donors were deprived of food and water for 24 h prior to laparoscopy (Baldassarre et al., 2003)

LOPU Anesthesia was induced with intravenous administration of 0.15 ml/kg body

weight of Rompun. The laparoscopy was carried out according to a method described by Baldassarre et al. (2003). Briefly, the anesthetized goats were restrained in a cradle in the standard position for laparoscopic insemination. The laparoscopic equipment was composed of an endoscope and two trocars. Following trocars’ insertion the ab-dominal cavity was filled with filtered air in order to facilitate visualization of the reproductive tract. The follicular contents were aspirated by puncturing follicles with the aspiration needle. Follicular contents were collected in the tube filled with warmed to 35ºC PBS medium supplemented with 0.4% bovine serum albumin (BSA).

Collection and grading of COCsFollicular contents were observed under stereomicroscope and COCs were col-

lected. The number of COCs recovered during one session per female ranged be-tween 1 and 19. There were 2–6 animals used during one session. The mean number of COCs recovered per goat was 5.8. The COCs were washed in TCM 199 holding medium, Earle’s salt with 25 mM HEPES containing 10% fetal calf serum (FCS) (Kątska, 2002; Kątska-Książkiewicz et al., 2004, 2007). COCs with a homogenous cytoplasm were pooled into fresh manipulation medium and held at 38°C until as-signed to maturation. Degenerated or dysmorphic oocytes and those without cumu-lus cells were excluded. The size of the surrounding cumulus cell mass varied from a minimum of two layers (grade 2 oocytes) to more complete and compact cumulus oophorus (grade 1 oocytes).

Maturation of oocytesThe procedure used in our previous experiments was applied (Kątska, 2002;

Kątska-Książkiewicz et al., 2004, 2007). Briefly, COCs were matured in modified TCM 199 Earle’s salt containing 5% estrous goat serum (EGS; prepared in our labora-tory), estradiol-17β (1 μg/ml) and human FSH (0.03 μg/ml). Volume of the medium was related to number of recovered COCs (5 to 10 COCs were placed in 100 μl of the medium). The COCs were cultured for 27 h at 38.5°C under 5% CO2 in air at maximum humidity.

in vitro fertilization After IVM, oocytes were fertilized in vitro (IVF) using frozen-thawed sperm of

the same donor. Semen was frozen during the reproductive season of the goat. Sam-ples of frozen semen selected for IVF contained at least 50% progressively motile spermatozoa after thawing. Straws of semen were thawed in water bath at 37°C for 1 min and kept there for an additional 5 min. The procedure of capacitation was developed in our previous study (Kątska-Książkiewicz et al., 2004). Briefly, spermatozoa were separated by layering 50 μl frozen-thawed semen under 2 ml calcium ion-free


TALP medium and allowing the spermatozoa to swim-up during incubation for 1 h at 39ºC. After incubation, the top 1 ml from tube was removed and pooled in a sterile centrifuge tube and centrifuged (300 x g for 10 min). The resulting sperm pellet was resuspended 1:1 with calcium ion-free TALP medium containing heparin sodium salt (100 μg/ml), i.e. the final heparin concentration in sperm suspension was 50 μg/ml. The sperm suspension was incubated for 45 min at 39ºC. After processing, sperm concentration and motility was assessed.

Mature COCs were mechanically denuded by gentle pipetting, washed and placed (5 to 10 COCs/100 μl medium) in TALP-IVF containing 10% EGS, a PHE mixture consisting of penicillamine (20 μM), hypotaurine (10 μM) and epinephrine (1 μM), and calcium lactate (L(+)-lactic acid, hemicalcium salt, 7.75 mM) (Kątska-Książkiewicz et al., 2004, 2007). The samples of capacitated spermatozoa were then added to the oocytes in fertilization wells for a final concentration of 1 to 2 x 106 spermatozoa/ml of fertilization medium. Gametes were incubated together for 16 to 18 h at 38.5°C under 5% CO2 in air (Kątska-Książkiewicz et al., 2004, 2007).

in vitro embryo cultureAfter 16 to 18 h of fertilization, the oocytes were washed 3 times with a holding

medium to remove corona cells and attached spermatozoa, then transferred into 50-μl drops of B2 medium (C.C.D., Paris, France) under mineral oil for 20 to 24 h (40 to 44 h post insemination). Then, the cleavage rate was recorded. Developmental com-petence of embryos was assessed in co-culture with Vero cells (Kątska-Książkiewicz et al., 2005, 2007). The co-culture was carried out into 50-μl drops of B2 medium under mineral oil. Medium in culture drops was partially changed (20 μl) at intervals of 48 h. Presumptive embryos were maintained in co-culture for 7 days. At the end of the culture period, total blastocyst rate was recorded.

Preparation of Vero cellsThe Vero culture was obtained frozen from ECACC, Salisbury, UK. Cell samples

were thawed in a 37°C water bath, washed by centrifugation in 10 ml of holding medium HEPES buffered TCM 199 and suspended in culture medium – Dulbecco’s MEM (DMEM; Gibco BRL, Life Technologies, Paisley, Scotland) supplemented with 10% FCS and 1% antibiotic–antimycotic solution, enriched with 2mM L-glutamine, 0.36 mM pyruvate, and 2 mM nonessential amino acids (Kątska-Książkiewicz et al., 2005, 2007). Cells were seeded at the following concentrations: a. 1 × 106 cells in 10 ml medium per flask (for passages); b. 1× 102 in 50 μl medium per drop (for co-culture with the small group of embryos). The medium for co-culture i.e. B2 medium enriched with 10% FCS had been exchanged before placing of embryos and then partially exchanged every 48 h (Kątska-Książkiewicz et al., 2005, 2007).

Treatment of recipient animalsTo prepare the recipient animals for the embryo transfer, the goats were synchro-

nized by treatment with intravaginal sponges impregnated with 30 mg fluorogestone acetate (Chrono-gest, Intervet, Holland) for 12 days. One day before sponge removal animals were treated with PMSG 500–750 i.u. depending on body weight. The em-bryos were transferred to recipients 3 days after sponge removal.


Embryo transferEmbryos in the 6- to 8-cell stage (44-48 h following IVF), were transferred into

a horn of uterus of recipient goats, close to the utero-oviductal isthmus. The catheter for intrauterine insemination, modified by supplementation with a needle 0.9 × 5 was used for LET. Six embryos were transferred per recipient, and two recipients were used.

Results

During 3 LOPU sessions in 1-week intervals, a total number of recovered oocytes was 49 (Table 1). Out of them 47 oocytes was selected as suitable for in vitro matura-tion. A large variation in follicle number was observed among the donors subjected to the LOPU procedure (Table 1).

Table 1. Recovery of COCs from donor goats using laparoscopic ovum pick-up

No. of donors LOPU sessions

Aspirated follicles total(mean ± SD per goat)

COCs total(mean ± SD per goat)

12 3 122 (10.2 ± 3.5) 49 (3.8 ± 1.8)

Table 2. Developmental competence following IVP of goat oocytes recovered by LOPU

No. of COCs recovered by LOPU 49No. of COCs used for IVM/IVF 47Cleaved embryos 29 (61.7%)Embryos co-cultured with Vero cells 17 (58.6%)Blastocysts 6 (35.3%)Transferred embryos/recipients 12/2No. of pregnant recipients 1 (50.0%)No. of offspring 1 (16.7%)

After IVM/IVF procedures 61.7% cleavage rate was recorded. Out of cleaved em-bryos 58.6% were used for in vitro culture with Vero cells and following 7 days of co-culture 6 of them (35.3%) reached the blastocyst stage (Table 2). Remaining 6- to 8-cell embryos (n = 12) were laparoscopically transferred to the uterus of 2 recipient animals. One of the recipient goat has appeared to be pregnant and following 152 days of pregnancy gave birth to one kid (Figure 1). It is the first goat produced following LOPU/IVP/LET procedures in Poland.


Figure 1. Kid born following laparoscopic transfer to the uterus of 6- to 8-cell stage embryos,with foster-mother

Discussion

In the present experiment we have observed the relatively low recovery rate of cumulus-oocyte complexes reaching approximately 40% in relation to aspirated folli-cles. It may be due to the individual animal variances, and due to the experience of an operator. However, large variations in follicle number and COCs recovery were also observed by other authors (Baldassarre et al., 2003).

As it has been shown in our recent study (Kątska-Książkiewicz et al., 2007), goat embryos developed in co-culture with Vero cells at a similar rate to cultures with goat oviduct epithelial cells. The observation documenting the similar usefulness of both co-culture systems seems to be a convenient approach for practical applications, be-cause Vero cell co-cultures offer the advantage of working with an identifiable, easy


to handle, and repeatable screening system. As we have demonstrated in our earlier experiments, bovine oviduct epithelial cells (BOEC) could be successfully cryopre-served without losing their properties; frozen-thawed BOECs could provide growth stimulatory components and/or remove toxic substances from the culture medium in a way similar to that of fresh, non preserved cells (Kątska et al., 1995). This advantage creates the opportunity for the use of several sources of cryopreserved somatic cells in a system for the in vitro co-culture of IVM/IVF-derived zygotes, which would be espe-cially useful in the large-scale production of embryos. This is important and attractive because the use of cryopreserved cells in a co-culture system may obviate potential concerns about living tissue as a source of infection/disease, since cryopreserved cell stocks could be screened prior to use. The obtaining of above of 35% of blastocysts following co-culture with Vero cells indicates the usefulness of this co-culture system for goat embryo culture, comparable with usefulness of goat oviduct epithelial cells (Kątska, 2002; Kątska-Książkiewicz et al., 2004, 2007).

Methods applied for laparoscopic oocyte recovery and embryo transfer allow the recovery of fully competent embryos, both for in vitro and in vivo development. The LOPU technology enables multiple use of the donor of oocytes. Of special impor-tance was the observation of Baldassarre et al. (2003) indicating that LOPU procedure can be repeated in the same donor within a short period of time without significant surgical sequels or decrease of response. Taking into account limited experimental material, development of described procedures allowing for better utilization of donor animal resources has an application value.

Considering usefulness of intrauterine embryo transfer for goat, it should be men-tioned that this procedure was involved with rather big asynchrony between early stage embryos (6 to 8 cells) and the place of their transfer, i.e. a horn of uterus. Such asynchrony is frequently applied in human IVF, where 4- to 8-cell stage embryos are transferred to the uterus. Tubal embryo transfer, which involves an embryo transfer via the uterine tube, seems to have a possible advantage over uterine embryo transfer due to more natural timing of embryo exposure to the uterine cavity. Tubal transfer of human embryos resulted in significantly higher clinical and ongoing pregnancy rates when compared with uterine transfer (Van Voorhis et al., 1995; Vorsselmans et al., 2003).

We have shown that embryo development following LET transfer was successful, allowing to produce the kid. However, to prove the reliability and effectiveness of the applied procedure of LET transfer to uterus in goat, an additional experiment, with 20 to 30 recipients, should be carried out.

References

B a l d a s s a r r e H., Wa n g B., K a f i d i N., G a u t h i e r M., N e v e u N., L a p o i n t e J., S n e e k L., L e d u c M., D u g u a y F., Z h o u J.F., L a z a r i s A., K a r a z a s C.N. (2003). Production of trans-genic goats by pronuclear microinjection of in vitro produced zygotes derived from oocytes recovered by laparoscopy. Theriogenology, 59: 831–839.

C o g n i e y. (1999). State of the art in sheep-goat embryo transfer. Theriogenology, 51: 105–116.


C r o z e t N., D a h i r e l M., G a l l L. (2000). Meiotic competence of in vitro grown goat oocytes. J. Re-prod. Fertil., 118: 367–373.

G a l l i C., D u c h i R., C r o t t i G., T u r i n i P., P o n d e r a t o N., C o l l e o n i S., L a g u t I., L a z z a r i G. (2003). Bovine embryo technologies. Theriogenology, 59: 599–616.

H a n Z.B., L a n G.C., W u Y.G., H a n D., F e n g W.G., Wa n g J.Z., T a n J.H. (2006). Interactive effects of granulosa cell apoptosis, follicle size, cumulus-oocyte complex morphology, and cumulus expan-sion on the developmental competence of goat oocytes: a study using the well-in-drop culture system. Reproduction, 132: 749–758.

J i m é n e z - M a c e d o A.R., I z q u i e r d o D., A n g u i t a B., M o g a s T., P a r a m i o M.T. (2005). Com-parison between intracytoplasmic sperm injection and in vitro fertilization employing oocytes derived from prepubertal goats. Theriogenology, 64: 1249–1262.

J i m é n e z - M a c e d o A.R., A n g u i t a B., I z q u i e r d o D., M o g a s T., P a r a m i o M.T. (2006). Em-bryo development of prepubertal goat oocytes fertilized by intracytoplasmic sperm injection (ICSI) according to oocyte diameter. Theriogenology, 66: 1065–1072.

K ą t s k a L., R y ń s k a B., S m o r ą g Z. (1995). The effect of co-culture system on developmental capa- city of bovine IVM/IVF oocytes. Theriogenology, 43: 858–870.

K ą t s k a L., K a n i a G., R y ń s k a B., G a j d a B., S m o r ą g Z. (2002). Offspring following transfer of goat embryos originating from in vitro mature and fertilized oocytes. Med. Wet., 58: 462–463.

K ą t s k a - K s i ą ż k i e w i c z L., R y ń s k a B., G a j d a B., S m o r ą g Z. (2004). Effect of donor stimula-tion, frozen semen and heparin treatment on the efficiency of in vitro embryo production in goats. Theriogenology, 62: 576–586.

K ą t s k a - K s i ą ż k i e w i c z L., B o c h e n e k M., R y ń s k a B. (2005). Effect of quality of sperm chro-matin structure on in-vitro production of cattle embryos. Arch. Tierz. Dummerstorf, 48: 32–39.

K ą t s k a - K s i ą ż k i e w i c z L., O p i e l a J., R y ń s k a B. (2007). Effects of oocyte quality, semen donor and embryo co-culture system on the efficiency of blastocyst production in goats. Theriogenology, 68: 736–744.

N e d a m b a l e T.L., D u F., X u J., C h a u b a l S.A., D i n n y e s A., G r o e n W., F a b e r D., D o b r i n -s k y J.R., Ya n g X., T i a n X.C. (2006). Prolonging bovine-sperm-oocyte incubation in modified medium 199 improves embryo development rate and viability of vitrified blastocysts. Theriogeno- logy, 66: 1951–1960.

P u j o l M., L o p e z - B é j a r M., P a r a m i o M.T. (2004). Developmental competence of heifer oocytes selected using the brilliant cresyl blue (BCB) test. Theriogenology, 61: 735–744.

R o d r i g u e z - G o n z á l e z E., L ό p e z - B é j a r M., Ve l i l l a E., P a r a m i o M.T. (2002). Selection of prepubertal goat oocytes using the brilliant cresyl blue test. Theriogenology, 57: 1397–1409.

R o d r i g u e z - G o n z á l e z E., L ό p e z - B é j a r M., I z q u i e r d o D., P a r a m i o M.T. (2003). Deve- lopmental competence of prepubertal goat oocytes selected with brilliant cresyl blue and matured with cysteamine supplementation. Reprod. Nutr. Dev., 43: 179–187.

U r d a n e t a A., J i m e n e z A.R., I z q u i e r d o D., P a r a m i o M.T. (2003). Effect of the addition of glutathione and glucose to the culture medium on embryo development of IVM-IVF prepubertal goat oocytes. Zygote, 11: 131–138.

Vo o r h i s B.J. v a n , S y r o p C.H., V i n c e n t R.D., C h e s n u t D.H., S p a r k s A.E., C h a p l e r F.K. (1995). Tubal versus uterine transfer of cryopreserved embryos: a prospective randomized trial. Fertil. Steril., 63: 578–583.

Vo r s s e l m a n s A., P l a t t e a u P., Vo s A. d e , A l b a n o C., S t e i r t e g h e m A. v a n , D e v r o e y P. (2003). Comparison of transfers to Fallopian tubes or uterus after ICSI. Reprod. Biomed. Online, 7: 82–85.

Wa n g B., B a l d a s s a r r e H., T a o T., G a u t h i e r M., N e v e u N., Z h o u J.F., L e d u c M., D u g a y F., B i l o d e a u A.S., L a z a r i s A., K e e f e r C., K a r a t z a s C.N. (2002). Transgenic goats produced by DNA pronuclear microinjection of in vitro derived zygotes. Mol. Reprod. Dev., 63: 437–443.



LUCyNA KĄTSKA-KSIAŻKIEWICZ, JOLANTA OPIELA, BOŻENNA RyńSKA, JAROSŁAW WIECZOREK, MIROSŁAW CEGŁA, ZDZISŁAW SMORĄG

Laparoskopowa transplantacja 6-, 8-komórkowych zarodków kozich uzyskanych in vitro

STRESZCZENIE

Celem badań było opracowanie warunków uzyskiwania in vitro zarodków kozich poprzez dojrze-wanie i zapłodnienie in vitro oocytów pęcherzykowych pobieranych z jajników przy zastosowaniu przyżyciowej metody laparoskopowej (LOPU – laparoscopic ovum pick-up), jak również określenie zdolności rozwojowych zarodków in vitro oraz in vivo po przeprowadzeniu laparoskopowego prze- niesienia zarodków (LET – laparoscopic embryo transfer). Ogółem 47 kompleksów oocyt-komórki wzgórka jajonośnego użyto do dojrzewania i zapłodnienia in vitro przy użyciu mrożonego-rozmrażanego nasienia kozła. Po zapłodnieniu, zygoty hodowano przez 24 godziny uzyskując 29 (61.7%) zarodków. Z 17 zarodków współhodowanych z komórkami Vero, 6 (35.3%) osiągnęło stadium blastocysty. Dwanaście zarodków w stadium 6- do 8-komórkowym transplantowano laparoskopowo do rogu macicy dwóm zsyn-chronizowanym biorczyniom, z których jedna po 152 dniach ciąży urodziła kózkę. Przedstawione metody pobierania oocytów, uzyskiwania zarodków in vitro oraz laparoskopowej transplantacji domacicznej 6-, 8-komórkowych zarodków pozwalają na uzyskanie normalnego potomstwa.


CHANgES IN THE ACTIVITY OF α-gALACTOSIDASEAND α-L-FUCOSIDASE DURINg THE POSTHATCH DEVELOPMENT

AND REgRESSION OF JAPANESE qUAIL TESTES AND EPIDIDYMIDIS AFTER LIgHT REDUCTION

R a d o s ł a w J ó z e f c z y k , M a r i a D r o b a , B o g u s ł a w D r o b a

Department of Food Chemistry and Toxicology, Rzeszów University, Ćwiklińskiej 2, 35-601 Rzeszów, Poland

AbstractThe specific activity of α-galactosidase (α-GAL) and α-L-fucosidase (α-FUC) during the posthatch development of Japanese quail testes remained elevated for testes weighing up to 200–400 mg and then decreased. During an experiment with regression caused by a shortened photoperiod, the activity of both enzymes increased several-fold after 15 days and remained elevated until day 30. Based on the results obtained it is suggested that both α-GAL and α-FUC activities estimated during the development and regression of Japanese quail testes originate mainly from Sertoli cells. The specific activity of α-GAL and α-FUC in the posthatch development of epididymidis remained low in imma-ture birds and increased markedly after sexual maturity. After epididymal regression, the activity of these enzymes decreased to reach similar values as in the early development stages. The activity of α-GAL and α-FUC changes in these processes similarly as in mammals.

Key words: acid glycosidases, Japanese quail, testes, epididymidis, development

Acid glycosidases such as α-galactosidase (EC 3.2.1.22) and α-L-fucosidase (EC 3.2.1.51) are lysosomal enzymes with optimum activity at acidic pH. A number of lysosomal glycosidases are highly active in mammalian reproductive organs (Dott, 1973; Tulsiani et al., 1998). It is generally acknowledged that they play a significant role in spermatozoa maturation and in the processes leading to fertilization. In testes, acid glycosidases are found in the lysosomes of reproductive and somatic cells and take part in the spermatogenesis process. They are also present in the acrosomes of spermatids and spermatozoa (Tulsiani et al., 1998). In mammals these enzymes are most active in the epididymidis (Conchie et al., 1959; Belmonte et al., 2002), both in epididymal tissue and in epididymal luminal fluid.

α-galactosidase (α-GAL) catalyses the hydrolysis of α-D-galactosidic linkages in the non-reducing end of oligosaccharides, galactomannans and galactolipids and

R. Józefczyk et al.48

is widely distributed in nature (Dey and Pridham, 1972). Semen from many animals lacks α-galactosidase, although some activity has been demonstrated in the seminal plasma of rabbits and in the epididymis of horses and rats (Conchie and Mann, 1957; Conchie et al., 1959). α-L-fucosidase (α-FUC) is known to catalyse the hydrolysis of α-L-fucose containing biological substances, such as glycoproteins, glycolipids and oligosaccharides (Wiederschain et al., 1973; Alhadeff, 1981; Beyer and Wiederschain, 1982). Mammalian α-L-fucosidases have been studied from rat epididymis and testis (Carlsen and Pierce, 1972; Leray et al., 1988; Leray, 1991) and bull seminal plasma and reproductive organs (Jaughiainen and Vanha-Perttula, 1986).

The number of particular cell types in mammalian testes changes during postnatal development. Primitive Sertoli and Leydig cells dominate in the testis during the early development stages. In rat, the contribution of these cells to the testicular structure is about 96% at 4 days of age, but decreases to about 3% in the testis from adult animals. In the mature testis, 97% of cells are formed by germinal elements and spermatids are the most abundant single cell type (Bellve et al., 1977 a, b). A similar trend is found in birds during posthatch testicular development and growth (Kirby and Froman, 2000). The posthatch development of the fowl testis can be divided into three phases, the boundaries of which are not clearly defined. In the earliest stage of avian testes development there is proliferation of spermatogonia and the somatic cells that support spermatogenessis. The next stage of development is the differentiation and the ac-quisition of functional competence by somatic support cells. During this stage sper-matogonia undergo a series of transformations leading to the onset of active meiosis. The initiation of meiosis appears to occur only after the completion of Sertoli cell proliferation (de Reviers, 1971 a, b; Kirby and Froman, 2000).

Some studies on various enzymes during sexual maturation and regression of mammalian testes established a link between their activity and specific types of re-productive or somatic cells (Gomes and Van Demark, 1974; Hodgen, 1977). In epidi-dymis the activity of acid glycosidases is very low in sexually immature animals and increases several times in mature animals (Conchie and Findlay, 1959). During epidi-dymal involution induced by different factors, the activity of these enzymes is usually observed to decrease to the level found in sexually immature animals (Conchie and Findlay, 1959).

There is little information about acid glycosidases (i.e. α-GAL and α-FUC) in male reproductive organs and semen of birds. Except some studies from our labora-tory (Dżugan et al., 2000; Droba, 2002; Józefczyk and Droba, 2004) only β-HEX and β-GAL activity in testes, epididymidis and semen of rooster was described (Lake, 1971; Kannan, 1974; McIndoe and Lake, 1974; Winnisch, 1974; Bamberg et al., 1976).

Unlike in mammals, the male reproductive system of birds has no additional re-productive organs and includes testes, rudimentary epididymidis and deferent ducts (Lake, 1971). The epididymis function is limited to sperm transport and acquisition of sperm motility (Kirby and Froman, 2000). Avian epididymides, similar to those in mammals, shows much higher activity of lysosomal hydrolases in relation to the testes (Bamberg et al., 1976; Droba, 2002). It can only be assumed that in birds, like in mammals, these enzymes are secreted into the epididymal fluid, because the acti-

Acid glycosidases in Japanese quail testes and epididymidis 49

vity of acid glycosidases in the seminal plasma of ejaculates is often very high (Droba, 2002).

Previously, we described changes in the testicular and epididymal activity of β-hexosaminidase (β-HEX), β-galactosidase (β-GAL), α- and β-mannosidase (α- and β-MAN) (Droba et al., 2007 b) and arylsulphatase (Droba et al., 2007 a) in Japanese quail. This study attempts to investigate changes in the activity of α-GAL and α-FUC in the quail testes and epididymidis during posthatch development and regression of these organs due to a short photoperiod, and compare these changes with those in mammals.


Male Japanese quails from the Experimental Station of the Department of Na- tural Bases of Animal Production at the Agricultural University in Lublin, Poland, were used. Birds received a standard feed according to age. Quails were reared from 1–8 days of hatching under 24-hour light and then were exposed to a photoperiod (16L : 8D). For the posthatch development experiment, male fowls were maintained according to Mather and Willson (1964). Birds, selected at 2- to 4-day intervals from 8 days of hatching to 37 days of age, were weighed and killed by decapitation. The testes and epididymidis were immediately removed, weighed and stored in liquid ni-trogen. For the regression experiment, mature, sexually active birds at 12 weeks of age (average weight of pair of testes 4000 mg and epididymidis 80 mg) were kept under short photoperiod (6L : 18D) according to Eroschenko and Wilson (1974). After 0, 10, 15, 20 and 30 days from the reduction of light, groups of seven males were randomly selected and decapitated. The testes and epididymidis were taken and stored as described previously.

For enzyme activity estimation, organs were thawed, minced and homogenized (1:9 w/v) in 1% NaCl with 0.1% Triton X-100 for 5 min in a glass homogenizer. The homogenates were then assayed for protein and enzymatic content. The protein con-centration was assayed by the Bradford method (1976) using bovine serum albumin as a standard.

The activity of α-GAL and α-FUC was determined spectrophotometrically according to Barrett and Heath (1977) with slight modifications. Homogenates (50 µl) were added to 100 µl of 6 mM p-nitrophenol-α-D-galactoside or p-nitrophenol-α-L-fucoside (Sigma, St Luis, MO USA) in 0.2 M citrate buffer at optimum pH (4.25 for α-GAL and 5.25 for α-FUC). Reaction mixtures were incubated at 37°C (for 10–30 min) and then 250 µl of 3.3% (w/v) trichloroacetic acid was added and centrifuged. Supernatants (250 µl) were mixed with 250 µl of 0.5 M carbonate buffer, and then absorbance at 400 nm was measured. One unit of enzyme activity (U) is defined as the amount of enzyme that hydrolyses 1 µmol substrate/minute.

The data obtained were analysed using one-way analysis of variance followed by LSD-test (Statistica, Stat Soft Inc., Tulsa, OK, USA).


Results

The specific activity of enzymes during the posthatch development of the quail testis in relation to the weight of a pair of testes is shown in Figure 1. These activities remained elevated (approx. 1.7–2 U/mg and 0.7–0.9 U/mg of protein for α-GAL and α-FUC, respectively) for testes weighing up to 200–400 mg. Then as testicular weight increased, the specific activity of both enzymes decreased. Testes in sexually mature birds showed the lowest level of α-GAL and α-FUC activity (approx. 1 and 0.4 U/mg of protein, respectively).

B significantly different from A (P<0.01) and b from a (P<0.05), respectively. * Specific activity of pooled smallest testes from 15 individuals.

Figure 1. Specific activity of acid glycosidases during testes posthatch development in relation to the weight of a pair of testes. Last bar shows specimens at 12 weeks of age. Values are given as mean

± SEM for the number of animals in parentheses

Figure 2. Total activity of α-GAL (A) and α-FUC (B) per testis (in log. scale) in relation to the weight of a pair of testes


B significantly different from A (P<0.01).

Figure 3. Specific activity of acid glycosidases during regression of testes. Values are given as mean± SEM for n = 7

B significantly different from A (P<0.01) and b from a (P<0.05), respectively.

Figure 4. A. Specific activity of acid glycosidases during epididymidis posthatch development in relation to the weight of a pair of testes. Values are given as mean ± SEM for n = 7

B. Specific activity of acid glycosidases during regression of epididymidis. Values are givenas mean ± SEM

The relationship between total α-GAL and α-FUC activity in mU per pair of testes (in logarithmic scale) is given in Figure 2 A and B. The total activity of both en-zymes increased abruptly for testes weighing approx. 30 mg, and then slowly for tes-tes weighing up to 150 mg. For heaviest testes, α-GAL and α-FUC activity establishes itself at a more or less constant level.

The specific activity of α-GAL and α-FUC in the testes during an experiment with regression caused by a shortened photoperiod is shown in Figure 3. The activity


of these enzymes increased 5- and 3-fold for α-GAL and α-FUC, respectively, after 15 days and remained elevated until day 30.

The specific activity of α-GAL and α-FUC in the posthatch development of epidi-dymidis was compared to the weight of testes (Figure 4 A). Within the analysed range of testicular weight, the weight of the epididymidis increases from 4 to 85 mg. The specific activity of both enzymes remained low, until testes reached a weight of ap-prox. 400-650 mg, and then increased slightly for testes weighing 800–1500 mg, and several-fold for testes of sexually mature quails (18 mU and 7 mU/mg of protein for α-GAL and α-FUC, respectively).

The specific activity of α-GAL and α-FUC during regression of the epididymidis due to short photoperiod is given in Figure 4 B. Generally, the epididymal activity of the analysed enzymes at 30 days of the experiment decreased, in the case of α-FUC to reach the values similar as in the early development stages.

Discussion

The α-galactosidase and α-fucosidase activity during posthatch development of the quail’s testes is shown in relation to testicular weight based on the findings of Mather and Wilson (1964), who reported that the stage of spermatogenic develop-ment in young Japanese quail is closely related to testicular weight. When comparing weights of the testes with stages of spermatogenic advancement, without regard to age of birds, a relationship exists in stages I (3.06 ± 0.66 mg; resting spermatogonia), II (56.7 ± 8.95 mg; dividing spermatogonia and few spermatocytes) and III (234.07 ± 46.12 mg; many spermatocytes). In stages IV (506.68 ± 99.21 mg; spermatocytes and spermatids) and V (551.11 ± 56.60 mg; spermatids and few spermatozoa), testicular development differs although the weights are similar. Full spermatogenic activity is indicated when the combined weight of the testes exceeds 1 g (stage VI).

During posthatch development of Japanese quail testes, the specific activity of α-GAL and α-FUC was elevated during stages I, II and III of spermatogenic develop-ment and then gradually decreased (Figure 1). The relationship between total α-GAL and α-FUC activity per pair of testes and testicular weight (Figure 2 A and B) shows close resemblance to the relationship between the total number of Sertoli cells found in cockerel testes and testes weight (de Reviers, 1971 b). A similar pattern of activity changes during the development of Japanese quail testes was shown by arylsulphatase (Droba et al., 2007 a). Based on our data, we suggest that both α-GAL and α-FUC activity estimated during the development of Japanese quail testes originates mainly from Sertoli cells.

The activity of α-GAL was not described in mammalian testes, while α-L-FUC activity was investigated in rat testis from the prepuberal to the mature status. The en-zyme activity in seminiferous tubules was found to be relatively high on day 25 after birth but decreased and remained relatively constant the following days during the onset of puberty. In contrast, α-FUC activity was nearly undetectable in the immature interstitium, but increased significantly during the onset of sexual maturity. Fucosi-dase activity from seminiferous tubules was neither dependent on androgen levels nor


influenced by the number, size, or state of maturation of spermatozoa. This observa-tion could be explained by α-FUC activity mainly owing to Sertoli cells, which are known to stop their division around day 20. Since the number of these cells remained invariable, their enzyme production (and/or specific activity) could possibly be con-stant (Leray et al., 1988; Leray, 1991).

α-FUC in rat testis has been found to be synthesized by pachytene spermatocytes and round spermatids but not by condensing spermatids (Hancock et al., 1993). The activity of this enzyme has also been detected in epididymal (Hancock et al., 1993), and ejaculated sperm (Jaughiainen and Vanha Perttula, 1986). Hancock et al. (1993) deduced that because synthesis of α-FUC did not occur beyond the round spermatid of spermatid stage and that epididymal epithelial cells can synthesize and secrete this enzyme in vitro, sperm-associated α-FUC may have been acquired from the epididy-mal lumen during their transit through the excurrent ducts.

The photoperiod requirements for gonadal development of avian species has been reviewed in detail by Lofts and Murton (1968). When immature quails of both sexes are subjected to a photoperiod of 12 h or more per 24 h, stimulated growth and maturation of testes occur. When mature males were exposed to short photoperiods (6L : 18D) a rapid testicular weight reduction was recorded (Follett and Farner, 1966; Eroschenko and Wilson, 1974). Signs of involution (regression) are seen in the quail’s testis prima-rily 10 days after light reduction. Seminiferous tubules filled with necrotic debris and increased steatogenesis were traits associated with testicular involution. Four weeks after light reduction, the majority of the lipoidal seminiferous tubules were cleared of necrotic debris and contained essentially a single layer of germinal epithelium; thus testes were histologically similar to the organ during the immature stages of develop-ment (Eroschenko and Wilson, 1974).

In this study we used a short photoperiod as one of the ways of causing regression and inhibiting spermatogenesis in testes (Gomes and Van Demark, 1974; Hodgen, 1977). When mature male quails were exposed to a short photoperiod the specific activity of α-FUC and α-GAL increased markedly on day 15 of the experiment (Figure 3). The elevated activity of lysosome enzymes is characteristic of the tis-sues and organs that undergo involution (Dott, 1973), and the lysosome apparatus of Sertoli cells is involved in the degradation of more specialized reproductive cells (Elkington et al., 1973; Bartke et al., 1998). As a result of regression caused by short photoperiod after 20-30 days, only Sertoli cells and resting spermatogonia are present in the spermatogenic epithelium (Eroschenko and Wilson, 1974). The same composi-tion of seminiferous tubules is shown by the testes of quails maintained under short photoperiod so as to prevent gonadal development (Follet and Farner, 1966; Ottinger and Brinkley, 1979).

The changes undergone by bird epididymidis during posthatch development are similar to those occurring during the maturation of mammals. After birth, the epidi-dymis goes through a phase of relatively slow growth (weight gain) followed by a rapid growth spurt associated with the onset of Leydig cell function and appearance of spermatozoa (Robaire and Hermo, 1988). It has been known that in rodents, the specific activity of acid glycosidases in the epididymis increased several-fold during sexual maturation, still before spermatozoa appear in the epididymis, and decreased


after surgical removal of the testis. For example, 4 weeks after castration of both mice and rats, β-HEX, β-GAL, α-MAN and β-GLUC activity was greatly reduced; in rats, α-MAN and β-GAL activity values obtained were comparable to or lower than for 2-week-old infant animals (Conchie and Findlay, 1959; Milne et al., 1978).

During the posthatch development of quail epididymidis, the activity α-GAL and α-FUC was initially very low, but in sexually mature birds it was found to increase several-fold (Figure 4 A). The use of short photoperiod reduces the activity of these enzymes up to 30 days, and for α-FUC these were similar to the values characteristic of immature birds. This is in agreement with the literature data mentioned earlier and with our previous results concerning changes in the activity of other acid glycosidases (β-HEX, β-GAL, α- and β-MAN) during posthatch development and regression of quail epidydimidis after light reduction (Droba et al., 2007 b). However, Belmonte et al. (2002) reported a 2- to 4-fold increase in β-HEX, β-GAL and α-MAN activity in rat cauda epididymal tissue 4 days after castration. As regards the activity of the above enzymes in epididymal tissue, epididymal fluid and epididymal spermatozoa, these authors found that enzymes in epididymidis can be redistributed among these different compartments. This showed that the activity of α-FUC and α-GAL, found in Japanese quail in the whole epididymidis involuted, may fail to reflect the increased activity in the tissue itself. A marked increase in the activity of α-GAL and α-FUC in the epidi-dymidis of sexually mature animals and a decrease in this activity during epididymal regression indicate that these enzymes take part in reproductive processes.

In summary, our results indicate that a change of α-FUC activity during the de-velopment of quail testes is similar to that found in rat testes. In quail epididymidis α-FUC and α-GAL activity changes similarly as most acid glycosidases in rodents.

References

A l d a h e f J.A. (1981). Human α-L-fucosidases and fucosidosis. In: Lysosomes and Lysosomal Storage Diseases. J.W. Callahan, J.A. Lowden (eds), pp. 299–314.

B a m b e r g E., S k o l e k R., S t ö c k l W. (1976). Verteilung der β-N-Acetylhexosaminidase und β-Galactosidase in Genitaltrakt des Hahnes (Gallus domesticus). Zbl. Vet. Med., Abstr., 23: 146–151.

B a r r e t t A.J., H e a t h M.F. (1977). Lysosomal enzymes. In: Lysosomes: a laboratory handbook, J.T. Dingle. Elsevier North-Holland (eds), Amsterdam, pp. 19–145.

B a r t k e A., S i n h a - H i k i m A.P., R u s s e l l L.D., M a j u m d e r S., R a o J.N., N e w t o n S.C., C h a n d r a s h e k a r V. (1998). Mechanizmy regulujące męskie funkcje reprodukcyjne u gryzoni rozmnażających się sezonowo. In: Ultrastruktura i funkcja komórki. A. Łukaszczyk, B. Bilińska, J. Kawiak, Z. Bielańska-Osuchowska (eds), PWN, Warszawa, 7: 257–273.

B e l l v e A.R., C a v i c c h i a J.C., M i l l e t t e C.F., O ’ B r i a n D.A., B h a t n a g a r Y.M., D y m M. (1977 a). Spermatogenic cells of the prepuberal mouse. J. Cell. Biol., 74: 68–85.

B e l l v e A.R., M i l l e t t e C.F., B h a t n a g a r Y.M., O ’ B r i a n D.A. (1977 b). Dissociation of the mouse testis and characterization of isolated spermatogenic cells. J. Histochem. Cytochem., 25: 480-494.

B e l m o n t e S.A., R o m a n o P., S a r t o r T., S o s a M.A. (2002). Compartmentalization of lysosomal enzymes in cauda epididymis of normal and castrated rats. Arch. Androl., 48: 193-201.

B e y e r E.M., W i e d e r s c h a i n G.y. (1982). Further evidence of human α-L-fucosidase polymorphism. Clinica Chim. Acta, 123: 251-259.

B r a d f o r d M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of pro-tein utilizing the principle of protein-dye binding. Anal. Biochem., 72: 248–254.

C a r l s e n R .B., P i e r c e J.G. (1972). Purification and properties of an α-L-fucosidase from rat epididy-mis. J. Biol. Chem., 247: 23–32.


C o n c h i e J., M a n n T. (1957). Glycosidases in mammalian sperm and seminal plasma. Nature, 179: 1190–1191.

C o n c h i e J., F i n d l a y J. (1959). Influence of gonadectomy, sex hormones and other factors, on the activity of certain glycosidases in the rat and mouse. J. Endocrinol., 18: 132–146.

C o n c h i e J., F i n d l a y J., L e v v y G.A. (1959). Mammalian glycosidases. Distribution in the body. Biochem. J., 71: 318–324.

D e y P.M., P r i d h a m J.B. (1972). Biochemistry of α-galactosidases. Adv. Enzymol., 36: 91–130.D o t t H.M. (1973). Lysosomes and lysosomal enzymes in reproduction. Adv. Reprod. Physiol., 6: 213–277.D r o b a B. (2002). Kwaśne glikozydazy w układzie rozrodczym koguta i indora. Zesz. Nauk. AR Kraków,

ser. Rozpr., z. 285, Wyd. AR Kraków.D r o b a M., J ó z e f c z y k R., D r o b a B., W i t k o w s k i A. (2007 a). Changes in the activity of soluble

arylsulphatase during the posthatch development and regression after light reduction of Japanese quail testes and epididymidis. Anim. Reprod. Sci., 97, 1–2: 103–113.

D r o b a M., J ó z e f c z y k R., D r o b a B., Witkowski A. (2007 b). Changes in the activity of acid gly-cosidases during posthatch development and regression after light reduction on Japanese quail testes and epididymidis. Comp. Biochem. Physiol. B, 146: 364–369.

D ż u g a n M., D r o b a M., D r o b a B. (2000). Seasonal changes in acid glycosidases from gander testes. Comp. Biochem Physiol., 127: 383–390.

E l k i n g t o n J.S., B l a c k s h a w A.W., J o n g B. d e (1973). The effect of hypophysectomy on testicular hydrolases, lactate dehydrogenase, and spermatogenesis in the rat. Aust. J. Biol. Sci., 26: 491–503.

E r o s c h e n k o V.P., W i l s o n W.O. (1974). Histological changes in the regressing reproductive organs of sexually mature male and female Japanese quail. Biol. Reprod., 11: 168–179.

F o l l e t t B.K., F a r n e r D.S. (1966). Pituitary gonadotropins in the Japanese quail (Coturnix coturnix japonica) during photoperiodically induced gonadal growth. Gen. Comp. Endocrinol., 7: 125–131.

G o m e s W.R., D e m a r k N.L. van (1974). The male reproductive system. Annu. Rev. Physiol., 36: 307–330.

H a n c o c k L.W., R a a b L., A r o n s o n N.N. (1993). Synthesis and processing of rat sperm-associated α-L fucosidase. Biol. Reprod., 48: 1228–1238.

H o d g e n G.D. (1977). Enzyme markers of testicular function. In: The testis. Eds. A.D. Johnson, W.R. Gomes. Academic Press, New York, San Francisco, London, pp. 401–423.

J a u c h i a i n e n A., Va n h a - P e r t t u l a T. (1986). α-L-fucosidase in the reproductive organs and semi-nal plasma of the bull. Biochim. Biophys. Acta, 880: 91–95.

J ó z e f c z y k R., D r o b a M. (2004). Acid glycosidases in the testes of Japanese quail. Ann. Anim. Sci., 4: 363–370.

K a n n a n Y. (1974). Glycosidases in fowl semen. J. Reprod. Fert., 40: 227–228.K i r b y J.D., F r o m a n D.P. (2000). Reproduction in male birds. In: Sturkie’s Avian Physiology. Ed.

G.C. Whittow. Fifth Edition, Academic Press, San Diego, London, Boston, New York, Sydney, Tokyo, Toronto, pp. 597–615.

L a k e P.E. (1971). The male in reproduction. In: Physiology and Biochemistry of the Domestic Fowl. Eds D.J. Bell, B.M. Freeman. Academic Press Inc., London, New York, vol. III: 1411–1447.

L e r a y G. (1991). Lysosomal glycosidase activities in rat testis during sexual maturation. Arch. Int. Physiol. Biochim. Biophys., 99: 251–255.

L e r a y G., S h a c o o r i V., P r o d h o m m e C., J o u a n o l l e A.M., B l a y a u M. (1988). Alpha – L-fu-cosidase in rat testis during sexual maturity. Arch. Androl., 21: 23–28.

L o f t s B., M u r t o n R.K. (1968). Photoperiodic and physiological adaptations regulating avian breeding cycles and their ecological significance. J. Zool., 155: 327–394.

M a t h e r F.B., W i l s o n W.O. (1964). Post-natal testicular development in Japanese quail (Coturnix coturnix japonica). Poultry Sci., 43: 860-871.

M c I n d o e W.M., L a k e P.E. (1974). The distribution of some hydrolytic enzymes in the semen of the domestic fowl Gallus domesticus. J. Reprod. Fert., 40: 359–365.

M i l n e A.F., W i l l i a m s J.N., R u d o l p h F.B. (1978). Changes in the activity of N-acetyl-β-D-hexosa-minidase in the rat epididymis with age. Comp. Biochem. Physiol., B, 59, 3: 199–200.

O t t i n g e r M.A., B r i n k l e y H.J. (1979). Testosterone and sex related physical characteristics during the maturation of the male Japanese quail (Coturnix coturnix japonica). Biol. Reprod., 20:905–909.

R e v i e r s M. de (1971 a). Le développment testiculaire chez le coq. I. Croissance pondérale des testicules et dévelopment des tubes séminifères. Ann. Biol. Anim. Bioch. Biophys., 11: 531–546.


R e v i e r s M. de (1971 b). Le développment testiculaire chez le coq. II. Morphologie de l’épithélium séminifère et établissement de la spermatogenèse. Ann. Biol. Anim. Bioch. Biophys., 11: 531–546.

R o b a i r e B., H e r m o L. (1988). Efferent ducts, epididymis, and vas deferens: Structure, functions, and their regulation. In: The Physiology of Reproduction. Eds E. Knobil, J.D. Neill. Raven Press, New York, pp. 999–1080.

T u l s i a n i D.R.P., A b o u - H a i l a A., L o e s e r C.R., P e r e i r a B.M.J. (1998). The biological and func-tional significance of the sperm acrosome and acrosomal enzymes in mammalian fertilization. Exp. Cell Res., 240: 151–164.

W i e d e r s c h a i n G.Y., K o l i b a b a L.G., R o s e n f e l d E.L. (1973). Human α-L-fucosidases. Clinica Chim. Acta, 46: 305–310.

W i n n i s c h R. (1974). Histochemischer Nachweis der Aktivitäten von β-N-Acetylglucosaminidase, β-D-Galactosaminidase und β-Glucuronidase in Genitaltrakt des Haushuhnes (Gallus domesticus). Med. Vet. Diss., Vien.


RADOSŁAW JóZEFCZyK, MARIA DROBA, BOGUSŁAW DROBA

Zmiany aktywności α-galaktozydazy i α-L-fukozydazy podczas powylęgowego rozwoju i regresji jąder i najądrzy przepiórek japońskich po skróceniu dnia świetlnego

STRESZCZENIE

Aktywność właściwa α-galaktozydazy (α-GAL) i α-L-fukozydazy (α-FUC) podczas powylęgowego rozwoju jąder przepiórek japońskich wzrosła w przypadku jąder ważących do 200–400 mg, po czym uległa zmniejszeniu. W czasie doświadczenia, w którym regresję wywołał skrócony dzień świetlny, aktywność obydwu enzymów wzrosła kilkakrotnie po 15 dniach i pozostała podwyższona do 30. dnia. W oparciu o uzyskane wyniki przypuszcza się, że aktywność zarówno α-GAL jak i α-FUC, oceniana pod-czas rozwoju i regresji jąder przepiórek japońskich, pochodzi głównie z komórek Sertoliego. Aktywność właściwa α-GAL i α-FUC podczas powylęgowego rozwoju najądrzy pozostała niska u niedojrzałych ptaków i znacząco wzrosła po uzyskaniu dojrzałości płciowej. Po regresji najądrzy aktywność tych en-zymów zmniejszyła się, osiągając podobne wartości jak we wczesnych stadiach rozwojowych. W czasie tych procesów aktywność α-GAL i α-FUC zmienia się podobnie jak u ssaków.


CONTENT OF PROTEIN AND ITS FRACTIONS IN MILKOF SIMMENTAL COWS WITH REGARD TO REARING TECHNOLOGY**

J o l a n t a K r ó l 1 , Z y g m u n t L i t w i ń c z u k 2, A n n a L i t w i ń c z u k 1 , A n e t a B r o d z i a k 1

1Department of Animal Materials Estimation and Utilisation,2Department of Cattle Breeding, Agricultural University, Akademicka 13, 20-934 Lublin, Poland

AbstractThe investigations included a total of 114 milk samples collected from Simmental cows over the summer season (June–August). From the examined milk samples, 56 were obtained from 4 farms situated in the Bieszczady region, where the cows were kept traditionally in tie stalls (group I). The other milk samples (58) were taken from one farm in the Lublin region, where 300 cows of this breed were maintained in the loose housing system (group II). On the farms from group I, a con-ventional feeding system was used. The cows grazed the pasture ad libitum in addition to receiving hay and concentrate. In group II, the TMR feeding system was applied (maize silage, spent grain, hay, concentrate). Each milk sample was analysed for protein and fat content using a Milko-Scan apparatus, for casein using Walker’s method based on the Polish Standard (PN-68/A-86122), and for the level of whey proteins (alpha-lactoalbumin (α-LA), beta-lactoglobulin (β-LG) and lactofer-rin) using reverse-phase high-performance liquid chromatography (RP-HPLC). The results show that the milk from Simmental cows is characterized by a relatively high concentration of protein, including casein and whey proteins. On the farms where the cows were managed in the conventional system (tie stalls, pasture feeding), the milk obtained had a significantly higher content of functional whey proteins, whereas cows fed according to the TMR system produced milk with a higher total content of protein, casein and fat.

Key words: Simmental cows, milk, protein, rearing technology

Currently, Simmental cattle account for 2% of the domestic population, thus occupying the third position after Black-and-White and Red-and-White breeds (Litwińczuk et al., 2006). The major advantage of the Simmentals proves to be an excellent adaptability to various environmental conditions, including the mountain and submountain regions. Milk from Simmental cows is characterized by a high level of protein, including casein, which is of primary importance for cheese making (Farot, 2002; Feleńczak et al., 2003). In addition, bovine milk proteins show some specific functional properties that promote health. The major bioactive components of

*This study was conducted as part of Ministry of Science and Higher Education project no. N311 014 31/0649.

J. Król et al.58

milk are whey proteins, mainly beta-lactoglobulin, alpha-lactoalbumin and lactofer-rin. These proteins may exert regulatory activities in a human organism; they affect the gastrointestinal, immune, cardiovascular and nervous systems and thus reduce the risk of lifestyle diseases, such as cardiovascular diseases, obesity, diabetes, cancer or even Alzheimer’s disease and HIV (Reklewska and Bernatowicz, 2003; Strohmaier, 2004; Riechel et al., 1998). Only a few available research papers discuss the problem of functional whey protein in the milk of cows of various breeds used in Poland.

The objective of the present study was to evaluate the content of these proteins in milk from Simmentals maintained under different rearing systems.


The investigations included a total of 114 milk samples collected from Simmen-tal cows over the summer season (June–August). From the examined milk samples, 56 were obtained from 4 farms situated in the Bieszczady region, where the Sim-mentals are kept traditionally in tie stalls (group I). The other milk samples (58) were taken from one farm in the Lublin region, where 300 cows of this breed were main-tained in the loose housing system (group II).

On the farms from group I the conventional feeding system was used. The cows grazed the pasture ad libitum in addition to receiving hay and concentrate. In group II, the TMR feeding system was applied (maize silage, spent grain, hay, concentrate).

Each milk sample was analysed for protein and fat content using a Milko-Scan apparatus, for casein using Walker’s method based on the Polish Standard (PN-68/A-86122), and for the level of whey proteins (alpha-lactoalbumin (α-LA), beta-lactoglobulin (β-LG) and lactoferrin) using reverse-phase high-performance liquid chromatography (RP-HPLC). The procedure of protein separation was based on the method elaborated by Romero et al. (1996). All the analyses were performed only in those milk samples in which the somatic cell count did not exceed 400,000 cells/ml (Somacount 150).

The obtained results were analysed statistically using the StatSoft Inc. STATIS-TICA ver. 6 program based on one-way analysis of variance. The significance of dif-ferences between the mean values for the evaluated groups was established with NIR Fisher’s test.

Results

The data from Table 1 reveal that Simmental cows maintained in loose stalls and fed TMR (group II) produced, on the average, 6.82 kg more milk daily (P≤0.01) in comparison with the cows maintained in tie stalls and fed on the pasture (group I). Meanwhile, the milk of cows from group II had a 0.13% higher content of total protein (P≤0.01), 0.06% higher casein level (P≤0.05) and 0.03 higher protein/fat ratio (P≤0.05) compared to the animals from group I. No significant differences were

Protein content of cows’ milk and rearing technology 59

recorded between the groups in fat content, and the milk obtained from the cows in group I showed a slightly raised level (by 0.05%) of this component.

The milk from the Simmental cows grazing the pasture (group I), maintained in the Bieszczady region, showed a higher content of whey proteins (Table 1). Highly significant differences (P≤0.01) between the groups appeared above all for the profile of beta-lactoglobulin, whose content in the milk of cows from group I was 0.53 g/l higher than in the milk of cows from group II. The milk of cows from group I was also characterized by the highest content of alpha-lactoalbumin (by 0.14 g/l) and lactofer-rin (by 27.9 mg/l).

Table 1. Daily milk yield and the content of analysed components in Simmental cows’ milk

Item Group In = 56

Group IIn = 58

Daily milk yield (kg) x

SD16.81 A5.25

23.63 B6.13

Total protein (%) x

SD3.42 A0.28

3.55 B0.25

Casein (%) x

SD2.50 a0.42

2.56 b 0.31

Fat (%) x

SD4.040.39

3.990.32

Protein/fat ratio x

SD0.83 a0.09

0.86 b 0.12

β-LG (g/l) x

SD3.70 B0.21

3.17 A0.34

α-LA (g/l) x

SD1.14 b0.20

1.00 a0.21

Lactoferrin (mg/l) x

SD116.22 b12.74

88.34 a31.39

Group I – conventional system, pasture.Group II – loose cowsheds, TMR.a, b – differences significant at P≤0.05.A, B – differences significant at P≤0.01.

Discussion

The crude protein content of bovine milk, mainly the casein level, decides its usability for cheese making. The research results demonstrate that the milk obtained from group II cows (TMR feeding system applied) had more beneficial processing parameters. The milk obtained from this group of cows was characterized by a more favourable protein/fat ratio, which indicates its higher usability for technological processing. In the studies by Feleńczak et al. (2003) and Barłowska et al. (2004), milk

J. Król et al.60

from the Simmentals grazing the pasture in the summer season, like in the present research, exhibited a lower content of protein, including casein.

As regards the health-promoting aspects, the most important parameter is the con-tent of functional whey proteins in milk. Farot (2002) determined the α-LA and β-LG levels in Simmental cows (according to the SDS PAGE method) and the obtained re-sults appeared to be closest to those recorded in the present study for milk from cows of group I (α-LA – 0.108% and β-LG – 0.392%).

According to Reklewska et al. (2003), who studied Black-and-White cattle, cows grazing a pasture produced milk with a significantly higher whey protein level as compared to the animals that were fed a balanced complete feed all year round. The results concerning the concentration of major milk whey proteins, i.e. β-LG (3.04–3.74 g/l) and α-LA (1.11–1.37 g/l) are comparable to those in the present research; however, a substantially lower lactoferrin content was determined (7.30–14.73 mg/l). A high milk lactoferrin level (similar to that in the present study) was also reported by the other authors (Reichel et al., 1998; Król et al., 2007).

A higher content of functional whey proteins in the milk of pastured cows (irre-spective of breed) was also confirmed in the studies of Król et al. (2007), involving Polish Red and Whitebacked breeds.

The present study revealed that regardless of the feeding and maintenance sys-tem the analysed milk from Simmental cows was characterized by a relatively high concentration of protein, including casein and whey proteins. On the farms where the cows were maintained in the conventional system (tie stalls and pasture feeding), the milk obtained showed a significantly higher level of functional whey proteins. How-ever, the cows fed according to the TMR system produced milk with a higher total content of protein, casein and fat.

References

B a r ł o w s k a J., L i t w i ń c z u k A., K r ó l J., K ę d z i e r s k a - M a t y s e k M. (2004). Jakość mleka produkowanego w gospodarstwach farmerskich utrzymujących krowy rasy simentalskiej. Zesz. Nauk. Prz. Hod., 72, 1: 161–166.

F a r o t A. (2002). Wartość odżywcza i przydatność technologiczna mleka krów różnych ras. Rozpr. dokt., AR Kraków, ss. 28–30.

F e l e ń c z a k A., F e r t i g A., S z a r e k J., C z a j a H., K u r b i e l A. (2003). Zmiany składu i cech fi-zykochemicznych mleka krów rasy Simental w zależności od sezonu. Rocz. Nauk. Zoot., Supl., 17: 849–851.

K r ó l J., L i t w i ń c z u k Z., B a r ł o w s k a J., K ę d z i e r s k a - M a t y s e k M. (2007). Initial results on casein and whey protein content in milk of Polish Red and Whiteback cows. Ann. Anim. Sci., Suppl., 1: 207–211.

L i t w i ń c z u k Z., C h a b u z W., S t a n e k P., J a n k o w s k i P. (2006). Bydło simentalskie w Polsce. Prz. Hod., 9: 22–26.

R e k l e w s k a B., B e r n a t o w i c z E. (2003). Funkcjonalne składniki mleka - znaczenie dla organizmu oraz możliwości modyfikowania ich zawartości w mleku. Zesz. Nauk. PTZ, Prz. Hod., 71: 47–69.

R e k l e w s k a B., B e r n a t o w i c z E., R e k l e w s k i Z., N a ł ę c z - T a r w a c k a T., K u c z y ń s k a B., Z d z i a r s k i K., O p r z ą d e k A. (2003). Zawartość biologicznie aktywnych składników w mleku krów zależnie od systemu żywienia i sezonu. Zesz. Nauk. PTZ, Prz. Hod., 68: 85–98.

R i e c h e l P., We i s s T., We i s s M., U l b e r R., B u c h h o l t s H., Scheper T. (1998). Determination of the minor whey protein bovine lactoferrin in cheese whey concentrates with capillary electrophoresis. J. Chromatogr., 817: 187–193.

Protein content of cows’ milk and rearing technology 61

R o m e r o C., P e r e z - A n d u j a r O., J i m e n e s S. (1996). Detection of cow’s milk in ewe’s or goat’s milk by HPLC. Chromatogr., 42, 181–184.

S t r o h m a i e r W. (2004). Chromatographic fractionation of whey proteins. Bulletin of the IDF, 389: 29–35.


JOLANTA KRóL, ZyGMUNT LITWIńCZUK, ANNA LITWIńCZUK, ANETA BRODZIAK

Zawartość białka oraz jego frakcji w mleku krów simentalskich z uwzględnieniem technologii chowu

STRESZCZENIE

Badaniami objęto ogółem 114 prób mleka pobranego od krów rasy simentalskiej w okresie letnim (VI-VIII). Z przebadanych próbek mleka 56 pochodziło z 4 wybranych gospodarstw z rejonu Biesz- czad, utrzymujących krowy systemem tradycyjnym w oborach uwięziowych, na stanowiskach ściołowych (grupa I). Pozostałe 58 prób mleka pochodziło z jednego gospodarstwa położonego na Lubelszczyźnie, utrzymującego około 300 krów w oborach wolnostanowiskowych (grupa II).

W gospodarstwach I grupy stosowano tradycyjny system żywienia. Krowy korzystały z pastwiska do woli, ponadto otrzymywały siano oraz paszę treściwą. W grupie II żywienie krów prowadzono systemem TMR (kiszonka z kukurydzy, młóto, siano, pasza treściwa).

W każdej próbie mleka oznaczano zawartość białka i tłuszczu (aparatem Milko-Scan 104) oraz kaze-iny (metodą Walkera wg Polskiej Normy PN-68/A-86122). Zawartość białek serwatkowych: alfa-laktoal-buminy (α-LA), beta-laktoglobuliny (β-LG) i laktoferyny oznaczano przy zastosowaniu wysokosprawnej chromatografii cieczowej w odwróconym układzie faz (RP-HPLC). Uzyskane wyniki wskazują, że oceniane mleko krów rasy simentalskiej charakteryzowało się stosunkowo wysoką koncentracją białka, w tym kazeiny i białek serwatkowych. W gospodarstwach utrzymujących krowy systemem tradycyjnym (obory uwięziowe, żywienie pastwiskowe) pozyskiwano mleko o istotnie wyższej zawartości funkcjonal- nych białek serwatkowych, natomiast krowy żywione systemem TMR produkowały mleko o wyższej zawartości białka ogólnego, kazeiny i tłuszczu.


BEHAVIOURAL RESPONSE OF NEWLY MIXED WEANERS TO A HANgINg WOODEN BALL AND A FREE BALL IN THE PEN

J a c e k N o w i c k i , E m i l i a M o s k a ł a , M a r c i n K o p y r a

Department of Pig Breeding, Agricultural University, Al. Mickiewicza 24/28,30-059 Kraków, Poland

Abstract24-hour behavioural observations of 144 weaners were carried out during 72 h after weaning and again during 24 h, three weeks after weaning. The weaners were mixed from 2 litters and divided into 3 groups: group I (6 weaners in replicate) housed in a standard pen, 1.5 m (width) × 2.2 m (length) covered with plenty of straw, group II (6 weaners in replicate) housed in a similar pen covered with plenty of straw with a hanging wooden ball, and group III housed in an identical pen with a free ball (6 weaners in replicate). A 24-hour behavioural profile of both groups was created based on agonistic behaviour (fighting and biting), interest in the toy (in groups II and III) and the resting phase. There were no significant differences in total activity between weaner groups. In the groups of weaners that had access to toys, the duration of aggressive behaviour during the first 72 hours was shorter and the frequency of aggressive behaviour was lower in comparison with the animals housed without a toy. On the day of weaning the hanging ball was less interesting to weaners but from the second day it became more attractive than a plastic free ball.

Key words: weaners, mixing, aggressive behaviour, toys

EU legal regulations draw attention to the provision of environmental enrichment for pigs. Commission Directive 2001/93/EC states that pigs kept in groups must be prevented from fighting, and when signs of severe fighting appear, the causes should be immediately investigated and appropriate measures taken, such as providing plen-tiful straw to the animals, if possible, or other materials for exploration. Polish legal regulations (Regulation of the Ministry of Agriculture and Rural Development, Jour-nal of Laws No. 167, p. 1629) state that stockpersons should minimize aggression among pigs and prevent fights. Similar directives exist in other EU countries. The British Code of Recommendations for the Welfare of Livestock: Pigs (2003) under-lines, in the section describing the welfare of weaners and rearing pigs, that the wel-fare plan should include a strategy for managing, mixing and establishing groups of pigs. Plenty of space and sufficient environmental enrichment can help minimize aggression on mixing. However, environmental enrichment does not generally extend

J. Nowicki et al.64

beyond the provision of straw. Results concerning the influence of environmental en-richment are not consistent.

The presence of enriching material may be important especially after weaning. Weaning is a stressful event often associated with vigorous fighting, growth check and digestive disorders (Paratt et al., 2006). The most intensive aggression occurs during the first 1–2 h, after which time it steadily decreases to a very low level by 24–48 h post-grouping. Within a given group, the amount of fighting increases proportionately to the number of unfamiliar pigs within the pen (Keeling and Gonyou, 2001). Such aggression in the first few hours after weaning may increase mortality and be detri-mental in economic terms.

The choice of enrichment for pigs in an indoor system is often arbitrary, failing to account for the requirements of the animals themselves. One of the consequences of this approach is that animals rapidly lose interest in other objects (Day et al., 2002). In the opinion of these authors, the effectiveness and success of any type of environmen-tal enrichment relies on its ability to reinforce a motivated behaviour, e.g. exploratory or feeding motivation. Toys that are not destructible are not very useful because pigs quickly get used to their presence and soon ignore them. Lewis et al. (2006) hold that the properties of a substrate determine whether or not it will be successful as a source of environmental enrichment. However, the destructibility and flexibility are widely accepted as material characteristics that are relevant to pig toys (Lewis et al., 2006).

Given the above information, it was decided to determine whether a non-destructible wooden ball or a free plastic ball can affect the behaviour of weaners after mixing and reduce the duration and frequency of agonistic behaviour.


24-hour behavioural observations were carried out with 144 Polish Landrace × Polish Large White crossbred weaners during 72 hours after weaning at 35 days af-ter farrowing (first observation period) and again during 24 hours, three weeks after weaning (second observation period). Animals were housed in a mechanically ven-tilated building with electronic control and temperature regulation. To avoid micro-climate differences, the observations were carried out in the early autumn and during spring. The experiment was performed in 8 replicates. In each replicate, weaners from 2 litters were mixed and divided into 3 groups:

Group I (6 weaners) housed in a standard pen, 1.5 m (width) × 2.2 m (length) covered with plenty of straw;

Group II (6 weaners) housed in a similar pen covered with plenty of straw with a hanging wooden ball, fixed to the ceiling;

Group III (6 weaners) housed in a similar pen covered with plenty of straw with a free toy (plastic ball) placed in the centre of the pen floor.

The pigs were fed ad libitum and were weighed at weaning and again at the begin-ning of the second observation period (after three weeks).

Each pig was individually marked using waterproof chalk, which enabled the ini-tiator and recipient of subsequent behaviour to be identified. A 24-hour behavioural

Behavioural response of weaners to balls in the pen 65

profile of both groups was created for the activity phase: agonistic behaviour (fighting and biting), fighting frequency, eating duration, eating frequency, duration of interest in the enriching object; as well as for the resting phase (lying on their side, lying on their belly, and sitting). 24-hour behavioural observations were carried out conti- nuously using two video cameras (Burle) and two time-lapse video recorders (Samsung SVR-24 JP and Panasonic AG 6124). During the night, illuminance did not exceed 40 lx in the pen area because backlights were used, so artificial light had no effect on the behaviour of weaners. The behavioural data obtained were marked on a previously prepared ethogram and statistically analysed using the Kruskall-Wallis test. Additionally, daily gains within 3 weeks were evaluated and analysed statistically us-ing Duncan’s test.

Results

The highest activity level of all the weaners observed was found on the day of mix-ing (Table 1). Weaners housed without an additional object were slightly more active. These weaners and pigs housed in the pen equipped with a free ball spent more time on fighting behaviour than weaners housed in the pen with a hanging wooden ball, but the difference was not significant. However, the average fighting frequency during the first day of observation was significantly higher in weaners housed without a toy in comparison with weaners that had access to a free plastic ball. There were no statisti-cally significant differences in eating time or eating frequency among the three groups of newly mixed weaners on this day, but the highest eating frequency was found in pigs housed in the pen with a free ball. The interest in the toy was also the highest in this group.

On the second observation day (the day after mixing) the activity of all groups of weaners decreased. However, higher activity levels were found in weaners housed with a free ball in comparison with the other groups. A decrease in fighting frequency in comparison with the day of mixing was noted in pigs housed with enriching ob-jects, but not in the pen without these, where fighting behaviour increased slightly. The differences concerning fighting frequency between weaners housed with a free ball and without an additional object were statistically significant. Eating time was not very different from that observed the previous day; however, eating frequency was the highest in pigs housed without an enriching object, which suggests that there were more fights near the feeder in this group and marginal weaners had to eat the food in several bouts. On this day, the hanging wooden ball was more interesting than the free ball but the differences were not significant.

On the third day, a further decrease in activity was found in weaners housed with enriching objects, but activity increased among pigs housed without these objects. The longest duration of fighting behaviour was also found in this group. Statistically significant differences were again found in fighting frequency. It is worth noting that the interest in the hanging toy increased in comparison with the previous days and in the case of the free ball it decreased slightly, which may suggest that there was a factor that made the free ball less attractive to weaners. Eating frequency was the highest in the pen without additional elements. After three weeks a further decrease in activity

J. Nowicki et al.66

was found in all the groups. Fighting frequency as well as duration of fighting behaviour also decreased in comparison with the first observation period. It is of note that the duration of fighting and average fighting frequency were lower in the groups of weaners housed with enriching objects, although this was not confirmed statistically. Interesting also is the relatively high interest in the hanging wooden ball, in compari-son with the free ball, which occurred during the second observation period.

Table 1. Behavioural profile of weaners housed in the pen with a hanging ball, a free ball and without a toy (24 h = 100%) and average daily gains within three weeks

BehaviourSubsequent days of observation (1 = day

of weaning)

Housing pen equipped with a hanging wooden

ball

pen equipped witha free ball pen without a toy

Eating (%) 1 3.06 ± 0.60 3.61 ± 0.71 3.43 ± 0.642 2.63 ± 0.46 3.95 ± 0.62 4.30 ± 0.773 3.13 ± 0.55 3.11 ± 0.53 6.35 ± 0.6421 3.85 ± 0.48 4.08 ± 0.82 6.88 ± 0.46

Eating frequency 1 11.75 ± 2.40 14.40 ± 2.83 13.20 ± 2.942 9.15 ± 2.23 12.15 ± 3.40 14.61 ± 4.153 7.08 a ± 1.82 6.72 b ± 2.94 14.10 ab ± 3.9321 12.56 ± 3,97 14.35 ± 4.03 14.39 ± 4.22

Fighting (%) 1 0.15 ± 0.04 0.28 ± 0.08 0.20 ± 0.072 0.25 ± 0.07 0.18 ± 0.03 0.26 ± 0.083 0.23 ± 0.05 0.15 ± 0.03 0.53 ± 0.0421 0.09 ± 0.01 0.03 ± 0.01 0.07 ± 0.02

Fighting frequency 1 7.12 ± 0.49 5.25 a ± 0.82 7.35 a ± 0.462 5.85 ± 0.72 3.65 a ± 1.59 8.13 a ± 0.943 2.16 a ± 0.78 3.12 b ± 1.32 6.25 ab ± 0.8921 1.20 ± 0.57 1.03 ± 0.38 1.18 ± 0.22

Interest in toy (%) 1 0.31 ± 0.11 0.51 ± 0.082 0.41 ± 0.06 0.28 ± 0.093 0.50 ± 0.13 0.25 ± 0.1621 0.32 ± 0.04 0.10 ± 0.04

Total activity (%) 1 32.05 ± 8.24 31.50 ± 8.36 32.53 ± 7.912 22.80 ± 8.07 24.46 ± 7.25 22.75 ± 6.363 20.05 ± 7.36 22.91 ± 7.29 25.03 ± 8.4521 19.35 ± 6.22 20.21 ± 5.59 21.23 ± 5.44

Total resting (%) 1 67.95 ± 8.24 68.50 ± 8.36 67.47 ± 7.912 77.20 ± 8.07 75.54 ± 7.25 77.25 ± 6.363 79.95 ± 7.36 77.09 ± 7.29 74.97 ± 8.4521 80.65 ± 6.22 79.79 ± 5.59 78.77 ± 5.44

Average daily gains within three weeks (g) 262.00 ± 41.16 283.00 ± 27.84 256.00 ± 28.35

Means in rows marked with the same letters differ statistically significantly (P<0.05).


It was found that apart from during the evening hours, the expression of activity of the weaners was very similar. After a resting phase of varying frequency, the animals drank water and then ate food. Before lying down, every weaner rooted in straw.

There were no statistically significant differences in daily gains between the ob-served groups of weaners; however, higher daily gains were achieved by weaners housed with additional objects.

Discussion

Weaning often combines several stressful events such as a sudden change of diet, a move to a new housing environment, disruption of the mother-young link and mix-ing with unfamiliar piglets (Merlot et al., 2004). Mixing with other animals induces aggressive behaviour, which is necessary for the establishment of a social hierarchy. The most intense aggression occurs during the first 1-2 days and steadily decreases to a very low level by 24-48 h post-grouping (Keeling and Gonyou, 2001). Merlot et al. (2004) report that the high cortisol level in newly mixed piglets decreases within 8 hours, which is evidence that during the first few hours the stress level connected with fights is the highest.

In our own experiment, the presence of enriching objects influenced the behaviour of weaners after mixing. This was especially evident for aggression measured as the average fighting frequency and duration of fighting behaviour. A decrease in aggres-sion levels was found to start from the evening hours on the weaning day and on the second day in groups housed with enriching objects, but not in the pen without them. This may suggest that the social hierarchy was established more quickly in pens with toys, and that the additional objects facilitated adaptation to the new environment. These observations are consistent with the findings of Blackshaw et al. (1997), where both fixed and free toys contributed to a decrease in aggression level. However, these authors suggested that free toys were less attractive than fixed toys because free toys can lay on the pen floor where they could be soiled by faecal material and pigs, which have a well-developed sense of smell, may lose interest in them. This was also visible in our results: the interest in the hanging wooden ball increased within the first three days, while the interest in the free ball gradually decreased. Interest in the toy was observed in the group with the wooden ball after a short aggressive attack performed by an initiator. The presence of the wooden ball probably shortened the duration of the aggressive attack, because the aggression was redirected to the ball. A low frequency of tail and ear biting in an enriched environment was also observed by Van de Weerd (2006), but this author suggested that the presence of straw alone is an efficient way of reducing aggression.

The results of studies by Pearce and Paterson (1993) showed that toys (chains, bars, cloth straps and tyres) used for pigs reared in crowded environments signifi-cantly increased the amount of exploratory behaviour, but did not influence the total activity level. Our own observations showed that the activity level was hardly affected by the housing system, although eating frequency and eating time seemed to be de-pendent on the presence of enriching objects, because the highest eating frequency

J. Nowicki et al.68

was found in pens without these, which may suggest that some of the weaners could not eat without disturbance and had to come to the feeder again when other pigs were resting.

It is concluded that the presence of additional objects that are not easily destruct-ible can affect the behaviour of newly mixed weaners and reduce aggression, although a free ball, at first very attractive because very easy to manipulate, seems to become less interesting to pigs because of faecal soiling. Regular cleaning would probably resolve this problem, although this would be difficult on large farms.

References

B l a c k s h a w J.K., T h o m a s F.J., L e e J.A. (1997). The effect of fixed or free toy on the growth rate and aggressive behaviour of weaned pigs and the influence of hierarchy on initial investigation of the toys. Appl. Anim. Beh. Sci., 53: 203–212.

Commision Directive 2001/93/EC of 9 November 2001 amending Directive 01/63 OEEC laying down minimum standards for the protection of pigs (2001). Official Journal of European Community, 1.12.2001.

D a y J.E.L., S p o o l d e r H.A.M., B u r f o o t A., C h a m b e r l a i n H.L., E d w a r d s S.A. (2002). The separate and interactive effects of handling and environmental enrichment on the behaviour and wel-fare of growing pigs. Appl. Anim. Beh. Sci., 75: 177–192.

K e e l i n g L.J., G o n y o u H.W. (2001). Social Behaviour in Farm Animals. CAB International.L e w i s E., B o y l e L.A., O ’ D o h e r t y J.V., L y n c h P.B., B r o p h y P. (2006). The effect of providing

shredded paper or ropes to piglets in farrowing crates on their behaviour and health and the behaviour and health of their dams. Appl. Anim. Beh. Sci., 96: 1–17.

M e r l o t E., M e u n i e r - S a l a ü n M.C., P r u n i e r A. (2004). Behavioural, endocrine and immune con-sequences of mixing in weaned piglets. Appl. Anim. Beh. Sci., 85: 247–257.

P a r a t t C.A., C h a p m a n K.J., T u r n e r C., J o n e s P.H., M e n d l M.T., M i l l e r B.G. (2006). The fighting behaviour of piglets mixed before and after weaning in the presence or absence of a sow. Appl. Anim. Beh. Sci., 101: 54–67.

P e a r c e G. P., P a t e r s o n A. M. (1993) . The effect of space restriction and provision of toys during rear-ing on the behaviour, productivity and physiology of male pigs. Appl. Anim. Beh. Sci., 36: 11–28.

Rozporządzenie Ministra Rolnictwa i Rozwoju Wsi z dnia 2 września 2003 r. w sprawie minimalnych wa-runków utrzymania poszczególnych gatunków zwierząt gospodarskich. (Dz. U. Nr 167, poz. 1629).

We e r d H.A. v a n d e, D o c k i n g C.M., Day J.E.L., B r e u e r K., E d w a r d s S.A. (2006). Effects of species-relevant environmental enrichment on the behaviour and productivity of finishing pigs. Appl. Anim. Beh. Sci., 99: 230–247.

Accepted for printing 12 IX 2007

JACEK NOWICKI, EMILIA MOSKAŁA, MARCIN KOPyRA

BEHAWIORALNA REAKCJA WYMIESzANYCH PO ODSADzENIU WARCHLAKÓW NA PODWIESZANĄ DREWNIANĄ PIŁKĘ I SWOBODNIE UMIESZCZONĄ PIŁKĘ W KOJCU

STRESZCZENIE

Przeprowadzono 24-godzinne obserwacje zachowania 144 warchlaków w czasie 72 godzin po odsadzeniu i ponownie przez 24 godziny po trzech tygodniach od odsadzenia. Obserwacjami obej-mowano warchlaki pochodzące z 2 miotów, które następnie po wymieszaniu dzielono na 3 grupy: grupa I (6 osobników w powtórzeniu): utrzymanie w kojcu o wymiarach 1,5 m × 2,2 m z dużą ilością ściółki,


grupa II (6 warchlaków w powtórzeniu): utrzymanie w identycznym kojcu wyposażonym w podwieszoną u sufitu drewnianą piłkę, grupa III: taki sam kojec z umieszczoną na podłodze plastikową piłką (6 warchlaków w powtórzeniu). Opracowano całodobowy profil zachowania wszystkich grup warchlaków, biorąc pod uwagę przede wszystkim zachowania agonistyczne oraz zainteresowanie dodatkowymi ele- mentami. Uwzględniono także czas trwania fazy odpoczynku. Nie stwierdzono statystycznie istotnych różnic w całkowitej aktywności pomiędzy obserwowanymi grupami warchlaków, natomiast w gru-pach warchlaków, które miały dostęp do elementów dodatkowych stwierdzono niższą częstotliwość występowania zachowań agresywnych oraz krótszy czas ich trwania. W dniu odsadzenia zainteresowanie warchlaków podwieszoną piłką drewnianą było mniejsze niż piłką umieszczoną na podłodze, aczkolwiek od drugiej doby obserwacji tendencja ta uległa zmianie.

Ann. Anim. Sci., Vol. 8, No. 1 (2008) 71– 80

HEN HOUSINg SYSTEM AND Egg qUALITY AS VIEWEDBY CONSUMERS

Z o f i a S o k o ł o w i c z 1 , J ó z e f a K r a w c z y k 2 , M a g d a l e n a D y k i e l 3

1Department of Biology and Agriculture, Rzeszów University, Ćwiklińskiej 2, 35-601 Rzeszów, Poland2Department of Animal Genetic Resources Conservation, National Research Institute of Animal

Production, 32-083 Balice n. Kraków, Poland3Department of Regional Economy and Farm Tourism, Higher State Vocational School,

Kazimierza Wielkiego 6, 38-400 Krosno, Poland

AbstractThe aim of this study was to determine consumer preferences for egg quality traits, to establish whether consumers consider the hen rearing system at purchase time, and to evaluate consumers’ knowledge of egg-marking code stamped on the shell. The study was carried out in Rzeszów from February to April 2007 by means of the questionnaire method, using 564 questionnaires. It was found that egg buyers were mainly interested in the freshness and price of eggs. They showed less interest in the layer rearing system and the type of egg packaging. The average consumer buys eggs mainly on farms and in small shops. Egg codes are not understood by over 60% of those surveyed. There is an urgent need to educate the public in egg codes and other information provided on egg packing.

Key words: hen eggs, market research, consumer preferences, hen housing systems

The growing competition in the food market is forcing producers to respond to changing consumer expectations. This increases the number of market studies and analyses with regard to consumer needs and preferences, which show that the senses of taste and aroma and sensory memory play an important role in shaping these preferences (Gawęcki, 2000; Wielewska, 2004). Food market studies in the European Un-ion have shown that the most important characteristics for 74% of those surveyed were freshness, quality and price (43%), sensory value (38%), health safety of prod-ucts (32%) and buyer’s habits (29%) (Babicz-Zielińska, 2001).

The majority of market research covers the entire food market. In these analyses, table eggs are of marginal interest despite being a valuable and easily available source of animal protein and many valuable nutrients. Few studies on egg consumer preferences show that freshness and price are the main factors considered at purchase time (Strojny, 1996; Bell et al., 2001). Trziszka et al. (2006), who investigated egg fresh-ness in more than ten US hypermarkets, reported that this trait depends mainly on the

Z. Sokołowicz et al.72

duration of egg storage rather than on egg weight, hen housing system or region of the country.

Polish legislation, harmonized with EU legislation, has ensured the traceability of production, obligating egg producers to mark eggs. The introduction of the egg sorting and packing system in accordance with legal requirements made it necessary to build egg-packing plants, and these investments were supported by pre-accession EU funds. This expensive undertaking will offer a chance for egg producers to market quality products manufactured in different hen housing systems, of which the con-sumer is informed through the marking system found on packaging and eggshells.

The aim of the study was to determine consumer preferences for egg quality traits, to establish whether consumers consider the hen rearing system at purchase time, and to evaluate consumers’ knowledge of egg marking code stamped on the shell.


The study was carried out in Rzeszów from February to April 2007 by means of the questionnaire method. In Rzeszów, eggs are sold by many groceries, more than a dozen markets and 5 supermarkets. Eggs are also sold on 4 large and a dozen small marketplaces. Questions in the questionnaire concerned consumer preferences for ta-ble eggs, with special regard to the place of egg purchase, knowledge of layer housing systems, the role of eggshell marks, and the preferred egg quality traits. Those sur-veyed ranked eight egg quality traits (price, weight, shell colour, yolk colour, fresh-ness, origin, rearing system, and packaging) according to their importance at purchase time on a scale of 1 to 8 (1 – most important at purchase time, 8 – least important at purchase time). In the ranking, more than one trait could be given the same ranking where traits were equally important for the consumer.

The questionnaire was carried out on a group of 600 adults, and 564 questionnaires were qualified for the study and 36 rejected because they lacked some answers or were illegible.

The respondents were divided into 4 age groups: <24 years old (39%), 25–35 years old (23%), 35-55 years old (29%), and >55 years old (8%). In terms of education, 45% respondents had secondary education, 45% had higher education, and 6% had vocational secondary education.

Of the 564 respondents, only 385 gave precise answers on the criteria of table egg selection and only this group was accounted for during analysis of these traits. The results of all 564 questionnaires were considered when processing the responses of all other questions.

Results

The results shown in Table 1 rank the importance of eight egg quality traits (1 = most important, 8 = least important), which are the criterion considered at pur-chase time by the consumers. The most important egg traits shown by the consumers

Hen housing system and egg quality as viewed by consumers 73

were freshness, followed by price, weight, and yolk and shell colour. The least impor-tant traits for the consumers were country of origin (6th place), layer rearing system (7) and egg packaging (8). In the group of respondents aged above 55, yolk colour was more important than egg price and weight, while the respondents were not guided by the country of production or hen rearing system at purchase time. However, they paid more attention to egg freshness compared to the other respondents. Those aged 36–55 were more sensitive to egg price, egg weight and country of origin.

Table 1. Importance of egg quality traits as ranked by consumers

No. Trait Position*1 price 22 egg weight 33 shell colour 54 yolk colour 45 freshness 16 origin (country) 67 rearing system 78 packaging 8

* 1 – most important trait during selection, 8 – least important trait during selection.

The questionnaire showed that over 60% of those surveyed do not understand the eggshell code (55% in the <24 group and as many as 69% in the >55 group) (Figure 1). The eggshell code provides obligatory information on the layer housing system1,*country of origin and the identification number of the production site, as-signed by veterinary authority2. Among those who can identify the hen housing sys-tem, it is unimportant to 49% and important to 51% of the respondents at purchase time (Figure 2). There were no significant differences in this respect among the age groups.

Among the consumers interested in the hen housing system, preference is given to backyard keeping in small peasant farms (approx. 56%), followed by free-range rearing (16.4%), ecological rearing (16.2%), intensive rearing in cages (5.05%) and the litter system (5.75%) (Figure 3). Backyard keeping has more support among older people, and free-range and ecological systems among young people.

The most important factor determining the purchase of eggs from a given rearing system is the consumers’ conviction that such eggs have better taste (48%) (Figure 4). Other determinants are egg price (20%), the conviction about the health-promoting value of eggs from a given rearing system (19%), and the conviction that housing con-ditions in a given system are friendly to hens (12%). 1/3 of the consumers are ready to pay up to 0.06–0.10 zloty more for eggs from the preferred housing system, while 25% of the respondents are inclined to pay >0.15 zloty more per egg, i.e. 50% more in relation to the mean egg price in a given weight class (Figure 5).

1 0 – ecological system, 1 – free-range system, 2 – litter system, 3 – cage system.2 Contains province number, district number and farm number.


Figure 1. Answers to the question: What information on the eggshell marking code can you read?

Figure 2. Answers to the question: When buying eggs, do you take account of the information on the management conditions of the hens that laid the eggs?


Figure 3. Answers to the question: Which hen management system do you prefer when buying eggs? (only the consumers interested in the hen management system during egg purchase, i.e. 51% of those

surveyed, responded)

Figure 4. Factors affecting the choice of the preferred hen management system


Figure 5. Answers to the question: how much would you be inclined to pay for an egg from the preferred hen housing system?

Figure 6. The respondents’ most popular place to buy eggs


Most often the respondents buy eggs directly from producer farms (35%) or at a local shop (32%) (Figure 6). Approx. 18% buy eggs at hypermarkets and 15% at marketplaces. Large differences according to age are observed. Most eggs bought in a direct sale are purchased by older people (>55), who buy them the least often in hypermarkets. Young people most often buy eggs at local shops (37%).

Discussion

The present study showed that egg freshness is the most important egg characteristic for the majority of consumers. The degree of egg freshness can be determined from the expiry date printed on the sales package. The second most important characteristic was the price. Egg consumers and other consumers showed similar preferences in earlier studies (Strojny, 1996; Babicz-Zielińska, 2001; Wielewska, 2004; Trziszka et al., 2006).

In the present study, like in the study of Trziszka et al. (2006), it was shown that egg weight plays a considerable role at purchase time and consumers prefer buying heavy eggs.

A special role in egg buying preferences is played by yolk and shell colour, the im-portance of which in light of the present study declined in comparison with previous years (Strojny, 1996). Although yolk colour cannot be evaluated at purchase time as it requires breaking the egg (sometimes sellers display the yolk of a broken egg), buyers most often rely on the information obtained from the shop assistant. Studies by the National Research Institute of Animal Production suggest that considerable progress has been made with regard to the use of colouring agents in commercial feeds. Today, eggs with a yolk colour rating of <5 points on the Roche scale are not marketed, al-though this was common as recently as 10 years ago. For consumers aware of these changes, yolk colour is of decreasing importance during egg selection.

The Polish market is dominated by brown-shelled eggs, which means that consum-ers can only choose eggshell hue, but the importance of this trait has also declined over the recent years (Strojny, 1996; Trziszka et al., 2006).

Sociodemographic changes have made Poland similar to highly developed Euro-pean countries and created new trends in the nutritional behaviour of Poles. Today’s young consumers suffer from chronic lack of time and most often do shopping in local shops (Kowalczuk and Żelazna, 2002; Kosicka, 2004). In the present study, we observed a relatively large group of people who bought eggs directly from the farm or at a marketplace, whereas Trziszka et al. (2006) showed that the Wrocław market was characterized by a reverse tendency, with an increased importance of shopping in hypermarkets. This type of consumer behaviour may vary according to the region of Poland. By way of example, the Podkarpackie province is characterized by a large number of small farms, which most often sell eggs at a marketplace or directly to consumers.

The expensive requirement of egg packing and shell marking was introduced on the market in 2005. The Introduction to the Council Regulation3�lays down that the

3 Council Regulation (EC) No 5/2001.


method by which hens are farmed is one of the major factors for consumers when purchasing eggs and that appropriate compulsory labelling of eggshells and packs, introduced at the request of consumer organizations, will ensure that the consumer is able to make an informed choice in this regard. The present findings and the results of Trziszka et al. (2006) have confirmed that Poles have little knowledge of the informa-tion placed on eggshells and egg packs. Consumers’ knowledge of the effect of hen housing system on egg quality results from their convictions or from the information obtained from other consumers.

Consumers would be most willing to buy eggs from backyard hens in small peasant farms or organic farms. These results are consistent with the findings of Fleszar and Sta-siak (2006), who reported that eggs and vegetables are the most popular buys in organic food shops. The prices of organic products are the greatest barrier to the development of this production method. Eggs in Poland are relatively cheap compared to other animal products. Because of this, even when their price increases 2-fold or 3-fold compared to eggs from intensive production, this limits demand to a lesser extent than for meat.

The study has shown that over 25% of those surveyed are inclined to pay 0.15 zloty more for an egg from the preferred production system and the price of eggs from backyard hens is higher by this amount compared to the price of eggs from inten-sive production in the same weight category. Ecological farming of hens is expensive mainly because of the technological regime and the need to obtain a certificate. This increases egg price by about 0.30 to 0.50 zloty compared to the price of eggs from intensive production, thus becoming a strong demand barrier.

The choice of eggs from a given farming system is determined above all by the re-spondent’s conviction that eggs from this system are tastier (51.95%) and have health-promoting effects. These results are in agreement with the results of studies conducted in the European Union, which show that in addition to freshness, quality and price, the most important factors driving food choice are sensory characteristics, health safety and habits (Babicz-Zielińska, 2000). The fact that buying eggs directly from farms is more popular than buying them from health food shops is likely determined by the price of eggs. This concerns the group of respondents whose buying decisions were motivated by the health-promoting value and sensory evaluation on the one hand, and the deep-rooted conviction that eggs from backyard hens have these advantages in addition to moderate price on the other.

In conclusion, egg buyers are mostly interested in egg freshness and price. The study revealed a certain contradiction in the information provided by the respondents, which shows that the origin of eggs is not important for buyers, while many of them show a great interest in eggs from backyard or ecological farms, and eggs are bought at marketplaces or on farms. This means that consumers are averse to buying eggs of unknown origin, but obtain this information through direct contact with sellers. This results from the lack of the respondents’ interest in the inscriptions placed on packages, and most of them are unable to read the information conveyed by the code stamped on the eggshell. One opportunity for the development of ecological hen farming methods is the fact that almost half of the respondents, convinced about the taste and health-promoting value of eggs from these production systems, are inclined to pay a higher price for them. However, these were only declarations on their part, because there are


no actual data in this respect, and observations have shown that there is little interest in the eggs sold by health food shops, which means that the demand is moderate.

There is an urgent need to educate people in the meaning of eggshell codes and other important information placed on egg packs, because the currently low level of public knowledge of this subject means that inputs incurred on the organization of egg packing plants are wasted, and producers of eggs from different farming systems are deprived of the low-cost and appropriate promotion of their eggs. Following the European example, consumers should be educated by both consumer organizations and egg producer groups. The data from the Central Statistical Office in Poland shows that food accounts for 47.7% of expenses in the group of lowest-income households and only 26.3% in highest-income households and concern the costs of buying ex-pensive foods having special dietetic and taste value. It is concluded from these data and the present findings that the increased standard of living will be paralleled by the increasing demand on hen eggs from extensive farming systems. At present, however, it is more profitable to sell to the former EU market, where the level of public educa-tion is higher and where Polish food enjoys a good reputation. Extensive hen farming systems are seriously threatened with the H5N1 virus and there is much evidence to suggest that in the near future extensive farming will not be a viable alternative for conventional production, and this will only extend the choice for consumers.

References

B a b i c z - Z i e l i ń s k a E. (2000). Czynniki wpływające na wybór żywności. Konsument żywności i jego zachowania rynkowe. Ogólnopol. konf. nauk., 12–13.10.2000, Warszawa, ss. 245–253.

B a b i c z - Z i e l i ń s k a E. (2001). Zachowanie konsumenta w stosunku do żywności i żywienia. Żywność. Nauka. Technologia. Jakość, Supl., 4 (29): 5–13.

B e l l D.D., P a t t e r s o n P.H., K o e l b e c k K.W., A n d e r s o n K.E., D a r r e M.J., C a r e y J.B., K u n e y D.R., Z e i d l e r G. (2001). Egg marketing in National Supermarkets: Egg quality. Poultry Sci., 80: 383–389.

F l e s z a r J., S t a s i a k J. (2006). Factors and consumers motivations when ecological food shopping on Koszalin market. J. Res. Appl. Agric. Eng., 51 (2): 36–41

G a w ę c k i J. (2000). Wybrane fizjologiczne uwarunkowania zachowań konsumentów żywności, Kon-sument żywności i jego zachowania rynkowe. Ogólnopol. konf. nauk., 12–13.10.2000, Warszawa, ss. 300–306.

K o s i c k a M. (2004). Konsument wobec konieczności podejmowania decyzji dotyczących zakupu produktów żywnościowych. Rocz. Nauk. SERiA, 6, 2: 138–144.

K o w a l c z u k L. Ż e l a z n a K. (2002). Uwarunkowania zachowań nabywczych polskich konsumentów - wyniki badań. Acta Scient. Pol. Oecon., 1–2: 85–92.

S t r o j n y J. (1996). Wieloatrybutowa analiza preferencji konsumentów jaj. Zesz. Nauk. AR Kraków. Ekonomika, 24: 77–88.

T r z i s z k a T., N o w a k M., K a ź m i e r s k a M. (2006). Preferencje konsumentów jaj na rynku wrocławskim. Żywność. Nauka. Technologia. Jakość, 3 (48): 107–117.

W i e l e w s k a I. (2004). Wymagania jakościowe konsumentów żywności w świetle badań. Rocz. Nauk. SERiA, 6, 2: 330–334.



ZOFIA SOKOŁOWICZ, JóZEFA KRAWCZyK, MAGDALENA DyKIEL

System utrzymania kur a jakość jaj w opinii konsumentów

STRESZCZENIE

Celem przeprowadzonych badań było określenie preferencji konsumentów w zakresie cech jakości jaj, stwierdzenie, czy konsumenci przy zakupie jaj uwzględniają system chowu kur oraz ocena znajomości przez konsumentów kodu oznakowania jaj drukowanego na skorupie.

Badania prowadzono na terenie Rzeszowa w okresie od lutego do kwietnia 2007 r. metodą ankietową, z wykorzystaniem 564 kwestionariuszy.

Stwierdzono, że nabywcy jaj zainteresowani są głównie ich świeżością i ceną. Mniejsze zaintereso-wanie wykazywali systemem chowu niosek i rodzajem opakowania jaj. Przeciętny konsument zaopatruje się w jaja głównie w gospodarstwach, fermach oraz w małych sklepach. Ponad 60% respondentów nie rozumie oznaczenia na skorupie jaj. Istnieje pilna potrzeba edukacji społeczeństwa w zakresie znajomości oznaczeń kodów na skorupie oraz innych informacji umieszczonych na opakowaniach jednostkowych jaj.

EFFECT OF WATER DEPRIVATION ON BROILER CHICKENPRODUCTIVITY**

I w o n a S k o m o r u c h a , E u g e n i u s z H e r b u t , E w a S o s n ó w k a - C z a j k a

Department of Technology, Ecology and Economics of Animal Production, National Research Institute of Animal Production, 32-083 Balice n. Kraków, Poland

AbstractThe aim of the experiment was to determine the effect of water deprivation (16 h/day) on the pro-ductivity of broiler chickens, litter moisture, manure moisture, and ammonia concentration in the air. Day-old Hubbard chicks were assigned to two groups. In group I (control), birds had free access to water throughout the experiment; in group II (experimental), starting from 21 days of rearing, birds were subjected to daily water deprivation at 0900–1200 h (3 h), 1400–1700 h (3 h) and 2000–0600 h (10 h). During the experiment, the individual body weight of the chickens, feed intake, water intake and mortality were recorded. On the final day of rearing, 20 chickens from each group were sub-jected to simplified slaughter analysis. At 21, 28, 35 and 42 days of rearing, NH3 air concentrations were measured inside the poultry facility and samples were taken to determine litter moisture and dry matter content of excrements. Limiting the access to water for 16 h/day from 21 days of rearing had a negative effect on the final body weights of chickens in the experimental group but had no effect on feed and water conversion or results of slaughter analysis. The experimental chickens were characterized by lower mortality compared to the control group. In the present study, the experimental factor had no significant effect on improved indoor climate by lowering ammonia concentration in the air.

Key words: broiler chickens, access to water, productivity, litter, ammonia

The high productivity of birds is conditional on meeting their drinking water re-quirements. Water plays a crucial role in all living processes and forms 50-70% of the birds’ total body weight. According to Chołocińska et al. (1997), daily amount of drinking water supplied to the broiler house should range from 0.3 to 0.5 l per bird. Water requirement results from bird age, body weight, sex, health, feed intake and composition, as well as drinker type and technical condition (Chołocińska et al., 1997; Miller et al., 1988; Bessei et al., 1999).

* Approval of the Animal Ethic Committee in Kraków, no. 344.This study was financed from the NRIAP statutory activity project, no. 4127.1.


I. Skoromucha et al.82

Under appropriate climatic conditions, increased water intake by birds is undesira-ble because it involves excessive respiratory evaporation and fecal and urinary excre-tion of water (Bennett and Leeson, 1989). Excessive moisture in livestock buildings negatively affects litter quality and indoor climate, in particular through increased ammonia concentration in the air (Chołocińska et al., 1997; Bessei et al., 1999; Sos-nówka-Czajka et al., 2004). Many authors report that the increased ammonia con-centration in livestock buildings is detrimental to the body’s physiological processes and thus negatively affects productive results and the quality of poultry products ob-tained (Emeash et al., 1998; Kristensen and Wathes, 2000; Al-Homidan et al., 2003). Johnson et al. (1991) reports that the increased NH3 concentration in the air reduces weight gains and increases feed intake per kg of body weight.

According to Chołocińska (1988), appropriate amounts of water can be supplied to regulate not only the basic living processes of birds but also their productivity.

The aim of the experiment was to determine the effect of water deprivation (16 h/day) in the second period of rearing on the productivity of broiler chickens, litter moisture, manure moisture, and ammonia concentration in the air.


The experiment was carried out at the Rossocha Experimental Station Ltd. of the National Research Institute of Animal Production during autumn. A total of 8000 day-old Hubbard chicks were assigned to 2 groups. Each group had 20 subgroups (repli-cates) with a stocking density of 15 birds/m2.

In group I (control), birds had free access to drinking water throughout the ex-periment; in group II (experimental), starting from 21 days of rearing, birds were subjected to daily water deprivation at 0900–1200 h (3 h), 1400–1700 h (3 h) and 2000–0600 h (10 h). Chickens were reared on litter to 42 days of age and fed standard diets on an ad libitum basis.

During the experiment, the individual body weight of the chickens, feed intake, water intake and mortality were recorded at weekly intervals. At 21, 28, 35 and 42 days of rearing, NH3 air concentrations were measured using Dräger tubes at 4 sites in every room, 30 cm above the litter. Litter and excrement samples were also taken to determine litter moisture and dry matter content of the excrements. Litter and excrement samples were taken at 4 sites in every room. On the final day of rearing, 20 chickens with close to average body weight were selected from each group. After slaughter and chilling, they were subjected to simplified slaughter analysis. The analy-sis included carcass weight with giblets before chilling, carcass weight with giblets and without giblets after chilling, weight of giblets, breast muscles and leg muscles, weight of abdominal fat in relation to carcass weight with giblets, and carcass dressing percentage with and without giblets.

The results were analysed statistically by means of one-way analysis of variance using Statgraphics Plus 6.0.

Water deprivation and broiler chicken productivity 83

Results

The body weight of broilers was similar in both groups to 28 days of rearing (Table 1). At 35 and 42 days into the experiment, broiler chickens from group I showed significantly higher body weights compared to those from the experimental group (27.57 vs. 107.1 g). There were no significant differences in feed or water conversion per kg weight gain (Table 2), or in the results of slaughter analysis (Table 4). Morta- lity was found to be 0.66% lower in the experimental group compared to the control group (Table 3).

Table 1. Body weight of broiler chickens (g)

Day of rearingGroup

1 27 140.23 ± 0.33 139.95 ± 0.2514 349.53 ± 0.92 349.63 ± 0.8621 627.80 ± 2.85 625.05 ± 2.3228 1042.33 ± 3.05 1038.03 ± 2.6635 1556.00 ± 3.32 A 1528.43 ± 2.52 B42 2096.07 ± 10.05 A 1988.97 ± 5.88 B

A, B – values in rows with different letters differ highly significantly (P>0.01).

Table 2. Feed and water conversion per kg weight gain of broiler chickens from 1 to 42 days of rearing

ItemGroup

1 2Feed intake (kg) 1.91 ± 0.01 1.93 ± 0.01Water intake (l) 2.50 ± 0.01 2.48 ± 0.01

Table 3. Mortality of broiler chickens (%)

Days of rearingGroup

1 2 1 – 21 1.83 ± 0.21 1.67 ± 0.4222 – 42 1.52 ± 0.26 1.01 ± 0.29 1 – 42 3.33 ± 0.17 2.67 ± 0.31

The concentration of ammonia in the air at 21 days of rearing was 0.84 ppm lower in the control group (Table 5). At 28 and 35 days of rearing, lower ammo-nia concentration in the air was characteristic of the experimental group (P>0.05). At 42 days of rearing, the concentration of ammonia was at the same level in both groups. Statistically significant differences in the dry matter content of manure were only found on day 21 of the experiment, with no differences observed between the groups in the other weeks (Table 5). No significant differences were found in litter moisture


(Table 5). However, compared to the control group, litter moisture in the experimental group was 2.73% lower on day 28, 3.63% lower on day 35, and 3.84% lower on day 42 of rearing.

Table 4. Results of slaughter analysis in 42-day-old broiler chickens

Item(%)

Group

I IIDressing percentage:

with gibletswithout giblets

70.36 ± 0.4466.93 ± 0.47

69.87 ± 0.4166.39 ± 0.42

Muscles:breastleg

21.68 ± 0.2618.86 ± 0.39

21.43 ± 0.3418.99 ± 0.30

Leg bones 5.80 ± 0.14 5.73 ± 0.16Abdominal fat 2.48 ± 0.13 2.48 ± 0.11Giblets 4.88 ± 0.15 4.76 ± 0.13

Table 5. Determinations of ammonia concentration in the air, dry matter content of excrements and litter moisture

Item Day of rearing Group1 2

Ammonia concentrationin the air (ppm)

21 2.83 ± 0.17 3.67 ± 0.3328 7.33 ± 1.30 5.00 ± 0.6235 9.33 ± 2.33 6.67 ± 1.6742 15.00 ± 0.00 15.00 ± 0.00

Dry matter content of excrements (%)

21 23.20 ± 0.35 a 20.07 ± 0.47 b28 21.93 ± 0.85 22.07 ± 0.3735 22.63 ± 0.58 23.27 ± 0.2442 23.53 ± 0.66 24.33 ± 0.24

Litter moisture (%) 21 45.70 ± 0.78 47.33 ± 0.5028 46.70 ± 1.01 43.97 ± 0.9935 47.23 ± 1.10 43.60 ± 0.6942 46.67 ± 0.96 42.83 ± 0.62

a, b – values in rows with different letters differ significantly (P>0.05).

Discussion

Restriction of water intake has a positive effect on the productivity of birds (Bessei et al., 1999). The exposure of broiler chickens aged 1-3 weeks to 12-, 18- and 24-hour water deprivation had no negative effect on their productivity (Chołocińska, 1988). Similar findings were reported by Gerry (1980), who exposed 3-week-old chickens fed on an ad libitum basis to water deprivation (30, 15, 10 and 5 minutes per hour).


Likewise, Bennett and Leeson (1989) and Chamblee et al. (1989) reported no effect of water deprivation on the final body weights of broiler chickens. However, in the present study the use of water deprivation from 21 days of rearing had a highly signifi-cant effect on lowering the final body weight of the birds. Ross (1960) reported that both body weight and feed intake decreased in birds having 30-minute daily access to water throughout 6 weeks of rearing.

Literate data show that there is a close relationship between the amount of water intake and feed consumption (Chołocińska, 1988; Miller et al., 1988; Ross et al., 1981). In the present study, there were no statistically significant differences in feed and water conversion per kg weight gain. No significant effect of water deprivation on feed conversion by birds was also reported by Chołocińska (1988) and Miller et al. (1988). Meanwhile, Watkins and Novilla (1994) reported that feed and water restric-tion had a highly significant effect on lowering feed intake, weight gains and feed conversion by birds, although the experimental factor had no effect on birds’ health, which has not been confirmed by the present study.

Skomorucha et al. (2006) report that restricted access of broiler chickens to water has a negative effect on meat quality. In the present study, there were no significant differences between the groups in dressing percentages for both the carcass with gib-lets and without giblets. Likewise, carcass muscle percentage and the other param-eters of slaughter analysis were similar in both groups.

Deterioration of environmental conditions in a broiler house involves increased litter moisture and increased ammonia concentration in the air (Sosnówka-Czajka et al., 2004). Chołocińska (1987) reports that litter moisture exceeding 33% has a det-rimental effect on indoor climate and thus reduces productivity. Bessei et al. (1999) showed that restriction of water by rationing or limiting the time of water availability to birds improved manure consistency. According to Herbut (1997), the rapid drying of excreta can help to obtain a considerable reduction in ammonia emission from poultry litter.

In the present study, limiting water access for 16 h/day from 21 days of rearing did not decrease ammonia concentration in the air. However, there was a tendency towards lower ammonia concentration at 28 and 35 days in the experimental group, which was probably connected with a slightly higher dry matter content of manure and lower litter moisture in the last three weeks of rearing (Sosnówka-Czajka et al., 2004).

It is concluded that limiting the access to water for 16 h/day from 21 days of rear-ing had a negative effect on the final body weights of chickens in the experimental group but had no effect on feed and water conversion or on the results of slaughter analysis. The experimental chickens were characterized by lower mortality, which could have been affected by slightly lower litter moisture and lower ammonia concen-tration in the air, especially at 4 and 5 weeks of rearing.

In the present study, the experimental factor had no significant effect on improved indoor climate by lowering ammonia concentration in the air.


References

A l - H o m i d a n A., R o b e r t s o n J.F., P e t c h e y A.M. (2003). Review of the effect of ammonia and dust concentrations on broiler performance. World’s Poultry Sci. J., 59: 340–349.

B e n n e t t C.D., L e e s o n S. (1989). Water usage of broiler breeders. Poultry Sci., 68: 617–621.B e s s e i W., R e i t e r K., F e i l e H. (1999). Zur Variation der Wasseraufnahme in zwei verschiedenen

Legehennenlinien. Arch. Geflügelk., 63, 3: 115–121.C h a m b l e e T.N., M o r g a n G.W., S c h u l t z C.D. (1989). Effect of refeeding following short-term de-

privation of feed or water, or both, on selected physiological parameters for broiler chickens. Poultry Sci., 68: 1619–1623.

C h o ł o c i ń s k a A. (1988). Wpływ przerw w dostępie do wody i paszy na wyniki tuczu kurcząt broj- lerów. Rocz. Nauk. Zoot., 15, 2: 145–154.

C h o ł o c i ń s k a A., W ę ż y k S., Wa w r z y ń s k i M. (1997). Wodooszczędne systemy w utrzymaniu kurcząt brojlerów. Rocz. Nauk. Zoot., 24, 2: 171–179.

E m e a s h H.H., A l i M.M., E l - B a b l y M.A. (1998). Effects of some pollutants as stressors on some behavioural patterns and performance of broiler chickens. Poultry Abstracts, 24, p. 58.

G e r r y R.W. (1980). Effect of the restriction of time of water availability on the performance of cage reared broilers. Poultry Sci., 59, p. 211.

H e r b u t E. (1997). Problemy ekologiczne w produkcji drobiarskiej. Mat. Konf.: Problemy higieny w ekologizacji rolnictwa. Warszawa, 11–12.06.1997, ss. 118–123.

J o h n s o n R.W., C u r t i s S.E., S h a n k s R.D. (1991). Effect on chick performance of ammonia and heat stressors in various combination sequences. Poultry Sci., 70, 5: 1132–1137.

K r i s t e n s e n H.H., Wa t h e s C.M. (2000). Ammonia and poultry welfare: a review. World’s Poultry Sci. J., 56: 235–245.

M i l l e r L., M o r g a n G.W., D e a t o n J.W. (1988). Cyclic watering of broiler cockerels. Poultry Sci., 67, 3: 378–383.

R o s s E. (1960). The effect of water restriction on chicks fed different levels of molasses. Poultry Sci., 39: 999–1002.

R o s s P.A., H u r n i k J.F., M o r r i s o n W.D. (1981). Effect of controlled drinking time on feeding beha- vior and growth of young broiler breeder females. Poultry Sci., 60: 2176–2181.

S k o m o r u c h a I., H e r b u t E., S o s n ó w k a - C z a j k a E. (2006). Effect of restricted access to water on meat quality of broiler chickens. Anim. Sci., Suppl., 1: 68–69.

S o s n ó w k a -C z a j k a E., S k o m o r u c h a I., H e r b u t E. (2004). Broiler chicken performance as related to stocking density and drinker type. Scientific Messenger of Lviv National Academy of Veteri-nary Medicine, 6, 2: 216–219.

Wa t k i n s K.L., N o v i l l a M.N. (1994). Feed gorging and extended water restriction do not produce knockdown in male turkeys fed monensin. Poultry Sci., 73: 587–590.

Accepted for printing 21 IX 2007

IWONA SKOMORUCHA, EUGENIUSZ HERBUT, EWA SOSNÓWKA-CZAJKA

Wpływ przerw w dostępie do wody pitnej na produkcyjność kurcząt brojlerów

STRESZCZENIE

Celem doświadczenia było określenie wpływu przerw w dostępie do wody pitnej, łącznie przez 16 h/dobę, na wyniki produkcyjne kurcząt brojlerów, wilgotność ściółki, pomiotu oraz zawartość amoni-aku w powietrzu.

Materiał doświadczalny stanowiły jednodniowe pisklęta Hubbard, które przydzielono do dwóch grup: I – kontrolnej – ptaki miały nieograniczony dostęp do wody pitnej przez cały okres doświadczenia;


II – doświadczalnej – od 21. dnia odchowu wprowadzono ptakom codzienne przerwy w dostępie do wody pitnej w godzinach: 9–1200 (3 h), 14–1700 (3 h) oraz 20–600 (10 h).

Podczas doświadczenia kontrolowano indywidualną masę ciała ptaków, zużycie paszy, wody oraz upadki. W ostatnim dniu odchowu wykonano uproszczoną analizę rzeźną na 20 kurczętach z każdej grupy. W 21., 28., 35. i 42. dniu odchowu wykonano pomiary stężenia NH3 w powietrzu pomieszczeń, a także pobrano próbki w celu określenia wilgotności ściółki oraz zawartości suchej masy w odchodach.

Ograniczenie czasu dostępu do wody pitnej przez 16 h/dobę od 21. dnia odchowu wpłynęło ujemnie na końcowe masy ciała kurcząt w grupie doświadczalnej, nie miało natomiast wpływu na zużycie paszy i wody na 1 kg przyrostu masy ciała ptaków oraz na wyniki analizy rzeźnej. Kurczęta doświadczalne charakteryzowały się natomiast mniejszą ilością kurcząt padłych w porównaniu do grupy kontrolnej. W badaniach własnych czynnik doświadczalny nie wpłynął w sposób istotny na poprawę mikroklimatu poprzez obniżenie poziomu amoniaku w powietrzu.


COMPARISON OF INTERNAL PARASITE INVASIONS IN SHEEP ON ECOLOgICAL AND CONVENTIONAL FARMS

B o g u m i ł a P i l a r c z y k 1 , A l e k s a n d r a B a l i c k a - R a m i s z 1 , A l o j z y R a m i s z 1 , B a r b a r a B i n e r o w s k a 2

1Department of Animal Biotechnology and Breeding, Agricultural University, Doktora Judyma 6, 71-466 Szczecin, Poland

2Polish Association of Beef Cattle Breeders and Producers, Doktora Judyma 10,71-466 Szczecin, Poland

AbstractCoproscopic examinations were performed on 62 sheep from 3 ecological farms and 85 sheep from 2 conventional farms. The mean prevalence of infestation with internal parasites was 79.03% in sheep from ecological farms and 42.35% in sheep from conventional farms. The mean prevalence of infestation with eimeria protozoa in sheep from ecological farms was almost double that of sheep from conventional farms (67.74% vs. 35.29%). Similar differences were found for other species (e. faurei, e. arloingi, e. pallida, e. intricata and e. parva). e. granulosa were additionally isolated from faecal samples of animals from conventional farms. The mean prevalence of sheep infestation with gastrointestinal nematodes was 30.59% on conventional farms and as much as 79.03% on ecological farms. In the sheep examined on conventional farms, four species of internal nematodes were identified: trichostrongylus spp. (17.65%), Haemonchus contortus (8.25%), Nematodirus spp. (5.88%) and oesophagostomum spp. (1.18%). In sheep from ecological farms, six species of internal nematodes were identified: trichostrongylus spp. (19.35%), Nematodirus spp. (16.13%), oesophagos-tomum spp. (6.45%), cooperia spp. (6.45%), Haemonchus contortus (4.84%) and chabertia ovina (4.84%). Liver fluke and Moniezia sp. tapeworms were also detected on both conventional and eco-logical farms.

Key words: sheep, parasites, ecological farms, conventional farms

Recent food crises (BSE, dioxins) have increased consumer interest in organic food. More and more ecological farms have been established in recent years in Po-land and throughout the world. Ecological production has become an alternative for small and medium farms. Ecological methods are considered to be environmentally friendly and organic breeding of animals is regarded as more favourable for animal welfare and consumers. In the ecological management system, sheep are particularly vulnerable to parasites because of the husbandry method and the ban on the use of an-tiparasitic drugs. It is believed that the intensification of livestock production and the associated large concentration of animals favour the occurrence and spread of various diseases, including invasive diseases.

B. Pilarczyk et al.90

Parasitoses continue to be one of the most common diseases of ruminants and cause considerable losses resulting mainly from poorer body condition, productiv-ity and immunity of animals. Although parasitic invasions in sheep are most often symptomless and thus escape breeders’ notice, they cause considerable economic losses. The most common parasitic invasions in sheep include gastrointestinal nema-todes, coccidia, cryptosporidia, tapeworms and liver fluke (Górski et al., 2004; Gaca-Łagodzińska, 1991; Waghorn et al., 2006; Hertzberg and Kohler, 2006).

The aim of the study was to compare the parasitofauna of sheep from ecological and conventional farms, on which animals are dewormed.


Coproscopic examinations were performed in sheep from 3 ecological farms and 2 conventional farms located in Western Pomerania. A total of 62 sheep from ecological farms (Pomeranian sheep – 20 ewes and 14 ewe lambs; Wrzosówka – 14 ewes and 14 ewe lambs) and 85 sheep from conventional farms (Texel – 17 ewes and 9 ewe lambs; Polish Merino – 31 ewes and 28 ewe lambs) were investigated. The ex-aminations were performed during the grazing season in August. Stocking density on the ecological farm did not exceed 2 LU (livestock units) per ha. Sheep were reared extensively in conditions that met their welfare requirements. Animals on these farms were fed farm-produced feeds. Summer feeding was based on pasture divided into paddocks, which were rotated every 6-7 days. The animals were kept indoors in the winter and on the pasture with offspring in the summer. Animals on the farm were not subjected to anthelmintic treatment. On conventional farms, sheep were reared semi-intensively. Feeding in the summer period was based on rotational grazing of grasslands and animals were dewormed twice a year.

The prevalence of infestation with gastrointestinal nematodes and Eimeria pro-tozoa was determined based on coproscopical examinations using Willis-Schlaaf’s flotation method (Ziomko and Cencek, 1995). The species composition of coccidia was determined using Pellerdi’s system (1974). The study was complemented with an oocyst culture performed in a moist chamber at 24–26°C. A 2.5% water extract of potassium dichromate (K2Cr2O7) was used as an antimoulding agent. The species of gastrointestinal nematodes were determined based on the larval culture of gastrointes-tinal nematodes from isolated eggs according to Gundłach and Sadzikowski (2001). Liver fluke eggs were detected using the decantation method (Ziomko and Cencek, 1995).

Results

The mean prevalence of infestation with internal parasites was 79.03% in 62 sheep from ecological farms and 42.35% in 85 sheep from conventional farms.

Coproscopic examinations showed that animals were infected with mixed coc-cidia. The mean prevalence of Eimeria infection was 67.74% in sheep from ecologi-

Comparison of internal parasite invasions in sheep 91

cal farms and 35.29% in sheep from conventional farms. Five species of coccidia were isolated from faecal samples taken on ecological farms: E. faurei, E. arloingi, E. pallida, E. intricata and E. parva (Table 1). On conventional farms, six coccidia spe-cies were isolated from faecal samples: E. faurei, E. arloingi, E. pallida, E. intricata, E. parva and E. granulosa (Table 1).

Table 1. Species composition of coccidia in the examined sheep

FarmCoccidia species - E.I. (%)

E. parva E. faurei E. intricata E. arloingi E. pallida E. granulosaConventionalEcological

42.3564.52

18.8256.45

10.5924.19

16.479.68

10.599.68

11.760

The study shows that the mean prevalence of sheep infestation with gastrointes-tinal parasites was 30.59% on conventional farms and 79.03% on ecological farms (Figure 1).

Figure 1. Prevalence of internal parasites in sheep, % of infected

In sheep from conventional farms, four internal nematode species were found: Trichostrongylus spp. (17.65%), Haemonchus contortus (8.25%), Nematodirus spp. (5.88%) and Oesophagostomum spp. (1.18%). In sheep from ecological farms, six species of internal nematodes were identified: Trichostrongylus spp. (19.35%), Nema- todirus spp. (16.13%), Oesophagostomum spp. (6.45%), Cooperia spp. (6.45%), Haemonchus contortus (4.84%) and Chabertia ovina (4.84%).

Fasciola hepatica liver fluke and Moniezia sp. tapeworms were also detected in sheep on both conventional and ecological farms.

B. Pilarczyk et al.92

Discussion

Epizootiological investigations carried out in Poland and abroad have shown that gastrointestinal nematodes play a considerable role in sheep production from the economic point of view (Waghorn et al., 2006; Hertzberg and Kohler, 2006). In the available parasitological literature, there are no studies concerning the occurrence of internal parasites in sheep reared in the ecological system.

In Poland, the prevalence of sheep infestation with gastrointestinal nematodes reaches 86% (Nowosad et al., 2000). In the present study, the prevalence of sheep infestation on ecological farms was almost double that on conventional farms.

Górski et al. (2004) reported that in Poland, the prevalence of sheep infestation with Fasciola hepatica was 10.9% and the infestation with Moniezia sp. tapeworms was 7%. In adult sheep, the same authors detected 10 species of gastrointestinal nema-todes. In the examined animals, Trichostrongylus spp. were the most common species (21.5%) and Oesophagostomum spp. were the least common species (0.1%). In our study, Trichostrongylus spp. was also the most common parasite found on both types of farm.

Epe et al. (2004) reported that the mean prevalence of sheep infestation was 43.1% for Eimeria protozoa, 6.7% for Strongyloides sp., 11.1% for Nematodirus spp., 9.5% for Moniezia sp., 7.8% for Trichuris spp., and 1.7% for Fasciola hepatica.

Among many parasite species found in sheep, coccidia play a special role due to their wide distribution regardless of climatic conditions. The species composition of coccidia depends mainly on the local environmental and breeding conditions.

Coccidia are intracellular parasites of epithelium in the alimentary tract, mainly the small intestine. In Poland, the prevalence of infestation with Eimeria protozoa ranges from 28.8% to 87.3% (Balicka-Ramisz, 1996; Gaca-Łagodzińska, 1991; Gór-ski et al., 2004). The most common of these include E. arloingi, E. faurei, E. intricata, E. pallida and E. parva (Balicka-Ramisz, 1996; Gaca-Łagodzińska, 1991). The main infestation sites include pastures, badly managed sheep houses, and standing waters used for watering. Lambs can be infected from older animals that are symptomless carriers of coccidia and shedders of oocytes.

In Slovakia, Vasilkova et al. (2004) found traditionally reared sheep to contain five species of Eimeria protozoa: E. parva (42% in lambs, 37% in adult sheep), E. ovinoidalis (33% and 29%), E. crandallis (14% and 19%), E. bakuensis (6% and 6%), and E. faurei (3% and 4%, respectively). The mean annual prevalence of coc-cidia invasion on conventional farms was similar to the findings of other authors, but was much higher on ecological farms.

In conclusion, parasitic diseases were more common in sheep from ecological farms than from conventional farms. Therefore, appropriate preventive measures should be developed and implemented for animals from ecological flocks.

References

B a l i c k a - R a m i s z A. (1996). Wpływ selenu i kokcydiostatyków na przebieg inwazji pierwotniaków z rodzaju Eimeria u owiec. Rozprawa nr 173. AR Szczecin.

Comparison of internal parasite invasions in sheep 93

E p e C., C o a t i N., S c h n i e d e r T. (2004). Ergebnisse parasitologischer Kotuntersuchungen von Pfer-den, Wiederkäuern, Schweinen, Hunden, Katzen, Igeln und Kaninchen in den Jahren 1998–2002. Dt. Tierarzt. Wochenschrift, 6: 243–247.

G a c a - Ł a g o d z i ń s k a K. (1991). Przebieg inwazji Eimeria spp. w cyklu rocznym u owiec-matek i ich jagniąt. Praca doktorska. ART, Olsztyn.

G ó r s k i P., N i ż n i k o w s k i R., S t r z e l e c E., P o p i e l a r c z y k D., G a j e w s k a A., W ę d r y c h o w i c z H. (2004). Prevalence of protozoan and helminth internal parasite infections in goat and sheep flocks in Poland. Arch. Tierz., Dummerstorf, 47, Special Issue, pp. 43–49.

G u n d ł a c h J., S a d z i k o w s k i A. (2001). Diagnostyka i zwalczanie inwazji pasożytów u zwierząt. Wyd. AR Lublin.

H e r t z b e r g H., K o h l e r L. (2006). Prevalence and significance of gastrointestinal helminths and pro-tozoa in South American Camelids in Switzerland. Berl. Műnchen. Tierarztl. Wochenschrift., 119 (7–8): 291–294.

N o w o s a d B., M a l c z e w s k i A., S k a l s k a M., F u d a l e w i c z - N i e m c z y k W., G a w o r J. (2000). The influence of different management systems on the infection level of some gastrointestinal para-sites in sheep in southern Poland. Wiad. Parazytol., 46 (2): 245–264.

P e l l e r d y L.P. (1974). Coccidia and Coccidiosis. Akademiai Kiodo, Budapest.Va s i l k o v a Z., K r u p i c e r I., L e g a t h J., K o v a l k o v i č o v a N., P e t ’ k o B. (2004). Coccidiosis

of small ruminants in various regions of Slovakia. Acta Parasitol., 49, 4: 272–275.Wa g h o r n T . S . , L e a t h w i c k D . M . , R h o d e s A . P. , L a w r e n c e K . E . , J a c k s o n R . ,

P o m r o y W. E ., We s t D.M., M o f f a t J.R. (2006). Prevalence of anthelmintic resistance on sheep farms in New Zealand. New Zealand Vet. J., 54: 271–277.

Z i o m k o I., C e n c e k T. (1995). Zarys laboratoryjnej diagnostyki parazytologicznej zwierząt gospodar-skich. Instytut Weterynarii, Puławy.

Accepted for printing 12 VI 2007

BOGUMIŁA PILARCZyK, ALEKSANDRA BALICKA-RAMISZ, ALOJZy RAMISZ, BARBARA BINEROWSKA

PORÓWNANIE INWAZJI PASOŻYTÓW UKŁADU POKARMOWEGO U OWIEC W gOSPODARSTWACH EKOLOgICzNYCH I TRADYCYJNYCH

STRESZCZENIE

Badania koproskopowe przeprowadzono u owiec pochodzących z 3 gospodarstw ekologicznych (62 sztuki) oraz z 2 gospodarstw tradycyjnych (85 sztuk). średnia ekstensywność zarażenia pasożytami przewodu pokarmowego owiec z gospodarstw ekologicznych wyniosła 79,03%, natomiast z gos-podarstw tradycyjnych 42,35%. średnia ekstensywność zarażenia pierwotniakami z rodzaju Eimeria u owiec pochodzących z gospodarstw ekologicznych była prawie dwukrotnie większa i wyniosła 67,74%, natomiast w gospodarstwach tradycyjnych 35,29%. Podobne okazało się zróżnicowanie gatunkowe: stwierdzono obecność E. faurei, E. arloingi, E. pallida, E. intricata i E. parva (z prób kału zwierząt z gospodarstw tradycyjnych dodatkowo E. granulosa). średnia ekstensywność zarażenia owiec nicien-iami żołądkowo-jelitowymi w gospodarstwach tradycyjnych wyniosła 30,59%, a w gospodarstwach eko-logicznych aż 79,03%. U badanych owiec w gospodarstwach tradycyjnych stwierdzono występowanie czterech gatunków nicieni przewodu pokarmowego: Trichostrongylus spp. 17,65%, Haemonchus contortus 8,25%, Nematodirus spp. 5,88% i Oesophagostomum spp. 1,18%. U owiec w gospodarstwach ekologicznych stwierdzono natomiast występowanie sześciu gatunków nicieni przewodu po-karmowego: Trichostrongylus spp. 19,35%, Nematodirus spp. 16,13%, Oesophagostomum spp. 6,45%, Cooperia spp. 6,45%, Haemonchus contortus 4,84% i Chabertia ovina 4,84%. Zarówno w gospodarst-wach tradycyjnych, jak i ekologicznych stwierdzono występowanie motylicy wątrobowej i tasiemców z rodzaju Moniezia sp.

INSTRUCTIONS TO AUTHORS OF RESEARCH PAPERSPUBLISHED IN THE ‘‘ANNALS OF ANIMAL SCIENCE”

I. General Rules

1. The ‘‘Annals of Animal Science” include original research papers which have not been publishedeither in part or as a whole in any other scientific journal, except for proceedings of symposia andscientific conferences. The submitted papers should be written and documented so as to form anintegrated whole.

2. The ‘‘Annals of Animal Science” also publishes review papers. The paper should not exceed 20manuscript pages, including up to 30 references. A summary in Polish and key words should be listedat the end of the paper. Papers should present the latest knowledge in a given field of science andcurrent literature.

3. The ‘‘Annals of Animal Science” cover the following range of topics: genetics and farm animal breeding;the biology, physiology and reproduction of animals; animal nutrition and feedstuffs; environment,hygiene and animal production technology; economics and the organization of animal production.The assignment of a paper to a given section should be proposed by the author(s), but the final decisionrests with the Editors.

4. Papers are printed in English with a Polish summary.5. Papers to be published should not exceed 16 manuscript pages (size A4) including tables, figures,

photographs, etc. and a summary.6. Papers are reviewed by two reviewers who are research workers specializing in the relevant field. One

unfavourable review means that the paper will not be published. The costs of printing are covered bythe authors or by the institutions from which the papers were sent, according to current rates of paperpreparation and printing. Authors will receive 25 offprints of their paper free of charge.

II. Submission of Manuscripts

1. Manuscripts for publication are submitted to the Editor-in-Chief by research workers or the heads ofresearch institutions where the studies were carried out, who take responsibility for their content,scientific value and the preparation of the text.

2. Manuscripts should be submitted in triplicate to: The Editors of ‘‘Annals of Animal Science”,National Research Institute of Animal Production, Sarego 2, 31-047 Krakow, Poland, tel. (+48)12 422-73-33, fax (+48) 12 422-80-65, e-mail: [email protected] on diskettes, and meet thefollowing requirements:Diskettes: 3 1/2′′ formatPrintout: 3 copiesWord processor: Microsoft WordPaper size: A4 (210 × 297 mm)Font: CG Times 11 pt or Times New Roman 12 ptMargins: 25 mm (left, right, top, bottom)Line spacing: doubleJustification: fullFormulae: equation editor

96

Tables: table functionThe ENTER key should only be used to start a new paragraph.

3. Attached to the manuscript should be the Manuscript Submission Form as appended at the end of thisInstruction.

III. Layout of the Text

1. Title page (unnumbered), not included in the paper volume, should contain: the title of the paper, thefull name(s) of author(s) with superscript numbers indicating the full postal address (postcode, street,no.) of the department and affiliated institution where the study was carried out, e.g.:

Jan Kowalski1, Maria Anna Rokicka2, Adam Nowacki3

1 Department of Zoology, Jagiellonian University, sw. Anny 12, 30-017 Krakow, Poland2 Department of Immuno- and Cytogenetics, National Research Institute of Animal Production,

32-083 Balice n. Krakow, Poland3 Experimental Station of the National Research Institute of Animal Production,

39-331 Chorzelow, Poland

abbreviated title (5-6 words as in the paper title or synonyms)source of research financing, e.g. work financed from:statutory activity, project no.author’s project of the Ministry of Science and Higher Education, project no.funds of the Ministry of Agriculture and Rural Development, project no.

2. Manuscripts should be organized in the following order:a) Abstract. Not more than 15-20 lines in length, containing the aim, principal methods and most

important results of the experiment.b) Key words. Maximum five items that best describe the paper’s content, beginning with words

of wider meaning, e.g. ruminants, dairy cows, somatotropin, prolactin, milk.c) Introduction. This should justify the research based on references and conclude with a clearly

formulated aim of the study or research hypothesis.d) Material and methods. This section should contain all information needed to replicate

the experiment, e.g. experimental factors, experimental design, species, breed, sex and numberof animals, duration of experiment, feed rations and their composition, laboratory techniquesand statistical methods used. In the descriptions of methods (biological, chemical, statistical)it is enough to refer to source material if applied accordingly. Modifications made to the methodsshould be described in detail.

e) Results can be presented in tabular or graphic form (figures, diagrams, photographs) and givena brief description. The text of the description should not repeat tabular data.

f) Discussion. This should interpret the results in terms of the influence of experimental factorsaccording to the aim of the experiment or to the hypothesis made in the Introduction.The experimental results should be interpreted using the current state of knowledge to helpthe reader accept or reject the hypothesis tested. This section should conclude with a summing-upand generalization of the results obtained. The direction of further studies in the relevant field maybe also hinted at here.

g) Acknowledgments (if any).h) References. Publications cited in the text must be organized in strict alphabetical order according

to name of author. Each citation should include the author’s name and initials, year of publication,full title of paper, abbreviated name of journal, number of volume and issue, and initial and finalpage numbers. When more than one paper published by the same author(s) in the same yearis cited, and the authors appear in the same order, the different papers should be assignedsuccessive letters of the alphabet (e.g. 1983 a, 1983 b) and arranged chronologically. Below areprovided examples of proper citations of references from scientific journals, congress proceedingsand books (manuals).

97

Papers published in periodicals: Jenkins K.J., Hidiroglou M. (1991). Tolerance of the preruminantcalf for excess manganese or zinc in milk replacer. J. Dairy Sci., 74: 1047-1053.Papers published in multi-author monographs, occasional publications, symposium or cong-ress proceedings: Miller E.L. (1982). Forage protein in ruminant animal nutrition. The nitrogenneeds of ruminants. In: D.J. Thomas (Editor), Proceedings of an International Symposium on ProteinRequirements for Cattle. Kansas State University, Kansas City, KN, pp. 254 – 269.Manuals and multi-author books: Bock H.D., Eggum B.O., Low A.G., Simon O., Zebrowska T.(1989). Editors. Protein metabolism in farm animals: evaluation, digestion, absorption andmetabolism. Oxford, UK, Oxford University Press (1989), 452 pp.Manuals and books: Cuhna T.J. (1991). Horse feeding and nutrition. San Diego, USA, AcademicPress, Inc. (1991). Second edition, 445 pp.

i) Summary in Polish — the same as the Abstract (Polish summary is not included in the textvolume) with full names of the author(s) and title of the paper.

3. Literature citations in the text. Research findings (or their authors) should be cited if strictlyconnected with the study topic or research methods used. The number of citations should not exceedthe 20 most important items quoted in the text. When a citation has more than two authors, the nameof the first author should be followed with ‘‘et al.”, e.g. Nowacki et al. (1992). Unpublished papersshould be listed in the text, e.g. Błonski (personal communication) or (Błonski, unpublished data).

4. Tables should present the most important data. The column on the left should list the parameters studied,while the columns in the middle and on the right should contain the results for individual experimentalfactors. Tables should contain numerical data, which are the mean values for a set of observations ormeasurements, replications and their statistical interpretation (e.g standard error, coefficient of variation).Tables numbered consecutively in Arabic numerals should be submitted on separate sheets. The titles ofthe tables should be brief. Each column should have a heading. Columns and lines should be spaced. Novertical lines are allowed. Horizontal lines can only be used for strictly justified purposes.Tabular data should not be repeated in graphic form (figures, diagrams, etc.). If there are no data fora given parameter, leave a blank. If an explanation is necessary, use an abbreviation and explain it asa footnote at the bottom of the table (e.g. ND — not determined or not detected). To designate thesignificance of differences between two means or interaction between factors, an additional column isrecommended with the heading ‘‘significance level”, using the signs x, xx, xxx for P ≤ 0.05, 0.01 and0.001 respectively. When the number of means is greater than two, the significance of differencesshould be designated with letters which follow tabular data. Their meaning should be explained belowthe bottom line of the table, e.g.:a, b, c, d — values in rows (or columns) with different letters differ significantly (P ≤ 0.05).A, B, C, D — as above for P ≤ 0.01.Statistical interpretation of the results should fit the design of the experiment and the hypothesestested.

5. Figures and photographs. Research results, presented in the form of figures, charts and diagrams,should be made on tracing paper or in other forms ready for reproduction. A single figure or diagrammust fit half of the text page. Black-and-white or colour photographs of postcard size should havegood contrast. Each figure or photograph should be provided with a brief description of its contentand, if necessary, a legend in English. References to figures or photographs in the text of the papershould be provided with a reference mark or information.Figures and photographs should be submitted in two sets.

6. Abbreviations should be explained on their first appearance. SI units of measure should be used. Thisalso concerns the energy value of feeds, which should be given in Joules.

7. Supplementary information. After receiving a review of the paper the authors should follow thereviewers’ guidelines for changes and corrections, and return all the materials received together witha corrected version of the manuscript within 10 days at the most. A failure to return it in due time willdelay publication by half a year. The correction of a galley-proof, confirming the final version of thepaper, should be made within 5 days of it being sent to the author(s). If this deadline is not met, theEditors bear no responsibility for changes made.

98

place date

‘‘Annals of Animal Science”Manuscript Submission Form

AAS issueTo be filled in by Editors

I am asking you to review and print the enclosed paper in ‘‘Annals of Animal Science”

1. Author(s), title of the paper. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2. Notifying person:Full name . . . . . . . . . . . . . . . . . . . . . . . . . . . .Address (postcode, town, street, no.) . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .Telephone, fax, e-mail . . . . . . . . . . . . . . . . . . . . . . . .Institution’s NIP number (for Polish authors only) . . . . . . . . . . . . . . .

3. Suggested section in ‘‘Annals of Animal Science”:Genetics and farm animal breedingBiology, physiology and animal reproductionAnimal nutrition and feedstuffsEnvironment, hygiene and animal production technologyEconomics and organization of animal production

4. I hereby warrant that the manuscript submitted for publication has neither in part nor as a whole beenpublished or submitted for publication in any other scientific journal.

5. I warrant that the co-authors of this manuscript are familiar with its content and have given consent toits publication in the presented form.

6. I commit myself to covering the costs of the paper’s publication after it is published, in accordancewith the prices valid at the moment of printing.

. . . . . . . . . . . . . . . . . . . . . . . . . . .Signature of the notifying person

This journal is included in the

POLISH SCIENTIFIC JOURNALS CONTENTS— AgRIC.&BIOL. SCI.

database which can be accessed on the World Wide Web at the followingURL address:

http://psjc.icm.edu.pl

DistributionSubscriptions and single copies of the journal can be ordered from:Instytut Zootechniki — PIB, Zespoł Wydawnictw i Poligrafii, 32-083 Balice k. Krakowa, PolandAnnual subscription price is PLN 60.00 within Poland and US$ 50.00 outside Poland.

PrintingDepartment of Publications and Printing, National Research Institute of Animal Production,32-083 Balice n. Kraków, Poland. Printed in 525 copies.

CONTENTS

M. Gołębiewski, P. Brzozowski - Comparison of dairy performance of montbeliarde And black-and-white cows housed In the same environmental conditions . . . . . . . . . . . . . . . . . . 3J. Wójcik, R. Pilarczyk, A. Jasiński, D. Piłat - Comparison of growth and development in cowsof different meat breeds in the western pomerania area based on parameterized results . . . . . . . 13M. Natonek-Wiśniewska, T. Rychlik - Polymorphism of selected microsatellite dna sequences in polish merino sheep and the evaluation Of their suitability for parentage control . . . . . . . . 23B. ślaska, G. Jeżewska - Optimization of pcr-rflp technique for analysis of some genes in the raccoon dog (nyctereutes procyonoides Gray 1834) . . . . . . . . . . . . . . . . . . . . . . . 29L. Kątska-Ksiażkiewicz, J. Opiela, B. Ryńska, J. Wieczorek, M. Cegła, Z. Smorąg - Laparoscopic transfer of goat 6-, 8-cell embryos Produced in vitro . . . . . . . . . . . . . . . . . . . . . . . 37R. Józefczyk, M. Droba, B. Droba - Changes in the activity of α-galactosidase And α-l-fucosidase during the posthatch development and regression of japanese quail testes and epididymidis after light reduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47J. Król, Z. Litwińczuk, A. Litwińczuk, A. Brodziak - Content of protein and its fractions in milk Of simmental cows with regard to rearing technology . . . . . . . . . . . . . . . . . . . . . . 57J. Nowicki, E. Moskała, M. Kopyra - Behavioural response of newly mixed weaners To a hang-ing wooden ball and a free ball in the pen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63Z. Sokołowicz, J. Krawczyk, M. Dykiel - Hen housing system and egg quality as viewed By consumers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71I. Skomorucha, E. Herbut, E. Sosnówka-Czajka - Effect of water deprivation on broiler chicken Productivity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81B. Pilarczyk, A. Balicka-Ramisz, A. Ramisz, B. Binerowska - Comparison of internal parasite invasions in sheep On ecological and conventional farms . . . . . . . . . . . . . . . . . . . . 89

1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

Documents

ANNALS OF ANIMAL SCIENCE - izoo.krakow.pl