Anatomical evidence supporting the potential for modulation by multiple neurotrophins in the majority of adult lumbar sensory neurons

Anatomical Evidence Supporting thePotential for Modulation by Multiple

Neurotrophins in the Majority of AdultLumbar Sensory Neurons

L.A. KARCHEWSKI, F.A. KIM, J. JOHNSTON, R.M. MCKNIGHT, AND V.M.K. VERGE*Department of Anatomy & Cell Biology and Cameco MS Neuroscience Research Center,

University of Saskatchewan S7N 5E5, Canada.

ABSTRACTNeurotrophins exert effects on sensory neurons through receptor tyrosine kinases (trks)

and a common neurotrophin receptor (p75). Quantitative in situ hybridization studies wereperformed on serial sections to identify neurons expressing single or multiple neurotrophintrk receptor mRNA(s) in adult lumbar dorsal root ganglion (DRG) in order to examine thepossibility of multi-neurotrophin modulation of phenotype via different trk receptors orvarious trk isoforms. Expression of mRNA encoding trkA, trkB, trkC, or p75 is restricted toselect subpopulations representing approximately 41%, 33%, 43%, and 79% of DRG neurons,respectively. Colocalization studies reveal that approximately 10% of DRG neurons coexpresstrkA and trkB mRNA; 19% coexpress trkA and trkC mRNA; and 18% coexpress trkB and trkCmRNA. Trilocalization of all three trk mRNAs is rare, with approximately 3–4% of neurons inthis category. Overall incidence of expression of more than one full length trk mRNA occurs inapproximately 40% of DRG neurons, whereas expression of individual trk mRNA is found inapproximately 34%. Full length trk receptor mRNA is rarely detected without p75, implicat-ing the latter in neuronal response to neurotrophins. Examination of two full-length isoformsof trkA reveal that they are coexpressed with relative levels of expression positivelycorrelated. TrkC mRNAs corresponding to 14- or 39-amino acid insert isoforms colocalize withthe non-insert trkC isoform, but the converse is not necessarily true. The data suggest thatsubstantial subpopulations of adult sensory neurons may be modulated through interactionswith multiple neurotrophins, the consequences of which are largely unknown. J. Comp.Neurol. 413:327–341, 1999. r 1999 Wiley-Liss, Inc.

Indexing terms: trkA; trkB; trkC; p75; trk isoforms; DRG

Neurotrophins are the most profound known modula-tors of sensory neuron survival, differentiation, and pheno-type, and include: nerve growth factor (NGF; reviewed inLevi-Montalcini and Angeletti, 1968), brain-derived neuro-trophic factor (BDNF; Barde et al., 1982; Leibrock et al.,1989), neurotrophin-3 (NT3; Ernfors et al., 1990; Hohn etal., 1990; Jones and Reichardt, 1990; Maisonpierre et al.,1990; Rosenthal et al., 1990), and neurotrophin 4/5 (NT4/5;Berkemeier et al., 1991; Hallbook et al., 1991). Identifica-tion of neurotrophin receptors, their expression patternsin dorsal root ganglion (DRG) neurons, how expressionchanges with injury or disease has facilitated and contin-ues to facilitate prediction of potential roles and therapeu-tic value of neurotrophins. The neurotrophin receptorsinclude two classes: p75NGFR, a single transmembraneglycoprotein that binds each of the neurotrophins (Johnsonet al., 1986; Radeke et al., 1987; Ernfors et al., 1990;

Rodriquez-Tebar et al., 1990) and the trk tyrosine kinasefamily of receptors which show greater ligand selectivityand high binding affinity. NGF mediates its effect via trkA(Kaplan et al., 1991; Klein et al., 1991); BDNF and NT4/5via trkB (Klein et al., 1990; Soppet et al., 1991; Squinto etal., 1991), and NT3 primarily through trkC, but it is alsoable to interact with trkA and trkB (Lamballe et al., 1991;Ip et al., 1993). Signaling via the trk family of receptorsmay also be modulated by select expression of the multiple

Grant sponsor: Canadian Medical Research Council; Grant number:12060; Grant sponsor: University of Saskatchewan Graduate Student andCollege of Medicine Arthur Smyth Scholarships; Grant sponsor: MRC.

*Correspondence to: Valerie M.K. Verge, Cameco MS/Neuroscience Re-search Center, Saskatoon City Hospital, Room 5800, 701 Queen Street,Saskatoon, Saskatchewan S7K 0M7, Canada. E-mail: [email protected]

Received 4 March 1999; Revised 16 June 1999; Accepted 24 June 1999

THE JOURNAL OF COMPARATIVE NEUROLOGY 413:327–341 (1999)

r 1999 WILEY-LISS, INC.

isoforms of both full-length trkA and trkC receptors. Thesplice variants of the trkA receptor encode two receptors, atrkA without insert (trkA NO INS) and a trkA with a6-amino acid (a.a.) insert in the extracellular bindingdomain (trkA INS). This region does not appear to affectthe receptor’s binding specificity or functional response toNGF, but is believed to confer enhanced responsiveness ofthe receptor to NT-3 (Barker et al., 1993; Clary andReichardt, 1994). The full-length trkC splice variants donot appear to result in responsiveness to other neurotroph-ins, but rather 14-a.a. (trkC i14) or 39-a.a. (trkC i39)inserts in the tyrosine kinase domain have been shown todiminish the signaling and neurite promoting capabilitiesof NT-3 (Tsoulfas et al., 1993, 1996; Meakin et al., 1997).

Past studies examining the distribution and overlap intrk and p75 receptor expression in mature DRG haveyielded valuable information regarding potential overlapin neurons that retrogradely transport NGF, BDNF, andNT-3 (DiStefano et al., 1992), common target innervation(McMahon et al., 1994), and percentages of neurons ex-pressing individual or multiple trk receptors or p75 (Vergeet al., 1992; Mu et al., 1993; Kashiba et al., 1995; Wetmoreand Olson, 1995; Wright and Snider, 1995). The findings,in addition to supporting a role for NGF acting primarilyon nociceptive neurons and NT-3 on the proprioceptivepopulation, indicate that trkA and trkC are unlikely to beexpressed by the same neuron, whereas trkB is most oftencoexpressed with either trkA or trkC. Neuronal expressionof more than one trk receptor is intriguing and providesthe anatomical correlate to explain the differential regula-tion of pathways activated by NGF and BDNF in sensoryneurons (Carter et al., 1995), the requirement of bothBDNF and NT-3 for regulation of substance P (Zhang etal., 1995), the differential requirements of slow adaptingmechanoreceptors for NT-3 and BDNF (Lewin, 1996), andthe differential regulation of trkA and associated pheno-type by NGF and NT-3 (Verge et al., 1992; Gratto andVerge, 1997).

In all previous studies, the size of the trkC and trkBpopulations varied greatly, with the former markedlylower than that observed by us. To resolve some of theconflicts in results between studies and to continue topredict the potential for combinatorial effects of neurotroph-ins on the same neuron in lumbar DRG, the degree ofcolocalization and trilocalization of trk receptor expressionusing serial thin sections to optimize the detection ofhybridization signal for each trk receptor (full-length andtruncated isoforms) and p75 mRNAs was examined. Inaddition, as some neurotrophin’s actions, namely NT-3’s,may be determined by interactions with full-length trkA ortrkC receptor isoforms, the expression of these isoformswas examined. Results indicate that the degree of overlapin trk expression in lumbar sensory neurons may havebeen underestimated in past studies and that some neu-rons express all three trk receptors, whereas others possi-bly express only truncated isoforms of trkB or trkC. Thehigh degree of coexpression of trkA isoforms in lumbarDRG suggests that NT-3 could potentially modulate thefunction of trkA neurons via the trkA INS isoform. Theexpression of multiple trk receptor mRNAs in individualneurons is more prevalent than the expression of single trkmRNAs.

MATERIALS AND METHODS

Animal and tissue preparation

All animal procedures were conducted in accordancewith the Society for Neuroscience policy on the use ofanimals in neuroscience research and the University ofSaskatchewan animal care committee guidelines.

Six young adult male Wistar rats weighing approxi-mately 250 g were heavily anesthetized with sodiumpentobarbital (50 mg/kg) intraperitoneally and perfusedvia aorta with cold 0.1 M phosphate-buffered saline (PBS,pH 7.4), followed by rapid dissection of right and leftlumbar (L4 and L5) DRG and superior cervical ganglia.Tissue was then embedded in OCT compound (Tissue Tek,Miles Inc., Elkhart, IN) and frozen in cold isopentane.Sections were cut serially at 5 or 6 µm on a Micron cryostat(Zeiss, Canada), thaw-mounted onto Probe-ON slides(Fisher Scientific, Canada) and stored with desiccant at-20°C until hybridization.

Preparation of probes

In situ hybridization was carried out on tissue using48-mer oligonucleotide probes complimentary to and selec-tive for the following mRNAs: rat trkA which is thecounterpart of bases 1198–1245 of the human trk sequence(Meakin et al., 1992; Merlio et al., 1992), rat p75, bases873–920 (Radeke et al., 1987); rat trkB (full-length), basepairs 1361–1408; rat trkB (all), bases 1313–1360 (Mid-dlemas et al., 1991); rat trkC (full-length), bases 1654–1701; rat trkC (all), bases 1189–1236 (Merlio et al., 1992).TrkB (all) and trkC (all) probes recognized both full-lengthand truncated transcripts, whereas trkA, trkB (full-length), and trkC (full-length) were selective for allknown full-length transcripts with a tyrosine kinase do-main. To selectively detect full-length trkAisoforms, probeswere designed against: (1) the 6-a.a. insert region (under-lined) and flanking 58 and 38 regions, bases 1235–1283(Clary and Reichardt 1994): 58 ATGTGCTGTTAGTGTCCACTGGCGAGAAGGAGACAGGGATGGGGTCCT3’- trkAINS; or (2) only the 58 and 38 regions flanking the insertexon so as to detect noninsert isoform: 5’TCTTGATGTGC-TGTTAGTGTCAGGGATGGGGTCCTCAGGGTTGAACTC38 - trkA NO INS. Detection of the three full-length trkCisoforms was achieved via probes designed against: (1)bases 2107–2154 which target the 58 and 38 sequencesflanking the boundaries of the two sequential exons encod-ing the sequence for the 39-a.a. (the last 14 a.a. of thissequence correspond to the 14-a.a. insert exon) and 14-a.a.inserts and thus detects only the noninsert isoform (Valen-zuela et al., 1993): 58 GAGCATGGTGTGTCCTCCCACCCT-GTAGTAATCAGTACTGTAGACGTC38 -trkC NO INS; (2)bases 2104–2151 of the alternatively spliced transcriptcontaining the 14-a.a. tyrosine kinase insert exon andcorresponding to 30 bases of the upstream 58 regionflanking the 14-a.a. insert exon and the first 18 base pairsof the exon encoding the 14-a.a. insert (underlined): 58TCCAGATGGATTAAAGAGCCTGTAGTAATCAGTACTGTAGACGTCCCT38 -trkCi14; and (3) bases 2140–2187 ofthe alternatively spliced transcript containing the 39-a.a.insert and corresponding to amino acids 3–20 of thisinsert, thus having no overlap with the 14-a.a. insertwhich is identical to amino acids 26–39 of this insert(underlined): 58 TAGCCTCTGTTGCTGCCACGACACGC-TGAATGGGCCCTTCTGGTATGG38 - trkCi39. All probeswere checked against the Genbank database (NIH) to

328 L.A. KARCHEWSKI ET AL.

ensure that no greater than 60% homology was found tosequences other than the cognate transcript.

The probes were labeled at the 38 end with a-[35S]dATP(NEN, Mandel Scientific, Canada) using terminal deoxy-nucleotidyltransferase in a buffer containing 10 mM CoCl2,1 mM dithiothreitol (DTT), 300 mM Tris base, and 1.4M-potassium cacodylate (pH 7.2), purified through NEN-SORB-20 columns (New England Nuclear, Boston, MA)and DTT added to a final concentration of 7 mM. Thespecific activities used ranged from 2.0 to 5.0 3 106 cpm/ngoligonucleotide.

In situ hybridization

Hybridization was carried out according to publishedprocedures where the stringency used for hybridizationwas such that homologies greater than 90% are requiredfor detection of the transcripts (Dagerlind et al., 1992).Briefly, the sections were brought to room temperature,air- dried and, without any additional treatment, coveredwith a hybridization buffer containing 50% formamide(Fisher Scientific, Canada) 43 SSC (13 SSC, 0.15 M NaCl,0.015 M sodium citrate), 13 Denhardt’s solution (0.02%bovine serum albumin and 0.02% Ficoll), 1% sarcosyl(N-laurylsarcosine), 0.02 M phosphate buffer (pH 7.0), 10%dextran sulphate, 500 mg/ml heat-denatured salmon spermDNA, 200 mM DTT, and 107 cpm/ml of probe. The slideswere placed in a box humidified with 13 SSC and incu-bated at 42°C for 14–18 hours. After hybridization, theslides were washed four times for 15 minutes in 13 SSC at55°C and then brought to room temperature over 30minutes while in the final rinse, dipped twice in distilledwater, dehydrated in 60% and 95% ethanol, and air-dried.

To generate radioautograms, the incubated slides weredipped in NTB2 nuclear track emulsion (Kodak, Roches-ter, NY) diluted 1:1 with distilled water, and stored in thedark with desiccant at 4°C. The sections were exposed for1–12 weeks, developed in Kodak D19 for 3 minutes, fixedand viewed under darkfield and brightfield conditions on aZeiss microscope.

In situ hybridization control experiments. The speci-ficity of hybridization signal for each probe used in thestudy was ascertained by hybridization of adjacent sec-tions of paired L5 ganglia. Series of sections were hybrid-ized with labeled probe, labeled probe with a 1,000-foldexcess of cold probe, or labeled probe with a 1000-foldexcess of another, dissimilar cold probe of the same lengthand similar guanine-cytosine (G-C) content. Because theprobe used to detect the trkA INS isoform contains 58 and38 sequences completely homologous to the sequencesfound in the noninsert transcript and thus has the poten-tial to hybridize to this transcript as a hairpin loopstructure, a 1,000-fold excess of unlabeled, noninsert probetargeting this region was always included with the labeledprobe detecting trkA INS in order to prevent any suchhairpin loop structures from forming. Under these condi-tions, labeled insert probe, trkA INS, would only effectivelybind to sequences of mRNA containing the insert.

Analysis

Quantitative. For trilocalization and colocalizationstudies, montages of photomicrographs were preparedfrom adjacent sections (magnification 4503). Individualneurons with a visible nucleus in one of the adjacentsections were identified and numbered (,200–400 cells/montage). Under 633 oil immersion light microscopy with

an interactive computer-assisted image-analysis system(Richardson et al., 1989), cross-sectional areas of indi-vidual neurons and the percentages of cytoplasmic areacovered by silver grains were measured in each ganglion.For each image, the density threshold was adjusted inter-actively so that the area per grain was constant for allneurons. Correction for grain overlap was made to obtain aparameter linearly related to density of silver grains(Richardson et al., 1989). Software for the image analysissystem was generously provided by W.G. Tatton (Dalhou-sie University, Halifax, Canada) and supplemented withpublished programs for data analysis and graphics (Presset al., 1988; Matlab, Mathworks Inc., Natick, MA). Cellswere considered labeled if they had more than five timesbackground levels of silver grains, as determined byaveraging grain counts over defined areas of the neuropildevoid of positively labeled cell bodies.

Figures

Photomicrographs for figures were taken with a Zeisscamera on TMAX100 (Kodak) black and white film under633 oil objective. Original photographs and graphs werescanned to computer and the contrast adjusted on theimages to match original photos using Adobe Photoshop4.0. Figures were sized and scale bars added for output.

RESULTS

Neuronal trk expression in lumbar DRG

To evaluate the expression of neurotrophin receptors inL5 DRG, sections were hybridized with 35S-labeled probesto detect transcripts encoding full-length forms of trkA,trkB, and trkC. Probes selective for trk receptors with atyrosine kinase domain were used to avoid false positiveidentification of labeled neurons due to scatter of hybridiza-tion signal from adjacent labeled perineuronal cells. Thisis a problem particularly when using probes directed to theextracellular domain of the trkB receptor because perineu-ronal cells, presumably satellite cells, express abundanttruncated trkB mRNA (McMahon et al., 1994; Kashiba etal., 1995; Wetmore and Olson, 1995; Fig. 4). Hybridizationcontrol experiments showed specific hybridization signalto be abolished in the presence of labeled probe plus a1,000-fold excess of unlabeled probe, whereas no change inhybridization pattern was observed when a 1,000-foldexcess of a dissimilar probe of equal length and similarG-C content was added (Fig. 3).

Neuronal expression of trkA, trkB, and trkC mRNA isheterogeneous and appears restricted to select subpopula-tions of neurons, consistent with the results of previousstudies (Figs. 1 and 5) (Verge et al., 1992; Ernfors et al.,1993; McMahon et al., 1994; Kashiba et al., 1995; Wetmoreand Olson, 1995; Wright and Snider, 1995). Quantificationdetermined silver grain densities and size of individualneurons (6 DRG sections, 268–365 neurons/section/plot).Neuronal labeling indices range from below background tomore than 100 times background with no apparent topog-raphy in the distribution of labeled neurons in the gan-glion section (Figs. 1 and 4). Frequency histograms oflabeling indices suggest the existence of two overlappingpopulations of neurons for trk receptors, those that ex-press the individual trk receptors and those that do not.This bimodal distribution is most apparent for trkA mRNAand less so for trkB and trkC (Fig. 1). Scatter diagramscomparing the frequency distribution of neurons and trkA,

TRK RECEPTORS IN LUMBAR DRG 329

Figure 1


trkB, or trkC labeling indices and cell volumes (both onlogarithmic scale) show that the two measurements aredistinct for each trk probe used (Fig. 1). In each case,neurons with greater than 5 times above backgroundlevels of labeling were considered to express detectablelevels of the trk receptor mRNA being investigated. Thevalidity of the cutoff point was confirmed by ensuring thatpercentages of labeled neurons by cell counts under an oilimmersion 633 objective were consistent with those ob-tained using the image analysis system.

Neuronal sizes were subdivided such that neurons witha diameter less than 40 µm were considered to be small tomedium-sized, and those greater than 40 µm in diameterlarge. Thus, , 41% (41.25 6 1.29 S.E.M.) of DRG neuronsexpress detectable trkA mRNA and 89% of those neuronsare small to medium in size, whereas only 11% are large(Fig. 1). Expression varies from lightly to heavily labeledin all size ranges, with larger neurons expressing trkAmRNA predominantly at high levels. Fewer neurons ex-press trkB mRNA with ,33% (33.0 6 3.06 S.E.M.) display-ing hybridization signal above levels of detection. Themajority (90%) of trkB-expressing neurons are medium-sized to large with the latter showing only low to moderatelevels of hybridization signal. A modest population of smallneurons express trkB mRNA, but only at very low levels(Fig. 1). TrkC-positive neurons are also mainly medium-sized to large with ,43% (43.0 6 1.55 S.E.M.) of DRGneurons expressing detectable levels of the mRNA (Fig. 1).Approximately 85% of these have medium to large diam-eters, whereas 15% are small. The intensity of hybridiza-tion signal is greatest over medium to large diameter cellswith the latter at moderate to high levels (.103 back-ground).

Although the levels of mRNA expression for the indi-vidual receptors are variable, a far greater proportion oftrkB and trkC mRNA expressing neurons display only lowlevels of hybridization signal and may be missed if theradioautograms are not exposed for a sufficiently longperiod of time.

Colocalization and trilocalization of trkexpression in lumbar DRG

The degree of colocalization of any two trk receptormRNAs or trilocalization of all three trk messages wasdetermined by identifying and quantifying hybridizationsignal over individual neurons in series of 5-µm-thick L5DRG sections each processed with probes to detect full-length forms of trkA, trkB, or trkC receptor mRNAs (6DRG sections, 295–395 neurons/section/plot). At this thick-

ness, most neurons could be identified in each of the threeserial sections. In addition, extended exposure times wereused to generate the radioautograms to optimize theidentification of neurons expressing low levels of trkmRNAs. Brightfield photomicrographs, scatterplots, andthree-dimensional histograms are used to show the degreeof colocalization between any two of the trk receptors(Figs. 2 and 3). The dashed horizontal and vertical lines onthe scatterplots represent points on the log scale that are 5times background labeling. The quadrants resulting fromthe intersection of the two lines divide the data such thatthe upper right quadrant contains data points where bothreceptor mRNAs are expressed, whereas the data points ofthe lower left quadrant represent neurons which do notexpress detectable levels of either mRNA. The top left andbottom right quadrants correspond to neurons expressingonly one of the two mRNAs being investigated, with theupper left expressing message as indicated on the y-axisand the lower right that indicated on the x-axis. Using thisapproach, each trk receptor is found to colocalize to adegree with other members of the trk receptor family. Forexample, ,10% (9.5 6 1.67 S.E.M.) of DRG neuronscoexpress trkA and trkB mRNA; many of these neuronsexpress high levels of trkA and low levels of trkB hybridiza-tion signal (Fig. 2). However, there are instances whenboth levels of hybridization signal are moderate to high inthe same neuron (.103 background; Fig. 2) and thesecomprise ,3% (3.05 6 1.77 S.E.M.) of DRG neurons. Incontrast, a much higher percentage of neurons, ,19%(19 6 0.68 S.E.M.), express both trkA and trkC mRNA witha wide range of labeling densities (Fig. 2). Of these, theneurons expressing trkA at varying levels along with onlylow levels of trkC mRNA (,103 background) are deter-mined to be small to medium-sized because only this sizerange of neurons is found to express trkC at low levels (Fig.1). In ,8% (8.11 6 2.49 S.E.M.) of DRG neurons, trkA andtrkC labeling densities are both at moderate to high levels.Coexpression of trkB and trkC mRNA is also detected inmany cells, representing ,18% (17.75 6 3.56 S.E.M.) ofDRG neurons, with most displaying low to moderate levelsof hybridization signal (Fig. 3). Only ,6% (5.7 6 0.77S.E.M.) of DRG neurons coexpress these two messagessuch that moderate to high labeling densities are observedfor both.

The incidence of trilocalization of trk receptor expres-sion is rare, with only ,3–4% of the DRG neuronalpopulation in this category (Fig. 1). The expression of twoor three trk receptor mRNAs by the same neuron occursalmost exclusively in medium-sized to large neurons;however, there are some trkA/trkC mRNA-positive neu-rons which are small. It should be noted that there is anoverall tendency, with the exception of trkA neuronscoexpressing trkC, for the moderate to high trkA-, trkB-, ortrkC-expressing neurons (.353 background) to not colocal-ize with another trk receptor mRNA (Figs. 2 and 3). Theincidence of expression of a sole trk receptor message wasdetermined from the colocalization and trilocalizationdata. Thus, approximately 16%, 9%, and 10% of all DRGneurons express trkA, trkB, and trkC mRNA, respectively,to the exclusion of other detectable trk receptors. The totalpopulation of DRG neurons expressing any form of trkreceptor was calculated likewise and showed approxi-

Fig. 1. Expression of trk receptor mRNA in dorsal root ganglion(DRG) neurons associated with intact sciatic nerve. Top: Brightfieldphotomicrographs of serial 5-µm- thick L5 DRG sections processed forin situ hybridization to detect mRNAs for trkA, trkB (full- length), andtrkC (full-length). Note the trilocalization of trk hybridization signalsover the middle neuron, and colocalization of trkA and trkC mRNAexpression in the upper and lower neurons. Bottom: Representativefrequency histograms of labeling indices (left column) and scatterplots(right column) to quantify labeling and volume of 350–365 identifiedneurons in serial sections processed for in situ hybridization to detectmRNAs for trkA, trkB (full-length), and trkC (full-length) as indi-cated. Dashed lines represent points on the log scale that are 5 timesbackground labeling. Data points above these lines represent neuronsconsidered to express detectable levels of mRNA for the individualneurotrophin receptor probes used. Scale bar 5 20 µm.


Fig. 2. Colocalization of trk mRNAexpression. Brightfield photomi-crographs of serial 5-µm sections of L5 dorsal root ganglion (DRG)processed for in situ hybridization with probes to detect mRNAs fortrkA, trkB (full-length), and trkC (full-length) as indicated. For eachpair of probes examined, stars indicate examples of neurons notlabeled for either mRNA, whereas solid arrows depict neurons express-ing abundant mRNA for both trks, and the open arrow indicatesmoderate levels of labeling for one trk with only low level of expressionfor the other. Scatterplots show quantification of colocalization of trk

receptor mRNA expression. Hybridization signal was quantified for334–395 identified neurons in adjacent sections of L5 DRG processedfor in situ hybridization by using probes to detect mRNAs for trkA,trkB (full-length) and trkC (full-length) as indicated. Dashed linesrepresent points on log scale that are 5 times background labeling.Data points in upper right quadrants of the graphs represent neuronsthat express detectable levels of mRNA for both markers. Scale bars 520 µm.

mately 74% of DRG neurons to express at least onefull-length form of trk receptor mRNA.

Some neurons may express only truncatedtrk receptors

Adjacent 5-µm DRG sections were hybridized with mix-tures of 35S-labeled oligonucleotide probes which detecteither all of the full-length forms of the neurotrophin

receptors trkA, trkB, and trkC (trkFULL mix) or all knownisoforms of these receptors, both truncated and full-length(trkALL mix). Colocalization analysis was performed todetermine whether some neurons express only truncatedtrk receptors. Radioautograms reveal low to high levels oflabeling for both mixtures of probes in all size ranges ofDRG neurons (Fig. 4), although there was a tendency todetect fewer small neurons due to the difficulty in trilocal-

Fig. 3. Colocalization of trkB and trkC mRNA expression andhybridization controls. Top: Brightfield photomicrographs of serial5-µ m sections of L5 dorsal root ganglion (DRG) processed for in situhybridization with probes to detect mRNAs for trkA, trkB (full-length), and trkC (full-length) as indicated. Stars indicate a neuronnot labeled for either mRNA; solid arrows depict neurons expressingabundant hybridization signal for both trkB and trkC, whereas theopen arrow shows a neuron with moderate levels of labeling for trkCand only a low level of expression for trkB. Middle: Scatterplot showsthe degree of colocalization between trkB (full-length) and trkC(full-length) receptor mRNA expression. Hybridization signal wasquantified for 295 identified neurons in adjacent sections of L5 DRG

processed for in situ hybridization by using trk receptor probes asindicated. Dashed lines represent points on log scale that are 5 timesbackground labeling. Data points in upper right quadrant of the graphrepresent neurons that express detectable levels of mRNA for bothmarkers. Bottom: Hybridization controls; 5-µm serial sections oflumbar DRG associated with intact nerve were hybridized withlabeled trkC probe (left) plus either a 1,0003 excess of cold, unlabeledtrkC probe (middle) or a 1,0003 excess of a dissimilar probe of similarG-C content. Note that the addition of cold trkC probe abolishes thehybridization signal, whereas addition of a dissimilar cold probe doesnot influence the pattern of hybridization. Scale bars 5 20 µm for top;80 µm for bottom.


izing this size of cell in three consecutive sections. Mostcells (92–94%) in the DRG display greater than 5 timesbackground levels of labeling using the mixture trkALL.This population estimation may be inaccurately high from

potential false-positive identification of labeled neuronsdue to the scatter of hybridization signal from perineuro-nal cells which express trkB mRNA for the truncated formof the receptor. Only 64–66% of the same cells have more

Fig. 4. Expression of trk receptors and p75 mRNA. Left: Bright-field photomicrographs of adjacent L5 dorsal root ganglion (DRG)sections processed for in situ hybridization using a mixture of trkA-,trkB-, and trkC-labeled probes to detect either trk receptors with thetyrosine kinase domain (trkFULL), all known transcripts of the trkreceptors (trkALL), or the common neurotrophin receptor, p75. Solidarrows show examples of neurons expressing abundant message forall three markers, whereas the open arrows depict neurons expressing

low levels of p75 in comparison to the trk mixes. Right: Scatterplotsquantify size and labeling indices of all identifiable neurons in DRGsections processed for in situ hybridization with probes as indicated ony-axis. Dashed lines represent points on log scale that are 5 timesbackground labeling. Data points above this line represent neuronsconsidered to express detectable levels of mRNA for individual probes.Note, there is a population of primarily small neurons that does not expressdetectable p75 or trkFULL mRNAs. Scale bar 5 20 µm.


than 5 times background labeling using the mixture thatdetects full-length trk receptors. A tight positive correla-tion between the two mixes of trk receptor probes exists, asdemonstrated in the scatterplot and three-dimensionalhistogram (Fig. 5). This result was expected because themRNAs detected by the trkFULL mix should be a subset of

those recognized by the trkALL mix. The difference be-tween the number of neurons displaying hybridizationsignal to the trkALL and trkFULL probe mixes mayrepresent a population of DRG neurons expressing weakmessage levels for truncated isoforms of the trk receptorsin the absence of full length forms or may result fromdetection of scattered signal from truncated forms onperineuronal cells. Those neurons which do not expresseither a full-length or truncated trk receptor are small tomedium-sized (Fig. 4).

p75 and full-length trk receptor expressionare tightly correlated

Colocalization studies reveal a positive correlation be-tween expression of p75 and the labeling of neurons witheither the trkALL or trkFULL mixes. p75 mRNA isdetected in approximately 79% of DRG neurons and thisexpression includes all size ranges and labeling densities(Fig. 4). Quantification of adjacent sections hybridizedwith p75 or trkALL mix probes show that only a few cellsexpress p75 in the absence of some form of a trk receptor,whereas the full-length forms of the trk receptors appearto be very rarely expressed without p75. The converse isnot true. Approximately 22% of p75 mRNA-positive neu-rons, which represent 17% of DRG neurons, do not expressdetectable hybridization signal with the trkFULL mix(Fig. 5). These neurons express p75 predominantly only atlow levels (,103 background).

trkA isoforms are coexpressed in lumbarsensory neurons

There does not appear to be a preferential expression ofone isoform over the other in either lumbar dorsal rootganglia or the superior cervical ganglion (data not shown).Two sets of serial sections from different animals wereanalyzed (198–248 neurons/section/plot). Expression pat-terns and the proportion of neurons expressing eitherdetectable trkA INS (insert) or trkA NO INS (noninsert)mRNAs are in agreement with that shown in Figure 1where the probe had the ability to detect both isoforms.Neuronal expression of both isoforms is most prevalent insmall to medium-sized cells, but does not exclude expres-sion in large neurons (Fig. 6). Approximately 39% of thecells express detectable mRNA for either trkA isoform andcolocalization analysis shows that ,91% of the labeledcells express both isoforms (Fig. 6). Relative levels ofexpression also appear to be positively correlated. In theoccasional neuron which expresses one isoform to theexclusion of the other, the level of hybridization signal isusually low (,103 background) and thus this raises thepossibility that the sections were not exposed long enoughfor detection of the other isoform.

Full-length trkC isoform expression is notlocalized to distinct populations

Expression of all three full-length trkC isoforms isdetected in predominantly medium-sized to large neurons(Fig. 7) as predicted from the data in Figure 1 which used aprobe that recognizes all three trkC isoforms. Two sets ofserial sections from different animals were analyzed (196–224 neurons/section/plot). The trkC NO INS, trkC i14, andtrkC i39 mRNA isoforms are expressed in approximately42%, 35%, and 27% of the population, respectively. Al-

Fig. 5. Colocalization of trk receptors and p75 mRNA from adja-cent L5 dorsal root ganglion (DRG) sections processed for in situhybridization by using a mixture of trkA-, trkB-, and trkC-labeledprobes to detect either all known transcripts of the trk receptors(trkALL), those with the tyrosine kinase domain (trkFULL), or thecommon neurotrophin receptor, p75. Representative scatterplots quantifylabeling of identified neurons in adjacent sections with probes indicated onx- and y-axis. Dashed lines represent point on log scale that is 5 timesbackground labeling. Data points in upper right quadrants of scatterplotsrepresent neurons that express detectable mRNA for both markers andthus represent the degree of colocalization for the two.


though there is more variability in levels of detectableexpression for both trkC insert isoforms, expression isalmost always colocalized with the noninsert trkC isoformand relative levels of expression appear to be positivelycorrelated (Fig. 7).

DISCUSSION

A detailed understanding of the populations of sensoryneurons that express the receptors for neurotrophins isfundamental for predicting and deciphering the roles of

Fig. 6. Expression and colocalization of trkA isoforms. Top: Bright-field photomicrographs of serial 6-µm sections of L5 dorsal rootganglion (DRG) processed for in situ hybridization with probes todetect mRNAs for trkA without insert (trkA NO INS) or trkA with a6-amino acid (a.a.) insert (trkA INS). Note the strong degree ofcolocalization of the two messages and similar levels of labelingintensities. Bottom: Representative scatterplots to quantify labelingand volume of 198–248 identified neurons in serial sections processed

for in situ hybridization to detect mRNAs for trkA NO INS or trkA INSas indicated. Dashed lines represent points on the log scale that are 5times background labeling. Data points above these lines representneurons considered to express detectable levels of mRNA for theindividual neurotrophin receptor probes used. In the trkA NO INS vs.INS plot, data points in upper right quadrants of the graphs representneurons that express detectable levels of mRNA for both markers, indicat-ing that the two messages are highly colocalized. Scale bar 5 20 µm.


these molecules in DRG neurons under normal and patho-logical conditions. With the exception of trkA, there arelarge variations in the reported subpopulations of adultlumbar sensory neurons that express neurotrophin trkreceptors (McMahon et al., 1994; Kashiba et al., 1995;Wetmore and Olson, 1995). The inability to detect specificlabeling over cells may be a consequence of the threshold ofdetection inherent to the techniques used. By hybridizingeach DRG section with only one probe, we attempted tooptimize detection of individual mRNAs. Furthermore, theuse of thin sections and prolonged exposure times facili-tated the identification of the same neuron in serialsections and resolution of hybridization signal (silvergrains) associated with a specific cell (Saltpeter et al.,1969).

This study provides the first direct anatomical evidencethat the majority of neurotrophin-responsive adult lumbarprimary sensory neurons may regulate phenotype in acomplex fashion by interacting with more than one neuro-trophin, as shown by the expression of two or more of thecognate high-affinity trk receptor mRNA along with p75receptor mRNA and the expression of a trkA isoformcapable of interacting with NT-3 in most, if not all, neuronsdetermined to be trkA mRNA-positive. More specifically,the experiments confirm and extend previous findings bydemonstrating that: (1) mRNAs encoding trkA, trkB, trkC(full-length receptor forms with tyrosine-kinase domain),and p75 are restricted to select subpopulations represent-ing approximately 41%, 33%, 43%, and 79% of DRGneurons, respectively; (2) trkA and trkB mRNA are coex-pressed in approximately 10% of DRG neurons with 19%coexpressing trkA and trkC mRNA and 18% coexpressingtrkB and trkC mRNA; (3) trilocalization of all trk mRNAsis rare with only 3–4% of primarily medium-sized to largeDRG neurons in this category, consistent with the sizeranges found to be mutual among the individual trk-expressing neurons; (4) approximately 26% of DRG neu-rons (small to medium in size) do not express detectablefull- length trk receptor mRNA; (5) colocalization studiesusing mixes of probes detecting either all forms or just thefull-length catalytic isoforms of trk receptors suggest someneurons may express a truncated form of trk receptor onlyat low levels; (6) full-length trk receptor mRNA is rarelydetected without p75, implicating it in the neuronal re-sponse to neurotrophins; (7) full- length trkA isoforms arecoexpressed in the same cells; and (8) the full-length trkCisoform without any kinase domain insert is expressed in asimilar percentage of neurons as described in this studywith a probe capable of detecting all full-length isoforms.Those isoforms containing 39-a.a. or 14-a.a. inserts arecoexpressed in neurons with the trkC noninsert isoformbut the percentages of the populations expressing themare variable.

Results regarding cell size distributions of adult ratDRG neurons expressing mRNA for the trks are in broadagreement with previous findings (DiStefano et al., 1992;Mu et al., 1993; McMahon et al., 1994; Kashiba et al., 1995;Wetmore and Olson, 1995; Wright and Snider, 1995). Withthe exception of one study (Kashiba et al., 1995), determi-nation of the trkA expressing subpopulation is consistentlywithin the 40–45% range (Verge et al., 1992; McMahon etal., 1994; Averill et al., 1995; Wetmore and Olson, 1995). Inthis study, differences with past reports arise largely fortrkB and trkC population estimates in lumbar DRG.

Previously, trkB mRNA has been reported as low as 5%(Kashiba et al., 1995) and 8% (Mu et al., 1993) and as highas 26–27% of DRG neurons (McMahon et al., 1994; Wet-more and Olson, 1995). The findings of this study showhigher percentages for the trkB population compared toothers. Estimates of the trkC subpopulation differ moregreatly ranging from 9% of all lumbar DRG neurons (Mu etal., 1993) to 17% (McMahon et al., 1994) and 15–21%(Kashiba et al., 1995; Wetmore and Olson, 1995). Inaddition to significantly higher percentages for the trkCpopulation, this study includes small neurons in the trkCpopulation description not reported by other studies. Be-cause trk population sizes differ between reports, it is notsurprising that little agreement has been made regardingthe extent of overlap between each of the trk receptorpopulation. Discrepancies in the size of subpopulationsexpressing trkB and trkC mRNA in lumbar DRG mayresult in underestimation of the extent to which they arecoexpressed with trkA and each other. In addition tofull-length trk receptor mRNA expression, a population ofneurons and perineuronal cells exist in the DRG that mayexpress only the truncated isoform of either trkB or trkCat low levels. Expression of noncatalytic isoforms mayproduce high local concentrations of neurotrophins, pre-vent their spread to inappropriate regions of the nervoussystem by acting as a sink for degradation, have dominantnegative roles or mediate signal transduction events (Lind-say et al., 1994; Biffo et al., 1995; Eide et al., 1996; Ninkinaet al., 1996; Baxter et al., 1997; Palko et al.,1999).

Coexpression of trk receptors is more prevalent thanexpression of individual trk receptors in adult rat lumbarDRG neurons. Taking into account the degree of colocaliza-tion of any two of the receptors or trilocalization of allthree, it is concluded that approximately 74% of DRGneurons express at least one member of the trk receptorfamily. This study finds that approximately 40% of DRGneurons express more than one trk receptor mRNA,whereas individual trk expression occurs in only 34% ofthe population. This result was initially surprising in lightof other studies which conclude that, with the exception oftrkB (McMahon et al., 1994), trk receptor expression isrestricted to largely distinct subpopulations of sensoryneurons (Mu et al., 1993; McMahon et al., 1994; Kashiba etal., 1995; Wright and Snider, 1995), but not so when thelarger trkB and trkC populations detected in this studyare factored in. In addition, data from this study supportthe possibility that NT-3’s role may extend beyond neuronsexpressing trkC to include the entire trkA populationwhich expresses an insert- containing splice variant thatenhances signaling by NT-3 (Barker et al., 1993; Clary andReichardt, 1994).

These data provide support for modulation of phenotypeand presumably function by multiple neurotrophins in asignificant portion of adult lumbar DRG neurons. Expres-sion of a neurotrophin receptor may not necessitate a rolefor the neurotrophin in mediating survival of the cell butrather for other aspects of its signal transduction cascadeor phenotype, such as that shown by the regulation ofacetylcholine sensitivity by NGF in nodose sensory neu-rons (Mandelzys et al., 1990) and the role of BDNF andNT-3 in signal transduction rather than survival in hippo-campal pyramidal neurons (Marsh and Palfrey, 1996).Also, it appears that slow adapting mechanoreceptors of


Figure 7


the DRG require NT-3 for postnatal survival, but BDNFfor normal function of mechano-transduction (Lewin, 1996).

The ability to respond to more than one neurotrophinmay lead to the differential regulation of downstreammolecules in the ensuing signal transduction cascadewhich would result in outcomes not observed by theactivation of an individual trk receptor. For example, NT-3and BDNF together, but not singularly, can positivelyregulate substance P (SP) expression following injury(Zhang et al., 1995). Alternatively, one neurotrophin maymodulate the ability of a neuron to respond to anotherneurotrophin, as has been suggested by the ability of NT-3to affect downregulation of trkA expression, NGF high-affinity binding sites, and SP with the effect on trkA beingmost notable in the DRG neurons coexpressing trkA andtrkC (Gratto and Verge, 1997, unpublished observations).Our finding that the trkA insert isoform is also expressedin neurons that have been classified in our past studies astrkA-positive (Verge et al., 1992) provides an alternatepathway in addition to trkC for NT-3 to alter NGFresponsiveness in these cells, and preliminary resultssuggest that the modulation of trkA expression by NT-3may be trkA isoform-selective (Gratto and Verge, unpub-lished observations). In sympathetic neurons, a role forNT-3 in mediating neuritogenesis, induction of ta1 mRNAbut not influencing survival, cell body hypertrophy or p75receptor induction as does NGF, is an example of how NGFand NT-3 may differentially act via presumably the sametrkA receptor isoform (Belliveau et al., 1997). Studies haveshown that activation of the trkC isoforms possessing thekinase inserts may alter the ability of neurons to undergoneuritogenesis in response to neurotrophin exposure and,depending on the cell type, reduce kinase activity (Tsoulfaset al., 1993, 1996; Meakin et al., 1997). Our studies alsoreveal that these isoforms are coexpressed with the nonin-sert isoform of trkC and, as such, their activation by NT-3may dampen the kinase activity affected by NT-3 activat-ing the noninsert isoform. What function these insertisoforms subserve in mature sensory neurons is unknown;however, all of the trkA and trkC isoforms analyzed in thisstudy are downregulated in response to peripheral nerveinjury and upregulated toward normal in response todelayed intrathecal infusion of NGF or NT-3, respectively

(Kim and Verge, unpublished observations). Thus, in re-gards to injury, the isoforms do not appear to be differen-tially regulated.

Despite extensive coexpression of trk receptors, wesuggest that single neurotrophins may act as primarydrivers of functionally distinct subpopulations of matureDRG neurons, because many of the neurons coexpress trkreceptors such that one trk is expressed at much higherlevels than the other. In addition, there are significantportions of the DRG population, namely 16%, 9%, and10%, that express trkA, trkB, and trkC to the exclusion ofthe others. The coexpression of low levels of another trk, orisoforms that allow response to another neurotrophin, mayconfer the ability to switch phenotype under such pathologi-cal states as inflammation when levels of neurotrophinsavailable to the afferents are altered (Neumann et al.,1996). We found a population of small to medium-sizedneurons representing approximately 26% of DRG neuronsthat do not express detectable levels of any member of theneurotrophin receptor family. This is in agreement withthe finding of others (McMahon et al., 1994; Wright andSnider, 1995) and it has been deduced that non-trk-expressing cells are those that bind the isolectin BSI-B4(Averill et al., 1995; Molliver et al., 1995), terminate in theregion of the spinal cord involved in nociceptive process-ing, and respond to glial-derived neurotrophic factor (Ben-nett et al., 1997).

The response of neurons to single and multiple neuro-trophins may be further influenced by p75. This studyshows detectable p75 expression in virtually all of neuronsexpressing full-length trk receptor mRNA. Although theexperiments do not address whether p75/trk mRNA ratiosare tightly held in the different trk-expressing subpopula-tions, previous studies have shown this to be the case forthe trkA (Verge et al., 1992) but others find it colocalized inonly half of the thoracic DRG trkC population (Wright andSnider, 1995), whereas we find p75 mRNA expressionbeing detectable in virtually all lumbar DRG trkC-expressing neurons (Verge et al., 1996). The ability of allneurotrophins to bind p75 may allow other neurotrophinsto alter ratios of available p75/trk, selectively activate thep75 pathway, or deter optimal neurotrophin receptor inter-actions. The function of p75 in mediating the response ofneurons may be multifold. In the absence of trk expres-sion, p75 receptor activation may mediate apoptosis (Rabi-zadeh et al., 1993; Barrett and Bartlett, 1994; Dobrowskyet al., 1994; Van der Zee et al., 1996; Frade et al., 1996),whereas coexpression with trks may enhance the sensitiv-ity of neurons to the neurotrophins (Barker and Shooter,1994; Hantzopoulos et al., 1994; Lee et al., 1994) bycreating an ability to bind the neurotrophins with higheraffinity than that observed with trk expression alone(Hempstead et al., 1991; Karchewski and Verge, 1997;Ross et al., 1998). Furthermore, the binding of one neuro-trophin to p75 may affect diminished signaling at a trkreceptor (MacPhee and Barker 1997).

In conclusion, it is believed that the presence of multipleneurotrophin receptors on a sensory neuron allow it torespond to a variety of neurotrophins which may playimportant and subtle roles in modulating specific pheno-type. Overlap in these neurotrophin-responsive popula-tions exposes the potential for convergent or divergentsignaling pathways, the full significance of which remainsto be elucidated.

Fig. 7. Expression and colocalization of trkC isoforms. Top: Bright-field photomicrographs of serial 6-µm sections of L5 dorsal rootganglion (DRG) processed for in situ hybridization with probes todetect mRNAs for trkC without insert (trkC NO INS), trkC with a14-amino acid (a.a.) insert (trkC i14), or trkC with a 39-a.a. insert(trkC i39). Note the strong degree of colocalization of the threemessages. Bottom left: Representative scatterplots to quantify label-ing and volume of 196–224 identified neurons in serial sectionsprocessed for in situ hybridization to detect mRNAs for trkC NO INS,trkC i14, or trkC i39 as indicated. Dashed lines represent points on thelog scale that are 5 times background labeling. Data points abovethese lines represent neurons considered to express detectable levelsof mRNA for the individual neurotrophin receptor probes used andshow this expression to be primarily in the medium-sized to largeneurons. Bottom right: Representative scatterplots to show quantifi-cation of colocalization of trkC receptor mRNA isoform expression.Hybridization signal was quantified for 196–224 identified neurons inadjacent sections of L5 DRG processed for in situ hybridization byusing probes to detect mRNAs as indicated. Dashed lines representpoints on log scale that are 5 times background labeling. Data pointsin upper right quadrants of the graphs represent neurons that expressdetectable levels of mRNA for both markers. Scale bar 5 20 µm.


ACKNOWLEDGMENTS

This work was supported by a Canadian Medical Re-search Council grant 12060 awarded to V.M.K.V., Univer-sity of Saskatchewan Graduate Student and College ofMedicine Arthur Smyth Scholarships to L.A.K., and anMRC Scholarship to V.M.K.V. We thank K.A. Gratto forvaluable insights.

LITERATURE CITED

Averill S, McMahon SB, Clary DO, Reichardt LF, Priestley JV. 1995.Immunocytochemical localization of trkA receptors in chemically identi-fied subgroups of adult rat sensory neurons. Eur J Neurosci 7:1484–1494.

Barde YA, Edgar D, Thoenen H. 1982. Purification of a new neurotrophicfactor from brain. EMBO J 1:549–553.

Barker PA, Shooter EM. 1994. Disruption of NGF binding to the low affinityneurotrophin receptor p75LNTR reduces NGF binding to trkA on PC12cells. Neuron 13:203–215.

Barker PA, Lomen-Hoerth C, Gensch EM, Meakin SO, Glass DJ, ShooterEM. 1993. Tissue-specific alternative splicing generates two isoforms ofthe trk A receptor. J Biol Chem 268:15150–15157.

Barrett GL, Bartlett PF. 1994. The p75 nerve growth factor receptormediated survival or death depending on the stage of sensory neurondevelopment. Proc Natl Acad Sci USA 91:6501–6505.

Baxter GT, Radeke MJ, Kuo RC, Makrides V, Hinkle B, Hoang R,Medina-Selby A, Coit D, Valenzuela P, Feinstein SC. 1997. Signaltransduction mediated by the truncated trkB receptor isoforms, trkB.T1and trkB.T2. J Neurosci 17:2683–2690.

Belliveau J, Krivko I, Kohn J, Lachance C, Pozniak C, Rusakov, Kaplan D,Miller FD. 1997. NGF and neurotrophin-3 both activate trkA onsympathetic neurons and differentially regulate survival and neurito-genesis. J Cell Biol 136:375–388.

Bennett DLH, Ramachandran N, Priestly JV, McMahon SB. 1997. GDNF isa trophic factor for the neurotrophin independent population of adultsensory neurons. Soc Neurosci Abstr 23:619.

Berkemeier LR, Winslow JW, Kaplan DR, Nikolics D, Goeddel DV, Rosen-thal A. 1991. Neurotrophin-5: a novel neurotrophic factor that activatestrk and trkB. Neuron 7:857–866.

Biffo S, Offenhauser N, Carter BD, Barde YA. 1995. Selective binding andinternalisation by truncated receptors restrict the availability of BDNFduring development. Development 121:2461–2470.

Carter BD, Zirrgiebel U, Barde YA. 1995. Differential regulation of p21ras

activation in neurons by nerve growth factor and brain-derived neuro-trophic factor. J Biol Chem 270:21751–21757.

Clary DO, Reichardt LF. 1994. An alternatively spliced form of the nervegrowth factor receptor trkA confers an enhanced response to neuro-trophin 3. Proc Natl Acad. Sci USA 91:11133–11137.

Dagerlind A, Friberg K, Bean AJ, Hokfelt T. 1992. Sensitive mRNAdetection using unfixed tissue: combined radioactive and non-radioac-tive in situ hybridization histochemistry. Histochemistry 98:39–49.

DiStefano PS, Friedman B, Radziejewski G, Alexander C, Boland P, SchichCM, Lindsay RM, Wiegand SJ. 1992. The neurotrophins BDNF, NT-3and NGF display distinct patterns of retrograde transport in peripheraland central neurons. Neuron 8:983–993.

Dobrowsky RT, Werner MH, Castellino AM, Chao MV, Hannun YA. 1994.Activation of the sphingomyelin cycle through the low-affinity neuro-trophin receptor. Science 265:1596–1599.

Eide FF, Vining ER, Eide BL, Zang K, Wang XY, Reichardt LF. 1996.Naturally occurring truncated trkB receptors have dominant inhibitoryeffects on brain-derived neurotrophic factor signaling. J Neurosci16:3123–3129.

Ernfors P, Ibanez CF, Ebendal T, Olson L, Persson H. 1990. Molecularcloning and neurotrophic activities of a protein with structural similari-ties to nerve growth factor: developmental and topographical expres-sion on the brain. Proc Natl Acad Sci USA 87:5454–5458.

Ernfors P, Rosario CM, Merlio JP, Grant G, Aldskogius H, Persson H. 1993.Expression of mRNAs for neurotrophin receptors in the DRG and spinalcord during development and following peripheral or central axotomy.Mol Brain Res 17:217–226.

Frade JM, Rodriguez-Tebar A, Barde YA. 1996. Induction of cell death byendogenous nerve growth factor through its p75 receptor. Nature383:166–168.

Gratto KA, Verge VMK. 1997. Exogenous NT-3 downregulates trkA in thesubpopulation of DRG neurons coexpressing trkA and trkC mRNAs. SocNeurosci Abstr 23:1435.

Hallbook F, Ibanez C, Persson H. 1991. Evolutionary studies of the nervegrowth factor family reveal a novel member abundantly expressed inxenopus ovary. Neuron 6:845–858.

Hantzopoulos PA, Suri C, Glass DJ, Goldfarb MP, Yancopoulos GD. 1994.The low affinity NGF receptor, p75, can collaborate with each of the trksto potentiate functional responses to the neurotrophins. Neuron 13:187–201.

Hempstead BL, Martin-Zanca D, Kaplan DR, Parada LF, Chao MV. 1991.High-affinity NGF binding requires coexpression of the trk proto-oncogene and the low-affinity NGF receptor. Nature 350:678–683.

Hohn A, Leibrock J, Bailey K, Barde YA. 1990. Identification and character-ization of a novel member of the nerve growth factor/brain-derivedneurophic factor family. Nature 344:339–341.

Ip NY, Stitt TN, Tapley P, Klein R, Glass DJ, Fandl J, Green LA, BarbacidM, Yancopoulos GD. 1993. Similarities and differences in the wayneurotrophins interact with trks in neuronal and nonneuronal cells.Neuron 10:137–149.

Johnson D, Lanahan A, Buck CR, Sehgal A, Morgan C, Mercer E, BothwellM, Chao MV. 1986. Expression and structure of the human NGFreceptor. Cell 47:545–554.

Jones KG, Reichardt LF. 1990. Molecular cloning of a human gene that is amember of the NGF factor family. Proc Natl Acad Sci USA 87:8060–8064.

Kaplan DR, Hempstead BL, Martin-Zanca D, Chao MV, Parada LF. 1991.The trk proto-oncogene product: a signal transducing receptor for nervegrowth factor. Science 252:554–558.

Karchewski LA, Verge VMK. 1997. Modified injury response in p75 KOmice may be influenced by altered ability to bind NGF. Soc NeurosciAbstr 23:339.

Kashiba H, Noguchi K, Ueda Y, Senba E. 1995. Coexpression of trk familymembers and low-affinity neurotrophin receptors in rat dorsal rootganglion neurons. Mol Brain Res 30:158–164.

Klein R, Martin ZD, Barbacid M, Parada LF. 1990. Expression of thetyrosine kinase receptor gene trkB is confined to the murine embryonicand adult nervous system. Development 109:845–850.

Klein R, Jing S, Nanduri V, O’Rourke E, Barbacid M. 1991. The trkprotooncogene encodes a receptor for nerve growth factor. Cell 65:189–197.

Lamballe F, Klein R, Barbacid M. 1991. TrkC, a new member of the trkfamily of tryosine protein kinases, is a receptor for NT-3. Cell 66:967–979.

Lee KF, Davies AM, Jaenisch R. 1994. p75-deficient embryonic dorsal rootsensory and neonatal sympathetic neurons display a decreased sensitiv-ity to NGF. Development 120:1027–1033.

Leibrock J, Lottspeich F, Hohn A, Hofer M, Hengerer B, Masaikowski P,Thoenen H, Barde YA. 1989. Molecular cloning and expression ofbrain-derived neurotrophic factor. Nature 341:149–152.

Levi-Montalcini R, Angeletti PU. 1968. Nerve growth factor. Physiol Rev48:534–569.

Lewin G. 1996. Neurotrophins and the specification of neuronal phenotype.Phil Trans R Soc Lond B 351:405–411.

Lindsay RM, Wiegard SJ, Altar CA, DiStefano PS. 1994. Neurotrophicfactors: from molecule to man. Trends Neurosci 17:182–190.

MacPhee IJ, Barker PA. 1997. Brain-derived neurotrophic factor binding tothe p75 neurotrophin receptor reduces trkA signaling while increasingserine phosphorylation in the trkA intracellular domain. J Biol Chem272:23547–23551.

Maisonpierre PC, Belluscio L, Squinto S, Ip NY, Furth ME, Lindsay RM,Yancopoulus GD. 1990. Neurotrophin-3: a neurotrophic factor related toNGF and BDNF. Science 247:1446–1451.

Mandelzys A, Cooper E, Verge VMK, Richardson PM. 1990. Nerve growthfactor induces functional nicotinic acetylcholine receptors on rat sen-sory neurons in culture. Neuroscience 37:523–530.

Marsh HN, Palfrey HC. 1996. Neurotrophin-3 and brain-derived neuro-trophic factor activate multiple signal transduction events but are notsurvival factors for hippocampal pyramidal neurons. J Neurochem67:952–963.

McMahon SB, Armanini MP, Lanway HL, Phillips HS. 1994. Expressionand coexpression of trk receptors in subpopulation of adult primarysensory neurons projecting to identified peripheral targets. Neuron12:1161–1171.

Meakin SO, Suter U, Drinkwater CC, Welcher AA, Shooter EM. 1992. The


rat trk protooncogene exhibits properties characteristic of the slow NGFreceptor. Proc Natl Acad Sci USA 89:2374–2378.

Meakin SO, Gryz EA, MacDonald JIS. 1997. A kinase insert isoform of rattrkA supports nerve growth factor-dependent cell survival but notneurite outgrowth. J Neurochem 69:954–967.

Merlio JP, Ernfors P, Jaber M, Persson H. 1992. Molecular cloning of the rattrkC and identification of cells expressing mRNAs for members of thetrk family in the rat central nervous system. Neuroscience 51:513–532.

Middlemas DS, Lindberg RA, Hunter T. 1991. TrkB, a neural receptorprotein-tyrosine kinase: evidence for a full-length and two truncatedreceptors. Mol Cell Biol 11:143–153.

Molliver DC, Radeke MJ, Feinstein SC, Snider WD. 1995. Presence orabsence of trkA protein distinguishes subsets of small sensory neuronswith unique cytochemical characteristics and dorsal horn projections. JComp Neurol 361:404–416.

Mu X, Silos-Santiago I, Carroll SL, Snider WD. 1993. Neurotrophinreceptor genes are expressed in distinct patterns in developing dorsalroot ganglia. J Neurosci 13:4029–4041.

Neumann S, Doubell T, Leslie T, Woolf C. 1996. Inflammatory painhypersensitivity mediated by phenotypic switch in myelinated primarysensory neurons. Nature 384:360–364.

Ninkina N, Adu J, Fischer A, Pinon LGP, Buchman VL, Davies AM. 1996.Expression and function of trkB variants in developing sensory neu-rons. EMBO J 15:6385–6393.

Palko ME, Coppola V, Tessarollo L. 1999. Evidence for a role of truncatedtrkC receptor isoforms in mouse development. J Neurosci 19:775–782.

Press WH, Flannery BP, Teukolsky SA, Vetterling WT. 1988. Numericalrecipes in C. Cambridge: Cambridge UP.

Rabizadeh S, Oh J, Zhong L, Yang J, Bitler C, Butcher L, Bredesen D. 1993.Induction of apoptosis by the low-affinity NGF receptor. Science 261:345–348.

Radeke MJ, Misko TP, Hsu C, Herzenberg LA, Shooter EM. 1987. Genetransfer and molecular cloning of the rat nerve growth factor receptor.Nature 325:593–597.

Richardson PM, Verge VMK, Riopelle RJ. 1989. Quantitative radioautogra-phy for NGF receptors. In: Rush RA, editor. Nerve growth factors.London: John Wiley & Sons. p 315–326.

Rodriguez-Tebar A, Dechant G, Barde YA. 1990. Binding of brain-derivedneurotrophic factor to the nerve growth factor receptor. Neuron 4:487–492.

Rosenthal AV, Nguyen T, Lewis M, Shih A, Laramee GR, Nikolics K,Winslow JW. 1990. Primary structure and biological activity of a novelhuman neurotrophic factor. Neuron 4:767–773.

Ross GM, Shamovsky IL, Lawrance G, Solc M, Dostaler SM, Weaver DF,Riopelle RJ. 1998. Reciprocal modulation of trkA and p75NTR affinitystates is mediated by direct receptor interactions. Eur J Neurosci10:890–898.

Saltpeter M, Bachmann L, Saltpeter EE. 1969. Resolution in electronmicroscope radioautography. J Cell Biol 41:1–20.

Soppet D, Escandon E, Maragos J, Middlemas DS, Reid SW, Blair J, BurtonLE, Squinto SP, Stitt TN, Aldrich TH, Davis S, Bianco SM, Radziejew-ski C, Glass DJ, Masaikowski P, Furth ME, Valenzuela DM, DiStefanoPS, Yancopoulos GD. 1991. TrkB encodes a functional receptor forbrain-derived neurotrophic factor and neurotrophin-3 but not nervegrowth factor. Cell 65:885–893.

Tsoulfas P, Soppet D, Escandon E, Tessarollo L, Mendoza-Ramirez JL,Rosenthal A, Nikolics K, Parada LF. 1993. The rat trkC locus encodesmultiple neurogenic receptors that exhibit differential response toneurotrophin-3 in PC12 cells. Neuron 10:975–990.

Tsoulfas P, Stephens RM, Kaplan DR, Parada LF. 1996. TrkC isoforms withinserts in the kinase domain show impaired signaling responses. J BiolChem 271:5691–5697.

Valenzuela DM, Maisonpierre PC, Glass DJ, Rojas E, Nunez L, Kpng Y,Gies DR, Stitt TN, Ip NY, Yancopoulos GD. 1993. Alternative forms ofrat trkC with different functional capabilities. Neuron 10:963–974.

Van der Zee C, Ross G, Riopelle RJ, Hagg T. 1996. Survival of cholinergicforebrain neurons in developing p75-deficient mice. Science 274:1729–1732.

Verge VMK, Merlio JP, Grondin J, Ernfors P, Persson H, Riopelle RJ,Hokfelt T, Richardson PM. 1992. Colocalization of NGF binding sites,trk mRNA and low affinity NGF receptor mRNA in primary sensoryneurons: responses to injury and infusion of NGF. J Neurosci 12:4011–4022.

Verge VMK, Gratto KA, Karchewski LA, Richardson PM. 1996. Neurotroph-ins and nerve injury in the adult. Phil Trans R Soc Lond B 351:423–430.

Wetmore C, Olson L. 1995. Neuronal and nonneuronal expression ofneurotrophins and their receptors in sensory and sympathetic gangliasuggest new intercellular trophic interactions. J Comp Neurol 353:143–159.

Wright DE, Snider WD. 1995. Neurotrophin receptor mRNA expressiondefines distinct populations of neurons in rat dorsal root ganglia. JComp Neurol 351:329–338.

Zhang Q, Ji RR, Lindsay R, Hokfelt T. 1995. Effect of growth factors onsubstance P mRNA expression in axotomized dorsal root ganglia.NeuroReport 6:1309–1312.


Documents

Anatomical evidence supporting the potential for modulation by multiple neurotrophins in the majority of adult lumbar sensory neurons