Altered protein kinase a in brain of learned helpless rats: effects of acute and repeated stress

ARY

BppdM4aRroCa

Kk

DpDsyc

pPwthsoraeedecdrsali

F

A

R

0d

ltered Protein Kinase A in Brain of Learned Helplessats: Effects of Acute and Repeated Stress

ogesh Dwivedi, Amal C. Mondal, Pradeep K. Shukla, Hooriyah S. Rizavi, and Jennifer Lyons

ackground: Stress-induced learned helplessness (LH) in animals serves as a model of behavioral depression and some aspects ofosttraumatic stress disorder. We examined whether LH behavior is associated with alterations in protein kinase A (PKA), a criticalhosphorylating enzyme, how long these alterations persist after inescapable shock (IS), and whether repetition of IS prolongs theuration of LH behavior and changes in PKA.ethods: Rats were exposed to IS either on day 1 or twice, on day 1 and day 7. Rats were tested for escape latency on days 2 andafter day 1 IS or days 2, 8, and 14 after day 1 and day 7 IS. [3H]cAMP (cyclic adenosine monophosphate) binding, catalytic activitynd expression of PKA subunits were determined in frontal cortex and hippocampus.esults: Higher escape latencies were observed in rats tested on day 2 after single IS and on day 14 after repeated IS. Concurrently,

educed [3H]cAMP binding, PKA activity, and expression of selective PKA RII� and C� and C� subunits were observed in the brainsf these rats.onclusions: Repeated IS prolongs the duration of LH behavior, and LH behavior is associated with reductions in apparent activitynd expression of PKA. These reductions in PKA may be critical in the pathophysiology of depression and other stress-related disorders.

ey Words: Behavior, depression, learned helplessness, proteininase A, stress

epression is a major public health concern. The lifetimeprevalence rate for depression is about 5%–19% (Kessleret al 1994; Robins et al 1984); of those depressed

atients, 50%–85% experience multiple episodes (Consensusevelopment Panel 1985). Depression is a major symptom of

uicidal behavior (Mann 1998; Soloff et al 2000). Despite manyears of research, the molecular and cellular mechanisms asso-iated with depression are not clear.

Several clinical studies have demonstrated that stress acts as aredisposing and precipitating factor in depression (Lloyd 1980;aykel 1982). Onset of depression is most commonly associatedith adverse life events. These adverse events are often outside

he control of affected individuals and may lead to feelings ofelplessness or lack of control. Because the ability to cope withtress is critical at the human level, parallel studies of the effectsf uncontrollable stress have been performed in animals, withesults of proactive interference with the acquisition of escape–voidance responding (Seligman and Maier 1967). This phenom-non is termed learned helplessness (LH) and has been usedxtensively as an animal model of stress-induced behavioralepression (Henn et al 1993; Petty and Sherman 1979; Shermant al 1982). The behavioral changes that occur under theseonditions are similar to the vegetative symptoms of clinicalepression (Willner 1995). Because LH represents an adverseeaction to severe stress, this model may also serve as a model forome aspects of posttraumatic stress disorder (PTSD; Basoglund Mineka 1992; Foa et al 1992; Mineka and Zinbarg 1996). Theimitation of the single stress paradigm model is that the behav-oral changes persist only for a short period of time (Maier 1990),

rom the Psychiatric Institute, Department of Psychiatry, University of Illi-nois at Chicago, Chicago, Illinois.

ddress reprint requests to Yogesh Dwivedi, Ph.D., Department of Psychia-try, University of Illinois at Chicago, 1601 West Taylor Street, Chicago, IL60612.

eceived December 29, 2003; revised March 24, 2004; accepted March 27, 2004.

006-3223/04/$30.00oi:10.1016/j.biopsych.2004.03.018

whereas by definition depression and PTSD persist much longerfollowing negative life events.

Until recently, the most accepted candidate for the immediatecause of depressive symptoms was associated with alterations inthe synaptic availability of monoamines such as noradrenaline,serotonin, and dopamine or alterations in their receptors (Char-ney 1998; Wong and Licinio 2001). Emerging evidence, however,suggests that abnormalities in signal transduction mechanisms,particularly at the level of protein phosphorylation, are importantmediators of neural plasticity and adaptations may play a criticalrole in the pathophysiology of depression (Duman et al 2000).Protein kinase A (PKA) is one such key phosphorylating enzyme,and upon activation it triggers a wide variety of physiologicresponses in the brain, including receptor desensitization; alteredneurotransmitter release; cell growth, differentiation, and sur-vival; synaptic plasticity; and activation or repression of genetranscription (Borrelli et al 1992; Nestler and Greengard 1994).PKA is a tetrameric holoenzyme composed of a regulatory subunitdimer with a catalytic subunit bound to each regulatory sub-unit. When two molecules of cAMP bind to each regulatorysubunit, the affinity of the regulatory subunits for the catalyticsubunits decreases, causing the holoenzyme to dissociate andrelease the two catalytic subunits and a regulatory subunit dimer.Whereas the regulatory subunits remain in the cytoplasm, thefree catalytic subunits can diffuse into the nucleus and phosphor-ylate substrates (reviewed by Skalhegg and Tasken 2000). It wasrecently reported that forskolin-stimulated adenylyl cyclase ac-tivity is decreased in brain of LH rats (Itoh et al 2003), butdownstream events at the level of PKA have not been studied indetail, although it has been shown that brain-derived neurotro-phic factor, which is regulated in response to PKA activationthrough cAMP response element binding protein, reverses LHbehavior in rats (Shirayama et al 2002).

This study was undertaken to test the hypothesis that LHbehavior is associated with alterations in PKA, to examine howlong these changes persist after inescapable shock (IS), and todetermine whether repetition of shocks would prolong theduration of the behavioral deficits and any changes in PKA. Ourstudy is critical not only in establishing whether PKA is involvedin depressive behavior but also in providing evidence from therepeated-stress group results of the potential role of PKA in otherstress-related disorders, such as PTSD.

BIOL PSYCHIATRY 2004;56:30–40© 2004 Society of Biological Psychiatry

M

A

ouhpbt8C

B

pLtwglfGb7a

I

fPcMwcogs

S

cccs(

Fia

Y. Dwivedi et al BIOL PSYCHIATRY 2004;56:30–40 31

ethods and Materials

nimalsVirus-free male Holtzman rats (Harlan Sprague–Dawley Lab-

ratories, Indianapolis, Indiana) were housed in individual cagesnder standard laboratory conditions (temperature 21 � 1°C,umidity 55 � 5%, 12-hour light–dark cycle). Animals wererovided free access to food and water and housed for 3 weeksefore the experiment. Body weight was 325–375 g at the start ofhe experiment. All the experiments were performed between–10 AM. Experimental procedures were approved by the Animalare Committee of the University of Illinois at Chicago.

ehavioral ProceduresLearned helplessness induction (IS) and escape test (ET)

aradigms for the experimental groups are provided in Figure 1.earned helplessness induction by IS and ET were performed byhe procedures described by Wu et al (1999) and Maier (2001),ith slight modifications. Rats were divided into three groups:roup A rats were given IS on day 1 and were tested for escapeatency on day 2. Group B rats were given IS on day 1 and testedor escape latency on day 2; the rats were tested again on day 4.roup C rats were given IS on day 1 and tested for escapeehavior on day 2; these animals were given another IS on dayand tested for escape behavior on days 8 and 14. All the

nimals were decapitated 24 hours after the last escape testing.

nescapable Shock TreatmentThe rats were placed in Plexiglas tubes with the tail extending

rom the rear of the tube. The tail was attached with tape to alexiglas rod. Shocks were delivered by means of a computer-ontrolled constant current shock generator (Model ENV-410B,ed Associates, Lafayette, Indiana) to electrodes augmentedith electrode paste to the rat’s tail. The inescapable shock

onsisted of 100 random shocks delivered for 5 sec at an intensityf 1.0 mA, with a mean interval of 60 sec. A tested control (TC)roup was placed in Plexiglas tubes but was not subjected tohocks.

huttle Box Escape TestingShuttle box escape testing was conducted in a shuttle box (70

m � 20 cm � 20 cm; Med Associates). The shuttle boxontained an electrified grid floor and was divided into two equalhambers with an arched doorway in the center (5 � 7 cm). Foothock was delivered through the grid floor by a shock generatorModel ENV-413, Med Associates). The shuttle box was con-

igure 1. Inescapable shock and escape test paradigms. The detailed exper-mental protocol is given in the Behavioral Procedures section of Methodsnd Materials. IS, inescapable shock; ET, escape test; D, decapitation.

tained in a soundproof cubicle with an exhaust fan, and a 6-Wlamp located in the center of the roof provided illumination. Theshuttle escape testing began with 5 trials (FR-1) during which asingle crossing would terminate the shocks. This was followedby 25 trials (FR-2) in which a rat had to cross from one side of theshuttle box to the other and come back to terminate the shocks.Shocks were terminated automatically after 30 sec if there was noresponse within that time. The intensity of the shocks was .6 mA.The shocks were presented on a variable schedule. There was a5-min interval between FR-1 and FR-2. Shuttle escape latenciesand escape failures were recorded automatically by a computerattached to the generator and shuttle box. In the FR-2 trial withescape latency � 20 sec was defined as an escape failure. Ratswith 10–25 failures to escape were considered to be deficient inthe escape response.

Rats were divided into two groups based on the mean latencyobserved after FR-2: 1) rats with mean latency � 20 sec (termedlearned helpless, LH) and 2) rats with mean latency � 20 sec(termed as nonlearned helpless, NLH). In our study, we foundthat about 50% of all the rats tested became LH rats. In group Crats, to which IS was given on day 1 and again on day 7, most ofthe rats that initially did not show an escape deficit (NLH)remained NLH even after the second shock paradigm; only a fewshowed a mean latency � 20 sec after the second paradigm.These rats were not included in this study. The rats that wereconfined to Plexiglas tubes but were not shocked were alsotested.

As mentioned earlier, rats were decapitated 24 hours after thelast escape testing, and trunk blood was collected on ice andcentrifuged. The plasma was stored at –80°C. Plasma corticoste-rone levels were measured by a commercially available radioim-munoassay kit (ICN Biomedical, Cleveland, Ohio). Brains wereremoved quickly. The various brain areas were dissected on iceand immediately stored at –80°C until analyzed.

Determination of [3H]cAMP Binding and PKA ActivitySpecific [3H]cAMP binding and basal and cAMP-stimulated

PKA activity were determined in membrane and cytosol fractionsof frontal cortex and hippocampus essentially by a proceduredescribed previously (Dwivedi et al 2002b). Bmax and KD of[3H]cAMP binding were determined in the presence or absenceof 5 �mol/L cAMP using various concentrations of [3H]cAMP(.25–10 nmol/L) and 25-�g protein. Bmax and KD were calculatedby Scatchard plots using the EBDA program (McPherson 1985).The activity of PKA was determined using [�-32P] adenosine 5triphosphate (ATP) and Kemptide in the presence (total) andabsence (endogenous) of 10 �mol/L cAMP. The phosphorylatedsubstrate was separated from residual [�-32P] ATP and 32Pincorporation was determined. Data are expressed as pmoles of[32P]phosphate transferred to Kemptide/min/mg protein.

Immunolabeling of PKA Subunit Isoforms by Western BlotImmunolabeling of individual catalytic and regulatory sub-

units of PKA in membrane and cytosol fractions of frontal cortexand hippocampus was determined by Western blot as describedearlier (Dwivedi et al 2002b). Equal volumes of membrane orcytosol fractions (20 �L containing 30-�g protein) were resolvedonto 10% (w/v) sodium dodecyl sulfate (SDS)-polyacrylamidegel and blotted on enhanced chemiluminescence (ECL) mem-brane (Amersham, Arlington Heights, Illinois). Blots were incu-bated overnight at 4°C with primary polyclonal antibody for PKARI�, RI�, RII�, RII�, C�, or C� (Santa Cruz Biotechnology, Santa

www.elsevier.com/locate/biopsych

Ca

ddtrsTAtPaapt

DQR

iscstrowhq2P�qwe

32 BIOL PSYCHIATRY 2004;56:30–40 Y. Dwivedi et al

w

ruz, California) at a dilution of 1:1000-1:3000 depending on thentibody used.

Before starting the immunolabeling, the procedure was stan-ardized using 10–100 �g of protein; we found that the opticalensity (OD) of the bands varied linearly with concentration upo 75 �g protein. The same membranes were stripped andeprobed with PKA or �-actin (Sigma Chemical, St. Louis, Mis-ouri) antibodies. �-Actin was used as a housekeeping protein.he ODs of the bands were quantified using the Loats Imagenalysis System (Westminster, Maryland) and were corrected by

he OD of the corresponding �-actin band. The specificity of allKA subunits was verified using corresponding peptides. All thentibodies except that for C� produced a single band. Thentibody for C� produced two bands. Incubation with blockingeptide eliminated the bottom band; therefore, we consideredhe top band as the band for C�.

etermination of mRNA Levels of PKA Subunits byuantitative Reverse Transcription Polymerase Chaineaction (RT-PCR)

The quantitation of mRNA levels was determined usingnternal standards as described earlier (Dwivedi et al 2002b). Theequences of external and internal primers for the variousatalytic and regulatory subunits are given in Table 1. Internaltandard templates were generated by site-directed mutagenesiso introduce a Bgl II (C�, RI�, RII�) or Xho I (C�, RI�, RII�)estriction site. To quantitate mRNA, decreasing concentrationsf PKA RI�, RII�, RI�, RII�, C�, or C� internal standard cRNAere added to 1 �g of total RNA isolated from frontal cortex orippocampus. After termination of the RT reaction, cDNA ali-uots containing reverse-transcribed material were amplified for5 cycles with Hot Tub DNA polymerase (Amersham Pharmacia,iscataway, New Jersey). Trace amounts of [32P]dCTP (.5–1Ci/sample) were included during the PCR step for subsequentuantification. Following amplification, aliquots were digestedith Xho I or Bgl II in triplicate and run by 1.5% agarose gellectrophoresis. The results were calculated as the counts incor-

Table 1. External and Internal Primer Sequences of ProAmplification

Primers

External Primer SequencesRI� F: 5CAAACGTGAAACTGTGGG

R: 5TCAAAGGGCCACGCGCAARI� F: 5TGC GAG ATG TAC GTG CAG

R: 5CTT CCT CAC GTA GGA GACRII� F: 5AGAGTGAATCGGACTCGGACG

R: 5GCCACGGTTTGCATACTGACCRII� F: 5TAAACCGGTTCACAAGGCGTG

R: 5GTTACCAACGCATCTTCCAACC� F: 5GATGTTCTCCCACTTACG

R: 5ATAGGCTGGTCAGCG AAGC� F: 5GGGGAACACGGCGATCGCCAA

R: 5CCAGGAACGTATTCCATAACCInternal Primer Sequences

RI� 5TGGACAGAAGATCTTGGTGCAAGGRII� 5CATTCTGCTTCTCGAGAACCTGGATCRI� 5AGATCCTGGCTCGAGAGAAGTCAARII� 5CCTGGATCCAGATCTGATGTCTCAC� 5CAGGTGACAGATCTCGGTTTTGCCC� 5GAGTCATGCTCGAGAAGCATAAAG

F, forward; R, reverse. Bold and italicized letters indi(CTCGAG) or Bgl II (AGATCT) cleavage sites.

ww.elsevier.com/locate/biopsych

porated into the amplified cRNA standard divided by the countsincorporated into the corresponding PKA subunit mRNA ampli-fication product versus a known amount of internal standardcRNA added to the test sample. The results are expressed asattomoles �g total RNA.

StatisticsData were analyzed with the SPSS 9.0 (Chicago, Illinois)

statistical package. All values are the mean � SD. Intergroupcomparisons were made by one-way analysis of variance(ANOVA). Post hoc comparisons were evaluated using Tukey’smethod of multiple comparison. Values were considered signif-icant at � .05.

Results

Escape LatenciesWe did not observe any significant differences in mean

escape latency after FR-1 trials in any experimental paradigm(data not shown). Escape latencies after 25 FR-2 trials in thedifferent groups are given in Table 2. In group A (IS on day 1 andescape test on day 2), LH rats showed a significantly higher meanescape latency than NLH or TC rats, whereas the escape latencyof NLH rats was not significantly different from that of TC rats.Similarly, in group B (IS on day 1 and escape test on day 2 andagain on day 4), the mean escape latency was significantly higheron day 2 in LH rats compared with TC or NLH rats; however, onday 4, the escape latency of LH rats was similar to that of NLH orTC rats. In group C (IS on day 1 and day 7 and escape latencydetermined at three time intervals: day 2, day 8, and day 14), themean escape latency was significantly higher in LH rats com-pared with the NLH group at all time intervals. None of thegroups showed significant differences in mean escape latencybetween TC and NLH rats (Table 2). The LH rats of groups A andC failed to escape 16–22 times, whereas NLH and TC ratsescaped readily with only 1–3 failures. All group B rats showedsimilar escape failures (1–4).

inase A Catalytic and Regulatory Subunit Isoforms for

GenBank Accession No. Nucleotide Position

M17086 653– 6731019 –1039

Clegg et al (1988) 049 – 069331–351

J02934 131–151493–513

M12492 313–323618 – 638

X57986 381– 401717–737

D10770 003– 023357–377

— 834 – 857— 306 –331— 191–214— 464 – 487— 544 –567— 170 –193

he mutated bases. Underlined bases indicate the XhO I

tein K

cate t

C

a��l2

[

e

T

F[

P

H[

P


orticosterone LevelsPlasma corticosterone levels were measured in rats of group A

nd group C and were as follows (ng/mL): group A rats: TC 24294, NLH 249 � 108, LH 293 � 95; group C rats: TC 279135, NLH 258 � 184, LH 310 � 96. Plasma corticosterone

evels did not differ in TC, NLH, and LH rats either in group A (df ,15, F .47, p .63) or in group C (df 2,15, F .19, p .82).

3H]cAMP BindingIn group A, in which rats were given IS on day 1 and tested for

3
scape behavior on day 2, it was observed that Bmax of [ H]cAMP
binding was significantly decreased in particulate and cytosolfractions of frontal cortex and hippocampus of LH rats comparedwith TC or NLH rats. Bmax of [3H]cAMP binding was not differentbetween NLH and TC rats either in frontal cortex or in hippocam-pus (Table 3).

In group B rats, given IS on day 1 and tested on day 4, Bmax

of [3H]cAMP binding did not differ significantly in TC, NLH, andLH rats in either cytosol or particulate fractions of frontal cortexor hippocampus (data not shown).

In group C rats, given IS on day 1 and day 7, and tested on day3

Table 2. Escape Latency of TC, NLH, and LH Rats After Different Stress Paradigms

Group

Escape Latency (seconds) ANOVA

TC NLH LH df F p

Group A Ratsa

Day 2 6.28 � 2.03 7.31 � 3.98 24.35 � 3.48d 2,15 57.73 �.001Group B Ratsb

Day 2 5.32 � 3.21 4.10 � 2.25 25.95 � 3.62d 2,15 95.18 �.001Day 4 5.75 � 2.39 4.06 � 1.75 7.88 � 3.86 2,15 2.77 .094

Group C Ratsc

Day 2 5.70 � 3.22 5.11 � 1.87 25.00 � 3.07d 2,15 98.66 �.001Day 8 6.20 � 3.11 4.78 � 2.33 25.99 � 3.72d 2,15 87.31 �.001Day 14 4.30 � 2.37 5.05 � 2.58 26.50 � 3.18d 2,15 127.76 �.001

Data are the mean � SD. TC, tested control; NLH, nonlearned helpless; LH, learned helpless; ANOVA, analysis ofvariance.

aRats were given inescapable shock (IS) on day 1 and tested for escape latency on day 2.bRats were given IS on day 1 and tested on day 2 and day 4.cRats were given IS on day 1 and tested on day 2; these rats were given another IS on day 7 and tested on day 8 and

day 14.dp � .001 compared with TC or NLH.

14, Bmax of [ H]cAMP binding was significantly lower in both

able 3. [3H] cAMP Binding and PKA Activity in Frontal Cortex and Hippocampus of Group A Ratsa

TC NLH LH

Overall Analysis of Variance Multiple Comparison

df F p TC vs. NLH NLH vs. LH TC vs. LH

rontal Cortex3H]cAMP Bindingb

Membrane 159.5 � 15.3 160.6 � 22.9 116.2 � 17.9 2,15 10.6 .001 .99 .003 .003Cytosol 234.0 � 31.6 240.5 � 18.7 172.6 � 35.6 2,15 9.6 .002 .92 .003 .007

KA Activityc

BasalMembrane 126.3 � 21.0 122.3 � 15.1 93.2 � 7.0 2,15 8.2 .004 .89 .013 .006Cytosol 258.8 � 26.7 251.2 � 32.9 188.8 � 19.7 2,15 12.1 .001 .87 .003 .001

cAMP-StimulatedMembrane 546.2 � 71.4 558.8 � 60.7 439.7 � 45.5 2,15 7.1 .007 .93 .01 .02Cytosol 1043.2 � 101.9 979.3 � 134.9 772.0 � 106.0 2,15 9.1 .003 .61 .018 .003

ippocampus3H]cAMP Bindingb

Membrane 225.8 � 21.6 226.2 � 35.5 177.2 � 16.8 2,15 7.1 .007 1.0 .014 .013Cytosol 359.0 � 17.5 331.8 � 63.0 264.7 � 37.9 2,15 7.4 .006 .54 .04 .005

KA Activityc

BasalMembrane 135.5 � 12.9 131.0 � 25.8 93.8 � 17.8 2,15 8.2 .004 .91 .013 .006Cytosol 253.0 � 25.9 240.6 � 26.7 184.7 � 14.0 2,15 15.1 �.001 .62 .002 �.001

cAMP-StimulatedMembrane 643.5 � 48.5 650.3 � 126.7 508.3 � 70.3 2,15 4.9 .023 .99 .03 .04Cytosol 1032.6 � 87.4 1028.0 � 108.2 807.0 � 105.3 2,15 9.8 .002 .99 .005 .004

TC, tested control; NLH, nonlearned helplessness; LH, learned helplessness; PKA, protein kinase A; cAMP, cyclic adenosine monophosphate.aRats were given inescapable shock on day 1 and tested for escape latency on day 2. Rats were decapitated 24 hours later.bfmol/mg protein.cpmoles/min/mg protein; values are the mean � SD.


ppmrg

Nc.�

B

b[afwci

bwt(

1dcrt

T

F[

P

H[

P

o


w

articulate and cytosol fractions of frontal cortex and hippocam-us of LH rats compared with TC or NLH rats (Table 4). Theagnitude of the decrease in Bmax of [3H]cAMP binding in LH

ats of group C was greater than that observed in the LH rats ofroup A.

KD values were not significantly different among TC, LH, orLH rats in any experimental group. KD values (nM) in frontalortex and hippocampus of TC rats were as follows: particulate83 � .14 and cytosol .66 � .14 for frontal cortex; particulate .71

.16 and cytosol .67 � .09 for hippocampus.

asal and cAMP-Stimulated PKA ActivityIn group A rats, given IS on day 1 and tested for escape

ehavior on day 2, similar to the results observed for Bmax of3H]cAMP binding, the basal as well as cAMP-stimulated PKActivity were significantly decreased in particulate and cytosolractions of frontal cortex and hippocampus of LH rats comparedith TC or NLH rats (Table 3). On the other hand, basal and

AMP-dependent PKA activity did not differ in TC and NLH ratsn either frontal cortex and hippocampus (Table 3).

In group B rats, given IS on day 1 and tested for escapeehavior on day 4, both basal and cAMP-dependent PKA activityere not significantly different in particulate and cytosol frac-

ions of frontal cortex and hippocampus in TC, NLH, and LH ratsdata not shown).

In group C rats, given IS on day 1 and day 7 and tested on day4, basal and cAMP-dependent PKA activity were significantlyecreased in both particulate and cytosol fractions of frontalortex and hippocampus of LH rats compared with TC or NLHats (Table 4). The magnitude of the decrease was greater thanhat observed in the LH rats of group A.

able 4. [3H]cAMP Binding and Protein Kinase A (PKA) Activity in Frontal C

TC NLH LH

rontal Cortex3H]cAMP Bindingb

Membrane 156.2 � 15.6 161.2 � 25.9 94.3 � 12.7Cytosol 269.7 � 42.1 241.7 � 42.4 145.2 � 37.2

KA Activityc

BasalMembrane 134.5 � 10.4 117.8 � 18.0 179.5 � 14.3Cytosol 248.3 � 26.5 243.8 � 30.4 153.8 � 46.4

cAMP-StimulatedMembrane 528.7 � 84.1 502.8 � 89.2 321.2 � 63.6Cytosol 1047.8 � 99.2 994.7 � 185.8 688.8 � 119.9

ippocampus3H]cAMP Bindingb

Membrane 236.5 � 37.1 242.8 � 39.4 158.2 � 31.4Cytosol 336.5 � 59.4 343.3 � 32.8 205.7 � 62.1

KA Activityc

BasalMembrane 138.5 � 18.0 134.0 � 21.3 95.3 � 22.9Cytosol 252.0 � 38.2 242.0 � 53.1 153.0 � 31.2

cAMP-StimulatedMembrane 633.7 � 123.0 596.6 � 104.2 434.8 � 45.9Cytosol 1047.7 � 128 1009.3 � 87.4 722.1 � 139.3

TC, tested control; NLH, nonlearned helplessness; LH, learned helplessnaRats were given inescapable shock on day 1 and tested for escape latenc

n day 14. Rats were decapitated 24 hours after the last escape test.bfmol/mg protein.cpmoles/min/mg protein; values are the mean � SD.


Protein Levels of PKA Regulatory and Catalytic SubunitIsoforms

Representative Western blots of regulatory and catalytic sub-unit isoforms of PKA in rat frontal cortex are shown in Figure 2.The apparent molecular masses of PKA RI�, RII�, RI�, and C�isoforms were 49, 51, 54, and 42 kDa, respectively, whereas PKARII� and C� isoforms migrated to 55 kDa. To normalize our data,we probed the same membrane with �-actin antibody. Theapparent molecular mass for �-actin protein was 46 kDa.

The effects of LH behavior in group A (IS on day 1 and testedfor escape behavior on day 2) on the immunolabeling of PKAregulatory and catalytic subunit isoforms in rat frontal cortex andhippocampus are given in Table 5. As can be seen, the proteinlevels of C�, C�, and RII� were selectively and significantlydecreased in frontal cortex and hippocampus of LH rats com-pared with TC or NLH rats. No significant differences wereobserved in the immunolabeling of RI�, RII�, or RI�.

The immunolabeling of PKA regulatory and catalytic subunitsin rats of group B (IS on day 1 and tested for escape behavior onday 4) showed there were no significant differences in any of theregulatory or catalytic PKA subunit isoforms either in frontalcortex or in hippocampus among TC, NLH, and LH rats (data notshown).

The immunolabeling of PKA regulatory and catalytic subunitisoforms in frontal cortex of group C rats (IS on day 1 and day 7and escape test on day 14) is provided in Figure 2; mean valuesin frontal cortex and hippocampus are reported in Table 6.Similar to the results of group A, we observed that the immuno-labeling of C�, C�, and RII� was significantly decreased infrontal cortex and hippocampus of LH rats compared with TC orNLH rats. In addition, we observed that the immunolabeling of

and Hippocampus of Group C Ratsa



2,15 15.0 �.001 .92 .001 .0012,15 15.4 �.001 .47 �.001 �.001

2,15 22.3 .001 .15 .001 �.0012,15 13.5 �.001 .97 .001 .001

2,15 12.0 .001 .84 .003 .0012,15 11.5 .001 .79 .005 .001

2,15 10.1 .002 .95 .003 .0052,15 12.8 .001 .97 .001 .002

2,15 7.7 .005 .92 .015 .0072,15 10.1 .002 .91 .006 .003

2,15 7.1 .007 .79 .028 .0082,15 13.1 .001 .84 .002 .001

KA, protein kinase A; cAMP, cyclic adenosine monophosphate.day 2; rats were again given shock on day 7 and tested on day 8 and retested

ortex

ess; Py on

Rp

mI

ododmqNctrqap

FPitCllapnposbRw


I� was significantly increased in both frontal cortex and hip-ocampus of LH rats as compared with TC or NLH rats (Table 6).

RNA Levels of PKA Regulatory and Catalytic Subunitsoforms

To examine whether the selectively altered immunolabelingf PKA regulatory and catalytic subunit isoforms in LH rats wasue to altered gene expression and whether the mRNA levels ofther regulatory or catalytic subunit isoforms of PKA in which weid not find any changes were also altered, we determined theRNA levels of all regulatory and catalytic subunit isoforms byuantitative RT-PCR in frontal cortex and hippocampus of TC,LH, and LH rats. Representative gel electrophoreses showingompetitive RT-PCR for PKA RI�, RI�, RII�, RII�, C�, and C� inhe frontal cortex are given in Figures 3A, 3B, 3C, 3G, 3H, and 3I,espectively. In addition, representative graphs showing theuantitation of mRNA for these respective PKA subunit isoformsre given in Figures 3D, 3E, 3F, 3J, 3K, and 3L. The amplificationroducts for PKA RI�, RI�, RII�, RII�, C�, and C� from the

igure 2. Representative Western blots showing the immunolabeling ofKA regulatory (RI�, RII�, RI�, and RII�) and catalytic (C� and C�) subunit

soforms in the soluble fraction of frontal cortex obtained from tested con-rol (TC), nonlearned helpless (NLH), and learned helpless (LH) rats of group, in which rats were given inescapable shock on day 1 and tested for escape

atency on day 2; rats were again given shock on day 7 and tested for escapeatency on day 8 and retested on day 14. Rats were decapitated 24 hoursfter the final testing. Protein samples (30 �g) were subjected to 10%olyacrylamide gel electrophoresis and transferred to enhance chemilumi-escence-nitrocellulose membranes, which were then incubated with therimary antibody specific for each regulatory and catalytic subunit isoformf PKA and with secondary antirabbit antibody. The membranes weretripped and probed with �-actin primary and antimouse secondary anti-ody. The bands were quantified as described in Methods and Materials.atios of the optical densities of each PKA subunit isoform to that of �-actinere calculated.

mRNA template were at 387, 303, 383, 326, 357, and 375 bp,whereas the corresponding digestion products arising from cRNAwere at 192 � 195 bp, 143 � 160 bp, 191 � 192 bp, 166 � 160bp, 174 � 183 bp, and 178 � 197 bp, respectively.

Comparison of the mRNA levels of the various PKA subunitisoforms in frontal cortex and hippocampus of group A rats (ISon day 1 and tested on day 2), showed that levels of C�, C�, andRII� were significantly decreased in frontal cortex and hip-pocampus of LH rats compared with TC or NLH rats, whereas nosignificant differences were observed in the mRNA levels of RI�,RII�, or RI� either in frontal cortex or in hippocampus of LH,NLH, or TC rats (Table 7).

The results from TC, NLH, and LH rats on day 4 after IS shock(group B) showed no significant differences in mRNA levels ofany of the PKA subunit isoforms either in frontal cortex or inhippocampus (data not shown).

When we determined the absolute amounts of PKA subunitmRNAs in brain of group C rats (IS on day 1 and again on day 7,and tested on day 14), we observed that the mRNA levels of RII�,C�, and C� subunits were selectively and significantly decreasedin frontal cortex and hippocampus of LH rats without any changein mRNA levels of RI� or RII�. On the other hand, the mRNAlevel of RI� was significantly increased in frontal cortex andhippocampus of LH rats compared with TC or NLH rats (Table 8).These changes were greater than those observed in the LH rats ofgroup A (IS on day 1 and tested on day 2).

Discussion

Our behavioral and analytical findings demonstrate selectiveand significant changes in PKA in brain of rats after acute shockstress that persist when the stress is repeated. We observed aclear behavioral differentiation between LH and NLH rats, be-cause the escape latency in LH rats was significantly differentfrom that of NLH or TC rats. Whereas NLH rats showed an escapelatency similar to that of TC rats, the escape latency of LH ratswas significantly higher than that of NLH or TC rats. The higherescape latency was present in LH rats exposed to IS on day 1 andtested for escape latency on day 2, but not rats tested on day 4,suggesting that the behavioral deficit does not persist for 4 daysafter a single-IS paradigm. These observations are similar to thosereported by Maier (2001), who found that the behavioral deficitpersists only until day 2 but not until day 4 after IS. When wesubjected rats to another IS on day 7 in addition to the first IS andtested them on day 14, the escape latency was significantlyhigher in LH rats compared with NLH or TC rats. Our observa-tions thus suggest that exposure to a second IS produces a longerlasting behavioral deficit.

Interesting results emerged when we determined the mea-sures of PKA in brain of LH, NLH, and TC rats. The LH rats givenIS on day 1 and tested on day 2 showed a significant decrease in[3H]cAMP binding in frontal cortex and hippocampus comparedwith NLH or TC rats. Similarly, both basal and cAMP-stimulatedPKA activity were significantly decreased in frontal cortex andhippocampus of these LH rats. When [3H]cAMP binding andbasal and cAMP-stimulated PKA activity were measured in frontalcortex and hippocampus of LH rats who were tested on day 4after IS, the changes in these measures had disappeared. On theother hand, in LH rats given IS twice, once on day 1 and again onday 7, and tested on day 14, both [3H]cAMP binding and basaland cAMP-stimulated PKA activity were significantly decreased,and the magnitude of these decreases was even greater than inLH rats given a single IS and tested on day 2.


acpPTtcsrsursart

T

F

H

T

F

H

o


w

To examine whether the changes in catalytic and regulatoryctivities of PKA are due to changes in expression of specificatalytic or regulatory subunits, we determined the mRNA androtein levels of the various catalytic and regulatory subunits ofKA in frontal cortex and hippocampus of LH, NLH, and TC rats.wo major categories of the PKA holoenzyme have been iden-ified based on the elution profile on a diethylaminoethyl ex-hange column, that is, type I and type II, which differ intructure depending on the type of regulatory subunit incorpo-ated, whereas the catalytic subunits are either identical or veryimilar. Multiple isoforms of PKA regulatory and catalytic sub-nits exist and are encoded by separate genes, namely, fouregulatory (RI�, RI�, RII�, RII�) and three catalytic (C�, C�, C�)ubunits. The expressed protein levels of the various catalyticnd regulatory subunits in frontal cortex and hippocampus of LHats given IS once on day 1 or repeated IS on day 7 showed thathe protein levels of RII�, C�, and C� were selectively decreased.

able 5. Immunolabelinga of PKA Catalytic and Regulatory Subunits in Fro

TC NLH LH

O

df

rontal CortexRI� 1.43 � .22 1.48 � .19 1.55 � .29 2,15RII� 1.37 � .17 1.42 � .27 1.49 � .15 2,15RI� 1.46 � .17 1.52 � .18 1.44 � .09 2,15RII� 1.52 � .23 1.58 � .19 1.03 � .20 2,15C� 1.56 � .24 1.55 � .17 1.10 � .15 2,15C� 1.51 � .20 1.41 � .17 .91 � .29 2,15

ippocampusRI� 1.53 � .15 1.37 � .26 1.49 � .19 2,15RII� 1.46 � .20 1.39 � .26 1.43 � .19 2,15RI� 1.51 � .16 1.48 � .20 1.21 � .38 2,15RII� 1.51 � .20 1.51 � .35 1.01 � .26 2,15C� 1.42 � .10 1.45 � .16 .96 � .20 2,15C� 1.45 � .19 1.37 � .31 .90 � .11 2,15

TC, tested control; NLH, nonlearned helplessness; LH, learned helplessnaRatio to �-actin.bRats were given inescapable shock on day 1 and tested for escape late

able 6. Immunolabelinga of PKA Catalytic and Regulatory Subunits in Fro

TC NLH LH

rontal CortexRI� 1.34 � .24 1.44 � .24 1.93 � .23RII� 1.46 � .28 1.48 � .36 1.64 � .35RI� 1.51 � .48 1.50 � .22 1.46 � .43RII� 1.55 � .22 1.58 � .19 .85 � .21C� 1.56 � .24 1.43 � .29 .89 � .22C� 1.46 � .23 1.48 � .25 .86 � .22

ippocampusRI� 1.52 � .27 1.59 � .23 2.38 � .42RII� 1.47 � .43 1.37 � .45 1.54 � .29RI� 1.53 � .28 1.36 � .28 1.56 � .43RII� 1.58 � .15 1.35 � .33 .92 � .11C� 1.52 � .14 1.46 � .26 .89 � .11C� 1.45 � .19 1.51 � .30 .81 � .24

TC, tested control; NLH, nonlearned helplessness; LH, learned helplessnaRatio to �-actin.bRats were given inescapable shock on day 1 and tested for escape latenc

n day 14. Rats were decapitated 24 hours after the last escape test. Values


These changes were not present in LH rats given IS once andtested on day 4. The changes in protein levels of RII�, C�, and C�were found to be associated with changes in their respectivemRNA levels. As with [3H]cAMP binding and PKA activity, themagnitude of the changes in mRNA and protein levels of thesePKA subunits was greater in LH rats who were exposed to therepeated shock paradigm compared with LH rats who weresubjected to a single-IS paradigm. Our results suggest that thechanges in [3H]cAMP binding and PKA activity could be due tothe reduced expression of specific PKA regulatory and catalyticsubunit isoforms, respectively. This notion is further supportedby our observation that not only cAMP-stimulated but also thatbasal PKA activity is reduced in brain of LH rats. It has beenshown that regulatory and catalytic subunits of PKA exist notonly in the heterodimeric holoenzyme state but that a certainamount of free catalytic subunits also exist in dynamic equilib-rium with the holoenzyme, which constitutes the basal PKA

ortex and Hippocampus of Group A Ratsb

l Analysis of Variance Multiple Comparison

F p TC vs. NLH NLH vs. LH TC vs. LH

.33 .72 .93 .88 .69

.56 .58 .91 .77 .56

.47 .63 .75 .64 .9812.62 .001 .88 .001 .00311.03 .001 .99 .003 .00211.86 .001 .72 .005 .001

.97 .40 .39 .59 .94

.13 .87 .86 .94 .982.23 .14 .98 .22 .176.20 .01 .99 .02 .019

17.24 �.001 .97 �.001 �.00110.72 .001 .80 .006 .002

KA, protein kinase A; cAMP, cyclic adenosine monophosphate.

n day 2. Rats were decapitated 24 hours later. Values are mean � SD.

ortex and Hippocampus of Group C Ratsb

ll Analysis of Variance Multiple Comparison

F p TC vs. NLH NLH vs. LH TC vs. LH

10.1 .002 .76 .009 .002.75 .49 .92 .70 .47.02 .98 .99 .98 .98

23.0 �.001 .95 �.001 �.00111.4 .001 .65 .007 .00113.1 �.001 .98 .001 .001

13.15 .001 .92 .002 .001.29 .75 .90 .73 .94.64 .54 .66 .55 .98

13.52 �.001 .21 .01 �.00120.77 �.001 .87 �.001 �.00114.52 �.001 .92 .001 .001

KA, protein kinase A; cAMP, cyclic adenosine monophosphate.

day 2; rats were again given shock on day 7 and tested on day 8 and retestede mean � SD.

ntal C

veral

ess; P

ncy o

ntal C

Overa

df

2,152,152,152,152,152,15

2,152,152,152,152,152,15

ess; P

y onare th

aas

Cstdsntbsb(1

F((fIbimo


ctivity. Reduction in both basal and cAMP-stimulated PKActivity therefore suggests that the cause may be reduced expres-ion of catalytic subunits.

Interestingly, in addition to the decreased expression of RII�,�, and C�, we observed that mRNA and protein level of RI� wasignificantly increased in frontal cortex and hippocampus of onlyhose LH rats that were subjected to the repeated shock para-igm. Whether this occurs in response to the decreased RII�ubunit expression or has some other functional significanceeeds to be examined. Also interesting, as mentioned earlier, ishat these rats show decreased [3H]cAMP binding. The reasonehind this paradoxical finding is not clear. Recently, it washown that cAMP binds not only to regulatory subunits of PKAut also to cyclic nucleotide gated channels and Epac proteinsexchange proteins directly activated by cAMP; de Rooij et al998; Dremier et al 2003). Whether the decrease in [3H]cAMP

igure 3. A representative experiment showing a competitive polymeraseH)C�, and (I)C� subunit isoform mRNA content in frontal cortex of a norm100 – 6.25 pg), RII� (200 –12.5 pg), C� (100 – 6.25 pg), or C� (100 – 6.25 pg) strontal cortex. The mixtures were reverse transcribed and PCR amplified in tII and electrophoresed on 1.5% agarose gel. The higher molecular size bandand arises from cRNA generated from the internal standard digested by Xh

ncorporated into the amplified cRNA standard divided by the counts incorpRNA amplification product versus a known amount of internal standard (c

f mRNA.

binding reflects changes in these cAMP-activated proteins will bean interesting topic for further study.

Another interesting observation was that the changes in PKAwere well correlated with the behavioral paradigms. For exam-ple, we did not find any changes in LH rats tested 4 days after asingle IS paradigm, and their escape latency was similar to that ofTC or NLH rats. On the other hand, changes in PKA occurredonly in those LH rats that showed a higher escape latency,whether subjected to a single or a repeated IS paradigm.Furthermore, the changes in PKA were specific to LH behaviorrather than to nonspecific effects of stress caused by restraint, tailshock, or testing because TC rats were handled similarly as NLHand LH rats; furthermore, NLH rats were given IS and both TCand NLH rats were tested for escape behavior. Interestingly, in arecent study, Malberg and Duman (2003) demonstrated thatexposure to avoidance testing, regardless of preexposure to IS,

reaction (PCR) analysis for protein kinase A (A)RI�, (B)RI�, (C)RII�, (G)RII�,t. Decreasing concentrations of RI� (100 – 6.25 pg), RII� (200 –12.5 pg), RI�rd cRNA were added to a constant amount (1 �g) of total RNA isolated fromsence of trace amounts of [32P]dCTP; aliquots were digested by Xho I or Bglsponds to amplification product arising from the mRNA, whereas the lowerBgl II. Bl, Blank. Data derived from the agarose gel are plotted as the countsd into the corresponding PKA: (D)RI�, (E)RI�, (F)RII�, (J)RII�, (K)C�, or (L)C�added to the test sample. The point of equivalence represents the amount

chainal ra

andahe precorreo I ororateRNA)


dirnadwstvi

a1pb

T

F

H

T

F

H

o


w

ecreased cell proliferation in hippocampus. According to thenvestigators, this could be due to elevated levels of corticoste-one after acute exposure to avoidance testing. Although we didot test the hypothesis of whether exposure to avoidance testinglso has similar or dissimilar effects on PKA, we found noifferences in corticosterone levels among TC, NLH, or LH ratshether given acute or repeated stress. A recent study has

uggested that reduced cell proliferation is not correlated withhe development of LH (Vollmayr et al 2003), suggesting thatarious biological measures may be differentially regulated dur-ng LH behavior.

It has been shown that [3H]cAMP binding (Manier et al 2000)nd �-adrenergic-stimulated PKA activity (Shelton et al 1996,999) are significantly reduced in the fibroblasts of depressedatients. On the other hand, it has been reported that [3H]cAMPinding (Lowther et al 1997) is decreased and PKA C� subunit


expression is increased in postmortem brain of depressed suicidevictims (Odagaki et al 2001). We recently observed, however,that [3H]cAMP binding and both basal and cAMP-stimulated PKAactivity (Dwivedi et al 2002a) and expression of selective cata-lytic and regulatory subunits (Dwivedi et al 2004) are signifi-cantly decreased in the prefrontal cortex of depressed suicidevictims. In a recent study, Kohen et al (2003) demonstrated asignificant decrease in the level of PKA C� in prefrontal cortex ofcongenitally LH rats. In addition, Itoh et al (2003) reported thatthe activity of forskolin-stimulated adenylyl cyclase is signifi-cantly decreased in brain of LH rats exposed to IS for 3 days andtested 24 hours after the last IS. These studies, as well as our own,indicate that depression may be associated with diminishedadenylyl cyclase-PKA signaling.

Clinically, our findings of decreased PKA in LH rats arerelevant. Many earlier studies have demonstrated that the mech-

able 7. mRNA Levelsa of PKA Catalytic and Regulatory Subunits in Frontal Cortex and Hippocampus of Group A Ratsb

TC NLH LH



rontal CortexRI� 159.3 � 33.4 155.6 � 32.3 174.1 � 31.5 2,15 .54 .59 .97 .59 .71RII� 239.8 � 24.6 218.1 � 59.4 238.5 � 40.6 2,15 .46 .64 .67 .71 .99RI� 177.7 � 27.5 162.8 � 16.4 160.8 � 30.3 2,15 .78 .47 .58 .99 .50RII� 364.5 � 40.0 353.3 � 31.2 279.5 � 35.6 2,15 9.9 .002 .85 .007 .003C� 172.7 � 19.6 170.8 � 25.3 110.3 � 30.2 2,15 11.6 .001 .99 .002 .002C� 183.6 � 30.7 177.0 � 13.3 115.1 � 27.4 2,15 13.7 �.001 .89 .002 .001

ippocampusRI� 174.6 � 37.8 158.3 � 37.2 168.8 � 28.3 2,15 .34 .71 .70 .86 .96RII� 253.2 � 24.7 244.8 � 33.4 242.3 � 31.9 2,15 .21 .81 .88 .98 .81RI� 176.5 � 24.9 169.5 � 21.2 184.0 � 28.8 2,15 .49 .62 .88 .59 .86RII� 344.3 � 28.5 344.8 � 26.8 243.0 � 35.9 2,15 21.9 �.001 1.0 �.001 �.001C� 169.7 � 23.5 162.0 � 36.8 101.0 � 28.3 2,15 9.4 .002 .89 .008 .003C� 170.5 � 18.6 168.2 � 36.3 99.9 � 18.8 2,15 14.6 �.001 .98 .001 .001

TC, tested control; NLH, nonlearned helplessness; LH, learned helplessness; PKA, protein kinase A; cAMP, cyclic adenosine monophosphate.aAttomoles/�g total RNA.bRats were given inescapable shock on day 1 and tested for escape latency on day 2. Rats were decapitated 24 hours later. Values are the mean � SD.

able 8. mRNA Levelsa of PKA Catalytic and Regulatory Subunits in Frontal Cortex and Hippocampus of Group C Ratsb

TC NLH LH



rontal CortexRI� 171.2 � 16.3 176.7 � 54.5 267.5 � 43.8 2,15 10.2 .002 .97 .005 .003RII� 235.8 � 29.5 244.3 � 38.9 233.5 � 52.0 2,15 .11 .89 .93 .89 .99RI� 171.2 � 20.3 166.5 � 29.7 169.8 � 20.6 2,15 .06 .94 .93 .96 .99RII� 373.5 � 40.5 338.2 � 42.0 216.0 � 37.8 2,15 23.5 �.001 .33 �.001 �.001C� 162.5 � 20.0 168.7 � 20.3 84.1 � 14.5 2,15 38.7 �.001 .83 �.001 �.001C� 175.0 � 22.5 163.7 � 20.3 106.8 � 21.7 2,15 17.2 �.001 .64 .001 �.001

ippocampusRI� 156.5 � 50.9 167.3 � 35.0 237.5 � 30.5 2,15 7.3 .006 .88 .02 .008RII� 271.2 � 25.3 259.3 � 33.3 236.1 � 49.3 2,15 1.3 .28 .85 .54 .27RI� 177.3 � 14.4 189.3 � 17.2 167.3 � 21.7 2,15 2.2 .14 .49 .12 .61RII� 352.2 � 36.5 337.5 � 26.2 208.8 � 19.8 2,15 46.4 �.001 .65 �.001 �.001C� 179.0 � 17.7 153.3 � 31.7 92.3 � 35.7 2,15 13.7 �.001 .31 .007 �.001C� 180.8 � 12.3 171.5 � 39.8 105.3 � 36.7 2,15 9.8 .002 .87 .007 .003

TC, tested control; NLH, nonlearned helplessness; LH, learned helplessness; PKA, protein kinase A; cAMP, cyclic adenosine monophosphate.aAttomoles/�g total RNA.bRats were given inescapable shock on day 1 and tested for escape latency on day 2; rats were again given shock on day 7 and tested on day 8 and retested

n day 14. Values are the mean � SD.

amrtlcedcaRtd

tswmcbos

savesbbo(biaptepbdssrsto

oMi

B

B

B


nisms of action of antidepressants may be associated withodulation in PKA. For example, chronic treatment with imip-

amine, tranylcypromine, or electroconvulsive shock causes theranslocation of PKA in rat brain (Nestler et al 1989). In addition,ong-term treatment with 5HT- or NE-reuptake inhibitors in-reases the binding of cAMP to 52-kDa RII subunits of PKA (Morit al 1998; Perez et al 1991), and Miyamoto et al (1997)emonstrated that long-term desipramine treatment of rats in-reased phosphorylation of the PKA substrate microtubule-ssociated protein-2, which may be associated with activation ofII PKA. These findings thus suggest that in depression, func-ions of PKA may be reduced and antidepressants may alleviateepressive symptoms by increasing the functioning of PKA.

Interestingly, when the rats were subjected to repeated stress,he behavioral deficit persisted longer than it did with a single-tress paradigm. This was accompanied by alterations in PKA,hich not only persisted in the repeated-stress group, but theagnitude of the changes in PKA was even greater. Given the

lose relationship of physiologic and behavioral manifestationsetween uncontrollable repeated stress and PTSD, our findingsf abnormal PKA in brain of these rats appear to be relevant totress-related disorders, particularly to PTSD.

The significance of the selective decrease in RII�, C�, and C�ubunits and of the increase in RI� with respect to LH behavior,nd thus in depression, is not clear at present; however, thearying RI:RII ratio and the varying intracellular distribution andxpression of PKA subunits in different tissues suggest that eachubunit may have distinct functional significance. Tissue distri-ution studies suggest that RII� is predominantly expressed inrain, adrenal, and adipose tissues and is the principal mediatorf cAMP activity in the mammalian central nervous systemSarkar et al 1984), whereas C� is expressed primarily in therain (Uhler et al 1986). Ludvig et al (1990) showed that RII�mmunolabeling is associated with postsynaptic but not presyn-ptic structures, suggesting that this subunit is involved in severalostsynaptic neuronal functions. Additionally, studies suggesthat RII�-mutant mice show defective motor behavior (Brandont al 1995) and that C�-mutant mice have impaired hippocampallasticity (Qi et al 1996). Given the significance of PKA in manyiological actions in the brain, together with emerging studiesemonstrating specific roles for its catalytic and regulatoryubunits in physiologic and behavioral manifestations, our ob-ervations of selectively and persistently decreased catalytic andegulatory activities and expression of RII�, C�, and C� in LH ratsuggest that alterations in PKA may be of critical significance inhe pathophysiology of LH, and thus in depressive behavior andther stress-related disorders.

This study was supported by grants from the National Institutef Mental Health (Grant Nos. KO1 MH01836 and RO1H68777-01) and a Young Investigator Award from the Amer-

can Foundation for Suicide Prevention to YD.

asoglu M, Mineka S (1992): The role of uncontrollable and unpredictablestress in post-traumatic stress responses in torture survivors. In: Bao-glu M, Mineka editors. Torture and Its Consequences: Current Treat-ment Approaches. Cambridge, MS: Cambridge University Press, 182–225.

orrelli E, Montmayeur JP, Foulkes NS, Sassone-Corsi P (1992): Signal trans-duction and gene control: The cAMP pathway. Crit Rev Oncog 3:321–338.

randon EP, Zhuo M, Huang YY, Qi M, Gerhold KA, Burton KA, et al (1995):Hippocampal long-term depression and depotentiation are defective inmice carrying a targeted disruption of the gene encoding the RI beta

subunit of cAMP-dependent protein kinase. Proc Natl Acad Sci U S A92:8851–8855.

Charney DS (1998): Monoamine dysfunction and the pathophysiology andtreatment of depression. J Clin Psychiatry 59(suppl 14):11–14.

Clegg CH, Cadd GG, McKnight GS: (1988): Genetic characterization of abrain-specific form of the type I regulatory subunit of cAMP-dependentprotein kinase. Proc Natl Acad Sci U S A 85:3703–3707.

Consensus Development Panel (1985): NIMH/NIH Consensus developmentconference statement on mood disorders: Pharmacological preventionof recurrences. Am J Psychiatry 142:469 –476.

De Rooij J, Zwartkruis FJT, Verheijen MHG, Cool RH, Nijman SMB, Witting-hofer A, Bos JL (1998): Epac is a Rap1 guanine-nucleotide-exchangefactor directly activated by cAMP. Nature 396:474 –477.

Dremier S, Kopperud R, Doskeland SO, Dumont JE, Maenhaut C (2003):Search for new cAMP-binding proteins. FEBS Lett 546:103–107.

Duman RS, Malberg J, Nakagawa S, D’Sa C (2000): Neuronal plasticity andsurvival in mood disorders. Biol Psychiatry 48:732–739.

Dwivedi Y, Conley RR, Roberts RC, Tamminga CA, Pandey GN (2002a): [3H]Cyclic-AMP binding sites and protein kinase A activity in the prefrontalcortex of suicide victims. Am J Psychiatry 159:66 –73.

Dwivedi Y, Rizavi, HS, Pandey GN (2002b): Differential effects of haloperidoland clozapine on [3H] cAMP binding, protein kinase A (PKA) activity, andmRNA and protein expression of selective regulatory and catalytic sub-unit isoforms of PKA in rat brain. J Pharmacol Exp Ther 301:197–209.

Dwivedi Y, Rizavi H, Shukla P, Lyons J, Faludi G, Palkovits M, et al (2004): PKAin postmortem brain of depressed suicide victims: Altered expression ofspecific regulatory and catalytic subunits. Biol Psychiatry 55:234 –243.

Foa E, Zinbarg RE, Olasov-Rothbaum B (1992): Uncontrollabililty and unpre-dictability in post-traumatic stress disorder: An animal model. PsycholBull 112:218 –238.

Henn FA, Johnson J, Edwards E, Muneyyirci J (1993): Animal models ofdepression. Clin Neurosci 1:152–156.

Itoh T, Abe K, Tokumura M, Horiuchi M, Inoue O, Ibii N (2003): Differentregulation of adenylyl cyclase and rolipram-sensitive phosphodiester-ase activity on the frontal cortex and hippocampus in learned helpless-ness rats. Brain Res 991:142–149.

Kessler RC, McGonagle KA, Zhao S, Nelson CB, Hughes M, Eshleman S, et al(1994): Lifetime and 12-month prevalence of DSM-III-R psychiatric disor-ders in the United States. Results from the National Comorbidity Survey.Arch Gen Psychiatry 51:8 –19.

Kohen R, Neumaier JF, Hamblin MW, Edwards E (2003): Congenitally learnedhelpless rats show abnormalities in intracellular signaling. Biol Psychiatry53:520 –529.

Lloyd C (1980): Life events and depressive disorder reviewed, II: Events asprecipitating factors. Arch Gen Psychiatry 37:541–548.

Lowther S, Katona CL, Crompton MR, Horton RW (1997): Brain [3H]cAMPbinding sites are unaltered in depressed suicides, but decreased byantidepressants. Brain Res 758:223–228.

Ludvig N, Ribak CE, Scott JD, Rubin CS (1990): Immunocytochemical local-ization of the neural-specific regulatory subunit of the type II cyclicAMP-dependent protein kinase to postsynaptic structures in the ratbrain. Brain Res 520:90 –102.

Maier SF (1990): The role of fear in mediating shuttle escape learning deficitproduced by inescapable shock. J Exp Psychol Anim Behav Process16:137–149.

Maier SF (2001): Exposure to the stressor environment prevents the tempo-ral dissipation of behavioral depression/learned helplessness. Biol Psy-chiatry 49:763–773.

Maier SF, Seligman MEP (1976): Learned helplessness: Theory and evidence.J Exp Psychol Gen 105:3–46.

Malberg JE, Duman RS (2003): Cell proliferation in adult hippocampus isdecreased by inescapable stress: Reversal by fluoxetine treatment. Neu-ropsychopharmacology 28:1562–1571.

Manier DH, Shelton RC, Ellis TC, Peterson CS, Eiring A, Sulser F (2000): Humanfibroblasts as a relevant model to study signal transduction in affectivedisorders. J Affect Disord 61:51–58.

Mann JJ (1998): The neurobiology of suicide. Nat Med 4:25–30.McPherson GA (1985): Analysis of radioligand binding experiments. A col-

lection of computer programs for the IBM PC. J Pharmacol Methods14:213–228.

Mineka S, Zinbarg R (1996): Conditioning and ethological models of anxietydisorders: Stress in dynamic context anxiety models. In: Mineka S, Zin-


M

M

N

N

O

P

P

P

Q

R

S


w

barg R, editors. 43rd Annual Nebraska Symposium on Motivation. Lincoln:University of Nebraska Press, 135–211.

iyamoto S, Asakura M, Sasuga Y, Osada K, Bodaiji N, Imafuku J, Aoba A(1997): Effects of long-term treatment with desipramine on microtubuleproteins in rat cerebral cortex. Eur J Pharmacol 333:279 –287.

ori S, Zanardi R, Popoli M, Garbini S, Brunello N, Smeraldi E, et al (1998):CAMP-dependent phosphorylation system after short and long-termadministration of moclobemide. J Psychiatr Res 32:111–115.

estler EJ, Greengard P (1994): Protein phosphorylation and the regulationof neuronal function. In: Siegel GJ, Agranoff BW, Albers RW, Molinoff PB,editors. Basic Neurochemistry: Molecular, Cellular, and Medical Aspects.Boston: Little Brown, 449 –474.

estler EJ, Terwilliger RZ, Duman RS (1989): Chronic antidepressant admin-istration alters the subcellular distribution of cyclic AMP-dependent pro-tein kinase in rat frontal cortex. J Neurochem 53:1644 –1647.

dagaki Y, Garcia-Sevilla JA, Huguelet P, La Harpe R, Koyama T, Guimon J(2001): Cyclic AMP-mediated signaling components are upregulated in theprefrontal cortex of depressed suicide victims. Brain Res 898:224–231.

aykel ES (1982): Life events and early environment. In: Paykel ES, editor.Handbook of Affective Disorders. New York: Guilford Press.

erez J, Tinelli D, Bianchi E, Brunello N, Racagni G (1991): CAMP bindingproteins in the rat cerebral cortex after administration of selective 5-HTand NE reuptake blockers with antidepressant activity. Neuropsycho-pharmacology 4:57–64.

etty F, Sherman AD (1979): Reversal of learned helplessness by imipramine.Commun Psychopharmacol 3:371–373.

i M, Zhuo M, Skalhegg BS, Brandon EP, Kandel ER, McKnight GS, Idzerda RL(1996): Impaired hippocampal plasticity in mice lacking the C�1 catalyticsubunit of cAMP-dependent protein kinase. Proc Natl Acad Sci U S A93:1571–1576.

obins LN, Helzer JE, Weissman MM, Orvaschel H, Gruenberg E, Burke JD Jr,Reiger DA (1984): Lifetime prevalence of specific psychiatric disorders inthree sites. Arch Gen Psychiatry 41:949 –958.

arkar D, Erlichman J, Rubin CS (1984): Identification of a calmodulin-bind-


ing protein that co-purifies with the regulatory subunit of brain proteinkinase II. J Biol Chem 259:9840 –9846.

Seligman ME, Maier SF (1967): Failure to escape traumatic shock. J ExpPsychol 74:1–9.

Shelton RC, Manier DH, Peterson CS, Ellis TC, Sulser F (1999): Cyclic AMP-dependent protein kinase in subtypes of major depression and normalvolunteers. Int J Neuropsychopharmacol 2:187–192.

Shelton RC, Manier DH, Sulser F (1996): CAMP-dependent protein kinaseactivity in major depression. Am J Psychiatry 153:1037–1042.

Sherman AD, Sacquitne JL, Petty F (1982): Specificity of the learned helpless-ness model of depression. Pharmacol Biochem Behav 16:449 –454.

Shirayama Y, Chen AC, Nakagawa S, Russell DS, Duman RS (2002): Brain-derived neurotrophic factor produces antidepressant effects in behav-ioral models of depression. J Neurosci 22:3251–3261.

Skalhegg BS, Tasken K (2000): Specificity in the cAMP/PKA signaling path-way. Differential expression, regulation, and subcellular localization ofsubunits of PKA. Front Biosci 5:D678 –D693.

Soloff PH, Lynch KG, Kelly TM, Malone KM, Mann JJ (2000): Characteristics ofsuicide attempts of patients with major depressive episode and border-line personality disorder: A comparative study. Am J Psychiatry 157:601–608.

Uhler MD, Chrivia JC, McKnight GS (1986): Evidence for a second isoform ofthe catalytic subunit of cAMP-dependent protein kinase. J Biol Chem261:15360 –15363.

Vollmayr B, Simonis C, Weber S, Gass P, Henn F (2003): Reduced cell prolifer-ation in the dentate gyrus is not correlated with the development oflearned helplessness. Biol Psychiatry 54:1035–1040.

Willner P (1995): Animal models of depression: Validity and applications. AdvBiochem Psychopharmacol 49:19 –41.

Wong ML, Licinio J (2001): Research and treatment approaches to depres-sion. Nat Rev Neurosci 2:343–351.

Wu J, Kramer GL, Kram M, Steciuk M, Crawford IL, Petty F (1999): Serotoninand learned helplessness: A regional study of 5-HT1A, 5-HT2A receptors
and the serotonin transport site in rat brain. J Psychiatr Res 33:17–22.

Documents

Altered protein kinase a in brain of learned helpless rats: effects of acute and repeated stress