Kidney International, Vol. 58 (2000), pp. 528–536

Altered gene expression in kidneys of mice with2,8-dihydroxyadenine nephrolithiasis

LI WANG, NANDITA RAIKWAR, LI DENG, MIN YANG, LI LIANG, CHANGSHUN SHAO,ANDREW P. EVAN, PETER J. STAMBROOK, AMRIK SAHOTA, and JAY A. TISCHFIELD

Departments of Medical and Molecular Genetics and Anatomy, Indiana University School of Medicine, Indianapolis, Indiana;Department of Genetics, Rutgers University, Piscataway, New Jersey; and Department of Cell Biology, Neurobiology, andAnatomy, University of Cincinnati College of Medicine, Cincinnati, Ohio, USA

Conclusions. These findings suggest that (1) there are sex-Altered gene expression in kidneys of mice with 2,8-dihydroxy-related differences in gene expression in DHA lithiasis, possi-adenine nephrolithiasis.bly caused by increased deposition of DHA crystals in maleBackground. We have developed a knockout mouse modelcompared with female kidneys; and (2) the expression of cer-for adenine phosphoribosyltransferase (APRT) deficiency, atain genes (for example, C10) may simply be an indication ofcondition that often leads to 2,8-dihydroxyadenine (DHA)

nephrolithiasis in humans. Aprt knockout male mice develop nonspecific cellular stimulation and may not be related to renalsevere renal damage by three months of age, but this is strain injury.specific. Renal damage in female mice is less pronounced thanin males. The gene level changes that promote renal injury inAPRT-deficient mice are not known.

Adenine phosphoribosyltransferase (APRT) is a ubiq-Methods. We used mRNA differential display polymeraseuitously expressed enzyme that catalyzes the formationchain reaction (DD-PCR) to analyze renal gene expression

changes in APRT-deficient male and female mice (strain C3H) of AMP from adenine and 5-phosphoribosyl-1-pyro-compared with age- and sex-matched Aprt heterozygote con- phosphate. In human APRT deficiency, adenine is oxi-trols. The differentially amplified bands were reamplified,

dized by xanthine dehydrogenase to 2,8-dihydroxyade-cloned, sequenced, and queried against the National Centernine (DHA). The sparingly soluble nature of DHA atfor Biotechnology Information nonredundant databases using

the Basic Alignment Search Tool. Relative quantitative reverse the normal urinary pH results in the excretion of DHAtranscription-polymerase chain reaction was used to confirm crystals in the urine and, frequently, the deposition ofthe results of DD-PCR for a selected number of genes in one-, DHA stones in the kidneys. Clinical symptoms of APRTthree-, and six-month-old male and female mice.

deficiency vary from benign to life threatening and mayResults. Sixty-three differentially amplified bands were identi-be present from birth or may be onset late in life. Majorfied, including 21 for known genes, and 8 of these were examined

further. In three-month-old APRT-deficient male mice, the signs and symptoms include crystalluria, hematuria, dys-expression of C10 was increased tenfold, and there was a four- uria, urinary tract infection, chronic interstitial nephritis,fold to sevenfold increase in the expression of a disintegrin and and, in some cases, chronic renal failure [1].metalloproteinase with thrombospondin motifs (ADAMTS-1),

We have generated APRT-deficient mice by geneMGP (matrix Gla protein), and lysyl oxidase (LOX). The ex-knockout technology [2, 3]. These mice mimic the humanpression of cholecystokinin-A receptor (CCKAR), imprinted

multimembrane-spanning polyspecific transporter-like gene 1 disease, but the disease appears to be more severe in(IMPT-1), and kidney androgen-regulated protein (KAP) was male than in female mice [2, 3]. As a consequence ofdiminished twofold to fourfold, but there was little or no change stone deposition in the kidneys, there is extensive struc-in the expression of organic anion transporter (OATP). Except

tural damage (inflammation, tubular dilation, necrosis,for a more than tenfold increase in C10 expression and up toand interstitial fibrosis) and loss of renal function in thesetenfold decrease in KAP expression, APRT-deficient female

mice did not show significant changes in gene expression com- mice. Laboratory measurements indicate that blood ureapared with controls. nitrogen is increased and creatinine clearance decreased

in APRT-deficient male mice compared with wild-typecontrols [3]. Female APRT-deficient mice show signifi-Key words: adenine phosphoribosyltransferase deficiency, gene knock-

out mice, renal gene, urinary tract infection, crystalluria, hematuria. cantly less renal damage than male mice of the same age.At age 12 weeks, for example, APRT-deficient females did

Received for publication June 1, 1999not show a significant impairment in glomerular filtrationand in revised form February 25, 2000

Accepted for publication March 13, 2000 rate, as estimated by creatinine clearance [3].The underlying molecular mechanisms involved in the 2000 by the International Society of Nephrology

528

Wang et al: Alterations in renal gene expression 529

pathogenesis of kidney stone disease, particularly alter- month-old male C3H Aprt heterozygote and a homozy-gous-deficient mouse was reverse transcribed with oneations in the expression of disease-related genes, are un-

known. The availability of a mouse model for this disease of 3 HT11M (H 5 HindIII site, T11 5 11Ts, M 5 A, C,or G) downstream primers using Superscript II RNase H2enables us, to our knowledge for the first time, to explore

the molecular pathological basis of DHA-induced neph- reverse transcriptase (GIBCO BRL). The same primerwas used subsequently as the 39 primer to amplify therolithiasis. In the present study, mRNA differential dis-

play polymerase chain reaction (DD-PCR) was used to single-stranded cDNAs together with 1 of 16 differentrandom 13-mer 59 primers, in the presence of [a-33P]-identify 63 cDNAs, including 21 known genes, in which

the expression was altered in APRT-deficient mice. The dATP (Amersham, Arlington Heights, IL, USA). ThePCR products were separated on a 6% denaturing poly-known genes encode proteins such as extracellular ma-

trix (ECM) proteins, membrane transporters, metabolic acrylamide gel, dried, and exposed to Kodak Max x-rayfilm for three to seven days. Gel slices containing theenzymes, and hormone-regulated proteins involved in

various physiological and pathological processes. The differentially amplified products were soaked in 20 mLwater for 15 minutes to remove the urea and were thenexpression of eight of these genes was further examined

by relative quantitative reverse transcription-PCR (RT- reamplified using the same primers [5].PCR) in APRT-deficient male and female mice of vari-

DNA cloning and sequencingous ages. Our findings suggest that there are sex-relateddifferences in gene expression in DHA lithiasis and that The reamplified PCR products were cloned into vector

CR2.1 using the TA cloning kit (Invitrogen, Carlsbad,the expression of certain genes may be related to nonspe-cific cellular stimulation rather than to renal injury. CA, USA). The recombinant plasmids were examined

for inserts by colony PCR using M13 reverse and forwardprimers [5] and were then sequenced using the Thermo

METHODSSequenase radiolabeled terminator cycle sequencing kit

Animals (Amersham, Cleveland, OH, USA). The sequences werequeried against the National Center for BiotechnologyThe Aprt gene knockout mice were originally gener-

ated in a mixed background of strains 129/Sv (embryonic Information (NCBI) GenBank and dbEST databases usingBasic Local Alignment Search Tool algorithm (BLAST).stem cells) and C57BL/6 J (blastocyst donors) [2]. The

mixed-strain heterozygotes were backcrossed to strainRelative quantitative RT-PCRC3H/HeJ mice for 10 generations, after which the prog-

eny was expected to be identical at 99.9% of their loci. Relative quantitative RT-PCR for a select numberof genes was carried out using the QuantumRNA kitC3H/HeJ Aprt heterozygotes were then mated to gener-

ate APRT-deficient homozygotes. Using the same strat- following the manufacturer’s instructions (Ambion, Inc.,Austin, TX, USA). Briefly, DNA-free total RNA (1.2 mg)egy, we have also introduced the Aprt mutation into

strains 129, Black Swiss, and C57. The Aprt genotypes was reverse transcribed with Superscript II RNase H2

reverse transcriptase (GIBCO BRL) using random de-were determined by PCR analysis of DNA isolated fromtail biopsies, as described previously [4]. The gross renal camers as downstream primers. The second-round PCR

reaction was performed with single-stranded cDNA orig-histologic changes in the different strains were similar,but the extent and timing of any strain-specific differences inating from the equivalent of 1 to 10 ng total RNA in

a 10 mL volume containing 1 3 PCR buffer, 200 mmol/Lremain to be established. We used C3H Aprt heterozy-gotes as controls in the following experiments, as pheno- each dNTP, 500 nmol/L gene-specific primers, and 0.25

units Taq DNA polymerase (GIBCO BRL). The prim-typic appearance and gross renal histology did not showany differences compared with wild-type animals [2]. ers were designed based on cDNA sequence analysis and

were obtained from GIBCO BRL. The PCR parametersTotal RNA isolation were a 15-second denaturation at 938C, a 30-second an-

nealing at 528C to 588C (depending on the gene), and aTotal RNA was isolated from whole mouse kidneysusing the Qiagen RNAeasy mini kits (Santa Clarita, CA, 30-second extension at 728C for 22 to 40 cycles. The PCR

products were resolved on a 1% agarose gel, stainedUSA). Contaminating DNA was removed by treatingthe samples with RNase-free DNase I (GIBCO BRL, with ethidium bromide, and analyzed by densitometery.

A mixed ratio of 18S ribosomal RNA primers and com-Gaithersburg, MD, USA).petimers was used to amplify rRNA as an internal con-

Differential display PCR trol under the same conditions as the genes of interest.A competimer is a primer that has been modified at itsDifferential display-PCR was performed using RNA-

image kits according to the manufacturer’s instructions 39 end to block extension by DNA polymerase.For a given sample, a standard curve was obtained by(GenHunter Corporation, Nashville, TN, USA). Briefly,

0.2 mg of total RNA from kidney tissue from a three- plotting the densitometric signal intensity of the rRNA

Wang et al: Alterations in renal gene expression530

PCR product versus the primers:competimers ratio using C10, a macrophage inflammatory protein; cholecystoki-nin-A receptor (CCKAR); imprinted multimembrane-GraphPad Prism software (GraphPad Software Inc., San

Diego, CA, USA). With different mixed ratios of 18S spanning polyspecific transporter-like gene 1 (IMPT-1);kidney androgen-regulated protein (KAP); lysyl oxidaserRNA primers and competimers (usually primers:com-

petimers ratios from 10:0 to 3:7), signal intensity of the (LOX); matrix Gla protein (MGP); and an organic aniontransporter (OATP). CCKAR and IMPT-1 are tubule488 bp 18S rRNA PCR band ranged from strong to weak.

The sample signal intensities were normalized as de- cell surface proteins. MGP is an ECM protein that inhib-its tissue calcification. LOX catalyzes the cross-linkingscribed in the Ambion manual, and the change in gene

expression was expressed as the ratio of the signal inten- of collagen in tissue fibrosis, and KAP and OATP are twohormone-regulated proteins. The PCR primer sequencessity of the RT-PCR product from an APRT-deficient

mouse divided by the intensity of the product from a and the expected product sizes for these gene fragmentsare shown in Table 2.heterozygote control. Because of inherent biological and

experimental variation, expression ratios in the range For relative quantitative RT-PCR, 18S rRNA was usedboth as an internal control and as an indicator that PCR0.5 to 2.0 were not considered significant.amplification was proportional to the template concen-tration. Figure 1A shows PCR products from 18S rRNA

RESULTSand ADAMTS-1 mRNA. Using calibration curves simi-

Identification of differentially expressed mRNAs lar to the one shown in Figure 1B, the expression ofADAMTS-1 in APRT-deficient mice was normalizedKidneys from a three-month-old male APRT-deficient

C3H mouse were pale yellow, atrophic, and of irregular against the internal control and then compared with ex-pression in heterozygous mice. The RT-PCR results wereshape, compared with healthy kidneys from an Aprt het-

erozygote of the same age. Total RNA extracted from similar to those from DD-PCR, indicating a significantelevation in gene expression for ADAMTS-1, C10, LOX,kidneys of APRT-deficient and heterozygous mice was

reverse transcribed and amplified by PCR. The RT-PCR and MGP, and decreased expression for KAP, CCKAR,and IMPT-1 (Table 3). A modest but insignificant de-products from the two mice were electrophoresed side

by side, and 63 differentially amplified bands were identi- crease in OATP expression was detected by RT-PCR.fied. Of these, 26 were strongly expressed in the Aprt

Analysis of gene expression at different agesheterozygous mouse, and 37 were strongly expressed inthe APRT-deficient mouse. The bands were cut from the To evaluate the onset and significance of altered gene

expression, kidneys from male and female mice agedgels, reamplified, cloned, sequenced, and queried againstthe NCBI nonredundant databases. cDNA fragments in one, three, and six months were examined for the above

eight genes. The gross renal morphology of one-month-the size range 100 to 500 bp provided sufficient sequenceinformation for DNA database searches. old APRT-deficient male mice was similar to heterozy-

gote controls, but the kidneys from three- and six-month-Fifty-three of the 63 cDNA clones (about 83%)matched a total of 44 nonredundant GenBank and dbEST old male mice were highly abnormal, showing atrophy,

pale color, and irregular shape. At a given age, kidneysdatabase entries. The 63 cDNA fragments were dividedinto the following categories: (1) previously identified from APRT-deficient female mice were much less se-

verely affected than from male mice.mouse genes (25 clones), (2) mouse homologues of iden-tified rat or human genes (4 clones), (3) mouse expressed The renal expression of C10 was increased tenfold

in a three-month-old, APRT-deficient male mouse, andsequence tag (EST) clones (20 clones), (4) mouse homo-logues of rat or human ESTs (4 clones), and (5) no match there was a fourfold to sevenfold increase in the expres-

sion of ADAMTS-1, MGP, and LOX. There was littlefound by BLAST (10 clones). Twenty-one known genes(Table 1), in which the renal expression was altered in or no change in the expression of these four genes at

one and six months (Fig. 2A). The expression of CCKARAPRT-deficient mice, encoded proteins such as ECMproteins, membrane transporters, metabolic enzymes, and IMPT-1 was diminished twofold to fourfold in male

mice at three months, with a modest decrease at oneand hormone-regulated proteins involved in variousphysiological and pathological processes. and six months (Fig. 2B). There was also a fourfold

decrease in the expression of KAP, and this decreaseQuantitative analysis of gene expression persisted at six months (Fig. 2C). There was little or no

change in the expression of OATP in the three ageBecause of their functional importance and to confirmthe results of DD-PCR, the expression of eight known groups (Fig. 2C). Except for a more than tenfold increase

in C10 expression and up to tenfold decrease in KAPgenes in three-month-old homozygous-deficient mice andin heterozygous mice was further examined by relative expression at three months, APRT-deficient female mice

did not show significant changes in gene expression com-quantitative RT-PCR. These were a disintegrin and metal-loproteinase with thrombospondin motifs (ADAMTS-1); pared with heterozygote controls (Fig. 2 D–F).

Wang et al: Alterations in renal gene expression 531

Table 1. Differentially expressed genes in kidneys of a 3-month-old male Aprt 2/2 C3H mouse identified by DD-PCR

Change in Product sizeClone expression bp Sequence identity GenBank #

A2-1 1 340 Pentylenetetrazol-related mRNA D45203A3-2, G3-1 1 400 Arginase II AF032466A411 2 360 Imprinted multimembrane-spanning polyspecific transporter-like gene 1 (IMPT-1) AF028739A9-2 1 420 Proteolipid protein (PLP) M15442A1113 2 300 Cholecystokinin type-A receptor (CCKAR) D85605C1111, 360G1111, 360G1112, 240G11-2 360A11-3 1 120 Macrophage inflammatory protein (C10) M58004C4-1 1 300 Homeodomain protein AJ000507C4-4 1 120 A disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS-1) AB001735C513 2 180 Fragile X mental retardation L23971G4-1, G15-3 1 180 Mouse lysyl oxidase (LOX) M65142G511 2 200 Hydrophobic protein L07095G111, 2 200 Kidney androgen-regulated protein (KAP) M22810,G711, M63707G712G9-1 1 100 Matrix Gla protein (MGP) D00613,

S77350G9-3 1 120 Arylsulfatase A X73230G9-4 1 120 EAT/MCL-1 mRNA U35623G15-1 1 600 T cell receptor AE000664G16-1 1 240 T cell receptor a/d M64239A1612 2 490 Similar to rat cytochrome b5 D13205C2-1 1 200 Similar to rat liver proteasomal ATPase, rat Tat-binding protein, human immuno- D83522,

deficiency virus tat transactivator binding protein-1 U77918,M34079

G911 2 400 Similar to rat organic anion transporter (OATP) L19031G15-2 1 100 Similar to rat diacylglycerol kinase (DGK) S49760

Symbols are: 1, increased renal expression in APRT2/2 mouse; 2, decreased renal expression in APRT2/2 mouse.

DISCUSSION served in lung tissue cultures from mice treated with NG-nitro-l-arginine-methyl ester, an inducer of granuloma-APRT-deficient mice generated by gene knockout de-tous inflammatory lesions in the lung [7]. Our studiesvelop DHA nephrolithiasis, as in humans. We have re-show that the level of C10 renal mRNA expression in-cently described the renal pathological characteristicscreased about threefold in one-month-old male mice andand some of the functional consequences of kidney dam-reached a tenfold increase in both male and female miceage in these mice [2, 3]. Because of the complexity ofat three months of age, compared with heterozygotekidney damage associated with APRT deficiency, it iscontrols. These findings implicate C10 as a mediator ofexpected that there will be alterations in the expressioninflammation and infiltration of lymphocytes in kidneysof many genes in this disease. In the present study, weof APRT-deficient mice. These data are consistent withhave shown that there are at least 63 differentially ex-previous observations that kidneys of one-month-old,

pressed mRNAs (including 21 known genes) in kidneys APRT-deficient mice exhibit mild-to-moderate inflam-of APRT-deficient mice. The corresponding proteins for mation and some crystal deposition associated withthe known genes are involved in many physiological and lymphocytic infiltration [2, 3]. Since the extent of renalpathological processes, suggesting that they may also be damage in APRT-deficient females was significantlyimportant in the pathogenesis of DHA nephrolithiasis. lower than in APRT-deficient males, it is also possibleBased on information about their function, eight of these that the expression of C10 is not a marker for renalgenes were selected for further investigation, as de- injury but may simply be a consequence of nonspecificscribed later in this article. cellular stimulation.

Our finding that the renal expression of ADAMTS-1Inflammation-associated genes (C10 and ADAMTS-1) is increased in APRT-deficient male mice but not in fe-

C10, a mouse macrophage inflammatory protein, be- male mice is very interesting, since this gene has beenlongs to the C-C chemokine family, and it induces direc- reported to be associated with inflammation. ADAMTS-1tional migration of T cells, monocytes, and eosinophils. encodes an ECM-binding protein that belongs to theC10 is induced in macrophages by an interleukin-4 stimu- cellular disintegrin and metalloproteinases (ADAM)

family [8]. In control mice, a very weak signal forlus [6]. Up-regulation of C10 expression has been ob-

Wang et al: Alterations in renal gene expression532

Table 2. Sequences of primers for relative quantitative RT-PCR and the sizes of PCR products

Gene Primers Size bp

ADAMTS-1 59GGTGCAAGCTCACCTGTGAAGC 39; 59CATCTTCTTGCATGTGGAACCG 39 212C10 59AGGATGAGAAACTCCAAGACTG 39; 59TCAAGCAATGACCTTGTTCCCA 39 354CCKAR 59TCTGGAGCTCTACCAAGGAATC 39; 59GACCACAATGACAATGAGCATG 39 286IMPT-1 59TCTTCGGGATCCTCCAGATGA 39; 59GTTGCACAGATGCAGAGAGGC 39 246KAP 59TCACTGTCTTCTGTGGTCTGAC 39; 59ACAATATCCTGAATGGCAGTCG 39 390LOX 59CTGCCTGGCCAGTTCAGCATAT 39; 59TCCACTGGCAGTCTATGTCTGC 39 302MGP 59TAATATTTGGCTCCTCGGCGCT 39; 59CGAGACACCATGAAGAGCCTGC 39 323OAPT 59ACAGCCATACCTGGGTACATG 39; 59GATAGCTTGATCCTCTTAGTGC 39 262

For each gene, the sequence on the left is for the forward primer.

Fig. 1. Relative quantitation of ADAMTS-1mRNA from a three-month-old adenine phos-phoribosyltransferase (APRT)-deficient mouseby reverse transcription-polymerase chain reac-tion (RT-PCR). (A) Gel showing the RT-PCRproducts from 18S rRNA and ADAMTS-1mRNA stained with ethidium bromide. The18S primers/competimers ratios ranged from6:4 to 2:8. (B) Standard curves for 18S rRNART-PCR. The intensities of the 18S rRNAPCR products for Aprt heterozygote (1/2; e;female) and homozygous-deficient (2/2; r;female) samples were plotted against the 18SrRNA primers/compatimers ratio by linear re-gression analysis. The intensity of the signalfor ADAMTS-1 and other genes was normal-ized, as described in the QuantumRNA man-ual (Ambion). Each data point is the mean offive replicates from one animal.

ADAMTS-1 transcripts was detected in the heart and diseases [10, 11], and increased LOX expression has beenobserved in fibrotic renal lesions during chronic adriamy-kidney but not in other organs (lung, liver, brain, and

muscle). Upon lipopolysaccharide administration, there cin nephropathy [12]. In adriamycin-treated rats, the ex-pression of LOX in total kidney, glomeruli, and medullawas systemic inflammation as well as stimulation in the

expression of ADAMTS-1 in kidney and heart. Interleu- increased up to threefold between weeks 8 and 12. Thesestudies suggested that collagen cross-link formation bykin-1 stimulates ADAMTS-1 mRNA expression in vitro

in colon 26 cells [9]. LOX might be implicated in the pathogenesis of irrevers-ible, fibrotic renal lesions. Although mesangial cells, kid-

LOX and kidney fibrosis ney fibroblasts, and epithelial cells all express LOX, onlyexpression in epithelial cells is induced by transformingLysyl oxidase is an enzyme that catalyzes collagen

cross-linking through oxidative deamination of lysyl growth factor-b (TGF-b). Our previous studies showedthat kidney lesions typical of chronic interstitial nephritisε-amino groups to form stable and insoluble collagen

products. The imbalance between collagen deposition were apparent in homozygous-deficient male mice [2].Our current observation that the renal expression ofand removal results in an abnormal accumulation of

ECM proteins. Several lines of evidence suggest that LOX is elevated in these mice implicates a role for thisgene in renal fibrosis in APRT deficiency.LOX expression is significantly elevated in fibrotic liver

Wang et al: Alterations in renal gene expression 533

Table 3. Changes in renal gene expression in a 3-month-old Hormone-regulated proteins (KAP and OATP)male Aprt 2/2 mouse identified by DD-PCR or relative

quantitative RT-PCR Kidney androgen-regulated protein (KAP) representsthe most abundant mRNA species in mouse kidney andChange in expressionis expressed in epithelial cells of proximal convolutedChange in expression by RT-PCR

Gene by DD-PCR (fold of control)a tubules [20]. The expression of KAP is multihormoneC10 1 10.62 regulated. Androgens stimulate KAP gene expression inLOX 1 7.69 epithelial cells of proximal convoluted tubules of corticalMGP 1 4.72

nephrons, while estrogens and pituitary hormones con-ADAMTS-1 1 4.33CCKAR 2 0.33 trol its expression in the juxtamedullary S3 segment ofIMPT-1 2 0.41 the tubules [21]. Furthermore, the androgenic responseKAP 2 0.25

of KAP gene expression is independent of pituitary func-OATP 2 0.90tion but dependent on thyroid hormone for maximalSymbols are: 1, increased renal expression in APRT2/2 mouse; 2, decreased

renal expression in APRT2/2 mouse induction [22]. OATP is another hormone-regulated genea Data are the mean of triplicate measurements from the same mouse that encodes an organic anion transporter and is expressed

only in the apical membrane of S3 proximal tubulesin the kidney [23]. Regulation of renal OATP mRNAexpression, stimulated by testosterone and inhibited byMGP and tissue calcificationestrogen, is important in modulating the renal tubular

Matrix Gla protein is a low molecular weight (14 kD), secretion of estradiol conjugated to form estradiol-17-b-g-carboxyglutamic acid (Gla)-containing, vitamin K- D-glucoronide inside the tubule cells [24]. The impair-dependent protein, and is a member of the family of ment of OATP transporter function may induce the accu-ECM mineral-binding Gla proteins. It is highly expressed mulation of estradiol in the kidney, and this may inhibitin developing bone and cartilage, acting as a regulator OATP expression.of calcification of the ECM [13, 14]. It is also expressed

APRT deficiency in male and female miceat a lower level in soft tissues, including kidney, heart,lung, and aorta, but its role is not clearly understood As reported previously, APRT-deficient female mice[15]. Kidney epithelial cells express MGP mRNA that are much less severely affected than males [3]. We havecan be developmentally regulated in vivo and is regu- carried out studies on urinary excretion of DHA (Stam-lated by growth factors and cell density in vitro [16, 17]. brook et al, unpublished data) and DHA crystal deposi-

tion in kidneys (Evan et al, manuscript in preparation)The physiological role of MGP in kidney is not yet clear.in male and female APRT-deficient mice of differentHowever, the increased expression of MGP in the kid-age groups. Males excrete significantly more DHA thanneys of APRT-deficient mice may implicate its impor-females, and they also have more DHA crystals in thetance in DHA nephrolithiasis.kidneys, suggesting that the observed sex difference indisease severity may be related to increased crystal depo-Transmembrane proteins (CCKAR and IMPT-1)sition in male kidneys. The increased expression of LOX,Cholecystokinin-A receptor (CCKAR), which is widelyADAMTS-1, MGP, CCKAR, and IMPT-1 in kidneysexpressed in the gastrointestinal system as well as in brainfrom APRT-deficient male mice supports the gender biasand kidney, functions as a receptor for gastrin/cholecys-in disease severity.tokinin for trophic control of the pancreas and gastroin-

In kidneys from three-month-old male mice, the pri-testinal tract [18]. The IMPT-1 gene encodes a predictedmary pathological change was interstitial fibrosis, which

multimembrane-spanning protein similar to bacterialextended from the renal capsule to the papilla. This

and eukaryotic polyspecific metabolite transporter and change appeared diffuse in that the entire kidney usuallymultidrug resistance pump [19]. IMPT-1 mRNAs are possessed extensive regions of fibrosis. Interstitial fibro-highly expressed in tissues with metabolite transport sis appeared more focal in kidneys from three-month-oldfunctions, including liver, kidney, intestine, extra-embry- female mice, and much less of the kidney was affected. Aonic membranes, and placenta. In our studies, the finding midcoronal section of a female kidney typically showedthat the renal expression of these two genes is decreased three to four small regions of fibrosis. Mild hydronephro-in APRT-deficient mice suggests an impairment of re- sis seen as dilation of the renal pelvis and some corticalceptor and transporter functions, which may ultimately thinning were found in both male and female mice; how-affect renal function. These data are consistent with our ever, again, this was less common in females.previous observations that kidney tubule damage is a Within the regions of renal interstitial fibrosis in malestriking feature in APRT deficiency and results in the and female mice, the following alterations were com-

monly seen: (1) tubular atrophy of primarily the proximalphysiological impairment of renal function [3].

Wang et al: Alterations in renal gene expression534

Fig. 2. RT-PCR for renal gene expression in male (A–C ) and female (D–F ) APRT-deficient mice at various ages. The graphs show the ratio ofrenal gene expression in APRT-deficient mice compared with heterozygote controls of the same age. Each data point is the mean of triplicatemeasurements from one animal. Symbols in A and D are: (j) C10; (h) LOX; (3) MGP; (.) ADAMTS-1. Symbols in B and E are: (d) CCKAR;(s) IMPT. Symbols in C and F are: (r) OATP; (e) KAP.

Wang et al: Alterations in renal gene expression 535

tubules, (2) tubular dilation of the proximal tubules and interactions [30–34]. The binding of COM crystals toapical microvilli facilitates their internalization into vesi-collecting ducts, (3) lymphocytic and macrophage infil-

tration around injured tubular segments, (4) perivascular cles and leads to changes in the cytoskeletal structure[35]. The endocytosed COM crystals were shown to acti-cuffing with interstitial infiltrates, (5) loss of postglomer-

ular capillaries, (6) crystal deposition around atrophic vate a number of immediate early genes (for example,c-myc, EGR-1, Nur-77), as well as plasminogen activatortubular segments, (7) crystalline formations within tubu-

lar lumens of the proximal and distal tubules as well inhibitor, platelet-derived growth factor, and connectivetissue growth factor [36]. The particular combination ofas the collecting ducts, (8) dilation of Bowman’s space

resulting in glomerular cysts, (9) flocculent material in activated genes was believed to favor the accumulationof ECM proteins and the stimulation of fibroblast prolif-dilated Bowman’s space suggestive of proteinuria, and

(10) increased matrix material in the interstitial space eration, suggesting a role for COM crystals in the devel-opment of interstitial fibrosis. Bikunin is a component(Evan et al, manuscript in preparation).

The progression of various forms of renal disease is of a family of serine proteases that appears to inhibitthe crystallization of calcium oxalate. The expressionmore rapid in men than in women [25, 26]. Men also have

a higher incidence of calcium oxalate nephrolithiasis, of bikunin is reported to be significantly increased incultured epithelial cells exposed to oxalate, suggestingbut the reasons for this are unclear. In a rat model of

urolithiasis, it has been shown that androgens increase that this may be a protective response to the nephrotoxiceffects of oxalate [37, 38].and estrogens decrease urinary oxalate excretion, plasma

oxalate concentration, and kidney calcium oxalate crys- We used a cDNA array (Clontech, Palo Alto, CA,USA) to monitor changes in gene expression in culturedtal deposition. These findings may partly explain why

nephrolithiasis is a predominantly male disease [27]. human renal epithelial (NHK-C) and African greenmonkey kidney epithelial (BSC-1) cells exposed to DHASex hormones per se may be important determinants

of the greater susceptibility of male kidneys to progressive crystals (Wang et al, manuscript in preparation). Thearray contains 588 cDNAs associated with various physi-renal injury. Potential mechanisms for this include effects

of sex hormones on matrix accumulation as well as inter- ological and pathological processes. Our findings suggestthat the binding of DHA crystals to cultured cells andaction of sex hormones with growth factors such as TGF-b.

In glomerulosclerosis, collagens synthesized by mesan- subsequent pattern of gene expression is similar to thatseen with COM crystals. These observations and thegial cells contribute to the pathological changes. It has

been reported that estradiol in micromolar concentra- availability of the APRT-deficient mouse model (inwhich the severity of the disease can be experimentallytions suppressed total collagen, type I collagen, and type

IV collagen synthesis, and decreased steady-state mRNA modulated) suggest that investigation of DHA lithiasismay provide insights into the molecular pathophysiologylevels for type I collagen in mesangial cells [28]. The

accumulation of glomerular ECM may contribute to the of the more common stone diseases.development of glomerular sclerosis. In contrast, testos-terone had no effect on collagen synthesis by mesangial ACKNOWLEDGMENTScells. More recently, it has been shown that estradiol This work was supported by National Institutes of Health grants

DK38185, ES05652, and ES 06096. A portion of this work was pre-inhibits gene expression by antagonizing the actions ofsented in abstract form (Wang et al, Am J Hum Genet 63:183, 1998).TGF-b [29].Li Wang was supported by a National Insitutes of Health TrainingGrant (PHS T32 HD07373). We gratefully acknowledge the assistance

Cell culture models for kidney stone disease of Dr. Sudhanshu Raikwar in the preparation of this manuscript.

The present study highlights the complexity of investi-Reprint requests to Amrik Sahota, Ph.D., Department of Genetics,

gating gene expression changes in whole kidneys. The Nelson Biological Laboratories, Rutgers University, 604 Allison Road,Piscataway, New Jersey 08854-8082, USA.observed changes may occur in tubular epithelial cells,E-mail: sahota@biology.rutgers.eduinterstitial fibroblasts, or infiltrating cells, and the expres-

sion of several genes may be altered in a given cell ortissue. To dissect these change at the cellular level and to APPENDIXassess the physiological and pathological importance of

Abbreviations used in this article are: ADAMTS-1, a disintegrinthe various genes in the development and progression and metalloproteinase with thrombospondin motifs; APRT, adenine

phosphoribosyltransferase; BLAST, Basic Local Alignment Searchof DHA nephrolithiasis, we are investigating the effectsTool; C10, a macrophage inflammatory protein; CCKAR, cholecystoki-of DHA crystals on gene expression in different types ofnin-A receptor; COM, calcium oxalate monohydrate; DD-PCR, differ-

cultured kidney cells. ential display PCR; DHA, 2,8-dihydroxyadenine; ECM, extracellularmatrix; EST, expressed sequence tag; Gla, g-carboxyglutamic acid;Calcium oxalate monohydrate (COM) is the mostIMPT-1, imprinted multimembrane-spanning polyspecific transporter-common cause of renal stone disease. COM is injuriouslike gene 1; KAP, kidney androgen-regulated protein; LOX, lysyl oxi-

to cultured renal epithelial cells, and this system has been dase; MGP, matrix Gla protein; NCBI, National Center for Biotechnol-ogy Information; and OATP, organic anion transporter.widely used to model the early events in crystal–cell

Wang et al: Alterations in renal gene expression536

Molecular structure of the mouse CCK-A receptor gene. BiochemREFERENCESBiophys Res Commun 236:630–635, 1997

19. Dao D, Frank D, Qian N, O’Keefe D, Vosatka RJ, Walsh1. Simmonds HA, Sahota A, Van Acker KJ: Adenine phosphoribo-syltransferase deficiency and 2,8-dihydroxyadenine lithiasis, in The CP, Tycko B: IMPT1, an imprinted gene similar to polyspecific

transporter and multi-drug resistance genes. Hum Mol GenetMetabolic and Molecular Bases of Inherited Disease (7th ed), editedby Scriver CR, Beaudet AL, Sly WS, Valle D, New York, 7:597–608, 1998

20. Meseguer A, Catterall JF: Mouse kidney androgen-regulatedMcGraw-Hill, 1995, pp 1707–17232. Engle SJ, Stockelman MG, Chen J, Boivin G, Yum M, Davies protein messenger ribonucleic acid is expressed in the proximal

convoluted tubules. Mol Endocrinol 1:535–541, 1987PM, Ying MY, Sahota A, Simmonds HA, Stambrook PJ, Tisch-field JA: Adenine phosphoribosyltransferase-deficient mice de- 21. Meseguer A, Catterall JF: Effects of pituitary hormones on the

cell-specific expression of the KAP gene. Mol Cell Endocrinolvelop 2,8-dihydroxyadenine nephrolithiasis. Proc Natl Acad SciUSA 93:5307–5313, 1996 89:153–162, 1992

22. Sole E, Calvo R, Obregon MJ, Meseguer A: Effects of thyroid3. Stockelman MG, Lorenz JN, Smith FN, Boivin G, Sahota A,Simmonds HA, Stambrook PJ, Tischfield JA: Chronic renal fail- hormone on the androgenic expression of KAP gene in mouse

kidney. Mol Cell Endocrinol 119:147–159, 1996ure in a mouse model of human adenine phosphoribosyltransferasedeficiency. Am J Physiol 275:F154–F163, 1998 23. Bergwerk AJ, Shi X, Ford AC, Kanai N, Jacquemin E, Burk

RD, Bai S, Novikoff PM, Stieger B, Meier PJ, Schuster VL,4. Stambrook PJ, Shao C, Stockelman M, Boivin G, Engle SJ,Tischfield JA: APRT: A versatile in vivo resident reporter of Wolkoff AW: Immunologic distribution of an organic anion trans-

port protein in rat liver and kidney. Am J Physiol 271:G231–G238,local mutation and loss of heterozygosity. Environ Mol Mutagen28:471–482, 1996 1996

24. Lu R, Kanai N, Bao Y, Wolkoff AW, Schuster VL: Regulation5. Corton JC, Gustafsson J: Increased efficiency in screening largenumbers of cDNA fragments generated by differential display. of renal OATP mRNA expression by testosterone. Am J Physiol

270:F332–F337, 1996Biotechniques 22:802–810, 199725. Neugarten J, Silbiger SR: Effects of sex hormones on mesangial6. Orlofsky A, Lin EY, Prystowsky MB: Selective induction of

cells. Am J Kidney Dis 26:147–151, 1995the b-chemokine C10 by IL-4 in mouse macrophages. J Immunol26. Silbiger SR, Neugarten J: The impact of gender on the progres-152:5084–5091, 1994

sion of chronic renal disease. Am J Kidney Dis 25:515–533, 19957. Hogaboam CM, Chensue SW, Steinhauser ML, Huffnagle GB,27. Fan J, Chandhoke PS, Grampsas SA: Role of sex hormones inLukacs NW, Strieter RM, Kunkel SL: Alteration of the cytokine

experimental calcium oxalate nephrolithiasis. J Am Soc Nephrolphenotype in an experimental lung granuloma model by inhibiting10(Suppl 14):S376–S380, 1999nitric oxide. J Immunol 159:5585–5593, 1997

28. Kwan G, Neugarten J, Sherman M, Ding Q, Fotadar U, Lei J,8. Kuno K, Matsushima K: ADAMTS-1 protein anchors at the extra-Silbiger S: Effects of sex hormones on mesangial cell proliferationcellular matrix through the thrombospondin type I motifs and itsand collagen synthesis. Kidney Int 50:1173–1179, 1996spacing region. J Biol Chem 273:13912–13917, 1998

29. Lei J, Silbiger S, Ziyadeh FN, Neugarten J: Serum-stimulated9. Kuno K, Kanada N, Nakashima E, Fujiki F, Ichimura F, Matsu-a1 type IV collagen gene transcription is mediated by TGF-b andshima K: Molecular cloning of a gene encoding a new type ofinhibited by estradiol. Am J Physiol 274:F252–F258, 1997metalloproteinase-disintegrin family protein with thrombospondin

30. Lieske JC, Norris R, Swift H, Toback FG: Adhesion, internaliza-motifs as an inflammation associated gene. J Biol Chem 272:556–tion and metabolism of calcium oxalate monohydrate crystals by562, 1997renal epithelial cells. Kidney Int 52:1291–1301, 199710. Desmouliere A, Darby I, Costa AM, Raccurt M, Tuchweber

31. Verkoelen CF, Van der Boom BG, Houtsmuller AB, SchroderB, Sommer P, Gabbiani G: Extracellular matrix deposition, lysylFH, Romlin JC: Increased calcium oxalate monohydrate crystaloxidase expression, and myofibroblastic differentiation during thebinding to injured renal tubular epithelial cells in culture. Am Jinitial stages of cholestatic fibrosis in the rat. Lab Invest 76:765–778,Physiol 274:F958–F965, 19981997 32. Thamilselvan S, Khan SR: Oxalate and calcium oxalate crystals11. Wakasaki H, Ooshima A: Synthesis of lysyl oxidase in experimen- are injurious to renal epithelial cells: Results of in vivo and in vitrotal hepatic fibrosis. Biochem Biophys Res Commun 166:1201–1204, studies. J Nephrol 11(Suppl 1):66–69, 1998

1990 33. Thamilselvan S, Hackett RL, Khan SR: Cells of proximal and12. Di Donato A, Ghiggeri GM, Di Duca M, Jivotenko E, Acinni distal tubular origin respond differently to challenges of oxalate

R, Campolo J, Ginevri F, Gusmano R: Lysyl oxidase expression and calcium oxalate crystals. J Am Soc Nephrol 10(Suppl 14):S452–and collagen cross-linking during chronic adriamycin nephropathy. S456, 1999Nephron 76:192–200, 1997 34. Khan SR, Byer KJ, Thamilselvan S, Hackett RL, McCormack

13. Luo G, D’souza R, Jogue D, Karsenty G: The matrix Gla protein WT, Benson NA, Vaughn KL, Erdos GW: Crystal-cell interactiongene is a marker of the chondrogenesis cell lineage during mouse and apoptosis in oxalate-associated injury of renal epithelial cells.development. J Bone Miner Res 10:325–334, 1995 J Am Soc Nephrol 10(Suppl 14):S457–S463, 1999

14. Luo G, Ducy P, McKee MD, Pinero GJ, Loyer E, Behringer RR, 35. Lieske JC, Swift H, Martin T, Patterson B, Toback FG: RenalKarsenty G: Spontaneous calcification of arteries and cartilage in epithelial cells rapidly bind and internalize calcium oxalate mono-mice lacking matrix GLA protein. Nature 386:78–81, 1997 hydrate crystals. Proc Natl Acad Sci USA 91:6987–6991, 1994

15. Fraser JD, Price PA: Lung, heart, and kidney express high levels 36. Hammes MS, Lieske JC, Pawar S, Spargo BS, Toback FG: Calciumof mRNA for the vitamin K-dependent matrix Gla protein. J Biol oxalate monohydrate crystals stimulate gene expression in renalChem 263:11033–11036, 1988 epithelial cells. Kidney Int 42:501–509, 1995

16. Cancela ML, Hu B, Price PA: Effect of cell density and growth 37. Iida S, Peck AB, Johnson-Tardieu J, Moriyama M, Glentonfactors on matrix Gla protein expression by normal rat kidney PA, Byer KJ, Khan SR: Temporal changes in mRNA expressioncells. J Cell Physiol 171:125–134, 1997 for bikunin in the kidneys of rats during calcium oxalate nephroli-

17. Zhao J, Warburton D: Matrix Gla protein gene expression is thiasis. J Am Soc Nephrol 10:986–996, 1999induced by transforming growth factor-b in embryonic lung culture. 38. Iida S, Peck AB, Byer KJ, Khan SR: Expression of bikunin mRNAAm J Physiol 273:L282–L287, 1997 in renal epithelial cells after oxalate exposure. J Urol 162:1480–

18. Lacourse KA, Lay JM, Swanberg LJ, Jenkins C, Samuelson LC: 1486, 1999