Alteration of HDL functionality and PON1 activities in acute coronary syndrome patients

Clinical Biochemistry xxx (2014) xxx–xxx

CLB-08851; No. of pages: 8; 4C:

Contents lists available at ScienceDirect

Clinical Biochemistry

j ourna l homepage: www.e lsev ie r .com/ locate /c l inb iochem

Alteration of HDL functionality and PON1 activities in acute coronarysyndrome patients

Abdelghani Bounafaa a,b,d,e, Hicham Berrougui b,e, Souade Ikhlef e, Abdelkhalid Essamadi a, Boubker Nasser a,Ahmed Bennis c, Najoua Yamoul c, Noreddine Ghalim d, Abdelouahed Khalil e,⁎a Laboratory of Biochemistry & Neuroscience, Applied Biochemistry and Toxicology Team, Hassan I University, Faculty of Sciences and Technology, Settat, Moroccob Department of Biology, Polydisciplinary Faculty, Sultan Moulay Sliman University, Beni-Mellal, Moroccoc Cardiology Service, Ibn Rochd University Hospital Center, Casablanca, Moroccod Laboratory of Biochemistry, Pasteur Institute of Morocco, Casablanca, Moroccoe Department of Medicine, Geriatrics Service, Faculty of Medicine and Biological Sciences, University of Sherbrooke, Sherbrooke, Quebec, Canada

⁎ Corresponding author at: CdRV-Campus de la sanSherbrooke, Quebec J1H 4N4, Canada.

E-mail address: [email protected] (A. Khalil).

http://dx.doi.org/10.1016/j.clinbiochem.2014.09.0010009-9120/© 2014 The Canadian Society of Clinical Chem

Please cite this article as: Bounafaa A, et al, Al(2014), http://dx.doi.org/10.1016/j.clinbioch

a b s t r a c t
a r t i c l e i n f o
Article history:
Received 21 April 2014Received in revised form 29 July 2014Accepted 16 August 2014Available online xxxx
Keywords:ACSHDLCholesterol effluxOxidative stressPON1

Objective: The functionality of HDL has been suggested as an important factor in the prevention of cardiovas-cular and coronary artery diseases. The objective of the present study was to investigate the functionality of HDLand the factors that may affect the anti-atherogenic properties of HDL in ACS patients.

Methods and results:One hundred healthy subjects and 205 ACS patients were recruited. HDL functionalitywas evaluated by measuring their capacity to mediate cholesterol efflux from J774 macrophages. Oxidativestress status was determined by measuring plasma malondialdehyde (MDA), protein carbonyl, and vitamin Elevels by HPLC. The PON1 Q192R polymorphism status and PON1 paraoxonase and arylesterase activities ofthe healthy subjects andACS patientswere also determined. The HDL of ACS patients displayed a limited capacityto mediate cholesterol efflux, especially via the ABCA1-pathway. MDA (7.06 ± 0.29 μM) and protein carbonyl(9.29 ± 0.26 μM) levels were significantly higher in ACS patients than in healthy subjects (2.29 ± 0.21 μM and3.07 ± 0.17 μM, respectively, p b 0.0001), while α- and γ-tocopherol (vitamin E) levels in ACS patients were
8-fold (p b 0.001) and 2-fold (p b 0.05) lower than in healthy subjects. Paraoxonase, arylesterase and HDL-corrected PON1 activities (PON1 activity/HDL ratio) were significantly lower in ACS patients. Logistic regressionanalyses showed that high PON1 paraoxonase and arylesterase activities had a significant protective effect(OR= 0.413, CI 0.289–0.590, p b 0.001;OR= 0.232CI 0.107–0.499, p b 0.001, respectively) evenwhen adjustedfor HDL level, age, BMI, and PON1 polymorphism.
Conclusion: The results of the present study showed that the functionality of HDL is impaired in ACS patientsand that the impairment may be due to oxidative stress and an alteration of PON1 activities.

© 2014 The Canadian Society of Clinical Chemists. Elsevier Inc. All rights reserved.

Introduction

Acute coronary syndrome (ACS) is a common complication and alife-threatening form of CHD. It includes unstable angina, non-ST seg-ment elevation myocardial infarction (NSTEMI), and ST segment eleva-tionmyocardial infarction (STEMI). Disruption of atherosclerotic plaqueand the resulting intracoronary thrombosis are thought to account formost ACS cases [1].

Dyslipidemia, considered to be one of themost prevalent risk factorsfor ACS, affects 30% to 50% of ACS patients [2]. Various internationalguidelines thus focus on reducing LDL levels as the principal thera-peutic pathway for preventing ACS. However, despite aggressive

té, FMSS, 3001 12th Avenue,

ists. Elsevier Inc. All rights reserved.

teration of HDL functionality aem.2014.09.001

LDL reduction, residual annual risk that approximates 9% in patientswith established coronary artery disease remains a reality, whichprompted questions about etiology and a therapeutic course ofaction [3]. As such, in addition to reducing LDL levels, strategies thatfocus on other parameters that may be involved in the recurrence ofcardiovascular events, particularly in patients with established CADsuch as ACS, should be developed.

A clinical study has shown that a low HDL levels in ACS patients atbaseline is a key predictor of major adverse cardiac events and deathat 1 year [4]. The authors suggested that therapies aimed at increasingHDL levels in ACS patients regardless of baseline LDL levels and statinstherapy should be evaluated [4]. However, while high HDL levels havebeen associated with cardiovascular protection, the functionality ofHDL is increasingly seen as important if not more important than theirlevel in the prevention of cardiovascular events [5]. This is eventruer in patients with established CAD or presenting a cardiovascular

nd PON1 activities in acute coronary syndrome patients, Clin Biochem

http://dx.doi.org/10.1016/j.clinbiochem.2014.09.001

mailto:[email protected]


http://www.sciencedirect.com/science/journal/02637296

www.elsevier.com/locate/clinbiochem


Table 1Demographic and clinical characteristics of healthy subjects and ACS patients.

Parameter Healthy subjects ACS patients P values

Mean age (years) 54.95 ± 0.55 57.47 ± 0.67 b0.0001Gender (male/female) 50/50 125/80 b0.0001BMI (kg/m2) 24.53 ± 0.22 27.22 ± 0.261 b0.001Systolic blood pressure 120.91 ± 0.95 132.82 ± 1.12 b0.001Diastolic blood pressure 71.00 ± 0.61 77.02 ± 0.77 b0.001Glucose (mmol/L) 5.14 ± 0.01 8.23 ± 0.049 b0.001Cholesterol (mmol/L) 3.75 ± 0.08 4.68 ± 0.08 b0.001TG (mmol/L) 1.19 ± 0.03 2.15 ± 0.07 b0.001HDL (mmol/L) 1.25 ± 0.02 0.98 ± 0.02 b0.001LDL (mmol/L) 2.85 ± 0.05 3.72 ± 0.07 b0.001CRP (mg/L) 6.781 ± 0.34 10.11 ± 0.76 b0.01

PON1 genotypeQQ (55.4%)a (n = 56) 56% (n = 113) 55.12%QR (34.09%)a (n = 39) 39% (n = 67) 32.68%RR (9.83%)a (n = 5) 5% (n = 25) 12.19% b0.05Diabetes 0% 42%Family history of ACS 0% 26%Smokers 0% 35%Statin intake 0% 5%

Data are presented as means ± SEM.Mean values were significantly different for healthysubjects and ACS patients.HDL-C (HDL-cholesterol), LDL-C (LDL-cholesterol), TC (total cholesterol), CRP (C-reactiveprotein), TG (triglycerides).

a (%) in whole population (healthy subjects and ACS patients).

2 A. Bounafaa et al. / Clinical Biochemistry xxx (2014) xxx–xxx

disease (CVD) risk factor given that these pathological conditions arecharacterized by metabolic changes and oxidative and inflammatorystates that may affect HDL functionality [6,7].

The functionality of HDL corresponds to their ability to exert theiranti-atherogenic activities, i.e., antioxidant and anti-inflammatoryactivities, and to mediate reverse cholesterol transport (RCT), which isbelieved to be the main anti-atherogenic function of HDL [8]. HDLparticles serve as a shuttle in RCT, removing excess cholesterol from pe-ripheral tissues and delivering it to the liver to be excretedwith bile. Thefirst rate-limiting step of this process is the interaction of lipid-poorapoA-I with ATP-binding cassette transporter A1 (ABCA1), which con-tributes to macrophage cholesterol efflux and the formation of HDL li-poproteins [9]. The mechanisms underlying the interaction betweenapoA-I and ABCA1, which lead to the lipidation of apoA-I, are poorly un-derstood. However, several studies have shown that this interactionmay be affected by oxidative modification of apoA-I, a process thatmay occur in the presence of several CVD risk factors [10]. Under pro-inflammatory conditions, HDL particles may be remodeled leading to ashift to an inflammatory profile, which in turn may alter their anti-atherogenic function [11].

A recent study by our laboratory has showed that PON1 regulatesthe capacity of HDL to mediate cholesterol efflux by enhancingthe apoA-I/ABCA1 interaction [12]. Interestingly, other studies haveshown that there is a significant decrease in the PON1 activity inthe presence of CVD risk factors such as hypercholesterolemia, dia-betes, and renal failure as well as with aging [13]. In addition, the en-zymatic activity of PON1 decreases markedly under oxidative stressand inflammatory conditions [13]. Interestingly, the decrease ofPON1 activity has been associated with high cardiovascular risk[14]. We propose that the oxidative stress conditions that developin ACS patients may lead to oxidative modifications of HDL compo-nents and contribute to an alteration of their capacity to mediatecholesterol efflux from macrophages. These oxidative modificationsmay also reduce PON1 activities, which in turn may affect the func-tionality of HDL.

Materials and methods

Subjects

Three hundred five subjects were enrolled in our study and weredistributed into two groups based on their health status. The firstgroup consisted of 100 healthy subjects that were recruited frompatients visiting the Biomedical Centre of the Casablanca Pasteur In-stitute in Casablanca, Morocco, for medical check-ups. These sub-jects (50 men and 50 women, mean age: 54.95 ± 0.55 years)were all healthy non-smokers and were not undergoing any treat-ments or taking vitamin supplements. The second group consistedof 205 patients with ACS (125 men and 80 women, mean age57.47 ± 0.67 years), who were enrolled at the Cardiology Serviceof the University Hospital Center in Casablanca, Morocco. They metthe diagnostic criteria for ACS, which was characterized using ECGsas STEMI, NSTEMI, or unstable angina. Acute myocardial infarctionwas confirmed with instrumental examination, including coronaryangiography and echocardiography. Patients suffering from hemor-rhagic or ischemic stroke, heart failure, arthritis, hypertension, ordiabetes were included. Patients with dysthyroidism or renal failure(creatinine clearance b40 ml/min) or undergoing hormonal treat-ment were excluded. Arterial blood pressure, lipid profile (LDL,HDL, and total cholesterol), and C-reactive protein (CRP) and glyce-mia levels were determined. Forty two percent of recruited patientswere diabetics, 35%were current cigarette smokers, 26% had a familyhistory of ACS and 5% were taking statins. The biochemical and phys-ical characteristics of the healthy subjects and ACS patients are listedin Table 1. All participants gave written informed consent prior totaking part in the present study.

Please cite this article as: Bounafaa A, et al, Alteration of HDL functionality a(2014), http://dx.doi.org/10.1016/j.clinbiochem.2014.09.001

Blood sample collection and lipid profile measurements

Blood samples were collected in dry or EDTA tubes after an over-night fast. The samples were centrifuged at 3000 ×g for 10 min, andaliquots of plasma were immediately stored at −80 °C until ana-lyzed. Whole blood samples (1 ml) were kept for polymorphismanalyses. Serum total glucose, total cholesterol, HDL-cholesterol,LDL-cholesterol, triglycerides, and C-reactive protein levels weremeasured using automated enzymatic assays (Kodak, EktachemUSA Systems).

Cholesterol efflux measurements

Whole plasma HDLwere isolated by adding 20% polyethylene glycol(PEG) to precipitate apolipoprotein B-containing lipoproteins. Choles-terol efflux was performed as previously described by our group [12].Briefly, J774macrophageswere incubated in fresh growthmedium con-taining [3H]-cholesterol (1 μCi/mL) for 24 h. Labeled cells were washedand were then incubated in serum-free medium containing 1% BSA for16 h to equilibrate. To produce ABCA1-enriched cells, [3H]-cholesterol-J774 were equilibrated in serum-free medium containing 1% BSA and0.3 mM cAMP for 16 h. Cholesterol efflux was assessed by incubatingthe radiolabeledmacrophages for 4 h at 37 °Cwith 25 μL/mL of apolipo-protein B-depleted plasma (PEG-treated plasma) obtained fromhealthysubjects and ACS patients [15]. The cells were collected by centrifuga-tion (350 ×g for 10 min) and were lysed in 0.1 M NaOH. The countsperminute (cpm) of the supernatants and cell lysates were determinedseparately using a liquid scintillation counter (model 1600 TR; PackardInstrument Company, Meriden, CT, USA). Cholesterol efflux was mea-sured by determining the percentage of radiolabeled cholesterolreleased (% cholesterol efflux) using the following formula: (cpm insupernatant/[cpm in cells + supernatant]) × 100 [12].

DNA extraction

DNA was extracted from granulocytes using the sodium iodideprocedure described by Ravanat et al. [16], with slight modifications.Briefly, 2 mL of lysis buffer (15 mM Tris, 7.5 mM EDTA, 0.225 mMdesferrioxamine, pH 8) was added to the granulocytes. After mixing,35 μL of 10% SDS was added. The mixture was vigorously mixed to



3A. Bounafaa et al. / Clinical Biochemistry xxx (2014) xxx–xxx

lyse the nuclear membrane. Ten m of RNase (100 mg/mL) in RNasebuffer (10 mM Tris, 1 mM EDTA, 2.5 mM desferrioxamine, pH 7.4)was added, and the samples were incubated for 15 min at 50 °C. Thirtymicroliters of Qiagen protease (20 mg/mL in deionized water) wasadded, and the samples were incubated at 37 °C for an additional 1 h.Subsequently, 0.6 mL of NaI solution (7.6 M NaI, 40 mM Tris, 20 mMEDTA, 0.3 mM desferrioxamine, pH 8.0) and 1 mL of 2-propanol wereadded. The DNA was precipitated by gently inverting the tubes severaltimes. The DNA was recovered by centrifuging the samples at 5000 ×gfor 15 min at 4 °C, washed with 1 mL of 40% 2-propanol, centrifugedat 5000 ×g for 5 min, washed in 1 mL of 70% EtOH, recovered by centri-fugation, and dissolved in 0.1 mM desferrioxamine.

PON1 genotype determination

PON1 R192Q genotypes were determined by PCR using a previouslypublished protocol, with slightmodifications [17]. We used the sense 5′TATTGTTGCTGTGGGACCTGAG3′ and anti-sense 5′CACGCTAAACCCAAATACATCTC3′ primers, which encompass the 192 polymorphic regionof the human PON1 gene. The PCR mixture contained 200 ng of DNAtemplate, 0.5 μM sense primer, 0.5 μM anti-sense primer, 200 μMdNTPs, and 1 U of Taq DNA polymerase (New England Biolabs,Canada). The DNA was denatured for 5 min at 95 °C. The PCR protocolwas as follows: 46 denaturing cycles (1 min at 94 °C), a 30-s annealingstep at 61 °C, and a 1-min extension step at 72 °C. The 99-bp PCRproduct was digested with 5 U of Alwl restriction endonuclease (NewEngland Biolabs) for 4 h at 37 °C. The digestion productswere separatedon 2% agarose gels and were visualized using SYBR Green (Sigma). TheR-genotype (arginine) contains a single Alw l restriction site, which re-sults in 66- and 33-bp products. The Q-genotype (glutamine) is notcut, which allows the PON1 192 genotype to be determined.

PON1 activities

PON1 paraoxonase activity was measured in the plasma samplesusing paraoxon (O,O-diethyl-O-p-nitrophenylphosphate; Sigma) asthe substrate and measured by the increase in absorbance at412 nm as described previously [18,19]. Briefly, activity was mea-sured at 25 °C after combining 50 μL of sample and 1 mL 100 mMTris/HCl buffer (pH 8.0) containing 2 mM CaCl2 and 5.5 mM paraox-on. The rate of 4-nitrophenol release was measured at 412 nm andenzymatic activity was calculated using a molar extinction coefficientof 17,100 M−1 cm−1. One unit of paraoxonase activity was defined as1 nM 4-nitrophenol formed per minute.

PON1 arylesterase activitywas determined bymeasuring the increasein absorbance at 270 using phenylacetate as the substrate [20,21]. Enzy-matic activity was calculated using the 1310 M−1 cm−1 molar extinc-tion coefficient. One unit of arylesterase activity was defined as 1 μmolphenylacetate hydrolyzed per minute.

Oxidative stress markers

Systemic oxidative stress was evaluated by measuring plasmaprotein carbonyl, malondialdehyde (MDA), and vitamin E (α- andγ-tocopherol) levels.

Protein carbonylPlasma protein carbonyl levels were assayed as described by

Levine et al. [22]. Briefly, carbonyl levels were determined bydinitrophenylhydrazine derivatization and were detected in TCA-precipitable materials by measuring the absorbance at 370 nm(ϵ = 22,000 M−1 cm−1).

Plasma MDAThiobarbituric acid-reactive substances (TBARS), mainly MDA,

were assayed by high-performance liquid chromatography (HPLC)


as described by Agarwal and Chase [23] using a 5 μm ODS100 mm × 4.6 mm HP Hypersil column, a 5 μm ODS guard column,and a methanol:water (40:60, v:v) mobile phase. The fluorescence de-tector was set at an excitation wavelength of 515 nm and an emissionwavelength of 553 nm. Plasma samples were treated with BHT antiox-idant and were heat derivatized at 100 °C for 1 h with thiobarbituricacid at acidic pH. They were then extracted with n-butanol, and 10 μLwas injected on the column.

Plasma vitamin EPlasma endogenous vitamin E was assayed as α- and γ-tocopherol.

Briefly, 100 μL of thawed plasma was mixed with an equal volume ofethanol, and tocopherols were extracted in 500 μL of hexane. Plasmaα-tocopherol and γ-tocopherol were resolved on a Sephasil reverse-phase HPLC column (C18, 5 μm particles, 25 × 0.46 cm i.d.; PharmaciaBiotech, Piscataway, NJ, USA) using a methanol–ethanol–isopropanol(88:24:10, v:v:v) mobile phase containing 20 mM lithium perchlorateand a flow rate of 1 mL/min. α-tocopherol and γ-tocopherol levelswere determined using an ESA Coulochem II 50–10A electrochemicalcell. Ultraviolet absorption was alsomonitored at 292 nm [24]. Tocoph-erol acetate was used as the internal standard.

Statistical analysis

Values are expressed as means ± SEM unless otherwise indicated.Comparisons between groups were performed using an unpairedt-test. One-way ANOVA was used for multiple comparisons. Logisticregression analyses were used to assess the association betweenPON1 paraoxonase/arylesterase activities and to the risk of ACS.P values b 0.05 were considered to be statistically significant.

Results

The baseline characteristics of the subjects are summarized inTable 1. There was a significant difference between ACS patients andhealthy subjects with respect to BMI, blood pressure, CRP inflammatorymarker, and lipid profile (total cholesterol, triglyceride, and HDL,and LDL levels). ACS patients had low HDL (0.98 ± 0.02 mmol/L,p b 0.001) and high LDL (3.72± 0.07 mmol/L, p b 0.001) and triglycer-ide levels (2.15 ± 0.07 mmol/L, p b 0.001) (Table 1).

Cholesterol efflux

We first investigated the capacity of HDL from ACS patients topromote cholesterol efflux compared to HDL from healthy subjects.Apolipoprotein B-depleted sample were incubated for 4 h with 3H-cholesterol-radiolabeled J774 macrophages using basal conditions,without stimulation with cAMP. There was a significant difference(p b 0.0001) between healthy subjects and ACS patients in the ca-pacity of their HDL to mediate cholesterol efflux (Fig. 1A). Howeverthis difference disappeared when cholesterol efflux measurementswere normalized to HDL concentration (=69.86 ± 2.90%/HDL-Cand 77.18 ± 1.86%/HDL-C for healthy and ACS patients, p b 0.8).

We then investigated the involvement of the ABCA1-pathway incholesterol efflux mediated by HDL from healthy subjects and ACSpatients. ABCA1-enriched macrophages incubated with HDL for 4 h tospecifically assess the interaction of ABCA1 with nascent pre-β-HDL.Interestingly, the overexpression of the ABCA1 transporter on J774macrophages led to a significant increase in the capacity of HDL fromboth healthy subjects and ACS patients to mediate cholesterol efflux(p b 0.001) (Fig. 1A). This increase remains significant even when thecholesterol effluxmeasurements were normalized to the concentrationof HDL cholesterol. We measured the change in the HDL-mediatedcholesterol efflux from ABCA1-enriched and non-enriched J774 macro-phages using HDL from healthy subjects and ACS patients. As shown inFig. 1B, HDL from ACS patients had less effect on cholesterol efflux than



Fig. 1. Impairment of the ABCA1-cholesterol efflux pathway in ACS patients. J774 macro-phageswere loadedwith [3H]-cholesterol. Theywere thenwashed and incubated for 12 hwith or without 0.3 mM 8-Br-cAMP. A) Stimulated or non-stimulated J774 macrophageswere incubated for 4 h with 50 μL/mL of apolipoprotein B-depleted plasma isolatedfrom healthy subjects and ACS patients. **p b 0.0001. B) ABCA1-dependent cholesterolefflux was measured as the difference between plasma whole HDL-mediated cholesterolefflux fromABCA1-enriched and non-enriched J774macrophages for each subject. Resultsare expressed as means ± SEM. **p b 0.003.

Fig. 2. Systemic oxidative stress status of healthy subjects and ACS patients. Oxidativestress was evaluated by measuring (A) plasma protein carbonyl and (B) MDA levels.MDA was measured by HPLC with fluorescence detection and protein carbonyls weredetected in TCA-precipitable materials by measuring the absorbance at 370 nm. Resultsare expressed as means ± SEM. ***p b 0.001 vs. healthy subjects.


HDL from healthy subjects (Δ efflux = 4.46 ± 0.42% and 7.58 ± 1.21%for ACS patients and healthy subjects, respectively, p b 0.003). Thisdifference remains significant and is even higher when measuredcholesterol efflux was normalized to the concentration of HDL(Δ = 11.59 ± efflux 1.25%/HDL-c and 16.47 ± 2.69%/HDL-c for ACSpatients and healthy subjects, respectively, p b 0.02).

Oxidative stress status

In order to explain the decrease in HDL-mediated cholesterol effluxcapacity in the ACS patients, we determined the levels of proteincarbonyls and MDA as markers of oxidative damage to proteins andlipids, respectively. We also determined the levels of plasma vitaminE, which is the main lipid-soluble plasma antioxidant. Plasma proteincarbonyl levels were more than 3-fold higher in ACS patients than in


healthy subjects (p b 0.0001) (Fig. 2A). Plasma MDA levels were alsohigher in ACS patients than in healthy subjects (7.06 ± 0.29 μM versus2.29 ± 0.21 μM, respectively, p b 0.003) (Fig. 2B). However, plasmavitamin E levels (α- and γ-tocopherol) were significantly lower in ACS[patients 8-fold (p b 0.001) and 2-fold (p b 0.05) lower, respectively,than in healthy subjects] (Figs. 3A and B).

PON1 genotype distribution and activity

The PON1 Q192R genotype distributions in healthy subjects and ACSpatients are presented in Table 1. The prevalence of the QQ, QR, and RRgenotypes in the entire study population was 55.4%, 34.09%, and 9.83%,respectively, with the Q and R alleles having a gene frequency of 0.755and 0.245, respectively, which is in excellent agreement with theHardy–Weinberg equilibrium.

The paraoxonase and arylesterase activities of PON1 were signifi-cantly lower in ACS patients than in healthy subjects (PON1 paraoxo-nase activity: 210.12 ± 6.37 vs. 366.3 ± 16.12 U/mL (p b 0.0001) andarylesterase activity: 78.67 ± 3.22 vs. 131.72 ± 4.71 U/mL(p b 0.0001), respectively) (Figs. 4A and B). PON1 is exclusively associ-ated with HDL and, as such, the PON1 activity/HDL ratio (HDL correctedfor PON1 enzymatic activity) may be more important than the level of



Fig. 3. Plasma vitamin E levels in healthy subjects and ACS patients. Endogenous plas-ma vitamin E was measured as (A) α-tocopherol and (B) γ-tocopherol by coulomet-ric detection (ESA Coulochem II 5010A electrochemical cell) coupled with ultravioletdetection. Results are expressed as means ± SEM. **p b 0.01, ***p b 0.001 vs. healthysubjects.


enzyme activity alone with respect to the risk of ACS. As shown inFigs. 4A and B, the paraoxonase/HDL and arylesterase/HDL ratioswere both significantly lower in the ACS patients than in the healthysubjects. Moreover, there was a strong significant correlation be-tween PON1 paraoxonase activity and the PON1/HDL-c ratio forboth healthy subjects and ACS patients (Fig. 5A). However, the coef-ficient value of these correlations was significantly lower in the ACSpatients than in the healthy subjects (R = 0.94 vs. 0.80, respectively,p b 0.001) (Fig. 5A).

Logistic regression analyses show that PON1 paraoxonase andarylesterase activities had a protective effect (OR = 0.413, CI 0.289–0.590, p b 0.001;OR= 0.232 CI 0.107–0.499, respectively, p b 0.001, re-spectively), which remained significant even when adjusted for HDLlevel, age, BMI, and PON1 polymorphism. Our results indicated that amean decrease in paraoxonase and arylesterase activities of 100 U/mL,as observed in the ACS patients, increased the risk for ACS events 5.5-fold and 4.3-fold, respectively (Table 2).

Our results also showed that PON1 activity was positively corre-lated to the level of ABCA1-dependent cholesterol efflux (R = 0.10,p b 0.05) for healthy subjects. However, this correlation is invertedwhen only the ACS patients were considered (R = − 0.18, p b 0.02)(Fig. 5B).


Discussion

Low HDL levels are common among patients with ACS and predictrisk for subsequent cardiovascular events even with intensive statintreatment [25,26]. While some strategies have been used in an attemptto increase HDL levels in ACS patients, it is essential that the functional-ity of HDL be taken into consideration since it may be more importantthan HDL levels in protecting against cardiovascular events [5,27].

A decrease in HDL-mediated cholesterol efflux has been associatedwith intima-media thickness and the likelihood of angiographic coro-nary artery disease [28]. Our results showed that HDL fromACS patientsis less effective in mediating cholesterol efflux than HDL from healthysubjects (pb 0.001). These results are in agreementwith those obtainedrecently by Hafiane et al. in a relatively small study involving 20ACS pa-tients, which also showed that therewas a decrease in cholesterol effluxin ACS patients immediately after the onset of symptoms, which wasmaintained 4 months after the onset [29].

The difference of HDL-mediated cholesterol efflux between healthyand ACS patients disappears when cholesterol efflux measurementswere normalized to HDL-cholesterol concentration. However, onemust point out that due to the differences in cholesterol content be-tween all HDL subclasses, normalization to HDL-cholesterol may under-estimate the fraction of cholesterol effluxed via preβ-HDL and lipid freeapoA-1.

It is noteworthy that, in our conditions, we observed no correlationbetween plasma HDL and cholesterol efflux in either healthy sub-jects or ACS patients. As such, the lower cholesterol efflux observedin ACS patients compared to the healthy subjects could not been ex-plained by the low plasma HDL levels in the ACS patients (0.97 ±0.02 mmol/L vs. 1.26 ± 0.025 mmol/L, respectively, p b 0.001).

Approximately half of ACS patients have low HDL levels, and lowHDL is almost completely untreated at the onset or following recurrentACS [26,30]. Moreover, these HDL particles in ACS patients arecompletely remodeled, becoming functionally defective as a result ofthe inflammatory conditions that develop in these patients [11]. InACS, HDL shift to a pro-inflammatory profile that impairs their capacityto mediate cholesterol efflux [11]. Moreover, the impairment of HDLfunction has been shown to be associated with several CVD risk factors,including hypercholesterolemia, obesity, smoking, and chronic renalfailure [31–33]. Given this, Khera et al. proposed that the cholesterolefflux capacity of HDL be measured as a metric of their function[28]. The results described above support the notion that the de-crease in cholesterol efflux in ACS patients is due to an alteration inHDL functionality.

Interestingly, the difference in cholesterol efflux between healthysubjects and ACS patients was higher when ABCA1-enriched J774macrophages were used (Fig. 1B). This suggests that the decrease incholesterol efflux in ACS patients is mainly caused by an alteration ofthe apoA-I–ABCA1 pathway. Macrophage-mediated cholesterol ef-flux is initiated by the interaction of apoA-I and lipid-poor apoA-I(preβ-HDL) with ABCA1. This interaction promotes cellular choles-terol binding to apoA-I and constitutes a rate-limiting factor for cho-lesterol efflux. ABCA1 forms a high-affinity complex with apoA-I bybinding amphipathic helices within the apolipoprotein [34]. In ourconditions, HDL was separated by PEG precipitation that, unlikeultracentrifugation methods, permits the recovery of whole HDLfractions, including pre-β-HDL [35].

Shotgun proteomic analyses have not revealed any significant differ-ences in the apoA-I content of HDL from ACS patients compared to HDLfrom healthy subjects [11]. However, the oxidative modification ofapoA-I that may occur in ACS patients may affect the ABCA1–apoA-I in-teraction, leading to a decrease in cholesterol efflux. Our measurementsof oxidative stress markers showed that the plasma of ACS patientscontained high protein carbonyl and MDA levels and low vitamin Elevels, which confirmed that ACS patients are subject to high oxidativestress. Moreover, HDL, as the major carrier of lipid hydroperoxides in



Fig. 4. Impairment of paraoxonase activity in ACS patients. Plasma paraoxonase 1 (A) and arylesterase (B) activities were measured in healthy subjects and ACS patients. The specific ac-tivities of PON1 [(C) paraoxonase and arylesterase (D) specific activities] were determined relative to the concentration of HDL. Results are expressed as means ± SEM. ***p b 0.001 vs.healthy subjects.


plasma [36], are constantly exposed to reactive carbonyls resulting fromlipid peroxidation (MDA, for example), which react with apoA-I lysineresidues, contributing to the alteration of the structure of apoA-I and af-fecting the apoA-I/ABCA1 interaction [37,38]. Several studies, includingours, have shown that high plasma carbonyl levels modify apoA-I andimpair its ability to transport cellular cholesterol via the ABCA1-pathway [10,38,39]. In our conditions, the high protein carbonyl levelsin the plasma of ACS patients may explain the altered functionality ofHDL and may contribute to the decrease in their capacity to mediatecholesterol efflux.

The functionality of HDL is also associated with the activity of PON1[40]. PON1 plays a major role in regulating the antioxidant and anti-inflammatory activities of HDL [18,41]. Moreover, PON1 prevents theaccumulation of oxidized lipids, inhibiting the atherogenic and inflam-matory response induced by these oxidation products. Some in vitrostudies, including ours, have shown that PON1 stimulates cholesterolefflux and regulates the association of apoA-I with the ABCA1 transport-er [12,42]. Our results show a positive correlation between the PON1paraoxonase activity and the capacity of HDL to mediate cholesterolefflux (Fig. 5B). This correlation suggests that a decrease in PON1 activ-ities in patientswith ACSmay affect other anti-atherogenic properties ofHDL and accelerate the recurrence of cardiovascular events.

PON1 activities have been associated with the recurrence of ische-mic cardiovascular events in patients undergoing antiplatelet treatmentwith clopidogrel [43]. This may be due to a genetic variant of PON1


(Q192R) that is unable to mediate clopidogrel bioactivation and that isassociated the clopidogrel efficacy in these patients [43]. However,questions about the association between PON1 genotype and the riskof recurrence of cardiovascular events have been raised by other studies[44,45]. Importantly, the low PON1 activity reported in these studieswas associated with the 192QQ polymorphism rather than with adecrease in the specific activity of PON1 [43]. However, our resultsshowed that the paraoxonase and arylesterase activities of PON1 areboth significantly lower in ACS patients. In the present study, logisticregression analyses, after adjusting for conventional risk factors forCAD, showed that high paraoxonase (OR = 0.413, CI 0.289–0.590,p b 0.00001) and arylesterase activities (OR = 0.232 CI 0.107–0.499,p b 0.0001) were associated with CAD protection, suggesting that lowparaoxonase and arylesterase activities may be predictive risk factorsfor CAD independent of other risk factors such as HDL level, age, BMI,and the PON1 Q192Q polymorphism. Our results also showed that thesignificantly lower paraoxonase activity in ACS patients is associatedwith all three PON1 genotypes (QQ, QR, and RR). It is established thatPON1 arylesterase activity is note affected by the Q192R polymorphismandmay reflect the plasma PON1 levels as confirmed by immunologicalmethods [46]. This may suggest that ACS patients have lower PON1levels. However, adjusting PON1 activities to HDL levels showed thatthe paraoxonase/HDL and arylesterase/HDL ratios were significantlylower in ACS patients than in healthy subjects (Figs. 4A and B). This con-firmed that the lower paraoxonase and arylesterase activities are due to



Fig. 5. Correlation between the paraoxonase activity and A) the PON1/HDL-cholesterolratio and B) the capacity of HDL to mediate cholesterol efflux for healthy subjectsand ACS patients. Plasma paraoxonase activity was determined by spectrophotometry(R = 0.94, p b 0.0001 and R = 0.80, p b 0.0001, respectively, for healthy subjects andACS patients). ABCA1-enriched J774 macrophages were loaded with [3H]-cholesteroland were incubated for 4 h with 50 μL/mL of apolipoprotein B-depleted plasma obtainedfrom healthy subjects and ACS patients. PON1 paraoxonase activity was determinedspectrophotometry (R = 0.19, p b 0.01).


a drop in specific PON1 activities rather than a decrease in the plasmaconcentration of PON1. This was confirmed by the measurements of thecorrelation between PON1 paraoxonase activity and the PON1/HDL

Table 2Logistic regression analysis of the association between PON1 activity and ACS.

Parameter β SE ORs (95% CI) P value

Paraoxonase activity −0.884 0.182 0.41 (0.11–0.50) b0.0001Arylesterase activity −1.46 0.392 0.23 (0.29–0.59) b0.0001HDL −0.125 0.024 0.88 (0.84–0.93) b0.0001Age (years) 0.083 0.025 1.09 (1.03–1.14) b0.001BMI (kg/m2) 0.338 0.076 1.40 (1.21–1.63) b0.0001


ratio. For the same PON1/HDL ratio, ACS patients had significantly lowerPON1 paraoxonase activity than the healthy subjects.

We have previously shown that high oxidative stress conditionsinactivate PON1 and alter the only free SH group on PON1 [18,47].Given the key role played by this SH group in regulating the antiox-idant activity of PON1 [18,47], alterations to the SH group would sig-nificantly affect the antioxidant potential of PON1 and, as such, theanti-atherosclerotic activity of HDL. PON1 associates with lipopro-teins through its N-terminus by binding phospholipids, and its enzy-matic activity is stabilized by apoA-I [48,49]. Oxidative modificationsto the lipid fraction of HDL, mainly phospholipids, and compositionalchanges that affect these lipoproteins under oxidative stress andinflammatory conditions in ACS patients, may down-regulate the ac-tivity of PON1.

Our results confirmed the association between low PON1 activitiesand an increased risk of CVD [50]. Due to the close association ofPON1 with HDL particles and the importance of PON1 in the regulationof the functionality of HDL, our results suggest that the levels of PON1paraoxonase and arylesterase activities might be strong markers ofHDL anti-atherogenic function and CVD risk.

In summary, the present study demonstrated that HDL of ACS pa-tients have a limited capacity to mediate cholesterol efflux, especial-ly via the ABCA1-pathway. The impairment of this principal anti-atherogenic activity of HDLmay be due to oxidative stress conditionsthat affect the interaction of apoA-I and the ABCA1 transporter. Thiswould be in agreement with our result showing that ACS patients aresubject to high oxidative stress as measured by an increase in MDA andprotein carbonyl levels and a decrease in plasma α- and γ-tocopherollevels. In addition, we showed that PON1 paraoxonase and arylesteraseactivities are also significantly lower in ACS patients. Given the role ofPON1 in the regulation of HDL anti-atherogenic functions, measuringPON1 activities could be used as a marker of HDL functionality.

Acknowledgment

This work was supported by a grant from the Canadian Institutes ofHealth Research (MOP-89912) and Pasteur Institute of Morocco.

Appendix A. Supplementary data

Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.clinbiochem.2014.09.001.

References

[1] Gutstein DE, Fuster V. Pathophysiology and clinical significance of atheroscleroticplaque rupture. Cardiovasc Res 1999;41:323–33.

[2] Sanchis J, Bodi V, Llacer A, Nunez J, Consuegra L, Bosch MJ, et al. Risk stratification ofpatients with acute chest pain and normal troponin concentrations. Heart 2005;91:1013–8.

[3] Sampson ML, Fazio S, Linton MF. Residual cardiovascular risk despite optimal LDLcholesterol reduction with statins: the evidence, etiology, and therapeutic chal-lenges. Curr Atheroscler Rep 2012;14:1–10.

[4] Wolfram RM, Brewer HB, Xue Z, Satler LF, Pichard AD, Kent KM, et al. Impact of lowhigh-density lipoproteins on in-hospital events and one-year clinical outcomes inpatients with non-ST-elevation myocardial infarction acute coronary syndrometreated with drug-eluting stent implantation. Am J Cardiol 2006;98:711–7.

[5] Sviridov D, Mukhamedova N, Remaley AT, Chin-Dusting J, Nestel P. Antiatherogenicfunctionality of high density lipoprotein: how much versus how good. J AtherosclerThromb 2008;15:52–62.

[6] Gbandjaba NY, Ghalim N, Hassar M, Berrougui H, Labrazi H, Taki H, et al. Paraoxo-nase activity in healthy, diabetic, and hemodialysis patients. Clin Biochem 2012;45:470–4.

[7] Soran H, Hama S, Yadav R, Durrington PN. HDL functionality. Curr Opin Lipidol 2012;23:353–66.

[8] Kennedy MA, Barrera GC, Nakamura K, Baldan A, Tarr P, Fishbein MC, et al. ABCG1has a critical role in mediating cholesterol efflux to HDL and preventing cellularlipid accumulation. Cell Metab 2005;1:121–31.

[9] Fu Y. Rate-limiting factors of cholesterol efflux in reverse cholesterol transport:acceptors and donors. Clin Exp Pharmacol Physiol 2010;37:703–9.

[10] Berrougui H, Isabelle M, Cloutier M, Grenier G, Khalil A. Age-related impairment ofHDL-mediated cholesterol efflux. J Lipid Res 2007;48:328–36.




http://refhub.elsevier.com/S0009-9120(14)00658-4/rf0005





























[11] Alwaili K, Bailey D, Awan Z, Bailey SD, Ruel I, Hafiane A, et al. The HDL proteome inacute coronary syndromes shifts to an inflammatory profile. Biochim Biophys Acta1821;2012:405–15.

[12] Berrougui H, Loued S, Khalil A. Purified human paraoxonase-1 interacts with plasmamembrane lipid rafts and mediates cholesterol efflux from macrophages. Free RadicBiol Med 2012;52:1372–81.

[13] Seres I, Paragh G, Deschene E, Fulop Jr T, Khalil A. Study of factors influencing thedecreased HDL associated PON1 activity with aging. Exp Gerontol 2004;39:59–66.

[14] Mackness B, Durrington P, McElduff P, Yarnell J, Azam N, Watt M, et al. Low paraox-onase activity predicts coronary events in the Caerphilly Prospective Study. Circula-tion 2003;107:2775–9.

[15] Izzo C, Grillo F, Murador E. Improved method for determination of high-density-lipoprotein cholesterol I. Isolation of high-density lipoproteins by use of polyethyl-ene glycol 6000. Clin Chem 1981;27:371–4.

[16] Ravanat JL, Douki T, Duez P, Gremaud E, Herbert K, Hofer T, et al. Cellular back-ground level of 8-oxo-7,8-dihydro-2′-deoxyguanosine: an isotope based methodto evaluate artefactual oxidation of DNA during its extraction and subsequentwork-up. Carcinogenesis 2002;23:1911–8.

[17] Cherki M, Berrougui H, Isabelle M, Cloutier M, Koumbadinga GA, Khalil A. Effect ofPON1 polymorphism on HDL antioxidant potential is blunted with aging. ExpGerontol 2007;42:815–24.

[18] Jaouad L, de Guise C, Berrougui H, Cloutier M, Isabelle M, Fulop T, et al. Age-relateddecrease in high-density lipoproteins antioxidant activity is due to an alteration inthe PON1's free sulfhydyl groups. Atherosclerosis 2006;185:191–200.

[19] Eckerson HW, Romson J, Wyte C, La Du BN. The human serum paraoxonase poly-morphism: identification of phenotypes by their response to salts. Am J HumGenet 1983;35:214–27.

[20] Paragh G, Asztalos L, Seres I, Balogh Z, Locsey L, Karpati I, et al. Serum paraoxonaseactivity changes in uremic and kidney-transplanted patients. Nephron 1999;83:126–31.

[21] Miller NE, La Ville A, Crook D. Direct evidence that reverse cholesterol transport ismediated by high-density lipoprotein in rabbit. Nature 1985;314:109–11.

[22] Levine RL, Garland D, Oliver CN, Amici A, Climent I, Lenz AG, et al. Determination ofcarbonyl content in oxidatively modified proteins. Methods Enzymol 1990;186:464–78.

[23] Agarwal R, Chase SD. Rapid, fluorimetric-liquid chromatographic determination ofmalondialdehyde in biological samples. J Chromatogr B Analyt Technol BiomedLife Sci 2002;775:121–6.

[24] Berrougui H, Cloutier M, Isabelle M, Khalil A. Phenolic-extract from argan oil(Argania spinosa L.) inhibits human low-density lipoprotein (LDL) oxidation and en-hances cholesterol efflux from human THP-1 macrophages. Atherosclerosis 2006;184:389–96.

[25] Schwartz GG. High-density lipoprotein cholesterol as a risk factor and target of ther-apy after acute coronary syndrome. Am J Cardiol 2009;104:46E–51E.

[26] Roe MT, Ou FS, Alexander KP, Newby LK, Foody JM, Gibler WB, et al. Patterns andprognostic implications of low high-density lipoprotein levels in patients withnon-ST-segment elevation acute coronary syndromes. Eur Heart J 2008;29:2480–8.

[27] Luscher TF, von Eckardstein A, Simic B. Therapeutic targets to raise HDL in patients atrisk or with coronary artery disease. Curr Vasc Pharmacol 2012;10:720–4.

[28] Khera AV, Cuchel M, de la Llera-Moya M, Rodrigues A, Burke MF, Jafri K, et al. Cho-lesterol efflux capacity, high-density lipoprotein function, and atherosclerosis. NEngl J Med 2011;364:127–35.

[29] Hafiane A, Jabor B, Ruel I, Ling J, Gebest J. High-density lipoprotein mediatedcellular cholesterol efflux in acute coronary syndromes. Am J Cardiol 2013;113:249–55.

[30] Pinto X, Millan J, Munoz A, Corbella E, Hernandez-Mijares A, Zuniga M, et al. A veryhigh prevalence of low HDL cholesterol in Spanish patients with acute coronarysyndromes. Clin Cardiol 2010;33:418–23.


[31] Holven KB, Aukrust P, Retterstol K, Otterdal K, Bjerkeli V, Ose L, et al. Theantiatherogenic function of HDL is impaired in hyperhomocysteinemic subjects. JNutr 2008;138:2070–5.

[32] Matsuo Y, Oberbach A, Till H, Inge TH, Wabitsch M, Moss A, et al. Impaired HDLfunction in obese adolescents: Impact of lifestyle intervention and bariatric surgery.Obesity 2013;21:E687–95.

[33] Ueyama K, Yokode M, Arai H, Nagano Y, Li ZX, Cho M, et al. Cholesterol efflux effectof high density lipoprotein is impaired by whole cigarette smoke extracts throughlipid peroxidation. Free Radic Biol Med 1998;24:182–90.

[34] Wang N, Silver DL, Thiele C, Tall AR. ATP-binding cassette transporter A1 (ABCA1)functions as a cholesterol efflux regulatory protein. J Biol Chem 2001;276:23742–7.

[35] Asztalos BF, de la Llera-Moya M, Dallal GE, Horvath KV, Schaefer EJ, Rothblat GH.Differential effects of HDL subpopulations on cellular ABCA1- and SR-BI-mediatedcholesterol efflux. J Lipid Res 2005;46:2246–53.

[36] Bowry VW, Stanley KK, Stocker R. High density lipoprotein is the major carrier oflipid hydroperoxides in human blood plasma from fasting donors. Proc Natl AcadSci U S A 1992;89:10316–20.

[37] Shao B, Fu X, McDonald TO, Green PS, Uchida K, O'Brien KD, Oram JF, Heinecke JW.Acrolein impairs ATP binding cassette transporter A1-dependent cholesterol exportfrom cells through site-specific modification of apolipoprotein A-I. J Biol Chem 2005;280:36386–96.

[38] Shao B, Pennathur S, Pagani I, Oda MN, Witztum JL, Oram JF, et al. Modifying apoli-poprotein A-I by malondialdehyde, but not by an array of other reactive carbonyls,blocks cholesterol efflux by the ABCA1 pathway. J Biol Chem 2010;285:18473–84.

[39] McCall MR, Tang JY, Bielicki JK, Forte TM. Inhibition of lecithin-cholesterol acyltrans-ferase and modification of HDL apolipoproteins by aldehydes. Arterioscler ThrombVasc Biol 1995;15:1599–606.

[40] Gaillard T, Parthasarathy S, Osei K. HDL dysfunctionality (Paraoxonase) is worse innondiabetic, postmenopausal African American than in white women. DiabetesCare 2011;34:e19.

[41] Loued S, Berrougui H, Componova P, Ikhlef S, Helal O, Khalil A. Extra-virgin olive oilconsumption reduces the age-related decrease in HDL and paraoxonase 1 anti-inflammatory activities. Br J Nutr 2013:1–13.

[42] Rosenblat M, Vaya J, Shih D, Aviram M. Paraoxonase 1 (PON1) enhances HDL-mediated macrophage cholesterol efflux via the ABCA1 transporter in associationwith increased HDL binding to the cells: a possible role for lysophosphatidylcholine.Atherosclerosis 2005;179:69–77.

[43] BoumanHJ, Schomig E, vanWerkum JW, Velder J, Hackeng CM, Hirschhauser C, et al.Paraoxonase-1 is amajor determinant of clopidogrel efficacy. NatMed 2011;17:110–6.

[44] Fontana P, James R, Barazer I, Berdague P, Schved JF, RebsamenM, et al. Relationshipbetween paraoxonase-1 activity, its Q192R genetic variant and clopidogrel respon-siveness in the ADRIE study. J Thromb Haemost 2011;9:1664–6.

[45] Sibbing D, Koch W, Massberg S, Byrne RA, Mehilli J, Schulz S, et al. No association ofparaoxonase-1 Q192R genotypes with platelet response to clopidogrel and risk ofstent thrombosis after coronary stenting. Eur Heart J 2011;32:1605–13.

[46] Richter RJ, Jarvik GP, Furlong CE. Determination of paraoxonase 1 status without theuse of toxic organophosphate substrates. Circ Cardiovasc Genet 2008;1:147–52.

[47] Jaouad L,Milochevitch C, Khalil A. PON1paraoxonase activity is reducedduringHDLox-idation and is an indicator of HDL antioxidant capacity. Free Radic Res 2003;37:77–83.

[48] Sorenson RC, Bisgaier CL, Aviram M, Hsu C, Billecke S, La Du BN. Human serum par-aoxonase/arylesterase's retained hydrophobic N-terminal leader sequence associ-ates with HDLs by binding phospholipids: apolipoprotein A-I stabilizes activity.Arterioscler Thromb Vasc Biol 1999;19:2214–25.

[49] Getz GS, Reardon CA. Paraoxonase, a cardioprotective enzyme: continuing issues.Curr Opin Lipidol 2004;15:261–7.

[50] Jarvik GP, Rozek LS, Brophy VH, Hatsukami TS, Richter RJ, Schellenberg GD, et al. Par-aoxonase (PON1) phenotype is a better predictor of vascular disease than isPON1(192) or PON1(55) genotype. Arterioscler Thromb Vasc Biol 2000;20:2441–7.
























































































































Documents

Alteration of HDL functionality and PON1 activities in acute coronary syndrome patients