alakpt kidney.pdf

8/10/2019 alakpt kidney.pdf

http://slidepdf.com/reader/full/alakpt-kidneypdf 1/7

Exacerbation of the ochronosis of alkaptonuria due to

renal insufficiency and improvement after renal transplantation

Wendy J. Introne,a Chanika Phornphutkul,a Isa Bernardini,a Kevin McLaughlin,b

Diana Fitzpatrick,a and William A. Gahla,*

a Section on Human Biochemical Genetics, Heritable Disorders Branch, National Institute of Child Health and Human Development,

National Institutes of Health, and the National Human Genome Research Institute, Building 10, Room 10C103 10 Center Drive,

MSC 1851, Bethesda, MD 20892-1851, USAb Faculty of Medicine, University of Calgary, Calgary, Alberta, Canada

Received 1 May 2002; received in revised form 28 June 2002; accepted 1 July 2002

Abstract

In alkaptonuria, homogentisate 1,2-dioxygenase deficiency causes tissue accumulation of homogentisic acid (HGA), followed by

signs and symptoms of ochronosis. These include massive urinary excretion of HGA, arthritis and joint destruction, pigmentation of

cartilage and connective tissue, and cardiac valve deterioration. We describe a 46-year-old man with alkaptonuria and diabetic renal

failure whose plasma HGA concentration was twice that of any other alkaptonuria patient, and whose ochronosis progressed much

more rapidly than that of his two alkaptonuric siblings. After renal transplantation, the plasma HGA normalized, and the daily

urinary excretion of HGA decreased by 2–3 g. This case illustrates the critical role of renal tubular secretion in eliminating HGA

from the body, and suggests that renal transplantation in a uremic patient not only restores HGA excretion, but may also provide

homogentisate 1,2-dioxygenase activity for the metabolism of HGA.

2002 Elsevier Science (USA). All rights reserved.

Keywords: Alkaptonuria; Homogentisic acid; Renal tubular secretion; Kidney transplantation; Ochronosis

1. Introduction

Alkaptonuria is a rare metabolic disorder due to defi-

ciency of homogentisate 1,2-dioxygenase (HGO), an en-

zyme in the tyrosine degradation pathway [1,2]. The

homogentisatedioxygenase gene, HGO, hasrecentlybeen

isolated [3], its organization reported [4], and several dif-

ferent mutations defined [3,5–7]. As a consequence of HGO deficiency, homogentisic acid (HGA) accumulates.

This compound is readily oxidized to benzoquinones,

which polymerize and constitute the ochronotic pigment

which binds to connective tissue [1]. This process destroys

joints, spinal disks, and bones. Often, the first sign of al-

kaptonuria is dark urine, which acquires its color due to

oxidation of HGA upon standing or exposure to alkaline

substances. Other manifestations include ochronotic

pigmentation of the sclerae, ear helices, and fingers, early

onset of arthritis affecting the spine first andlater the large

joints, kidney and prostate stones, and valvular heart

disease [1,8]. Definitive diagnosisis based uponthe finding

of gram quantities of HGA in a 24-h urine collection; the

HGA can be detected by gas chromoatography-mass

spectrometric analysis for organic acids, or by a specificassay [9]. Treatment of alkaptonuria is symptomatic [1],

although the use of 2-(2-nitro-4-trifluoromethylbenzoyl)-

1,3-cyclohexanedione (nitisinone), an approved therapy

for tyrosinemia type I [10], to block HGA formation has

recently been proposed [11].

Normally, the kidney clears the offending homogen-

tisic acid so effectively that alkaptonuria patients excrete

gram quantities of HGA each day. This high level of

HGA removal is achieved by active renal tubular se-

cretion of HGA; patients with large filtered loads of

HGA have fractional excretions which are several

hundredfold normal. The salutary effects of tubular

Molecular Genetics and Metabolism 77 (2002) 136–142

www.academicpress.com

*Corresponding author. Present address: MGB, NHGRI, NIH, 10

Center Drive, MSC 1851, Building 10, Room 10C103, Bethesda, MD

20892-1851, USA. Fax: 301-402-2740.

E-mail address: [email protected] (W.A. Gahl).

1096-7192/02/$ - see front matter 2002 Elsevier Science (USA). All rights reserved.

PI I : S 1 0 9 6 - 7 1 9 2 ( 0 2 ) 0 0 1 2 1 - X

http://mail%20to:%[email protected]/

http://mail%20to:%[email protected]/



secretion on the symptoms of AKU become especially

apparent when severe renal disease occurs. We now

report the impact of kidney failure on the severity of

ochronosis in a single member of a sibship including

three adults with alkaptonuria.

2. Patients and methods

2.1. Case histories

Two brothers and their sister, all having alkaptonu-

ria, were admitted to the NIH Clinical Center under a

protocol approved by the National Institute of Child

Health and Human Development institutional review

board. Each gave informed consent to participate in a

study of the clinical, biochemical, and molecular aspects

of alkaptonuria. Patient numbers correspond to a mas-

ter list of enrolled individuals.Patient #11 was a 48-year-old woman with intermit-

tent hip pain for 10 years, right shoulder pain for 2.5

years following a motor vehicle accident, recent onset of

knee pain, and bouts of migrating bone pain. She also

complained of back stiffness, but without pain, and had

an intermittent black discharge from her breasts. She

was diagnosed with alkaptonuria based upon ear pig-

mentation and the previous diagnosis of her brother,

patient #12.

Patient #12, a 46-year-old male, noted episodes of

numbness in his left leg at 34 years of age. Spine ra-

diographs revealed five calcified discs, and a discectomy

was performed at the age of 35. The patient also un-

derwent steroid injections into his ears to relieve in-flammation and tenderness in both helices. A biopsy of

his inflamed right ear at age 43 revealed ochronotic

material, making the diagnosis of alkaptonuria. At age

45, the patient underwent a right total knee replacement.

At the time of surgery, the right fibula was healing from

a spontaneous fracture. Upon admission to the NIH

Clinical Center, the patient suffered from back pain,

most severe in the lumbosacral region and associated

with severe degenerative changes throughout the spine.

Ambulation was limited to approximately one-half a

block. He also complained of shoulder, elbow, and leftknee pain, and range of motion was decreased in his

shoulders, elbows and knees. The patient had a 23-yearhistory of insulin-dependent diabetes, and the resultant

nephropathy had worsened significantly since his knee

replacement.

A third sibling, patient #13, was a 41-year-old man

with a history of dark urine. He had been otherwise

asymptomatic until the age of 37 when he sustained an

injury to his back. The pain and limited mobility

worsened despite physical therapy. One and one half

years after the injury, this man underwent a discectomy.

Like his brother, he suffered from inflammation andtenderness of the ears. A biopsy of the left helix at age 38

showed black cartilage. He never required a joint re-

placement. When seen at the NIH, the patient com-

plained of severe back pain, as well as pain in the

shoulders, knees, and hips.

2.2. Mutation analysis

Genomic DNA was obtained from whole blood using

standard extraction procedures [12]. The coding region of

the HGO gene, comprising exons 1–14, was amplified

using primers shown in Table 1. PCR amplification of

genomic DNA was performed using 1 lL of DNA, 1

PCR buffer (GIBCO-BRL), 0.75 mM MgCl2,100 lMdNTPs, 0.1 lM of each primer, and 1.0U Taq

DNA polymerase in a total volume of 25 lL. An initial

denaturation step of 96 C for 4 min was followed by 35

PCR cycles, each with a denaturation step of 94 C for

Table 1

PCR amplification primers for exons of the HGO gene

Exon Primers Fragment

size (bp)

Annealing

temperature

Forward Backward

1 gcctctggaaacacttaggaac ctgataccctgaagttctcag 355 60

2 gaggttacagtgtagacccac gaccatctggcaacccgatatg 479 62

3 catatcgggttgccagatggtc gaacatacctctagtcagctc 638 62

4 gagccattctgtgtatcactc catagcagcatgagaatggac 223 58

5 caaacatgtgtgtgcacgtgc cttggcattcaggctgcaaatg 359 64

6 gaaatgtgcctcatgaacctc gtgcatatgacttcacaag 285 60

7 gactctaagttccacaagggc ctagacctcagtctctggattg 338 64

8 aatgcagccttaagcctttcc ctcgttgtccagacatgacag 278 58

9 tatctctggacccaatgagag ctgggaagacacttggtctag 517 60

10 taccagactggaaatgcagtg aacactcgccttggcaatcag 354 62

11 cagctgcagcttatgaacc ctgtaaatgtcaggggtctac 413 60

12 gtccttctcacaacatgtggg gtgcagcaggatcctgaattc 546 62

13 ctgattcctgtcagagagtgg ctgctgggttggatactatac 780 60

14 cccataccttctgttgacatc tcttgcaagactgacctgac 512 60

W.J. Introne et al. / Molecular Genetics and Metabolism 77 (2002) 136–142 137



30 s, a 1 min annealing step at the temperatures listed in

Table 1, and an extension step at 72 C for 1 min. Am-

plification cycles were followed by an elongation step at

72 C for 10 min, with storage at 4 C. Automated se-

quencing was performed using a CEQ Dye Terminator

Cycle sequencing Kit, according to manufacturer’s pro-

tocol (Beckman–Coulter).

2.3. Homogentisic acid determinations

Homogentisic acid in urine and deproteinized plasma

was assayed using the colorimetric method of Lustberg

et al. [9]. The HGA was first oxidized to benzoquinone

acetic acid and then reacted with diethylene-triamine to

form an adduct, which exhibited an absorption maxi-

mum at 385 nm and a very high extinction coefficient.

The assay was reliable for samples containing >2.5 lg/

mL or >15 lM.

3. Results

3.1. Molecular diagnostics

All 14 exons of the HGO gene of patient #12 were

sequenced and two heterozygous mutations were iden-

tified. One is a known G to A substitution at the IVS1-1

position creating a splice site abnormality [6]. The sec-

ond mutation is a G to A substitution at nucleotide 648,

changing a glycine to an arginine at codon 161. Based

on functional analysis studies performed by Rodriguez

et al. [13], this mutation is predicted to provide 1% of

wild-type activity.

3.2. Renal function

Creatinine clearances were calculated in duplicate for

all three siblings, as well as for unaffected individuals,

and adjusted for body surface area. The renal function

of patient #12 was approximately 31 mL/min/1.73 m2, or30% of that of his affected brother and sister (Table 2).

The value for patient #12 was consistent with the

technetium-99 m DTPA measurement of glomerular

filtration rate performed one year prior to the NIHadmission, i.e., 28.4 mL/min/1.73 m2.

3.3. Homogentisic acid (HGA) levels

Homogentisic acid was measured in plasma and urine

for all three siblings and for normal and AKU controls.

While patients #11 and #13 displayed plasma and urine

HGA values typical of AKU patients, the plasma HGA

values for patient #12 were 4–7 times higher (Table 2).The urine HGA of patient #12, 200 times that of normal

controls, was well within the range for his siblings andother alkaptonuria patients.

3.4. Ochronosis

In the three years prior to admission to the NIH,

patient #12 had noticed a significant increase in the

degree of ochronotic pigmentation of his skin, particu-

larly his face. On physical examination, he manifested

significant darkening of his neck, face, and sclerae,

particularly compared with his two affected siblings(Fig. 1). Additional evidence of enhanced ochronosis

appeared over his spine, along the lateral aspects of his

index fingers, and in his disfigured ear helix (Fig. 2).

3.5. Radiographic findings

The radiographic findings of patient #12 were signifi-

cantly advanced compared to those of his siblings and of

other alkaptonuria patients his age. Patient #12 had

pronounced degenerative changes in the cervical spine,

while the cervical spine of hisolder sister, patient #11, was

relatively spared, with good intervertebral disc height and

no evidence of calcification (Fig. 3A). In addition, patient

#12 had nearly complete loss of the discs in the thoracicand lumbar spine, with obvious calcification at nearly

every level of thethoracic and lumbarregion andcomplete

loss of lumbar lordosis (Fig. 3B). In contrast, the thoracic

and lumbar regions of the spine of patient #11 showed

milder loss of intervertebral disc height and disc calcifi-

cation, with the lumbar region more severely affected than

the thoracic area (Fig. 3B).

Patient #11 had mild narrowing of the knee joints, but

no other bone or joint abnormalities in the upper or lower

extremities. Radiographs of the upper extremities of pa-

tient #13 revealed no significant bone or joint abnor-malities. Views of the lower extremities demonstrated

Table 2

Baseline renal function and HGA values

Parameter Patients Other Alkaptonuriaa

#11 #12 #13

Cr Cl (mL/min/1.73 m2) 83, 71 33, 29 104, 133 79 22

Plasma HGA (lg/mL) 3.8, 9.1 14.4, 27.8 5.0, 5.0 6.6 2.6

Urine HGA (g/day) 2.7, 3.1 6.3, 6.4 10.8, 9.1 4.9 2.2

a N ¼ 58, mean SD. Normal creatinine clearance values for adults are 90–125mL/min. Normal plasma HGA values are below the level of

detection. Plasma and urine values of HGA in alkaptonuria patients are 2–3 orders of magnitude greater than normal.

138 W.J. Introne et al. / Molecular Genetics and Metabolism 77 (2002) 136–142



Fig. 1. Faces and sclerae of patients #11, #12, and #13. Note enhanced pigmentation in patient #12 compared with his older sister



mild degenerative changes in the hip joints. In contrast,

patient #12 had narrowing of both hips and elbow joints

and the left knee joint. Calcifications were also noted in

both hips adjacent to the greater trochanter and ischium

and in the shoulders adjacent to the greater tuberosity(data not shown).

3.6. Effects of renal transplantation

Patient #12 received a renal allograft from an unaf-

fected sister proven on molecular grounds not to carry

either of her brother’s HGO mutations. Three to six

months after renal transplantation, his plasma and urine

HGA values had fallen to approximately half their pre-

transplant levels (Table 3).

4. Discussion

The signs and symptoms of alkaptonuria, including

cartilage pigmentation, arthritis, and cardiac valve dete-

rioration, reflect generalized damage to connective tissue.

This occurs due to binding of HGA and/or its oxidation

products, benzoquinone acetic acid and its polymers,

to cartilage, bones, and joints. Ochronotic pigment ac-

cumulation and damage may exhibit a predilection forthese tissues, either because they turn over slowly and

accumulate benzoquinones over time, or because their

abundant collagen content avidly binds HGA and ben-

zoquinones.Although alkaptonuria manifests clinically in joints

and peripheral tissues, the bulk of tyrosine catabolism,

and HGA production, occurs in the liver, with a minor

contribution from the kidneys [1]. The kidney eliminates

nearly all the HGA produced in the body, with the

blood serving as a conduit for transport from the liver to

the kidney. Consequently, the flux through the tyrosine

catabolic pathway can be estimated by the total daily

urinary HGA in alkaptonuria patients lacking HGO

activity, i.e., 4–8 g [1]. Glomerular filtration alone can-

not rid the alkaptonuric body of this huge HGA load.

Even if the plasma HGA level rose as high as 10 lg/mL,

Fig. 2. Ochronotic tissues in patient #12. Darkened cartilage is visible under the skin covering the spine (A), in the helix of the disfigured right ear (B),

and in the webbing between the first and second digits (C).






a glomerular filtration rate of 100 mL/min would yield a

filtered load of only 1 mg/min or 1.44 g per day. This is

less than the measured excretion in most patients. In

actuality, renal tubular secretion enhances HGA re-

moval, such that HGA clearances approximate 400–

500 mL/min, close to the rate of renal blood flow [1].

This enormous clearance rate maintained plasma HGA

levels in the range of 7 lg/mL in our alkaptonuria pa-

tients (Table 2).

In view of the critical role of the kidney in HGA re-

moval, it is reasonable to expect that the renal failure of

patient #12 was responsible for his increased plasma

HGA concentrations and worsening ochronosis. There-

fore, it was not surprising that this patient’s plasma HGA

decreased after his filtration and secretion functions were

restored by a renal allograft procedure (Table 3).

It was surprising, however, that normalization of renal

filtrationandsecretionwas accompanied by a reductioninurinary HGA. We propose that this occurred because the

donor kidney provided HGO activity, reducing the

amount of HGA that accumulated. Based upon the spe-

cific activity of HGO in human kidney, i.e., 2.7–5.4 lmol

of HGA metabolized per hour per 0.1 g of wet weight [14],a normal 120-gram kidney should be able to metabolize

13–26 g of HGA per day. The actual amount metabolized

would depend upon how much of the plasma HGA could

be delivered to the intracellular location of the enzyme.

Nevertheless, it appears plausible that the transplanted

HGO enzymatic activity may have been responsible for

the absolute reduction (by 2–3 g) in the patient’s daily

HGA excretion (Table 3), in spite of the relative increase

(i.e.,as a percentage of thefilteredload) in HGA secretion.

This case illustrates the critical role the kidneys play in

eliminating HGA from the bodies of alkaptonuria pa-

tients. We suggest that renal transplantation may havedual salutary effects upon patients in kidney failure, i.e.,

increased fractional excretion of HGA, resulting in lower

plasma HGA concentrations, and increased metabolism

of HGA, resulting in lower total body production of

HGA. Further evidence and additional cases are required

to substantiate this hypothesis. The course of patient #12

alsoemphasizes the crucial importance of preserving renal

function in alkaptonuria patients. Only a single case of

ochronotic nephrosis has been reported [15], but ob-

struction from renal stones, which occurs frequently in

alkaptonuria[1], should be avoided to prevent consequent

renal impairment.

References

[1] B.N. La Du, Alkaptonuria, in: C.R. Scriver, A. Beaudet,W. Sly,D. Valle (Eds.), The Metabolic and Molecular Bases of Inherited

Disease, vol. 2, eigth ed., McGraw-Hill, New York, 2001, pp.

2109–2123.

[2] B.N. La Du, V.G. Zannoni, L. Laster, J.E. Seegmiller, The nature

of the defect in tyrosine metabolism in alkaptonuria, J. Biol Chem

230 (1958) 251–260.

[3] J.M. Fernandez-Canon, B. Granadino, D. Beltran-Valero de

Bernabe, M. Renedo, E. Fernandez-Ruiz, M.A. Penalva, S.

Rodriguez de Cordoba, The molecular basis of alkaptonuria, Nat.

Genet. 14 (1996) 19–24.

[4] B. Granadino, D. Beltran-Valero de Bernabe, J.M. Fernandez-

Canon, M.A. Penalva, S. Rodriguez de Cordoba, The human

homogentisate 1,2-dioxygenase (HGO) gene, Genomics 43 (1997)

115–122.

[5] D. Beltran-Valero de Bernabe, B. Granadino, I. Chiarelli, B.

Porfirio, E. Mayatepek, R. Aquaron, M.M. Moore, J.J.M. Festen,

R. Sanmarti, M.A. Penalva, S. Rodriguez de Cordoba, Mutation

and polymorphism analysis of the human homogentisate 1,2-

dioxygenase gene in alkaptonuria patients, Am. J. Hum. Genet. 62

(1998) 776–784.

[6] D. Beltran-Valero de Bernabe, F.J. Jimenez, R. Aquaron, S.

Rodriguez de Cordoba, Analysis of alkaptonuria (AKU) muta-

tions and polymorphisms reveals that the CCC sequence motif is a

mutational hot spot in the homogentisate 1,2 dioxygenase gene

(HGO), Am. J. Hum. Genet. 64 (1999) 1316–1322.

[7] A. Zatkova, D. Beltran-Valero de Bernabe, H. Polakova, M.

Zvarik, E. Ferakova, V. Bosak, V. Ferak, L. Kadasi, S. Rodriguez

de Cordoba, High frequency of alkaptonuria in Slovakia:

Evidence for the appearance of multiple mutations in HGOinvolving different mutational hot spots, Am. J. Hum. Genet. 67

(2000) 1333–1339.

[8] W.M. O’Brien, B.N. La Du, J.J. Bunim, Biochemical, pathologic,

and clinical aspects of alkaptonuria, ochronosis and ochronotic

arthropathy, Am. J. Med. 34 (1963) 813–838.

[9] T.J. Lustberg, J.D. Schulman, J.E. Seegmiller, The preparation

and identification of various adducts of oxidized homogentisic

acid and the development of a new sensitive colorimetric assay for

homogentisic acid, Clin. Chim. Acta 35 (1971) 325–333.

[10] S. Lindstedt, E. Holme, E.A. Lock, O. Hjalmarson, B. Strand-

vik, Treatment of hereditary tyrosinaemia type I by inhibition of

4-hydroxyphenylpyruvate dioxygenase, Lancet 340 (1992) 813–

817.

[11] Y. Anikster, W.L. Nyhan, W.A. Gahl, NTBC and alkaptonuria,

Am. J. Hum. Genet. 63 (1998) 920–921.[12] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A

Laboratory Manual, second ed., Cold Spring Harbor Laboratory,

Cold Spring Harbor, NY, 1989.

[13] J.M. Rodriguez, D.E. Timm, G.P. Titus, D. Beltran-Valero de

Bernabe, O. Criado, H.A. Mueller, S. Rodriguez de Cordoba,

M.A. Penalva, Structural and functional analysis of mutations in

alkaptonuria, Hum. Mol. Genet. 9 (2000) 2341–2350.

[14] V.G. Zannoni, J.E. Seegmiller, B.N. La Du, Nature of the defect

in alkaptonuria, Nature 193 (1962) 952–953.

[15] J.A. Cooper, T.J. Moran, Studies on ochronosis. I. Report of case

with death from ochronotic nephrosis, Arch. Pathol. 64 (1957) 46–

53.

Table 3

Effects of renal transplantation on HGA values of patient #12

Pre-transplant Time after transplant

3 months 6 months

Cr Cl (mL/min/1.73 m2) 31 71 55

Plasma HGA (lg/mL) 21.1 7.3 13.3

Urine HGA (g/day) 6.4 2.7 4.0


Documents

alakpt kidney.pdf