Upload
others
View
6
Download
0
Embed Size (px)
Citation preview
Agriculturally beneficial endophytic bacteria of
wild plants
By
Imran Afzal
Department of Biotechnology
Faculty of Biological Sciences
Quaid-i-Azam University
Islamabad
2017
Agriculturally beneficial endophytic bacteria of
wild plants
A thesis submitted in the partial fulfillment of requirements for the degree of
Doctor of Philosophy
In
Plant Biotechnology
By
Imran Afzal
Department of Biotechnology
Faculty of Biological Sciences
Quaid-i-Azam University
Islamabad
2017
DEDICATED TO MY LOVING
PARENTS, Wife and kids
For their support &
prayers
Contents
Acknowledgement i
Index of Figures iii
Index of Tables v
List of Abbreviations vi
Summary vii
Chapter 1 Introduction and Literature Review 1-27
1.1 Introduction 1
1.2 Types of endophytic bacteria 3
1.3 Colonization of plants by endophytic bacteria 4
1.3.1 Rhizosphere colonization by the endophytic bacteria 4
1.3.2 Root colonization by the endophytic bacteria 5
1.3.3 Systemic colonization of aerial plant tissues by the endophytic
bacteria 7
1.4 Diversity of endophytic bacteria 7
1.4.1 Factors affecting endophytic bacterial diversity of a plant 7
1.4.2 Methods for studying endophytic diversity bacteria 9
1.4.3 Endophytic bacteria diversity of different Plants 12
1.5 Mechanisms of Host Plant growth promotion 12
1.5.1 Nutrient acquisition 16
1.5.1.1 Nitrogen availability 16
1.5.1.2 Phosphorus availability 17
1.5.1.3 Iron availability 17
1.5.2 Phytohormone production and modulation 18
1.5.2.1 Moderating plant Indole Acetic Acid levels 18
1.5.2.2 Control of ethylene levels 20
1.5.2.3 Production of Plant Cytokinins and Gibberellins 20
1.5.3 Indirect growth promotion by suppression of phytopathogens 21
1.6 Bacterial genes expressed in the endosphere 23
1.7 Host specificity of growth promoting endophytic bacteria 24
Aims and Objectives 27
Chapter 2 Selective isolation and characterization of agriculturally
beneficial endophytic bacteria from Wild Hemp using Canola 28-62
Abstract 28
2.1 Introduction 29
2.2 Materials and Methods 30
2.2.1 Collection of plant samples 30
2.2.2 Isolation of Endophytic Bacteria 31
2.2.3 Enumeration of endophytic bacteria 32
2.2.4 Selection and storage of pure strains 32
2.2.5 Bacterial preservation in glycerol stock 32
2.2.6 In-vivo plant growth promotion assay 32
2.2.6.1 Seed collection 33
2.2.6.2 Canola gnotobiotic root elongation assay 33
2.2.7 Confirmation of endophytic growth 33
2.2.8 Salt stress tolerance 34
2.2.9 In-vitro plant growth promotion assays 34
2.2.9.1 Indole acetic acid production 34
2.2.9.2 Phosphate solubilization 35
2.2.9.3 Siderophore production 36
2.2.10 Plant cell-wall degrading enzymes 36
2.2.10.1 Cellulase activity 36
2.2.10.2 Pectinase activity 37
2.2.11 Fungal cell-wall degrading enzymes 37
2.2.11.1 Protease activity 37
2.2.11.2 Chitinase activity 38
2.2.12 Antifungal Activity 38
2.2.13 Molecular identification of endophytic bacterial 38
2.2.13.1 Bacterial genomic DNA extraction 39
2.2.13.2 PCR amplification of 16S rRNA gene 39
2.2.13.3 Confirmation of PCR product using Agarose Gel electrophoresis 39
2.2.13.4 PCR product purification 40
2.2.13.5 16S rRNA gene sequencing 40
2.2.13.6 16S rRNA gene sequences analysis 41
2.2.14 Phylogenetic analysis of endophytic bacteria 41
2.3 Results 41
2.3.1 Isolation of endophytic bacteria 41
2.3.2 Identification of endophytic bacteria 42
2.3.3 Phylogenetic Analysis 45
2.3.4 Plant cell-wall degrading enzymes 47
2.3.5 Nutrient availability 48
2.3.6 Fungal cell-wall degrading enzyme 50
2.3.7 Antifungal Assay 52
2.3.8 Production of IAA 52
2.3.9 In-vivo plant growth promotion assay 53
2.3.9.1 Canola gnotobiotic root elongation 54
2.3.9.2 Confirmation of endophytic presence 55
2.3.9.3 Canola gnotobiotic root elongation under salt stress 58
2.3.10 Growth under salt stress 58
2.4 Discussion 59
Chapter 3 Plant growth-promoting potential of endophytic bacteria
isolated from roots of wild Dodonaea viscosa L. 63-86
Abstract 63
3.1 Introduction 64
3.2 Materials and Methods 65
3.2.1 Collection of plant samples 65
3.2.2 Isolation of endophytic bacteria 65
3.2.3 Enumeration of endophytic bacteria 66
3.2.4 Selection and maintenance of pure strains 66
3.2.5 Bacterial preservation in glycerol stock 66
3.5.6 In-vivo plant growth promotion assay 67
3.2.6.1 Seed Collection 67
3.2.6.2 Gnotobiotic Canola root elongation assay 67
3.2.7 In-vitro plant growth promotion assays 68
3.2.7.1 Indole acetic acid production 68
3.2.7.2 Phosphate solubilization 68
3.2.7.3 Siderophore production 68
3.2.8 Plant cell-wall degrading enzymes 69
3.2.8.1 Cellulase activity 69
3.2.8.2 Pectinase activity 69
3.2.9 Fungal cell-wall degrading enzymes 70
3.2.9.1 Protease activity 70
3.2.9.2 Chitinase activity 70
3.2.10 Antagonistic activities against pathogenic fungi 70
3.2.11 Molecular identification of endophytic bacterial 71
3.2.11.1 Bacterial genomic DNA extraction 71
3.2.11.2 PCR amplification of 16S rRNA gene 71
3.2.11.3 PCR product purification 72
3.2.11.4 16S rRNA gene sequencing and analysis 72
3.2.11.5 Phylogenetic analysis of endophytic bacteria 72
3.3 Results 73
3.3.1 Isolation of endophytic bacteria 73
3.3.2 Identification of endophytic bacteria 73
3.3.3 Phylogenetic Analysis 76
3.3.4 Production of IAA 77
3.3.5 Nutrient availability 77
3.3.6 Production of plant cell-wall degrading enzymes 79
3.3.7 Production of Fungal cell-wall targeting enzyme 80
3.3.8 Antifungal Assay 81
3.3.9 Canola gnotobiotic root elongation assay 82
3.4 Discussion 84
Chapter 4 Comparative in-planta transcriptome profiling of selected
Burkholderia phytofirmans PsJN genes using qPCR 87-110
Abstract 87
4.1 Introduction 88
4.2 Materials and Methods 89
4.2.1 Performance of experimental work 89
4.2.2 Propagation of Bacteria 89
4.2.3 Plant bacterization using Vacuum Infiltration 90
4.2.4 Bacterial estimates in the inoculated plants 90
4.2.5 Bacterial Recovery for RNA extraction 91
4.2.6 RNA extraction from bacterial pellets 92
4.2.7 cDNA synthesis from extracted RNA 94
4.2.8 qPCR Primer designing 94
4.2.9 Standard PCR for cDNA analysis 95
4.2.10 qPCR for in planta differential gene expression 96
4.3 Results 97
4.3.1 Bacterial estimates in the inoculated plants 97
4.3.2 RNA extraction from bacterial pellets 99
4.3.3 Standard PCR for cDNA analysis 101
4.3.4 qPCR for in-planta differential gene expression 102
4.4 Discussion 105
Conclusions 111
References 113
Appendix A 140
Appendix B 149
Publications 162
i
Acknowledgements
All the praises for the almighty ALLAH the most omnipotent, the most merciful, who
bestowed us with the ability and potential to seek knowledge of his creatures, and his Prophet
Muhammad (S.A.W.W), who is forever a source of guidance and knowledge for humanity
as a whole. I also pay my gratitude to the Almighty for enabling me to complete this research
work within due course of time.
The successful completion of this journey is due to the combined efforts of many people.
PhD is a long and complicated journey. During this journey, I was helped by many and I
would like to show my gratitude to all of them. This work could not have been finished
without their help.
Primarily, I am extremely grateful to my supervisor, Dr. Zabta Khan Shinwari, Professor,
Department of Biotechnology, Biological Sciences, Quaid-i-Azam University, Islamabad, for
his dynamic and valuable supervision. It is his confidence, imbibing attitude, splendid
discussions and endless endeavors through which I have gained significant experience.
Without his much needed support that he extended every step of the way, this endeavor
would never have been possible. I will remain deeply indebted to him for the rest of my life.
My special thanks are due to, Dr. Muhammad Naeem, Chairman Department of
Biotechnology, Quaid-i-Azam University, Islamabad, and Dr. Bilal Haider Abbasi,
Associate professor, Department of Biotechnology, Quaid-i-Azam University, Islamabad, for
their valuable guidance throughout my PhD period.
I must acknowledge my debt to Prof. Steven E. Lindow, Department of Plant and Microbial
Biology, University of California, Berkeley, USA, for providing me an opportunity to carry
out a part of my research project at his facility. His constructive comments, guidance and
great co-operation played a fundamental role in carrying out this epic work. This project was
supported by Higher Education Commission of Pakistan (HEC), and I acknowledge this
institution for providing me Indigenous and Overseas IRSIP Scholarship for my research in
Pakistan and USA.
I am also thankful to my colleagues and my lab fellows, especially Irum Iqrar, Khansa Jamil
and Nadia Batool, for helping me during my difficult times. I must mention my dear friend,
ii
Sohail Irshad, for encouraging and helping me in every step of the way, and enabling me to
achieve the nearly impossible.
Lastly, this work would never have been possible without the support of my parents and my
wife, who never gave up in believing in me, and empowering me during my difficult times.
Imran Afzal
iii
List of Figures
Figure 1.1 Plant root section showing three types of endophytic bacteria 3
Figure 1.2
Mechanisms used by endophytic bacteria for plant colonization and
growth promotion (Pink, establishment in host; blue, plant growth
promotion; black, rhizosphere competence and attachment). Processes
labeled with star are experimentally (mostly mutational) verified while
others are suspected, inferred from literature or genome comparisons.
22
Figure 2.1 Standard curve of Indole Acetic Acid 35
Figure 2.2 Plate showing growth of isolated endophytic bacteria 42
Figure 2.3
Agarose gel electrophoresis of PCR amplified 16S rRNA gene of
bacterial isolates. First lane, 1 kb DNA ladder; second lane, negative
control; third lane, positive control; lanes 1, 2, 3, 4, 5, 6, 7 and 8 PCR
amplified DNA of ~1465bp size.
43
Figure 2.4 Electropherogram of 16S rRNA gene from bacterial isolate MOSEL-
w2. 43
Figure 2.5 Percentage of endophytic bacterial genera obtained from C. sativa using
direct isolation method 44
Figure 2.6 Percentage of endophytic bacterial genera obtained from C. sativa using
selective isolation 44
Figure 2.7
Phylogenetic tree of endophytic bacteria from C. sativa (direct and
selective isolation) constructed with 16S rRNA gene sequences using
the Neighbour-Joining method. Branch points show bootstrap
percentages (500 replicates). Bar 0.02 indicates changes per nucleotide
position. Cluster enclosed in red box contains isolates significantly
promoting canola growth.
47
Figure 2.8 Pectinase (left) and Cellulase (right) activity of four bacterial isolates on
Pectin and Cellulose (CMC) containing medium. 48
Figure 2.9
Cellulase (blue bars) and Pectinase (orange bars) assay of endophytic
bacteria isolated from C. sativa using direct isolation. Values of zones
of hydrolysis produced by bacteria have been organized into three
categories based on the size: 3, large (>1.0 cm); 2, medium (0.5-1 cm);
1, small (<0.5 cm).
49
Figure 2.10
Cellulase (blue bars) and pectinase (orange bars) assay of endophytic
bacteria isolated from C. sativa using selective isolation. Values of
zones of hydrolysis produced by bacteria have been organized into three
categories: 3, large (>1.0 cm); 2, medium (0.5-1 cm); 1, small (<0.5
cm).
49
Figure 2.11 Mineral phosphate solubilization activities of four bacterial isolates on
insoluble mineral phosphate containing medium. 50
Figure 2.12
Mineral phosphate solubilization activity of bacteria isolated from C.
sativa using direct isolation. Values of zones of hydrolysis produced by
bacteria have been organized into three categories: 3, large (>1.0 cm); 2,
medium (0.5-1 cm); 1, small (<0.5 cm).
50
Figure 2.13
Mineral phosphate solubilization activity of bacteria isolated from C.
sativa using selective isolation. Values of zones of hydrolysis produced
by bacteria have been organized into three categories: 3, large (>1.0
cm); 2, medium (0.5-1 cm); 1, small (<0.5 cm).
51
Figure 2.14 Protease activity of bacteria isolated from C. sativa using selective
isolation. Values of zones of hydrolysis produced by bacteria have been 51
iv
organized into three categories: 3, large (>1.0 cm); 2, medium (0.5-1
cm); 1, small (<0.5 cm).
Figure 2.15 Dual culture antifungal assay of five selected endophytic bacteria
against Aspergillus niger (left) and Fusarium oxysporum (right) 52
Figure 2.16
IAA production by bacteria isolated from C. sativa using direct isolation
(Blue bars, without tryptophan; Orange bars, with tryptophan). Values
represent mean of three replicates.
55
Figure 2.17
IAA production by bacteria isolated from C. sativa using selective
isolation (Blue bars, without tryptophan; Orange bars, with tryptophan).
Values represent mean of three replicates.
56
Figure 2.18 Root elongation of canola by three selected growth promoting bacteria
under gnotobiotic conditions. Scale indicates values in centimeters. 56
Figure 2.19
Canola gnotobiotic root elongation assay of endophytic bacteria isolated
from C. sativa roots using direct isolation. Each bar represents mean
root length (± SE, n=12) of five day old plantlets treated with sterile
0.03M MgSO4 (Control) or bacterial suspension in 0.03M MgSO4
(0.1±0.02 OD at 600nm). Green bars represent isolates significantly
increasing root length and red bars significantly decreasing root length
compared to control (Least significant difference, p ≤ 0.05).
57
Figure 2.20
Canola gnotobiotic root elongation assay of endophytic bacteria isolated
from C. sativa rhizosphere by selective isolation using canola. Each bar
represents mean root length (± SE, n=12) of five day old plantlets
treated with sterile 0.03M MgSO4 (Control) or bacterial suspension in
0.03M MgSO4 (0.1 ± 0.02 OD at 600nm). Green bars represent isolates
significantly increasing root length compared to control (Least
significant difference, p ≤ 0.05).
57
Figure 2.21
Root elongation of canola by three selected growth promoting bacteria
under gnotobiotic condition and 125mM NaCl stress. Scale indicates
values in centimeters.
58
Figure 2.22
Canola gnotobiotic root elongation assay of three growth promoting
bacteria in the presence of 125mM NaCl stress. Each bar represents
mean root length (± SE, n=12) of five day old plantlets treated with
sterile 0.03M MgSO4 (Control) or bacterial suspension in 0.03M
MgSO4 (0.1 ± 0.02 OD at 600nm). Green bars belong to isolates
significantly increasing root length under stress compared to control
(Least significant difference, p ≤ 0.05).
59
Figure 3.1 Percentage of endophytic bacterial genera isolated from D. viscosa 74
Figure 3.2
Phylogenetic tree of endophytic bacteria isolated from Dodonaea
viscosa roots constructed with 16S rRNA gene sequences using the
Neighbour-Joining method. Branch points show bootstrap percentages
(500 replicates). Bar 0.02 indicates changes per nucleotide position.
Clusters enclosed in red boxes contain isolates significantly promoting
canola growth.
76
Figure 3.3
IAA production by bacteria isolated from Dodonaea viscosa roots (Blue
bars, without tryptophan; Orange bars, with tryptophan). Values
represent mean of three replicates.
77
Figure 3.4 Tri-calcium phosphate medium plate showing phosphate solubilization
activity of Streptomyces caeruleatus MOSEL-RD17 78
Figure 3.5 Siderophore production by Bacillus cereus MOSEL-RD27 on the test
media. 78
v
Figure 3.6
Cellulase (blue bars) and Pectinase (orange bars) assay of endophytic
bacteria isolated from Dodonaea viscosa roots. Values of zones of
hydrolysis produced by bacteria have been organized into three
categories based on the size: 3, large (>2 cm); 2, medium (1-2 cm); 1,
small (<1 cm).
80
Figure 3.7
Skimmed milk containing media showing Protease activity (left) and
Colloidal chitin media showing Chitinase activity (right) by Bacillus
subtilis MOSEL-RD28
82
Figure 3.8
Anti-Aspergillus niger (left) and Anti-Fusarium oxysporum (right)
activity of selected endophytic bacteria isolated from Dodonaea viscosa
roots.
82
Figure 3.9
Canola gnotobiotic root elongation assay of endophytic bacteria isolated
from Dodonaea viscosa roots. Each bar represents mean root length (±
SE, n=12) of five day old plantlets treated with sterile 0.03M MgSO4
(Control) or bacterial suspension in 0.03M MgSO4 (0.1±0.02 OD at 600
nm). Green bars represent isolates significantly increasing root length
and red bar significantly decreasing root length compared to control
(Least significant difference, p ≤ 0.05).
83
Figure 4.1
Bacterial counts in leaf tissue at four different day (0, 2, 4, 6) after
inoculation with three different dose of bacterial suspension (104 cfu/ml,
blue; 106 cfu/ml, red; 108 cfu/ml, green), using vacuum infiltration
method.
98
Figure 4.2
Bacterial counts in leaf tissue at four different days (0, 2, 4, 6) after
inoculation with 109 cfu/ml bacterial suspension, using vacuum
infiltration method.
99
Figure 4.3
Bioanalyzer results for in-planta bacterial RNA samples. The peaks for
16S and 23S rRNA are indicated along with a virtual gel of the run
sample.
100
Figure 4.4 Bioanalyzer results for M9 bacterial RNA samples. The peaks for 16S
and 23S rRNA are indicated along with a virtual gel of the run sample. 100
Figure 4.5
Agarose gel electrophoresis of three PCR amplified strain PsJN genes
from in-planta (P1, P2, P3) and M9 (M1, M2, M3) samples using the
first strand cDNA as template. The respective RT controls (PC and
MC), non-bacterized plant sample (C), and 100 bp ladder (L) are also
shown.
101
Figure 4.6
In-planta gene expression profile of 15 Burkholderia phyrofirmans PsJN
genes versus M9 cultured bacteria using Relative Quantification qPCR
(Green bars, upregulated genes; Red bars, downregulated genes; Gray
bars, no change).
104
Figure 4.7 Dissociation curve analysis for ACCD gene (Bphyt_5397) for both M9
and in-planta samples indicating a single product type. 105
vi
List of Tables
Table 1.1 Some common endophytic bacterial genera isolated from agronomic
plants reported in literature 13
Table 1.2 Diversity of endophytic bacterial isolated from some wild plants. 14
Table 1.3 Selected bacterial genes involved in endosphere colonization, host
interaction and promotion of plant growth 25
Table 2.1 Number of bacterial isolates recovered from two isolation procedures
along with average cell counts recovered on three growth media. 42
Table 2.2
Identification of endophytic bacteria resulting from selective isolation
method based on the partial 16S rRNA gene sequence. GenBank match
similarity was ≥99% for all isolates while their Eztaxon match similarity
and GenBank accession is given below.
45
Table 2.3
Identification of endophytic bacteria resulting from direct isolation
method based on the partial 16S rRNA gene sequence. GenBank match
similarity was ≥99% for all isolates while their Eztaxon match similarity
and GenBank accession is given below.
46
Table 2.4
Protease production (PRO), Chitinase production (CHI), Siderophore
production (SID), Anti Aspergillus niger (AN), and anti Fusarium
oxysporum (FO) activities of endophytic bacteria isolated from C. sativa
using direct isolation.
53
Table 2.5
Protease production (PRO), Chitinase production (CHI), Siderophore
production (SID), Anti-Aspergillus niger (AN), and anti-Fusarium
oxysporum (FO) activities of endophytic bacteria isolated from C. sativa
using selective isolation.
54
Table 3.1 Number of bacterial isolates recovered from Dodonaea viscosa roots
along with average cell counts recovered on three growth media. 73
Table 3.2
Identification of endophytic bacteria isolated from Dodonaea viscosa
roots. GenBank match similarity was ≥99% for all isolates while their
Eztaxon match similarity and GenBank accession is given below.
75
Table 3.3 Phosphate solubilization and Siderophore production activity of
endophytic bacteria isolated from Dodonaea viscosa roots. 79
Table 3.4
Protease production (PRO), Chitinase production (CHI), Anti-
Aspergillus niger (AN), and Anti-Fusarium oxysporum (FO) activities of
endophytic bacteria isolated from Dodonaea viscosa roots.
81
Table 4.1
Selected (15) strain PsJN genes used for expression analysis, their
function, and their qPCR primer sequences, and expected product size
are given. Two bacterial housekeeping genes used as endogenous control
and bacterial detection in in-planta samples are also provided.
95
vii
List of Abbreviations
(A)RISA (Automated) Ribosomal intergenic spacer analysis
°C Degree celcius
µg/ml Microgram per milliliter
µl Microlitre
ACC 1-aminocyclopropane-1-carboxylate
AN Aspergillus niger
ANOVA Analysis of variance
ARDRA Amplified rDNA Restriction Analysis
BLAST Basic Local Alignment Search Tool
bp Base pair
C2H4 Ethylene
CAS Chrome Azurol S
CEL Cellulase activity
cfu/gfw Colony forming units per gram fresh weight
CHI Chitinase activity
cm Centimeter
CMC Carboxymethyl cellulose
Ct Threshold cycle
DGGE Denaturing Gradient Gel Electrophoresis
DNA Deoxyribonucleic acid
EDTA Ethylenediaminetetraacetic acid
ET Ethylene
F Forward primer
Fe3 Ferric
FISH Fluorescence in situ hybridization
FO Fusarium oxysporum
gfp Green fluorescent protein
gusA beta-glucuronidase gene
h Hours
HDTMA Hexadecyltrimetyl ammonium bromide
IAA Indole acetic acid
ISR Induced systemic resistance
IVET In-vivo expression technology
JA Jasmonic acid
kb kilobase
L Litre
log Logarithm
LPS Lipo-polysaccharides
LSD Least Significant Difference
M Molar
MEGA5 Molecular evolutionary genetics analysis 5
MgSO4 Magnesium sulphate
ml Milliliter
mM Millimolar
MOSEL Molecular systematics and applied ethnobotany laboratory
N2 Nitrogen
viii
NA Nutrient agar
NaCl Sodium chloride
NaOCl Sodium hypochlorite
NARC National Agricultural Research Centre
NCBI National Center for Biotechnology Information Search database
ng Nanogram
nm Nanometer
O2 Oxygen
OD Optical density
PCR Polymerase chain reaction
PDA Potato dextrose agar
PEC Pectinase activity
PGP Plant growth promoting
PGPB Plant growth promoting bacteria
PGPR Plant growth promoting rhizobacteria
pH Potential of hydrogen
PHO Phosphate solubilization
PIPES Piperazine-1,4-bis (2- ethanesulfonic acid)
PRO Protease activity
psi Pascal per square inch
qPCR Quantitative Polymerase chain reaction
QS Quorum sensing
R Reverse primer
rDNA Ribosomal Deoxyribonucleic acid
RIN RNA Integrity Number
RNA Ribonucleic acid
RNA-seq Ribonucleic acid sequencing
ROS Reactive oxygen species
rpm Revolutions per minute
RQ Relative quantification
rRNA Ribosomal ribonucleic acid
S Svedberg
s Seconds
SA Salicylic acid
SE Standard error
TAE Tris acetate EDTA (Ethylenediaminetetraacetic acid)
TGGE Temperature Gradient Gel Electrophoresis
Tm Melting temperature
T-RFLP Terminal Restriction Fragment Length Polymorphism
Tris Tris (hydroxymethyl) aminomethane
TSA Tryptic Soya agar
TSB Tryptic soya broth
V/cm Volts per centimeter
VNC Viable but nonculturable
w/v Weight / Volume
ix
Summary
Endophytic bacteria colonize internal plant tissues and can improve plant growth under
normal and stressed conditions. Most past work has focused on the endophytic bacteria of
agronomic plants. Wild perennial plants remain little investigated for their endophytic
diversity. Unlike crop plants, wild plants are constantly challenged by adverse environmental
conditions. Choosing the right endophytic partner can abet wild plants to survive better under
adversity. Since endophytic bacteria can have broad host range, identifying agriculturally
beneficial endophytic bacteria of wild plants can have great agricultural significance.
Therefore, the present work focused on the isolation and characterization of plant beneficial
endophytic bacteria from wild perennial plants to assess their growth promoting potential on
Canola (Brassica napus). Moreover, in-planta gene expression profiling of a model
endophytic bacterium was also undertaken to identify the bacterial traits important during
endophytic growth.
Endophytic bacteria were isolated from two wild perennial plants, Cannabis sativa L. and
Dodonaea viscosa L. For C. sativa, two different approaches were used to isolates endophytic
bacteria. The first approach involved direct isolation from C. sativa roots while the second
novel approach utilized canola plants to selectively isolate endophytes from C. sativa
rhizosphere. Selective method isolated 18 distinct bacteria while direct method isolated 16
bacteria. The bacteria were identified using 16S rRNA gene sequence. The selective method
yielded 13 unique bacterial genera while the direct method isolated 11 genera. Overall, the
most abundant genera were Acinetobacter, Chryseobacterium, Enterobacter,
Microbacterium, Nocardioides, Paenibacillus Pseudomonas, Stenotrophomonas. Moreover,
six (33.3%) isolates from selective method significantly promoted canola root growth under
gnotobiotic conditions, as compared to two (12.5%) isolates from direct method. The bacteria
that significantly promoted canola growth were found to be phylogenetically related.
Furthermore, C. sativa roots contained 8×107 cfu/gfw bacterial cells.
From the second wild plant used for isolating endophytic bacteria, D. viscosa , the bacteria
were isolated from roots of the healthy plants, which contained 1×107 cfu/gfw bacterial cells.
Bacterial identification based on 16S rRNA gene sequence revealed 11 distinct bacterial
genera, where Bacillus, Xanthomonas and Streptomyces were the most predominant. Many
isolates (67%) significantly promoted canola root growth; Bacillus, Pseudomonas and
Xanthomonas were prominent genera in this regard. These bacteria were also found to be
x
phylogenetically related, strengthening the argument that plant growth promoting ability of
the endophytic bacteria is evolutionary conserved.
Many traits required for plant growth promotion and colonization were detected in the
endophytic isolates from C. sativa and D. viscosa. Most of the bacteria produced plant cell-
wall degrading enzymes (cellulase and pectinase) needed for systemic plant colonization.
Moreover, all isolates produced phytohormone IAA, where majority of the growth promoting
isolates produced IAA in the range 2-10 µg/ml. The isolates also possessed phosphate
solubilization and siderophore production. Moreover, seven isolates of C. sativa and D.
viscosa inhibited the growth of two phytopathogenic fungi Aspergillus niger and Fusarium
oxysporum. Most pronounced antifungal activity was observed for the genera Bacillus,
Paenibacillus, Pseudomonas and Streptomyces. All the fungal antagonists produced fungal
cell-wall targeting enzymes, chitinase and protease.
Burkholderia phytofirmans PsJN is a model endophytic bacterium that can promote growth of
a variety of non-host plants. Expression of 15 selected strain PsJN genes was analyzed and
compared between bacterial growth in-planta and growth on M9 minimal media. For this,
strain PsJN was vacuum infiltrated into tomato plants, and inoculum dose was first optimized
for maximum bacterial extraction from leaf tissues. Out of four inoculum doses tested, the
dose 109 cfu/ml yielded the highest cells counts (108 cfu/gfw on second day) and was used to
inoculate plants for gene expression study. Compared to M9 grown bacteria, total bacterial
RNA extracted from in-planta bacteria was lower in quantity and quality, but RNA was
analyzable using qPCR. Bacterial gene expression was analyzed and compared between in-
planta and M9 bacteria using relative quantification qPCR. Eight genes were upregulated
during in-planta growth: Cellulase and Pectinase (plant colonization), IAA degradation and
ACC deaminase (plant growth promotion), β-xylosidase and β-galactosidase (sugar
metabolism), peroxidase (oxidative stress reduction) and one quorum sensing gene (cell-cell
communication); three genes were downregulated: IAA synthesis (phytohormone), flagella
(movement), and second quorum sensing gene. Expression of Pili (cell attachment),
aerobactin (siderophore), hemagglutinin and Type III secretion system gene (virulence) was
similar between the two growth conditions. Gene expression study revealed that the
bacterium was active in the tomato leaves and expressed traits that are compatible with plant
growth promotion and invasion. The present work concludes that wild perennial plants harbor
unique and agriculturally beneficial endophytic bacteria with multiple plant growth
promoting traits that are expressed during endophytic growth.
Chapter 1
Introduction and Literature Review
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 1
1.1 Introduction
Plants can develop associations with members of their ecosystem to thrive in their natural
environments. Microorganisms are one of the most important organisms that can develop
beneficial associations with plants (Santoyo et al., 2016). Such plant-beneficial bacteria are a
class of bacteria that provide numerous benefits to their host plants, helping them in
tolerating various biotic and abiotic stresses that can challenge their growth (Miliute et al.,
2015). These bacteria can live both externally or internally in their host plant. Bacteria that
live outside their host plants are either epiphytic, those living on the plant leaf surfaces, or
rhizospheric, those inhabiting plant roots within the soil (Compant et al., 2010). While the
bacteria that live and thrive inside the host plant are called endophytic bacteria (Hardoim et
al., 2008). All these classes of bacteria share numerous characteristics essential for host plant
growth promotion (Compant et al., 2010).
Endophytic bacteria are considered a subclass of rhizospheric bacteria, commonly called as
plant growth promoting rhizobacteria (PGPR). These are in fact a specialized group of
rhizobacteria that have acquired the ability to invade their plant host (Reinhold-Hurek and
Hurek, 2011). They share all the important traits consistent with the host plant growth
promotion found in rhizobacteria. In fact, the beneficial effects provided by endophytic
bacteria to host plants are usually greater than those provided by many rhizospheric bacteria.
However, these effects may exacerbate when the plants are challenged by stress conditions
(Chanway et al., 2000; Hardoim et al., 2008).
In 1926, endophytic growth was described as a particular stage of bacterial growth, where
bacteria infect and develop a close mutualistic relation with plants (Perotti, 1926). Thus,
endophytic bacteria are now described as the bacteria that are isolated from surface sterilized
plant tissues and do not cause any noticeably harm to their host plants (Santoyo et al., 2016).
These bacteria can exists within the plant host, including aboveground and underground plant
parts and even seeds, thereby positively affecting plant development (Chebotar et al., 2015).
The bacteria use the plant endosphere as a unique protective ecological niche that provides a
safe and consistent environment unperturbed by fluctuating environmental conditions
affective rhizospheric and epiphytic bacteria (Senthilkumar et al., 2011). Moreover, most
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 2
endophytic bacteria have a biphasic life cycle that alternates between plants and the soil
environment.
Nearly 300,000 plant species that exist on the earth are thought to be a host to one or more
endophytes (Ryan et al., 2008). Theses endophytes can be both fungi and bacteria (Singh et
al., 2011; Reinhold-Hurek and Hurek, 2011). The endophytic bacteria can not only promote
growth of the host plant, but also help the host in tolerating stress conditions, and produce
allelopathic effects against other competing plant species (Rosenblueth and Martínez-
Romero, 2006; Mei and Flinn, 2010; Cipollini et al., 2012). Thus, they enable their host to
have better survival against biotic and abiotic challenges and competition by other plants.
Endophytic bacteria have been isolated and characterized from diverse type of plant hosts.
These include agronomic crops, prairie plants, plants growing in extreme environments, and
wild and perennial plants (Zinniel et al., 2002; Nair and Padmavathy, 2014; Yuan et al.,
2014). Endophytic bacteria have been isolated from different plant parts that are above and
below ground (Senthilkumar et al., 2011). The parts include roots, stems, leaves, seeds,
fruits, tubers, ovules and nodules, where roots have the greatest numbers of bacterial
endophytes as compared to above ground tissues (Rosenblueth and Martínez-Romero, 2006).
Numerous reports exist regarding useful endophytic bacteria in plant growth promotion of
plants like wheat, rice, canola, potato, tomato, and many more (Sturz and Nowak, 2000; Mei
and Flinn, 2010). Most of these studies involve the possible growth promotion potential of
the endophytes isolated from the same plants. However other studies have reported the
growth promotion effect of endophytic bacteria on non-host plants (Sessitsch et al., 2005).
There have been contrasting reports about the host specificity of endophytes. Some
researchers have indicated that the endophytes are only able to promote plant growth in plants
that are very closely related to their natural host (Long et al., 2008). On the other hand, there
have been reports regarding the growth promotion due to endophytes among diverse hosts
(Ma et al., 2011; Sessitsch et al., 2005). Nevertheless, broad host range of endophytes makes
a power tool in agriculture biotechnology. Therefore, endophytes have a great potential to be
used as biofertilizers and biopesticides and in developing a sustainable, safe and effective
agriculture system.
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 3
1.2 Types of endophytic bacteria
Hardoim et al. (2008) have categorized the endophytic bacteria based on their endophytic
lifestyle and ability to invade plant hosts. Based on their life strategies, endophytic bacteria
are categorized as ‘obligate endophytes’ or ‘facultative endophytes’ (Figure 1.1). The
obligate endophytes strictly depend on plant host for growth and survival and are transmitted
to a new host plant either vertically or by means of a vector. Facultative endophytes only live
a stage of their life cycle in their host plants and they can also survive in other habitats.
Facultative endophytes are further characterized into three types: competent, opportunistic
and passenger endophytes. Competent endophytes are the bacteria that can effectively
colonize the plant tissues, have the ability to manipulate host physiology, and are favored by
the plant host, leading to a positive plant-microbe association (Hardoim et al., 2012).
Opportunistic endophytes are the bacteria that only occasionally enter the plant host to get
more nutrients, increased protection from predators, and to escape competition (Reinhold-
Hurek and Hurek, 1998). The passenger endophytes are the bacteria that enter plant by
accident and lack features that allow systematic colonization of plant host (Hardoim et al,
2008).
Soil bacteria can become
endophytic by: (1) accidently
entering the host via wounds and
are retained in the root zone
(passenger endophytes, red cells);
(2) active invasion of host to get
benefit from the host where they are
mostly retained in root tissues,
(opportunistic endophytes, blue
cells); (3) using specialized
mechanism to invade host roots,
systematically infect the above-
ground parts of the host, develop a
positive association, and adapt to
the internal environment of the host
plant (competent endophytes,
yellow cells).
Figure 1.1 Plant root section showing three types of endophytic bacteria (Hardoim et al., 2008)
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 4
1.3 Colonization of plants by the endophytic bacteria
Endophytic bacteria can be considered a subset of the rhizospheric bacteria (Misko and
Germida, 2002; Marquez-Santacruz et al., 2010). However, compared to rhizobacteria,
endophytic growth has an added advantage over rhizospheric growth. Living within plant
tissues allows endophytic bacteria to be in close contact with the plant host to readily exert a
direct beneficial effect in return for consistent supply of nutrients. In fact, endophytic bacteria
represent a class of specialized rhizobacteria that have acquired the ability to invade plant
roots after establishing a rhizospheric population (Compant et al., 2005).
Endophytic colonization of host by the bacteria is determined by a battery of different
bacterial traits. These traits are collectively referred to as colonization traits and regulate the
entire process of plant colonization. The colonization process involves complex
communication between the two partners. The process usually starts from the roots, and
requires recognition specific compounds in the root exudates by the endophytic bacteria (De
Weert et al., 2002; Rosenblueth and Martínez-Romero, 2006). Plants produce these root
exudates to interact with beneficial bacteria for their own ecological advantage (Compant et
al., 2005a). Moreover, it has been observed that endophytic bacteria colonize plant interior in
a sequence of events similar to rhizosphere colonization by the rhizobacteria (Hallman et al.,
1997). However, endophytic colonization involves a suite of environmental and genetic
factors that allow a bacterium to enter plant endophere (Compant et al., 2010). Although,
endophytic bacteria usually enter the plants through the root zone, the aerial parts of the
plants, including stems, leaves, flowers and cotyledons, may also be used (Zinniel et al.,
2002). Once inside the roots, endophytic bacteria can now systemically infect the adjacent
plant tissues.
1.3.1 Rhizosphere colonization by the endophytic bacteria
The rhizosphere colonization is a highly competitive task for endophytic bacteria to occupy
spaces and get nutrients (Raaijmakers et al., 2002). Only those bacteria, either beneficial or
pathogenic, that can competitively colonize plant rhizosphere will thrive in this environment
and have an effect on plant growth and development (Haas and Keel, 2003). Bacterial traits
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 5
like motility and polysaccharide production are important in the colonization of plant
rhizosphere by Alcaligenes faecalis and Azospirillum brasilense (Santoyo et al., 2016)
Bacterial rhizosphere population can range between 107-109 cfu per gram of rhizosphere soil
(Benizri et al., 2001); rhizoplane population ranges from 105 to 107 colony forming units per
gram fresh weight (Benizri et al., 2001; Bais et al., 2006). Bacterial detection systems based
on gfp/gusA labelled strains, immunomarkers, and fluorescence in situ hybridization (FISH)
have revealed that bacterial cells first colonize the rhizosphere after they have been
inoculated into the soil (Gamalero et al., 2003). The bacterial cells then attach to the root
surfaces forming a string of cells (Hansen et al., 1997). The bacteria can then colonize the
entire root surface and some rhizodermal cells, leading to establishment of microcolonies or
biofilms by the bacrteria (Benizri et al., 2001). Rhizoplane colonization has been investigated
in both plants growing in-vitro and plants growing in natural soil (Compant et al., 2010).
To confer beneficial effects on host plant, the bacteria have to competently colonize the plant
rhizosphere and rhizoplane (Compant et al., 2005b). They also have to compete with other
rhizospheric members while colonizing the host plant (Whipps, 2001). Moreover, the bacteria
do not colonize the host plant root system in a uniform manner. For example, Gamalero et al.
(2004) reported that while colonizing tomato plants, distribution and density of Pseudomonas
fluorescens strain A6RI varied according to the root zone. This non-uniform colonization of
plant root by the bacteria is a result of different factors controlling the process of root
colonization. These factors include root exudation patterns, bacterial attachment and motility,
bacterial quorum sensing, bacterial growth rate, and minimizing competition by producing
antagonistic substances and acquiring nutrients efficiently (Compant et al., 2010). Moreover,
to be successful, the bacteria need to metabolically adapt to the range of nutrients available in
the plant roots exudates. This was demonstrated by Matilla et al. (2007) in the gene
expression analysis Pseudomonas putida KT2440 competently colonizing corn rhizosphere,
where bacterial genes involved in metabolism and oxidative stress were upregulated.
1.3.2 Root colonization by the endophytic bacteria
After establishing themselves in the rhizoshere and rhizoplane, bacterial endophytes are
known to make their way inside the plant root and colonize themselves with subpopulations
ranging from 105-107 cfu/gfw (Hallmann, 2001). This involves bacterial adhesion to cell
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 6
surface structures, which is mediated by polysaccharides, pili and bacterial adhesins (Hori
and Matsumoto, 2010). Once on the root surface, the bacteria might reach the root entry sites,
like lateral root emergence and wounds, using type IV pili mediated twitching motility.
Importance of this feature was demonstrated in diazotrophic endophyte Azoarcus sp. BH72
colonizing rice roots, where mutant defective in pilus retraction showed decreased root
surface colonization compared to the wild-type bacteria (Böhm et al. 2007). Nevertheless,
every endophytic bacterium has its own distinct colonization pattern and colonization site
preferences (Zachow et al. 2010). Once these bacteria have established themselves on the
roots surfaces, they start to penetrate into the root interior using specialized mechanism.
The process of penetration into the host can be passive or active. Passive penetration can
occur at cracks present at root emergence areas, root tips, or those created by deleterious
organisms (Hardoim et al., 2008). Active penetration by competent endophytic bacteria is
achieved by means of dedicated machinery of attachment and proliferation. This involves
presence of lipopolysaccharides, flagella, pili, twitching motility, and quorum sensing which
can affect endophytic colonization and bacterial movement inside the host plants (Duijff et
al., 1997; Dörr et al., 1998; Böhm et al., 2007; Suarez-Moreno et al., 2010). In addition, the
secretion of cell-wall degrading enzymes, mainly pectinases and cellulases are known to be
involved in bacterial penetration and spreading within the plant (Compant et al., 2005a).
Although not experimentally proven, it has been proposed that endophytic bacteria produce
low levels of cell-wall degrading, as compared to phytopathogens that produce deleteriously
high levels of these enzymes, and can thus avoid triggering plant defense system (Elbeltagy
et al. 2000). Furthermore, another way by which endophytic bacteria avoid being detected as
a pathogen by the plant is maintaining low cell densities (2-6 log cfu/gfw) as compared to
pathogenic bacteria (7-10 log cfu/gfw) (Zinniel et al., 2002). Hence, the endophytic presence
of bacteria is determined by chance factors and bacterial genetic determinants that enable
bacterial-plant crosstalk leading to active endophytic colonization process (Hardoim et al.,
2008). The plant host also plays a critical role in selecting an endophytic partner where
secretion of specific root exudates and a selective plant defense response are considered
important factors in selection of specific endophytes (Rosenblueth and Martínez-Romero,
2006).
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 7
1.3.3 Systemic colonization of aerial plant tissues by the endophytic bacteria
After entry into the roots, the endophytic bacteria can spread systemically to colonize above
ground tissue. They can establish stems and leaves population densities between 103-104
cfu/gfw under natural conditions (Compant et al, 2010). It is not clear whether bacterial
colonization of higher plant tissues confer similar beneficial effects on plant host as those
seen with root colonization. Nevertheless, only few bacteria can colonize aerial vegetative
parts of their host plants due to the physiological requirements needed to occupy these plant
niches (Hallmann, 2001). Thus, the bacteria that migrate to the above ground plant tissue are
well adapted to this particular endophytic niche. Bacterial movement inside plants is
supported by bacterial flagella and plant transpiration stream (James et al., 2002; Compant et
al., 2005a). Migration along intercellular spaces requires the secretion of cell-wall degrading
enzymes like cellulases and pectinases (Compant et al., 2010). However, movement through
xylem element occurs through perforated plates that allow movement of bacteria through
large pores without requiring cell-wall degrading enzymes (Bartz, 2005). The final sink for
these specialized endophytic bacteria is leaf tissue. Endophytic bacterial mostly colonize the
leaf tissues from plant roots, but just like phytopathogenic bacteria, endophytic bacteria can
gain entry into the leaves from the phyllosphere via leaf stomata (Senthilkumar et al., 2011).
1.4 Diversity of endophytic bacteria
Bacterial endophytes have been found in every plant species that has been studied. Thus, an
endophyte-free plant is a rare exception in the natural environment (Partida-Martínez and
Heil, 2011). In fact, a plant without the associated beneficial bacteria would be less fit to deal
with phytopathogens and more susceptible to the stress conditions (Timmusk et al., 2011).
The type of endophytic diversity present in a plant can depend on several factors which are
discussed below.
1.4.1 Factors affecting endophytic bacterial diversity of a plant
Apart from bacterial competence to colonize plants as endophytes, the host plant and
environmental factors can strongly influence the endophytic diversity of a particular plant.
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 8
Host plant age, genotype, geographical location, and even the tissue being analyzed can
determine the types of endophytic bacteria it harbors (Hallmann and Berg, 2006). Moreover,
host plant growth stages can also determine the endophytic diversity of a plant, where plant
stages enriched in nutrient availability tend to have increased bacterial diversity (Shi et al.,
2014). Not only that, the climatic conditions can also influence the endophytic colonizers of a
plant species. Penuelas et al. (2012) observed that changes in climate significantly altered the
abundance and composition of endophytic bacteria within the leaf tissues.
Another important factor affecting the observable endophytic diversity of a plant is the
method used to study these bacteria. The spectrum of bacteria recovered from a plant can
depend on the nature, concentration and even length of treatment time for a sterilizing agent
used to recover bacteria (Hallmann and Berg, 2006, Hallman et al., 2006).
The type of endophytic community of a plant is strongly influenced by nature of the plant
host species (Ding and Melcher, 2016). Different plant species growing in the same soil can
have distinctly different endophytic diversity. Germida et al. (1998) reported that canola and
wheat plants grown in the same field had very different spectrum of bacterial species as
endophytes. This observation was supported by Ding et al. (2013) who identified the host
species being the most important determinant in selecting its endophytic community,
followed by sampling dates and sampling locations. In fact, different cultivars of a plant
species grown in the same soil can also differ in their endophytic diversity, as reported by
Granér et al. (2003) for four different cultivars of Brassica napus having different endophytic
bacterial inhabitants. Thus the host plant species strongly governs the type of endophytic
bacteria colonizing it.
More interestingly, the type of soil used to grow a plant can also determine its endophytic
community. Thus, the same plant cultivar growing in different agricultural soils can have
very different endophytic bacteria. This was observed by Song et al. (1999) who reported
significantly different endophytic bacterial diversity for peanut cultivar grown in different
fields. Moreover, Rashid et al. (2012) isolated different types of endophytic bacteria by
growing one cultivar of tomato in 15 different agricultural soils. Collectively, these findings
indicate that occurrence of different endophytes is due to the diverse nature of soil samples.
The difference in endophytic community can also result by the preference imposed by the
plant host in response to soil and stress conditions. Siciliano et al. (2001) reported that plants,
while growing in the petroleum hydrocarbon contaminated soil, recruited those endophytic
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 9
bacteria which had the necessary contaminant-degrading genes. Moreover, the genes
encoding for nitro-aromatic compound degradation were more prevalent in endophytic strains
selected by the plants than within rhizospheric or soil microbial communities. Similarly,
Granér et al. (2003) reported that wilt resistant cultivar of oilseed rape contained a higher
proportion of endophytic bacteria antagonistic to the wilt causing Verticillium longisporum
than the susceptible cultivar. Presence of phytopathogens in plants has been considered an
important factor in the restructuring of endophytic bacterial communities. This was noticed
by Bogas et al. (2015) for their work on the restructured endophytic communities of
asymptomatic and symptomatic Paullinia cupana plants challenged by Colletotrichum spp.
Hence, the selection of endophytic bacterial communities is a dynamic process that is tightly
controlled by host plant (Berg and Hallmann, 2006; Trivedi et al., 2010).
1.4.2 Methods for studying endophytic diversity bacteria
Endophytic bacterial communities are conventionally studied using culturing based methods
(Ding et al., 2013). However, to investigate the endophytic bacterial communities using these
methods, the bacteria must be cultivable under laboratory conditions. Cultivation procedure
relies on the isolation of endophytic bacteria from plant tissue. The isolation procedure
should be sensitive enough to recover most of the cultivable endophytic bacteria, but should
be strong enough to eliminate epiphytes and other contaminating bacteria from the plant
tissues being processed. Commonly, isolation protocol requires surface sterilization of plant
tissues followed by their maceration, serial dilution and plating on the bacterial growth
medium (Barac et al., 2004). Sterilizing agents like sodium hypochlorite, ethanol and
hydrogen peroxide are commonly used to achieve the surface sterilization, and usually these
chemicals are used in a series to improve the effectiveness of the sterilization procedure
(Schulz et al., 1993; Romero et al., 2001; Lodewyckx et al., 2002). The sterilized tissue is
washed with sterile distilled water several times to remove the residual chemicals. The
sterilization is confirmed by plating small amount of distilled water from the last wash on the
culture media, where absence of bacteria confirms the effectiveness of sterilization
procedure. Moreover, surface sterilization producing high numbers of endophytic bacterial
growth on agar media indicates minimum damage to the endophytic population by the
sterilization procedure (Eevers et al., 2015). This is desired as any damage to the endophytic
community by the sterilizing agent can comprise the authenticity of a bacterial diversity
analysis. These cultivable bacteria are then identified using morphological, physiological,
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 10
biochemical and molecular approaches, where molecular approaches being the most accurate
of all (Ma et al., 2016). A number of molecular markers have been identified that permit the
identification of specific microbial taxa and their phylogenetic classification. Among these
molecular markers, 16S rRNA is most commonly employed to identify bacteria and
determine their phylogenetic relatedness (Srinivasan et al., 2015).
Total populations estimates of endophytic bacteria in plants may vary. These estimates can
depend on the type of growth media used for isolation, growth conditions of the host plant,
and method used to sterilize plant tissue (Romero et al., 2001; Lodewyckx et al., 2002;
Hallmann et al, 2006; Eevers et al., 2015). For example, a successful surface sterilization can
result in the penetration of these sterilizing chemicals in to the interior tissues, sometimes
killing the endophytic colonizers and compromising the correct bacterial estimates
(Lodewyckx et al., 2002; Hallmann et al., 2006). Similarly, selection of growth medium also
affects the numbers and diversity of endophytes that can be isolated from a specific plant
tissue, as no medium can meet the nutritional and growth requirements of all the bacteria
(Reiter et al., 2002; Eevers et al., 2015). Growth media are not always the reason for the
inability to culture bacteria as some bacteria can enter viable but nonculturable (VNC) state
and are unable to divide (Sessitsch et al., 2002). Moreover, even when endophytic bacteria
have been successfully isolated, maintaining them on growth media can sometimes prove to
be difficult (Trivedi et al., 2011; Eevers et al., 2015). Nevertheless, it is recommended that
endophytic bacteria are isolated using more than one type of growth media, and
supplementing these media with plant extracts can increase the overall diversity of bacteria
isolates (Hallmann et al., 2006; Eevers et al., 2015). However, cultivation-dependent methods
can strongly underestimate the number of bacteria present in plant tissues (Bogas et al.,
2015), as cultivable bacteria usually represents only 0.001% to 1% of the actual endophyte
counts (Torsvik and Øvreås, 2002; Alain and Querellou, 2009). Thus, the culture-based
methods have been surpassed by culture-independent methods, which tend to be less biased
in analyzing the true endophytic diversity.
Culture-independent methods to study endophytic diversity mostly rely on the total bacterial
genomic DNA extraction from plant tissues. The plant tissue is first processed to remove the
surface bacteria. This is usually achieved using aseptic peeling technique to remove the
surface layers, or by vigorously shaking the plant tissues with acid-washed glass beads in
saline solutions to dislodge the surface bacteria, followed by washes with sterile distilled
water. The processed plants tissues are then homogenized to extract the bacteria genomic
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 11
DNA (Sessitsch et al., 2002). The genomic DNA can then be analyzed using a range of
molecular fingerprinting techniques. Mostly commonly, the genomic DNA is used to amplify
a marker gene, usually the 16S rRNA gene, to analyze the bacterial diversity (Garbeva et al.,
2001). The variety of amplified gene fragments, representing the entire endophytic
population of a plant, are then analyzed using community DNA fingerprinting techniques like
Amplified rDNA Restriction Analysis (ARDRA), Denaturing Gradient Gel Electrophoresis
(DGGE), Temperature Gradient Gel Electrophoresis (TGGE), and Terminal Restriction
Fragment Length Polymorphism (T-RFLP) (Hallmann et al., 2006; Ma et al., 2016).
Alternatively, the highly variable region between 16S and 23S rDNA can be analyzed using
(Automated) Ribosomal Intergenic Spacer Analysis (ARISA) for the community
fingerprinting (Saito et al., 2007). However, to be detected by these fingerprinting techniques,
an endophytic population must represent about 1% of the total community (Smalla 2004).
Moreover, chances of detecting novel bacteria using these methods are low, as databases of
fingerprinting methods are largely incomplete (Ding et al., 2013).
The DNA fingerprinting techniques have largely been superseded by more advance
molecular techniques like metagenomics to study the microbial diversity. Metagenomics
involves DNA extraction from the entire bacterial population for analysis of its gene content
using next generation sequencing (Allan, 2014). The sequencing could be done for the entire
DNA, which is then assembled and annotated, or it could be done for one particular gene or
phylogenetic marker, like 16S rRNA. Thus, the metagenomics approaches allow full depth of
endophytic diversity analysis in comparison to traditional fingerprinting. Using
metagenomics approach, Sessitsch et al. (2012) uncovered the hidden community of rice
endorhizosphere, and deciphered many traits shared by the endophytic inhabitants that might
be crucial in their endophytic competence and success of the endophytes. However, the
DNA-based community analysis cannot selectively analyze the viable or metabolically active
bacterial cells. For this, RNA-based approaches are utilized, which can specifically determine
the metabolically active population, as the amount of RNA can be correlated to the growth
activity of the endophytic bacteria. Sharma et al. (2004) compared the rhizosphere bacterial
communities of three related legume plants and observed that metabolic profiles of the three
bacterial communities were more dissimilar (45-50% similarity) as compared to DNA-based
profiling (70-90% similarity). Similarly, comparative mRNA-based and DNA-based analyses
of root-associated communities in rice plants revealed that only a fraction of nitrogen fixing
bacteria actively performed the activity (Knauth et al., 2005; Diallo et al., 2008).
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 12
Endophytic bacterial populations can also be studied directly in their natural settings.
Techniques like fluorescence in situ hybridization (FISH) have allowed studying the
endophytic bacteria in the natural habitat (Piccolo et al., 2010). Moreover, by combing FISH
with other DNA fingerprinting techniques, the dominant population of the endophytic
community of a plant can also be identified (Sun et al., 2008). Such a polyphasic approach
that combines different methods is indeed recommended when analyzing endophytic bacterial
communities. In fact, combinatorial approaches, combining both culture-dependent and
culture-independent methods, can increase the likelihood of completely analyzing the
structure and function of endophytic bacterial community of a plant (Sessitsch et al., 2004;
Hallmann et al., 2006).
1.4.3 Endophytic bacteria diversity of different Plants
Endophytic bacterial diversity has been reported for a number of plant species. In general,
Proteobacteria is the most predominant phylum frequently isolated from plants, including the
classes α-, β-, and γ-proteobacteria, where γ-proteobacteria is the most diverse and dominant.
(Miliute et al., 2015; Santoyo et al., 2016). Members of the Actinobacteria, Bacteroidetes,
and Firmicutes are also among the classes most commonly found as endophytes (Reinhold-
Hurek and Hurek, 2011). Other classes such as Acidobacteria, Planctomycetes and
Verrucomicrobia are less commonly found as endophytes (Santoyo et al., 2016). However,
predominance of these phyla can vary with the type of host plant species (Bodenhausen et al.,
2013; Ding and Melcher, 2016). Among the most commonly isolated bacterial genera are
Bacillus, Burkholderia, Microbacterium, Micrococcus, Pantoea, Pseudomonas and
Stenotrophomonas, where Bacillus and Pseudomonas are the predominant genera (Hallmann
et al., 2006; Chaturvedi et al., 2016). A list of endophytic bacteria isolated from some
agronomic crop plants and some wild plants is provided in Table 1.1 and 1.2.
1.5 Mechanisms of Host Plant growth promotion
Endophytic bacteria have been shown to impart several beneficial effects on their plant host
directly or indirectly. They can benefit plants directly by assisting plants in getting nutrients,
and improve plant growth by modulating growth related hormones, which can help plants
grow better under normal and stressed conditions (Ma et al., 2016). Indirectly, endophytic
bacteria improve plant growth by discouraging phytopathogens using mechanisms like
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 13
antibiotic and lytic enzyme production, nutrient unavailability for the pathogens, and priming
plant defense mechanisms and thereby protecting the plants from future attacks by pathogens
(Miliute et al., 2015). These beneficial processes are discussed below.
Table 1.1 Some common Endophytic bacterial genera isolated from agronomic plants reported in
literature (Hallmann et al., 2006; Rosenblueth and Martínez-Romero, 2006; Miliute et al., 2015)
Plant Endophytic bacteria genera
Alfalfa Bacillus, Erwinia, Microbacterium, Pseudomonas, Salmonella
Banana Azospirillum, Burkholderia, Citrobacter, Herbaspirillum, Klebsiella
Black pepper
Arthrobacter, Bacillus, Curtobacterium, Micrococcus, Pseudomonas, Serratia
Canola Acidovorax, Agrobacterium, Aureobacterium, Bacillus, Chryseobacterium,
Cytophaga, Flavobacterium, Micrococcus, Pseudomonas, Rathayibacter,
Carrot Agrobacterium, Bacillus, Klebsiella, Pseudomonas, Rhizobium, Salmonella,
Staphylococcus
Clover Agrobacterium, Bacillus, Methylobacterium, Pseudomonas, Rhizobium
Cotton
Bacillus, Burkholderia, Clavibacter, Erwinia, Phyllobacterium, Pseudomonas
Cucumber
Agrobacterium, Bacillus, Burkholderia, Chryseobacterium, Clavibacter,
Curtobacterium, Enterobacter, Micrococcus, Paenibacillus, Phyllobacterium,
Pseudomonas, Serratia, Stenotrophomonas
Grapevine Comamonas, Enterobacter, Klebsiella, MoraxellaPantoea, Pseudomonas,
Rahnella, Rhodococcus, Staphylococcus, Xanthomonas
Maize
Achromobacter, Agrobacterium, Arthrobacter, Bacillus, Burkholderia,
Corynebacterium, Curtobacterium, Enterobacter, Erwinia, Herbaspirillum,
MicrobacteriumMicrococcus, Paenibacillus, Phyllobacterium, Pseudomonas,
Rhizobium, Serratia
Pineapple Azospirillum, Burkholderia
Potato
Acidovorax, Acinetobacter, Actinomyces, Agrobacterium, Alcaligenes,
Arthrobacter, Bacillus, Capnocytophaga, Chryseobacterium, Comamonas,
Corynebacterium, Curtobacterium, Enterobacter, Erwinia, Klebsiella,
Leuconostoc, Methylobacterium, Micrococcus, Paenibacillus, Pantoea,
Pseudomonas, Psychrobacter, Serratia, Shewanella, Sphinogomonas,
Stenotrophomonas, Streptomyces, Vibrio, Xanthomonas
Radish Proteobacteria, Salmonella
Red clover
Acidovorax, Agrobacterium, Arthobacter, Bacillus, Bordetella, Cellulomonas,
Comamonas, Curtobacterium, Escherichia, Klebsiella,
Methylobacterium, Micrococcus, Pantoea, Pasteurella, Phyllobacterium,
Pseudomonas, Psychrobacter, Rhizobium, Serratia, Sphingomonas, Variovorax,
Xanthomonas
Rice (wild and
cultivated)
Agrobacterium, Azoarcus, Azorhizobium, Azospirillum, Bacillus,
Bradyrhizobium, Burkholderia, Chromobacterium, Enterobacter,
Herbaspirillum, Ideonella, Klebsiella, Micrococcus, Pantoea, Pseudomonas,
Rhizobium, Serratia, Stenotrophomonas
Soybean Erwinia, Agrobacterium, Pseudomonas, Klebsiella, Enterobacter, Pantoea,
Bacillus
Sugar cane Acetobacter, Gluconacetobacter, Herbaspirillum, Klebsiella
Tomato Brevibacillus, Escherichia, Pseudomonas, Salmonella
Wheat Bacillus, Burkholderia, Flavobacterium, Klebsiella, Microbispora, Micrococcus,
Micromonospora, Mycobacterium, Nacardiodes, Rathayibacter, Streptomyces
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 14
Table 1.2 Diversity of endophytic bacterial isolated from some wild plants.
Plant Location Endophytic bacteria Reference
Alnus firma Mine tailing Bacillus sp. Shin et al., 2012
Alyssum
bertolonii Serpentine outcrop
Arthrobater
Bacillus
Curtobacterium
Leifsonia
Microbacterium
Paenibacillus
Pseudomonas
Staphylococcus
Barzanti et al., 2007
Calystegia soldanella Sand dunes
Acinetobacter
Arthrobacter
Chryseobacterium
Curtobacterium
Enterobacter
Microbacterium
Pantoea
Pedobacter
Pseudomonas
Stenotrophomonas
Park et al., 2005
Commelina
communis Mine wasteland
Arthrobacter
Arthrobacter
Bacillus
Bacillus pumilus
Herbaspirillum
Microbacterium
Sphingomonas
Sun et al., 2010
Cressa cretica,
Salicornia brachiate,
Suadea nudiflora,
Sphaeranthus indicus
Coastlines
Acinetobacter
Arthrobacter
Bacillus
Kocuria
Oceanobacillus
Paenibacillus
Pseudomononas
Virgibacilus
Arora et al., 2014
Elsholtzia
Splendens Mine wasteland
Acinetobacter calcoaceticus
Acinetobacter junii
Bacillus
Bacillus firmus
Bacillus megaterium
Burkholderia
Exiguobacterium aurantiacum
Micrococcus luteus
Moraxella
Paracoccus
Serratia marcescens
Sun et al., 2010
Elymus mollis Sand dunes
Acinetobacter
Arthrobacter
Chryseobacterium
Enterobacter
Exiguobacterium
Flavobacterium
Klebsiella
Pedobacter
Pseudomonas
Stenotrophomonas
Park et al., 2005
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 15
Table 1.2 continued
Plant Location Endophytic bacteria Reference
Halimione portulacoides
Salt marsh
Altererythrobacter
Hoeflea
Labrenzia
Marinilactibacillus
Microbacterium
Salinicola
Vibrio
Fidalgo et al., 2016
Mammillaria fraileana
(cactus) Wild rocky habitat
Azotobacter vinelandii
Bacillus megaterium
Enterobacter sakazakii
Pseudomonas putida
Lopez et al., 2011
Miscanthus sinensis Mine wasteland Pseudomonas koreensis Babu et al., 2015
Noccaea caerulescens Metal contaminated
site
Agreia
Arthrobater
Bacillus
Kocuria
Microbacterium
Sthenotrophomonas
Variovorax
Visioli et al., 2014
Pachycereus pringlei
(cardon cactus) Volcanic areas
Acinetobacter
Bacillus
Citrobacter
Klebsiella
Paenibacillus
Pseudomonas
Staphylococcus
Puente et al., 2009a
Pinus contorta (Lodgepole pine)
Sub-boreal Pine
Spruce
Bacillus
Brevibacillus
Brevundimonas
Cellulomonas
Kocuria
Paenibacillus
Pseudomonas
Bal et al., 2012
Pinus sylvestris Mine wasteland Bacillus thuringiensis Babu et al., 2013
Polygonum pubescens Heavy metal
contaminated soil Rahnella sp. JN6 He et al., 2013
Prosopis strombulifera Saline environment
Achromobacter xylosoxidans
Bacillus licheniformis
Bacillus pumilus
Bacillus subtilis
Brevibacterium halotolerans
Lysinibacillus fusiformis
Pseudomonas putida
Sgroy et al., 2009
Salix caprea Heavy metal
contaminated soil
Bacillus
Frigoribacterium
Frondihabitans
Kocuria
Leifsonia
Massilia
Methylobacterium
Microbacterium
Ochrobactrum
Pedobacter
Plantibacter
Rhodococcus
Sphingomonas
Spirosoma
Subtercola
Kuffner et al., 2010
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 16
Table 1.2 continued
Plant Location Endophytic bacteria Reference
Sedum alfredii Hance Mining area
Burkholderia
Sphingomonas
Variovorax
Zhang et al., 2013
Thuja plicata (Red cedar)
Sub-boreal Pine
Spruce
Arthrobacter
Bacillus
Paenibacillus
Pseudomonas
Streptoverticillium
Bal et al., 2012
Wild Prairie Plants Prairie
Cellulomonas
Clavibacter
Curtobacterium
Microbacterium
Zinniel et al., 2002
1.5.1 Nutrient acquisition
Soils usually lack a sufficient quantity of one or more of the nutrient compounds necessary
for plant growth. The endophytic bacteria can help their host plants is by getting increased
amounts of the limiting plants nutrients, which include nitrogen, iron, and phosphorus (Glick,
2012). These mechanisms are discussed below and also summarized in Figure 1.2.
1.5.1.1 Nitrogen availability
Endophytic bacteria can increase the Nitrogen availability for their host plants. These bacteria
can supply fixed atmospheric nitrogen to their host plants by expressing nitrogenase activity
(Montañez et al., 2012). Nitrogenase is a highly conserved protein and all N2 fixing bacteria
have this enzyme, with ample evidence suggesting lateral gene transfer (Ivleva et al., 2016).
Nitrogen fixing bacteria like Azoarcus sp. BH72, Azospirillum brasilense, Burkholderia spp.,
Gluconacetobacter diazotrophicus, and Herbaspirillum seropedicae have been reported to
increase the host plant biomass by N2 fixation under controlled conditions (Bhattacharjee et
al. 2008). Associative nitrogen-fixing endophytes perform better than rhizosphere
microorganisms in enabling plants to thrive in nitrogen limited soil environments and
promote plant health and growth (Hurek and Reinhold-Hurek, 2003). Gupta et al. (2013)
reported that endophytic nitrogen-fixing bacteria may also enhance the rate of nitrogen
fixation and accumulation in plants residing in nitrogen limited soils. Endophytic bacteria are
not as efficient as root nodule associated Rhizobium in Nitrogen-fixation ability. However,
endophytic strains of Gluconacetobacter diazotrophicus perform exceptionally well in this
ability. Strains of Gluconacetobacter diazotrophicus have been identified living in symbiosis
with sugarcane and pine plants (Dong et al., 1994; Carrell and Frank, 2014). Similarly,
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 17
Nitrogen-fixing endophyte Paenibacillus strain P22 has been found in poplar tree, which was
shown to contribute to the total nitrogen pool of the host plant (Scherling et al., 2009).
1.5.1.2 Phosphorus availability
Phosphorous is another major micronutrients crucial for enzymatic reactions responsible for
many plant physiological processes (Ahemad, 2015). Although present in ample quantities,
most of the soil phosphorus is insoluble, and therefore cannot support the plant growth due to
its unavailability. Moreover, almost 75% of phosphorus applied as fertilizer forms complexes
with soil and becomes unavailable for plants (Ezawa et al., 2002). Endophytic bacteria can
increase the availability of phosphorus for plants by solubilizing precipitated phosphates,
using mechanisms like acidification, chelation, ion exchange and production of organic acid
(Nautiyal et al., 2000). They can also increase phosphorus availability in the soil by secreting
acid phosphatase that can mineralize organic phosphorus (van der Hiejden et al., 2008).
Moreover, endophytic bacteria can prevent phosphate adsorption and fixation under
phosphate-limiting conditions by assimilating solubilized phosphorus (Khan and Joergensen,
2009). Thus, these bacteria can act as a sink to provide phosphorus to the plants when they
need it. Phosphate solubilization feature is commonly found in endophytic bacteria. For
instance, around 59-100% of endophytic populations from cactus, strawberry, sunflower,
soybean and other legumes were mineral phosphates solubilizers (Kuklinsky-Sobral et al.
2004; Forchetti et al. 2007; Dias et al. 2009; Palaniappan et al. 2010; Puente et al. 2009a).
Puente et al. (2009b) examined the role of phosphate solubilizing endophytic bacteria by
growing bacteria-free cacti on mineral phosphate supplemented with either endophytes or
nutrients, and compared them with plants grown under sterile conditions. The inoculated
plants grew well without nutrient addition, and their growth was comparable to fertilized
plants, whereas the bacteria-free cacti failed to grow. This indicated that endophytic bacteria
provided the developing plantlets with limiting nutrient.
1.5.1.3 Iron availability
Iron is important element of life required by most organisms. Iron is part of many iron-
containing proteins controlling important physiological processes like transpiration and
respiration (Ma et al., 2016). Iron usually occurs in the insoluble ferric (Fe3) that is
unavailable to most plants, which includes carbonates, hydroxides, oxides and phosphates of
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 18
iron. Endophytic bacteria produce iron chelating agents called siderophores that can bind
insoluble ferric ions, and plants can acquire iron from these bound siderophores via root
based chelate degradation or ligand exchange (Rajkumar et al., 2009; Ma et al., 2016). Hence,
bacterial siderophores play a major role in providing iron to plants under iron limitation (Ma
et al., 2011). Marques et al. (2010) demonstrated that siderophore production by plant
beneficial bacteria strongly correlated with maize plant growth traits including shoot and root
biomass. Furthermore, Radzki et al. (2013) recently demonstrated that bacterial siderophores
efficiently provided iron to tomato plants during growth in hydroponic culture. Iron
acquisition is not the only benefit provided to the plants by siderophore producing bacteria.
Endophytic bacteria can also discourage the growth of phytopathogens by siderophore
production, possibly by iron depletion (Ahmad et al., 2008). In fact, Calvente et al. (2001)
demonstrated that the bacterial siderophore containing spent media inhibited the growth of
phytopathogenic molds, and antifungal activity was correlated to siderophore concentration.
1.5.2 Phytohormone production and modulation
Endophytic bacteria can enhance nutrients accumulation and metabolism of host plants by
producing growth regulating phytohormones. Recent studies examining the possible role of
plant hormones released by endophytic bacteria have shown that the endophytic colonization
caused enhanced plant nutrient uptake and biomass (Gravel et al., 2007; Shi et al., 2009;
Phetcharat and Duangpaeng, 2012). In general, there are five types of plant hormones,
namely abscisic acid, cytokinins, ethylene, gibberellins and indole-3-acetic acid (IAA), where
IAA and ethylene are the most important homones in plant-bacterial interactions.
1.5.2.1 Moderating plant Indole Acetic Acid levels
IAA is a major plant auxin that is involved in numerous plant physiological processes. These
processes include cell-cell signaling, regulation of plant development, and induction of plant
defense system (Navarro et al., 2006; Gravel et al., 2007; Spaepen et al., 2007). IAA can also
initiate lateral and adventitious root formation, mediates responses to stimuli, affects
photosynthesis and biosynthesis of metabolites, and mediate resistance to stress conditions
(Glick, 2012). Further, IAA can even control synthesis of other plant hormones like ethylene
(Woodward and Bartel, 2005).
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 19
Modulating plant IAA pools is an important trait by which endophytic bacteria can enhance
plant growth. IAA production by the endophytic bacteria can result in improved plant root
biomass and surface area, and increased production of lateral roots in host plants (Kuklinsky-
Sobral et al., 2004; Tsavkelova et al., 2007; Taghavi et al. 2009; Dias et al., 2009).
Tsavkelova et al. (2007) reported that endophytic bacteria that were isolated from terrestrial
orchids produced IAA. They noticed that the culture supernatant of the bacteria stimulated
root formation of kidney beans by significantly increasing root length and the number of
developing roots, indicating possible role of bacterial IAA in the development plant root
system. A more direct evidence of the role of bacterial IAA in plant beneficial effects came
from Patten and Glick (2002), who showed that Pseudomonas putida GR12-2 defective in
IAA synthesis was unable to increase plant root growth and lateral root formation.
While lower amounts of IAA production by bacteria can enhance plant root growth, higher
quantities can cause stunting of root growth (Malik and Sindhu, 2011). In a continuation
work to Patten and Glick (2002) to study the effects of IAA levels on plant growth,
Pseudomonas putida GR12-2 mutant, that was modified to overproduce IAA, produced much
shorter roots in mung bean compared to uninoculated control plants. This is not surprising as
high IAA production is known to be the characteristic of plant pathogens (Rashid et al.,
2012), and can cause increased production of ethylene, which is a plant stress hormone
(Woodward and Bartel, 2005).
IAA production is not the only way by which endophytic bacteria can improve host plant
growth. Indeed, the reverse activity, degradation of IAA, can also play a significant role in
enhancing plant growth. This was demonstrated by Leveau and Lindow (2005) for the plant
growth prompting and IAA degrading Pseudomonas putida Strain 1290, which completely
abolished the inhibitory effects of exogenous IAA on the elongation of radish roots. The
bacteria also produced IAA in the presence of tryptophan, which is a precursor of IAA.
However, it was shown that IAA production by Pseudomonas putida Strain 1290 did not
have the similar deleterious effects on radish roots as did the high IAA-producing strains.
Thus, the authors suggested that this dual status, the ability to both produce and destroy IAA,
enables this bacteria to finely control IAA levels to produce a net positive effect on host
plant. Similarly, Zúñiga et al. (2013) showed that mutant Burkholderia phytofirmans PsJN,
which was defective in IAA mineralization, was unable to alleviate the inhibitory effects of
exogenous IAA in the roots of Arabidopsis thaliana compared to wild type strain.
Nevertheless, Bacterial IAA production is considered a very important trait in selecting plant
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 20
beneficial bacteria. Moreover, plant IAA levels can also determine whether bacterial IAA
stimulates or suppresses plant growth, where bacterial IAA production benefiting those plants
with low levels of endogenous IAA (Glick, 2012).
1.5.2.2 Control of ethylene levels
Ethylene is an important plant hormone that controls the plant response to abiotic and biotic
stresses. It can control different developmental and physiological processes like root
initiation, leaf senescence, root nodulation, abscission, cell elongation, fruit ripening and
auxin transport (Sun et al., 2006). Biotic and abiotic stress results in an increased ethylene
production in plants that leads to inhibition of root elongation, development of lateral roots
and formation of root hair. Endophytic bacteria produce an enzyme called 1-
aminocyclopropane-1-carboxylate (ACC) deaminase that can hydrolyze ACC, which is a
precursor of plant hormone ethylene. ACC degrading bacteria can bind to plant roots and
cleave the exuded ACC into a-ketobutyrate and ammonia to use it as a nitrogen source (Sun
et al., 2009). Thus, hydrolysis of ACC can alleviate plant stress, thereby improving plant
growth under stress conditions (Santoyo et al. 2016). A number of plant growth promoting
endophytic bacteria have been reported to have ACC deaminase activity (Zhang et al., 2011;
Nikolic et al., 2011; Rashid et al., 2012). In fact, ability of these bacteria to benefit plant
growth can be related to ACC deaminase production. This was demonstrated by Sun et al.
(2009) who mutated the ACC deaminase gene of the canola growth promoting Burkholderia
phytofirmans PsJN and observed that the mutant was no longer able to promote canola root
growth. However, introduction of the wild-type ACC deaminase gene restored the growth
promoting ability of mutant Burkholderia phytofirmans PsJN, indicating the crucial role this
enzyme plays in growth promotion of host plants.
1.5.2.3 Production of Plant Cytokinins and Gibberellins
Several studies have shown that many plant beneficial endohytic bacteria can produce
cytokinins gibberellins. Cohen et al. (2009) revealed the effects of Azospirillum lipoferum in
maize plants treated with inhibitor of Gibberellins synthesis and subjected to drought stress or
well watered. The gibberellin produced by the endophytic bacterium was important in plant
stress alleviation. Similarly, Bhore et al. (2010) identified cytokinin-like compounds in the
broth-extracts of two endophytic bacteria, isolated from Gynura procumbens, using cucumber
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 21
cotyledon greening bioassay. The two bacteria were identified as Psuedomonas resinovorans
and Paenibacillus polymaxa. More work is needed to elucidate the role of bacterial
gibberellins and cytokinins in improving plant growth.
1.5.2.4 Indirect growth promotion by suppression of phytopathogens
Endophytic bacteria enhance the host plant growth indirectly by discouraging the growth of
phytopathogens and plant pests. They can produce substances that reduce phytopathogen
caused diseases like antibiotics, toxins, siderophores, hydrolytic enzymes and antimicrobial
volatile organic compounds (Sheoran et al., 2015). Both bacterial and fungal pathogens can
be targeted by endophytic bacteria (Lodewyckx et al. 2002). Bacteria belonging to
Actinobacteria, Bacillus, Enterobacteor, Paenibacillus, Pseudomonas and Serratia are the
most commonly reported genera for their antimicrobial activity against phytopathogens
(Lodewyckx et al. 2002; Aktuganov et al., 2008; Liu et al., 2010). Endophytic bacteria have
been demonstrated to successfully suppress fungal disease in plants like black pepper, potato
and wheat (Coombs et al. 2004; Sessitsch et al. 2004; Aravind et al. 2009). These
antimicrobial activities against fungi can be result from production of fungal cell-wall
targeting enzymes chitinase, proteases and glucanases (Zarei et al., 2011; Zhang et al., 2012).
Antimicrobial activity against bacterial pathogens has been reported for Bacillus subtilis
BSn5 that targeted plant pathogen Erwinia carotovora subsp. carotovora. However, the exact
mechanism of action against the pathogen is not known (Dong et al., 2001; Deng et al.,
2011). Moreover, an endophytic bacteria Pantoea vagans C9-1 has been commercialized as a
bacterial biocontrol agent for fire blight (Smits et al., 2011). Activity against nematodes was
reported by Aravind et al., 2010 for suppression of phytopathogenic burrowing nematode
(Radopholus similis Thorne) by endophytic bacteria Bacillus megaterium BP 17 and
Curtobacterium luteum TC 10. Endophytic bacteria active against plant pest have also been
demonstrated, where genetically modified endophytic Pseudomonas fluorescens expressing
Bacillus thuringiensis toxin and Serratia marcescens chitinase effectively targeted Eldana
saccharina (Sugarcane Borer) larvae (Downing et al., 2000).
Plant beneficial bacteria can use a mechanism called induced systemic resistance (ISR) to
protect their host plants from phytopathogens. ISR induced by endophytic bacteria can
protect host against various different fungal, bacterial and viral pathogens (Alvin et al.,
2014). The ISR primes plant defense mechanisms, thereby protecting unexposed plant parts
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 22
against future pathogenic attacks against microbes and herbivorous insects. Endophytic
bacteria can initiate ISR using salicylic acid (SA), or jasmonic acid (JA) and ethylene (ET)
mediated type pathways, which are usually a network of interconnected signaling pathways
involved in ISR induction (Pieterse et al., 2012). Endophytic bacteria of genus Bacillus,
Pseudomonas and Serratia have been shown to protect plant hosts using defense priming by
ISR (Kloepper and Ryu, 2006; Pieterse et al., 2014). The bacteria must also be able to
overcome these host defense responses in order to colonize the host plant (Ma et al., 2016).
Figure 1.2 Mechanisms used by endophytic bacteria for plant colonization and growth promotion
(Pink, establishment in host; blue, plant growth promotion; black, rhizosphere competence and
attachment). Processes labeled with star are experimentally (mostly mutational) verified while others
are suspected, inferred from literature or genome comparisons. (Reinhold-Hurek and Hurek, 2011)
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 23
ISR may involve both the SA and JA/ET pathways. Niu et al. (2011) showed that Bacillus
cereus AR156 triggered both the SA and JA/ET signaling pathways in Arabidopsis to induce
ISR, which led to an additive effect of plant protection. Similarly, Conn et al. (2008)
indicated that A. thaliana plants inoculated with endophytic Actinobacteria showed
upregulation of both defense pathways, thereby protecting against subsequent infection by
phytopathogenic bacteria Erwinia carotovora and fungus Fusarium oxysporum. However, the
primed defense pathways differed for the two pathogen types. The resistance to Erwinia
carotovora was by JA/ET pathway, while resistance towards Fusarium oxysporum was by
SA pathway. Thus, the same bacteria were able to prime two different pathways to confer
resistance to different pathogen (Conn et al., 2008).
1.6 Bacterial genes expressed in the endophere
Endophytic bacteria colonize the plant endosphere and confer growth benefits to their host by
using a wide variety of traits. Some of these traits have been confirmed using techniques like
gene deletion / disruption and complementation (Sun et al., 2009; Zúñiga et al., 2013), real-
time PCR (Yousaf et al., 2011; Zhao et al., 2016), in-vivo expression technology (IVET)
(Rediers et al., 2003), gusA fusion reporter system (Roncato-Maccari et al., 2003), gene
overexpression (Fan et al., 2013), gene introduction (Cho et al., 2007), and RNA-seq based
whole transcriptome profiling (Sheibani-Tezerji et al., 2015).
Most of these studies have been done on Burkholderia phytofirmans strain PsJN, a model
endophytic bacterium, with the ability to competently colonize (both rhizosphere and
endosphere) and promote growth of a variety of different plant hosts, including Arabidopsis
thaliana, grape, maize, potato, switch-grass, tomato, and wheat (Sessitsch et al., 2005;
Sheibani-Tezerji et al., 2015). Moreover, strain PsJN can also increase tolerance of host
plants to abiotic stress such as chilling and drought (Barka et al., 2006; Naveed et al., 2014),
and biotic stress like inhibiting growth of fungal phytopathogens (Sharma and Nowak, 1998;
Barka et al., 2002). Strain PsJN have been shown to require IAA degradation, ACC
deaminase, and quorum sensing to colonize host plants and produce beneficial effects (Sun et
al., 2009; Zúñiga et al., 2013). Moreover, in-planta gene expression profiling revealed that,
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 24
during its growth inside host plants, the bacterium expresses a number of different traits
related cellular homeostasis, cell redox homeostasis, energy production, general metabolism
(amino acids, lipids, nucleotides, sugars), and transcription regulation (Sheibani-Tezerji et al.,
2015). The same study revealed that bacterium expresses enzyme related to oxidative stress
when host plants are challenged with drought stress. Another study on strain PsJN indicated
that bacterium expresses traits involving iron uptake and storage (Zhao et al., 2016).
Nevertheless, more work is needed to elucidate the importance of different genes required by
strain PsJN for its endophytic success. Other bacteria have also been studied for their
endophytic gene expression and lifestyle, which have been summarized in Table 1.3.
1.7 Host specificity of growth promoting endophytic bacteria
The plant growth promoting ability of endophytic bacteria can be influenced by the genotype
of plant host. Long et al. (2008) noticed that plant growth promoting bacteria of Solanum
nigrum that were highly host specific, where these bacteria were unable to produce growth
enhancement in Nicotiana attenuate, a non-host plant. Similarly, Kim et al. (2012) reported
that growth promotion of switch grass by Burkholderia phytofirmans PsJN is plant genotype
dependent. However, many endophytic bacteria can have a broad host range, as has been
demonstrated in the case of Burkholderia phytofirmans PsJN, isolated from onion roots
(Pillay and Nowak, 1997), which can promote growth of Arabidopsis thaliana, grape, maize,
potato, switch-grass, tomato, and wheat (Sessitsch et al., 2005; Sheibani-Tezerji et al., 2015).
Bacterial genotype can also strongly influence the growth promoting effects of bacterial
endophytes on host plants. This was demonstrated by Trognitz et al. (2008), where different
strains of Burkholderia phytofirmans differed markedly in their growth promoting abilities of
same potato cultivar. Similarly, Dong et al. (2003) reported that four strains of endophytic
Salmonella enterica colonize alfalfa roots and hypocotyl differently. Hence, plant
colonization and growth promotion by the endophytic bacteria appears to be an active process
that is controlled by the genetic factors of both partners.
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 25
Table 1.3 Selected bacterial genes involved in endosphere colonization, host interaction and
promotion of plant growth.
Gene Function Technique Bacteria Reference
acds
(ACC deaminase) Stress reduction
Gene deletion,
complementation
; gene disruption
Burkholderia
phytofirmans
PsJN
Sun et al., 2009;
Zúñiga et al.,
2013
iacC IAA degradation Gene disruption
Burkholderia
phytofirmans
PsJN
Zúñiga et al.,
2013
N-acyl-
homoserine
lactone synthase
Quorum Sensing Gene disruption
Burkholderia
phytofirmans
PsJN
Zúñiga et al.,
2013
nifH
(nitrogenase) Nitrogen fixation
Pnif: :gusA fusion
reporter system;
RT-PCR
Herbaspirillum
seropedicae;
Bradyrhizobium,
Pelomonas,
Bacillus sp.,
Cyanobacteria
Roncato-Maccari
et al., 2003;
Terakado-
Tonooka et al.,
2008
eglA; eglS
(endoglucanse)
Systemic
colonization
Transposon
mutagenesis; gene
disruption by
homologous
recombination
Azoarcus sp.
strain BH72;
Bacillus
amyloliquefaciens
Reinhold-Hurek
et al., 2006; Fan
et al., 2016
Pectinase Systemic
colonization
Gene
overexpression Bacillus Fan et al., 2013
alkB
(alkane
monooxygenase)
Diesel
degradation Real-time PCR
Pseudomonas sp.,
Rhodococcus sp.
Andria et al.,
2009
carAB
Pathogen cell-cell
signaling
disruption
Gene disruption,
complementation
Pseudomonas sp.
strain G
Newman et al.,
2008
aiiA
(N-acyl-
homoserine
lactonase)
Pathogen quorum
sensing disruption
Gene introduction
by electroporation
Burkholderia sp.
KJ006 Cho et al., 2007
Multiple genes
Stress response,
chemotaxis,
metabolism, and
global
regulation
dapB-Based In
Vivo Expression
Technology
System
Pseudomonas
stutzeri A15
Rediers et al.,
2003
CYP153 genes
(alkane
degradation)
Petroleum
hydrocarbon
defradation
Real-time PCR
Enterobacter
ludwigii;
Pseudomonas
sp. strain ITRI53,
Pantoea sp. strain
BTRH7
Yousaf et al.,
2011; Afzal at al.,
2011
pilT
(type IV pili)
Endophytic
colonization by
Twitching
Motility
Deletion mutation Azoarcus sp.
Strain BH72 Böhm et al., 2007
O-antigenic
side chain Attachment
Spontaneous
phage-mediated
mutant
Pseudomonas
fiuorescens
strain WCS417r
Duijff et al., 1997
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 26
Table 1.3 continued
Gene Function Technique Bacteria Reference
Multiple genes
Transcription
regulation,
general
metabolism
(sugars, amino
acids,
lipids, and
nucleotides),
energy
production,
cellular
homeostasis, cell
redox
homeostasis, ECF
group IV sigma
factors
In-planta RNA-
seq based
transcriptome
profile
Burkholderia
phytofirmans
PsJN
Sheibani-Tezerji
et al., 2015
Ferritin Iron storage Real-time PCR
Burkholderia
phytofirmans
PsJN
Zhao et al., 2016
TonB-dependent
siderophore
receptor
Siderophore
mediated iron
uptake
Real-time PCR
Burkholderia
phytofirmans
PsJN
Zhao et al., 2016
L-ornithine5-
monooxygenase
Siderophore
synthesis Real-time PCR
Burkholderia
phytofirmans
PsJN
Zhao et al., 2016
There are numerous reports of non-host plant growth promotion by endophytic bacteria. Ma
et al. (2011) isolated Nickel resistant Pseudomonas sp. A3R3 from Nickel accumulating
Alyssum serpyllifolium. The bacteria promoted the growth of the host plant and the non-host
Brassica juncea under metal stress. Similarly, Sun et al. (2015) showed that Copper-resistant
Burkholderia sp. GL12 and Bacillus megaterium JL35 could significantly promote growth of
host Elsholtzia splendens and a non-host Brassica napus grown in heavy metal-contaminated
soils. Thomas and Upreti (2014) demonstrated that endophytic bacterial isolated from crops
plants that could inhibit Ralstonia solanacearum (wilt pathogen) also mitigated the disease
effects of Ralstonia solanacearum on a non-host tomato plant. Moreover, endophytic bacteria
isolated from different agricultural soils using tomato plants were able to promote canola
growth under gnotobiotic conditions (Rashid et al., 2012). Collectively, these finding suggest
that endophytic bacteria can have broad host range in terms of their plant growth promoting
potential, a feature that could be exploited in agriculture sector.
Chapter 1 Introduction & Literature Review
Agriculturally beneficial endophytic bacteria of wild plants 27
Aims and Objectives
The rationale of the proposed study is that wild plants that grow under challenging conditions
and exhibit unique survival abilities may harbor interesting endophytic bacteria. Those
exceptional survival capabilities of the plants may be due to their endophytic bacterial
inhabitants. As endophytic bacteria are known to have a broad host range, the unique survival
abilities they impart to their host may not be species specific. Hence the potential to isolate
useful agricultural beneficial endophytic bacteria from wild plants is immense, since this area
remains largely neglected. Furthermore, a comparison between the successful and
unsuccessful colonizers of a new host plant may reveal the bacterial traits needed to promote
growth of a wide variety of non-host plants. The expected outcome of the proposed research
work will be unearthing of new agriculturally beneficial bacteria as bio-inoculants for crop
plant, and an improved understanding of bacterial traits important for general plant beneficial
effects. The specific objectives are as follows.
1. To isolate and identify endophytic bacteria from wild perennial plants.
2. Investigate the in-vivo growth promotion potential of isolated bacteria on a crop plant.
3. Explore the bacterial mechanisms of plant invasion and growth promotion using in-vitro
assays (plant colonization, phytohormone production, and nutrient availability).
4. Investigate the biocontrol potential of bacterial isolates against phytopathogenic fungi.
5. Undertake in-planta gene expression profiling of a growth promoting endophytic bacteria
to identify genes of endophytic colonization and growth promotion.
Chapter 2
Selective isolation and characterization of agriculturally
beneficial endophytic bacteria from Wild Hemp using
Canola
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 28
Selective isolation and characterization of agriculturally beneficial endophytic bacteria
from Wild Hemp using Canola
Abstract
Endophytic bacteria can function as biofertilizers and biopesticdes to improve
plant growth thereby decreasing the use of dangerous chemical fertilizers and
pesticides. Wild perennial plants remain a neglected niche to isolate plant beneficial
endophytic bacteria for commercial application to crops. Present study isolated
endophytic bacteria from wild Cannabis sativa L. (hemp) using two different methods
to examine their ability to promote Canola growth. The first method involved
isolation of endophytic bacteria directly from the roots; while, the second novel
approach involved selective isolation of endophytic bacteria from C. sativa
rhizosphere using a second host plant, Canola. Selective isolation yielded six bacteria
that significantly promoted canola root growth while direct isolation produced only
two such bacteria. Most noticeable isolates with multiple plant benefical traits were
Pantoea vagans MOSEL-t13, Pseudomonas geniculata MOSEL-tnc1, and Serratia
marcescens MOSEL-w2. These bacteria endured NaCl stress upto 7% and benefited
canola growth under NaCl stress. Most of the isolated bacteria possed plant beneficial
traits like IAA production, mineral phosphate solubilization, and siderophore
production to improve iron uptake. Most isolates also produced cellulase and
pectinase that allow bacteria to target plant cell-wall and systemically colonize plants.
Some isolates also antogonized the growth of two plant fungal pathogens in dual
culture assay, and produced chitinase and protease, indicating their usefulness as
biocontrol agents. Paenibacillus sp. MOSEL-w13 was most prominent bacteria in
antifungal activity. These results conclude that wild perennial plants harbor distinct
plant benefical endophytic bacteria and demonstrates the usefulness of newly
proposed selectively isolation for the improved isolation of these bacteria.
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 29
2.1 Introduction
Endophytic bacteria are a group of plant associated bacteria known to improve growth
of their plant host. The bacteria achieve this by producing plant hormones, increasing nutrient
availability and mitigating biotic and abiotic stress (Glick, 2012). Unlike rhizobacteria, the
well-known bacteria establishing symbiotic relationships with many plants, endophytes thrive
within the internal tissues of plants and use specialized mechanisms to enter the host
(Compant et al., 2010). Primarily, they enter the host from the rhizosphere soil surrounding
the roots (Conn and Franco, 2004). This entry is also regulated by the plant host itself (Dong
et al., 2003). As a result, plants are known to harbor specific microflora as their mutualistic
symbionts. On the other hand, endophytic bacteria can have multiple hosts, being either host
specific or general endophytes (Hardoim et al., 2008).
Most of the work on endophytic bacteria has been focused on agricultural crops.
However, a large number of plants still remain unstudied for their endophytic diversity,
particularly the wild and perennial plants. Wild and perennial plants provide an interesting
niche to screen for the potential plant growth promoting bacteria. Unlike crop plants, wild
plants are constantly challenged by harsh and adverse conditions, including water and
nutrient scarcity, extreme weather and attacks by pests and pathogens. They ensure their
vitality using a range of mechanisms. This includes choosing the right endophytic partners
that help them withstand such difficulties (Rout et al., 2013). Therefore, identifying
potentially useful endophytic bacteria of wild plants, that can also improve growth of crop
plants, can be extremely beneficial for the agricultural sector.
Wild hemp (Cannabis sativa L.) is a good candidate for the evaluation of useful
endophytic bacteria. It is a common herbaceous plant in many parts of the world, known for
its medicinal use as well as a source of recreational drug. In Pakistan, it is a native plant that
grows wildly and perennially in most areas of Pakistan, occurring more abundantly in
northern Punjab (Ashraf et al., 2012). Although some work has been done on endophytic
bacteria of wild plants including C. sativa (Hung et al., 2007; Kusari et al., 2014; Zinniel et
al., 2002), there are only limited studies where these bacteria were tested for their usefulness
on commercial crops (Ma et al., 2011; Zhang et al., 2011).
Researchers have used different properties of bacteria to select plant growth
promoting bacteria. The most widely used method is to select bacteria with ACC deaminase,
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 30
an enzyme that breaks down the precursor of plant stress hormone thereby improving plant
growth (Sun et al., 2009). Using this approach, endophytic bacteria have been isolated, both
from wild plants and agricultural soils, promoting growth of a non-host canola plant (Rashid
et al., 2012; Zhang et al., 2011). However, the growth promoting ability of ACC deaminase
producing bacteria can be limited to the original host (Long et al., 2008). Moreover, some
non-ACC deaminase bacteria can also enhance plant growth similar to ACC deaminase
bacteria (Ma et al., 2011; Sheng et al., 2008).
Aims and objectives
The aim of present study was to isolate and characterize useful endophytic bacteria
from C. sativa with ability to promote canola growth. In addition to direct isolation from
surface sterilized host tissues (Beneduzi et al., 2013), endophytic bacteria were also
selectively isolated using a new approach. The isolated bacteria were tested for different traits
consistent with the plant growth promotion. Some growth promoting bacteria were also tested
for their ability to reduce the inhibitory effects of salt stress on plant growth.
2.2 Materials and Methods
The study presented was carried out in the Molecular Systematics and Applied Ethnobotany
Laboratory (MOSEL), Department of Biotechnology, Quaid-i-Azam University, Islamabad.
The experiments performed included isolation and identification of endophytic bacteria from
Cannabis sativa, and their characterization on the basis of various in-vivo and in-vitro plant
growth promotion and biocontrol assays. Detailed methods are as under and recipes are
provided in Appendix A.
2.2.1 Collection of plant samples
Wild Cannabis sativa L. was collected from three sites located within the campus area
of Quaid-i-Azam University, Islamabad. The samples were immediately brought to
laboratory and processed for isolation of endophytic bacteria.
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 31
2.2.2 Isolation of Endophytic Bacteria
Culturable bacteria were isolated from the healthy Cannabis sativa plants growing in the
wild. Two different approaches were used for the isolation. The first approach was direct
isolation of endophytic bacteria from roots of C. sativa using a modified approach of Rashid
et al. (2012). The roots were washed using tap water and then chopped into 2-3 cm lengths.
The cuttings were surface sterilized by washing with 70% ethanol (2 minutes) followed by a
wash with commercial bleach (5 minutes), and then washed 10 times with sterile distilled
water. Water from the last wash was plated on Tryptic Soy agar (TSA) to ensure no epiphytes
were selected. About 5-6 cuttings were macerated in 5 ml of sterile 0.03 M MgSO4 using an
autoclaved mortar and pestle, and kept in a laminar flow cabinet for 30 minutes at room
temperature. The macerate (100 µl) was serially diluted up to 10-3 using 900 µl of diluent
(0.03 M MgSO4) in each dilution tube, and 100 µl of each dilution was spread plated on half
strength Tryptic Soya agar (TSA) and Nutrient agar (NA), and on R2A agar medium. The
inoculated media were incubated for 3-5 days at 30°C. Dilutions were plated in replicates on
each growth medium.
The second approach was novel and involved selective isolation of endophytic bacteria from
rhizosphere of C. sativa using canola. About 1% rhizosphere soil was added to 50 ml half
strength tryptic soy broth (TSB). The inoculated broth was incubated at 30°C for 48 hours
with 150 rpm orbital shaking. About 1 ml of the resulting mixed culture was added to fresh
50 ml half strength TSB with 5% rhizospheric soil extracts and incubated under conditions
indicated earlier. The resulting mixed culture was washed twice with 0.03 M MgSO4 and
adjusted to an absorbance of 0.2 at 600 nm. Agricultural soil was autoclaved twice for one
hour at 120°C and 15 psi and added to plastic pots. The resulting soil was also plated on TSA
to ensure it contained no indigenous microbes. Canola seeds were surface sterilized and sown
in the autoclaved soil. The soil was then thoroughly drenched with bacterial culture
suspension prepared earlier. The pots were placed on a lab bench top and plants emerging
from the seeds were grown for 4 weeks to give them ample time to take up endophytic
bacteria from the enriched rhizobacterial pool. The plants were then uprooted, washed
thoroughly with tap water, reduced to 2-3 cm cuttings, and endophytic bacteria were isolated
as described earlier.
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 32
2.2.3 Enumeration of endophytic bacteria
After 3-5 days incubation, several morphologically different colonies appeared on all the
above three types of media (TSA, R2A agar and NA). All the incubated plates were carefully
observed and the numbers of colonies were counted for each media plate, and finally bacteria
were enumerated as colony forming units per gram fresh weight (cfu/gfw) using the
following formula.
Plate
count
X
10 X Dilution
Factor X 50 ÷
Weight
of
roots
= cfu /
gfw
30-300
colonies
Cells in
1 ml of
dilution
Cells in
macerate
serially
diluted
Cells in
total
macerate
Grams
Cells
per
gram
root
tissue
2.2.4 Selection and storage of pure strains
Morphologically distinct bacterial colonies were selected from the isolation procedure on the
basis of color, shape, texture, size and gram reaction, The pure bacteria were maintained on
half strength TSA slants at 4°C.
2.2.5 Bacterial preservation in glycerol stock
Glycerol stocks are important for long-term storage of bacterial strains. Tryptic Soya broth
(TSB) medium was prepared and autoclaved for 20 minutes at 121°C. A pure bacterial
culture was inoculated into the broth using a wireloop, and the culture was incubated
overnight at 30°C. Next day, 700 µl of the overnight culture was mixed with 300 µl of 50%
glycerol solution (50% glycerol in 50% distilled water) in a cryovile. The prepared bacterial
glycerol stocks (15% glycerol) were immediately stored at -80°C.
2.2.6 In-vivo plant growth promotion assay
Bacterial isolates were examined for their ability to promote canola plants using gnotobiotic
roots elongation assay.
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 33
2.2.6.1 Seed collection
Canola seeds were collected from National Agricultural Research Centre (NARC),
Islamabad.
2.2.6.2 Canola gnotobiotic root elongation assay
Canola seeds were surface sterilized by washing with 70% ethanol for 1 min and 20%
commercial bleach (1% NaOCl) for 10 min. Residual chemicals were removed by washing
10 times with sterile distilled water. Bacteria were grown in half strength TSB for 48 hours,
cells were harvested by centrifugation at 5000 rpm at 4°C and washed twice with 0.03 M
MgSO4 and resuspended to an absorbance of about 0.1±0.02 at 600 nm. The suspension was
used to treat the surface sterilized seeds for 1 hour at room temperature. The treated seeds
were placed in tubes containing 0.5% water agar (1 seed per tube and 18 tubes per treatment).
Surface sterilized seeds, treated with sterile 0.03 M MgSO4 were used as a negative control.
The tubes were placed at 25°C and 60% relative humidity in a plant growth chamber with 12
h light / dark cycles. The root lengths of plants were measured on day 5. The roots lengths of
top 12 plantlets (showing highest root length) per treatment were considered for further
analysis. Treated plant root lengths were compared to control plants by means of one way
ANOVA (p value ≤ 0.05) and Least Significant Difference (LSD) (pairwise comparison) at p
value = 0.05 using Statistix 8.1 software.
For testing growth promotion of canola by selected bacteria under salt stress, water agar was
supplemented with 25 mM NaCl in the gnotobiotic assay.
2.2.7 Confirmation of endophytic growth
Selected plant growth promoting bacteria were tested for their endophytic presence. Surface
sterilized seeds were treated with test bacteria as described before. The seeds were grown in
flasks containing Murashige and Skoog Basal Salt (Sigma-Aldrich M5524) medium
supplemented with 3% sucrose and 0.8% agar. Flasks were placed at 25°C and 60% relative
humidity in a plant growth chamber with 12 h light / dark cycles. Plantlets were harvested
after 2 weeks and surface sterilized by washing with 70% ethanol (30 seconds) and 1%
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 34
commercial bleach (2 min) followed by 10 washes with sterile distilled water. To confirm the
sterilization process, water from the last wash was plated on TSA medium. The surface
sterilized plant (root and stem) were macerated and plated on TSA medium to confirm
presence of test bacteria.
2.2.8 Salt stress tolerance
Selected plant growth promoting bacteria were tested for their ability to tolerate different salt
concentration. For this, bacteria were grown in TSB in the presence of 0%, 1%, 2%, 3%, 5%,
7% and 10% NaCl concentration for 24 h at 30°C. Bacterial growth was measured by taking
absorbance at 600 nm using uninoculated broth as blank.
2.2.9 In-vitro plant growth promotion assays
The isolated endophytic bacteria were analyzed for different traits consistent with plant
growth promotion, plant colonization and biocontrol of phytopathogens. The details are as
under.
2.2.9.1 Indole acetic acid production
Calorimetric estimation method (modified) was used to evaluate the indole acetic acid (IAA)
production by endophytic bacteria proposed by Gordon and Weber (1951). For this, bacteria
were used for inoculating into 5 ml of TSB with and without tryptophan (200 μg/ml).
Incubation was done at 30˚C for 24 hours. After incubation, cultures were centrifuged for 10
minutes at 10,000 rpm and supernatants were shifted to new tubes. For estimating the amount
of IAA produced by the bacteria, one part of supernatant was mixed with 2 parts of
Salkowski reagent. For control (blank), uninoculated broth was used in place of supernatant.
The resulting mixture was left for incubation at room temperature for 25 minutes. Strains
capable of producing indole acetic acid developed pink color that was analyzed at 535 nm
using a spectrophotometer (UV3000 spectrophotometer), where the control reaction was used
as spectrophotometer blank. Amount of IAA produced by individual strains was evaluated
using a standard curve of IAA as described below. Experiment was performed in duplicate
and values were averaged.
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 35
2.2.9.1.1 Standard curve of IAA
IAA stock solution (5 µg/ml) was prepared by dissolving IAA (0.001 grams) in
2% ethanol solution (200 ml). The stock was twofold serially diluted up to 0.313 µg/ml by
mixing 1 part sample with 1 part diluent. Then, one part of each dilution was mixed with 2
parts of Salkowsky reagent. The mixtures were incubated at room temperature for 25
minutes. The resulting reaction was analyzed at 535 nm using a spectrophotometer (Gordon
and Weber, 1951). The process was performed in duplicate. IAA concentrations and their
corresponding absorbance (average of two replicates) were plotted in a graph using Microsoft
Excel program (Figure 2.1).
Figure 2.1 Standard curve of Indole Acetic Acid
Finally, the concentration of IAA produced by individual strains was calculated using the
following formula generated using a standard curve.
IAA produced (µg/ml) = (Sample Absorbance + 0.004) ÷ (0.0369)
2.2.9.2 Phosphate solubilization
The tri-calcium phosphate containing minimal medium was used to qualitatively
measure of bacterial phosphate solubilization (Kuklinsky-Sobral et al., 2004). The bacteria
y = 0.0369x - 0.004R² = 0.9992
0
0.02
0.04
0.06
0.08
0.1
0.12
0.14
0.16
0.18
0.2
0 1 2 3 4 5 6
Ab
sorb
ance
(5
35
nm
)
IAA concetration (µg/ml)
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 36
capable of solubilizing mineral phosphate can produce a clear zone around them on the milky
white media. An overnight bacterial culture was spot inoculated on the test media. The
inoculated media was incubated for 2-3 days at 30˚C. Zone of clearing around the colonies
was used to identify phosphate solubilizing bacteria. Zones of clearing (cm) produced by
bacteria were converted into three categories (large, >1.0 cm; medium 0.5-1 cm; small, <0.5
cm) for plotting them in graph.
2.2.9.3 Siderophore production
Ability of the bacteria to produce siderophore was determined qualitatively using a modified
approach of Pérez-Miranda et al. (2007) based on chrome-Azurol S (CAS) based agar
medium (Schwyn and Neilands, 1987). The CAS medium (1L) prepared by mixing Chrome
Azurol S (CAS) 60.5 mg, 72.9 mg, Piperazine-1,4-bis (2- ethanesulfonic acid) (PIPES) 30.24
g, and 1 mM FeCl3·6H2O in 10 mM HCl 10 mL. Agarose (0.9%, w/v) was used as gelling
agent. Siderophores detection was achieved after 10 ml overlays of this medium were applied
over TSA media (supplemented with 50 µg/ml of 8-Hydroxyquinoline) plates with overnight
grown bacteria. After 15 minutes, a change in color in the overlaid medium confirmed
siderophore producer by microorganisms, where blue to purple indicated catechol type
siderophores, and blue to orange indicated hydroxamate type siderophores. All these
experiments were performed in triplicate.
2.2.10 Plant cell-wall degrading enzymes
Isolated bacteria were examined for the ability to produce plant cell-wall targeting Cellulase
and Pectinase using qualitative assays.
2.2.10.1 Cellulase activity
In order to determine the Cellulase activity of the selected bacterial strains, all the strains
were processed in triplicates. Cellulase activity of the bacterial strains was analyzed by
Hendricks et al. (1995) method. For this, cellulose-Congo red agar was prepared and
autoclaved at 121ºC for 20 minutes. After autoclaving the media was cooled and poured into
plates. The isolates were inoculated on the media plates and incubated at 30ºC for 3-5 days.
After incubation, Cellulase activity was confirmed by identifying zone of clearing around the
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 37
bacteria. The test was performed in triplicate. Zones of hydrolysis (cm) produced by bacteria
were converted into three categories (large, >1.0 cm; medium 0.5-1 cm; small, <0.5 cm) for
plotting them in graph.
2.2.10.2 Pectinase activity
Pectin containing minimal media was used to identify pectinase producing bacteria (Hankin
et al., 1971). Overnight grown bacteria were inoculated on the media plates and incubated at
30ºC for 3-5 days. The zones of hydrolysis of pectin around bacterial colonies were
visualized by flooding culture plates with iodine solution (Ouattara et al., 2008). The
experiment was performed in triplicate. Zones of hydrolysis (cm) produced by bacteria were
converted into three categories (large, >1.0 cm; medium 0.5-1 cm; small, <0.5 cm) for
plotting them in graph.
2.2.11 Fungal cell-wall degrading enzymes
Isolated bacteria were examined for the ability to produce fungal cell-wall targeting Protease
and Chitinase using qualitative assays.
2.2.11.1 Protease activity
The protease activity of selected bacterial strains was determined using skim milk agar
medium of Bibi et al. (2012). For this, full strength medium TSA was prepared first. Then, in
another flask 2% (w/v) of skimmed milk was dissolved in distilled water equal in volume to
that of TSA. Both preparations were autoclaved at 121ºC for 20 minutes. After autoclaving,
TSA and skimmed milk preparations were mixed together to produce half strength TSA
containing 1% skimmed milk. The media was poured in to sterile petri plates. The test
bacteria were spot inoculated on the media. Cultures were then placed in an incubator at 30ºC
for 2 days. Protease activity was confirmed by the appearance of zones of clearing around the
colonies. Test was performed in triplicate. Zones of hydrolysis (cm) produced by bacteria
were converted into three categories (large, >1.0 cm; medium 0.5-1 cm; small, <0.5 cm) for
plotting them in graph.
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 38
2.2.11.2 Chitinase activity
Chitinase activity was tested by using chitinase screening media containing chitin (Bibi et al.,
2012). Chitinase media was prepared by adding 0.6% w/v colloidal chitin to half strength
TSA. Colloidal chitin was prepared by adding 2 grams of crab chitin in 100 ml of
Hydrochloric acid and left for 24 hours at 4ºC in a refrigerated orbital shaker incubator at 150
rpm. After incubation, about 2 liter of sterile distilled water was added to the mixture and left
overnight at 4ºC. Supernatant was then removed carefully and the remaining solution
containing the precipitates was filtered followed by washing of precipitates thoroughly with
sterile distilled water to neutralize the pH of resulting colloids. The colloidal chitin prepared
was used for media preparation. The media was autoclaved and poured in sterilized petri
plates. Bacteria were inoculated on media plates and incubated for 5 days at 30º C. Chitinase
production was detected by the appearance of clear zones around the bacteria. The tests were
performed in triplicate. Zones of hydrolysis (cm) produced by bacteria were converted into
three categories (large, >1.0 cm; medium 0.5-1 cm; small, <0.5 cm) for plotting them in
graph.
2.2.12 Antifungal Activity
To test the antifungal potential of the bacteria, Fusarium oxysporum (accession no: 1114) and
Aspergillus niger (accession no: 1109) were obtained from the Fungal Culture Bank,
University of the Punjab, Lahore. Dual culture method was used for this purpose by
inoculating bacteria on the sides and the test fungi in the center of agar medium containing
1:1 ratio of potato dextrose agar (PDA) and TSA (Kumar et al., 2012). Culture plates were
incubated at 30°C for 5-7 days and bacterial colonies antagonizing fungal growth were
identified by presence of zone of inhibition at the point of interaction. The test was performed
in triplicate.
2.2.13 Molecular identification of endophytic bacterial
Bacterial isolates were identified based on their 16S rRNA gene sequence. For this, the test
bacteria were propagated on TSA by incubating at 30°C for 24 hours. The bacteria were then
processed for genomic DNA extraction, followed by PCR amplification of 16S rRNA gene,
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 39
purification of the PCR product, sequencing of the PCR product, and analyses of resulting
sequences for identification of bacteria.
2.2.13.1 Bacterial genomic DNA extraction
Purified bacterial colonies were processed for genomic DNA isolation. Each colony was
carefully transferred to a PCR tube with the help of sterilized loop and 100 μl of lysis buffer
was added to each tube and the contents were thoroughly mixed. Lysis buffer (2 ml) was
prepared by mixing 1.75 ml nuclease free water, 200 μl 10% Triton X-100, 40 μl 1M Tris
HCl (pH 8.0) and 8 μL 0.5 M of EDTA (pH 8.0). For each reaction/cell lysis we used 100 μl
of this buffer. PCR tubes containing the mixture were heated at 95°C for 10 minutes in
thermocycler followed by centrifugation at 14000 rpm for 10 minutes to pellet the cell debris.
The supernatant containing genomic DNA was collected and stored at -20°C for further
processing.
2.2.13.2 PCR amplification of 16S rRNA gene
Supernatant (containing genomic DNA) collected from above procedure was used as a
bacterial template for PCR reaction. Bacterial 16S rRNA gene was amplified using the
universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-
GGTTACCTTGTTACGACTT-3'), as proposed by Weisburg et al. (1991). PCR reaction
mixture (50 µL) was prepared containing 0.3 µM of forward and reverse primers, about 4 µL
template DNA and 1×GoTaq® Green Master Mix (Promega, USA) in PCR grade water. PCR
amplification was performed with initial denaturation at 94°C for 5 minutes, followed by 30
cycles of denaturation (94°C for 30s), annealing (55°C for 30s) and extension (72°C for 1
minute) with a final extension at 72°C for 10 min.
2.2.13.3 Confirmation of PCR product using Agarose Gel electrophoresis
The resulting PCR product (approximately 1500 bp) was visualized on 1% agarose gel
containing ethidium bromide and compared to a 1 kb ladder (ThermoFisher Scientific, USA)
for size confirmation. For this, about 1 g agarose (Fisher Scientific, USA) was dissolved in
1×TAE buffer and heated in microwave oven for mixing. The gel was cooled down and then
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 40
50 μl of 10 mg/ml ethidium bromide (ThermoFisher Scientific, USA) was added and mixed,
and the gel was casted in the electrophoresis tray with the fitted comb. After casting, the tray
containing gel was shifted to electrophoresis chamber containing the 1×TAE buffer. The gel
was completely submerged in the tank buffer. About 3 μl of amplified DNA samples were
mixed with 1 μl 6× loading dye (ThermoFisher Scientific, USA) and loading into the wells of
the gel. The first well was loaded with a 1 kb ladder (ThermoFisher Scientific, USA) to verify
correct size amplicons. The power supply was connected and the electrophoresis was
performed at a constant voltage of 5 V/cm for 40 minutes. The DNA bands were analyzed
using Gel Doc System (Dolphin-Doc Plus, Wealtec Bioscience).
2.2.13.4 PCR product purification
PCR products were purified using PureLink PCR Purification Kit (Invitrogen, USA)
according to provided instructions. For this, Binding Buffer B2 containing isopropanol (4
parts) was mixed with PCR product (1 part). The contents were transferred to Spin Column in
a collection tube. The tubes were centrifuged 10,000×g for 1 minute at room temperature.
The resulting flow through was discarded. Then, about 650 μL of Wash Buffer with ethanol
was added to the column containing the bound amplified DNA. The tube was again
centrifuged 10,000×g for 1 minute and the flow through was discarded. The tubes were then
centrifuged at maximum speed at room temperature for 2-3 minutes to remove any residual
Wash Buffer to the column. The columns were then shifted to Elution Tube. Then, about 50
μL of Elution Buffer was added to the columns, which were then incubated at room
temperature for 1 minute. The tubes were centrifuged at maximum speed to elute the PCR
amplified DNA. The purified DNA was confirmed by agarose gel electrophoresis as
described above and stored at -20°C for further processing.
2.2.13.5 16S rRNA gene sequencing
For sequencing of 16S rRNA gene, the purified PCR products of amplified 16S rRNA gene
were sent to Macrogen, Inc. (South Korea).
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 41
2.2.13.6 16S rRNA gene sequences analysis
The sequences were analyzed for their quality using BioEdit v7.0.5 program and trimmed.
The trimmed sequences were used to identify bacteria using Basic Local Alignment Search
Tool (BLAST) search tool against the GenBank database available at the National Center for
Biotechnology Information Search database (NCBI; https://www.ncbi.nlm.nih.gov/) website.
The bacteria were identified based on their maximum score and percentage similarity (≥99%)
with other GenBank bacterial accession. For determining bacterial similarity with type
strains, Eztaxon server version 2.1 was used (http://www.ezbiocloud.net/; Kim et al., 2012b).
The sequences of the identified bacteria were deposited at GenBank.
2.2.14 Phylogenetic analysis of endophytic bacteria
The evolutionary linkages among the isolates were assessed through phylogenetic analysis.
For this, multiple alignments were first performed for the 16S rRNA gene sequences of the
isolates using ClustalXv2.1. The aligned sequences were then constructed into a phylogenetic
tree based on Neighbor-Joining method (Bootstrap using 500 replicates) using MEGA5
software.
2.3 Results
The present investigation was carried out for the isolation, screening and characterization of
endophytic bacterial strains from Cannabis sativa. The bacteria were isolated using two
different approaches, and were identified and analyzed for different traits consistent with
plant growth promotion, plant invasion and biocontrol of phytopathogenic fungi. The details
of the results are as follows:
2.3.1 Isolation of endophytic bacteria
After enumeration of isolated bacteria, a total of 34 bacterial colonies were selected on the
basis of colony size, morphology, color, shape and growth pattern (Figure 2.2). Out of 34
morphologically distinct bacteria isolated from C. sativa, sixteen were directly isolated from
the surface sterilized roots, and eighteen were selectively isolated from the enriched
rhizosphere bacteria using canola plants. From both the sources, highest cell counts were on
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 42
R2A agar (Direct isolation, 8×107 cfu/gfw; Selective isolation, 6 × 104 cfu/gfw) followed by
TSA (Direct, 3×106 cfu/gfw; Selective, 4.9×104 cfu/gfw) and NA (Direct, 1×106 cfu/gfw;
Selective, 8×103 cfu/gfw). Moreover, bacteria cells recovered were more in case of direct
isolation compared to selective isolation (Table 2.1). Morphologically similar bacteria
isolated from the two sources were considered among the isolates from C. sativa roots. These
selected colonies were further purified by repeated sub culturing.
Figure 2.2 Plate showing growth of isolated endophytic bacteria
Table 2.1 Number of bacterial isolates recovered from two isolation procedures along with average
cell counts recovered on three growth media.
Source Direct Isolation Selective isolation
Total bacteria isolates 16 18
TSA 3×106 cfu/gfw 4.9×104 cfu/gfw
R2A 8×107 cfu/gfw 6×104 cfu/gfw
NA 1×106 cfu/gfw 8×103 cfu/gfw
2.3.2 Identification of endophytic bacteria
Bacteria were identified based on their 16S rRNA gene sequence. For this, genomic DNA
was extracted from overnight grown bacteria and was used as a template in the PCR reaction.
PCR amplification of the 16S rRNA gene of isolates, using 27F and 1492R universal primers,
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 43
yielded a product close to 1500 bp (Figure 2.3). PCR amplicons were sequenced
commercially and sequence quality was analyzed using BioEdit program. The sequencing
electropherogram revealed that all sequences were clean and of good quality (Figure 2.4).
The resulting partial sequences were used to identify the endophytic isolates using GenBank
and Eztaxon databases.
Figure 2.3 Agarose gel electrophoresis of PCR amplified 16S rRNA gene of bacterial isolates. First
lane, 1 kb DNA ladder; second lane, negative control; third lane, positive control; lanes 1, 2, 3, 4, 5, 6,
7 and 8 PCR amplified DNA of ~1465bp size.
Figure 2.4 Electropherogram of 16S rRNA gene from bacterial isolate MOSEL-w2.
Results from GenBank and Eztaxon analysis revealed that a diversity of bacterial genera were
isolated from the two isolation methods, where the most prominent genera were
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 44
Acinetobacter, Chryseobacterium, Enterobacter, Microbacterium, Nocardioides,
Paenibacillus Pseudomonas, Stenotrophomonas. The direct method isolated 13 unique
bacterial genera while selective method isolated 11 genera (Figure 2.5 and 2.6).
Figure 2.5 Percentage of endophytic bacterial genera obtained from C. sativa using direct isolation
method
Figure 2.6 Percentage of endophytic bacterial genera obtained from C. sativa using selective isolation
Most of the isolates shared more than 99% homology to the closest type strain based on the analysis
of EzTaxon server. However, four isolates (MOSEL-w4, MOSEL-p22, MOSEL-w2.5 and MOSEL-
r15) shared about 98% similarity, while MOSEL-w13 and MOSEL-n5 shared about 97% similarity to
the closest type strain. Further, all isolates shared 99-100% similarity to a GenBank submission,
analyzed using BLAST program. The 16S rRNA gene sequences of identified endophytic bacteria
have been deposited at GenBank database, where each submission has been given a unique accession
number (Table 2.2 and 2.3).
0
5
10
15
20
25P
erce
nta
ge
0
5
10
15
20
Per
cen
tage
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 45
Table 2.2 Identification of endophytic bacteria resulting from selective isolation method based on the
partial 16S rRNA gene sequence. GenBank match similarity was ≥99% for all isolates while their
Eztaxon match similarity and GenBank accession is given below.
Strain
(MOSEL) GenBank closest match
EzTaxon closest match
(type strain)
Similarity
(%)
Genbank
accession
w4 Chryseobacterium sp. YU-SS-
B-43
Chryseobacterium
indologenes LMG 8337 98.57 KF307668
p22 Bacterium 1A5 Chryseobacterium tructae
1084-08 98.49 KF307670
w15 Curtobacterium sp. EP_L_2 Curtobacterium
flaccumfaciens LMG 3645 100 KF307671
p6 Enterobacter hormaechei
strain SR3
Enterobacter cancerogenus
LMG 2693 99.62 KF307674
w7 Enterobacter cloacae strain
RM20
Enterobacter cloacae subsp.
dissolvens LMG 2683 99.81 KF307675
w12 Exiguobacterium acetylicum
strain ZYJ-7
Exiguobacterium indicum
HHS31 99.62 KF307677
w2.16 Microbacterium sp. ZL2 Microbacterium
ginsengiterrae DCY37 99.14 KF307678
w2.5 Microbacterium sp. Am3 Microbacterium natoriense
TNJL143-2 98.86 KF307679
w2.1 Microbacterium sp. THG S3-
10
Microbacterium
phyllosphaerae DSM 13468 99.52 KF307680
w13 Paenibacillus sp. 512(2014) Paenibacillus hunanensis
FeL05 97 KF307683
w1 Paenibacillus sp. BL14 Paenibacillus tundrae A10b 99.14 KF307684
w6 Pantoea anthophila strain L8-
457
Pantoea anthophila LMG
2558 99.52 KF307685
w16 Paracoccus marcusii strain
BF13-3
Paracoccus marcusii DSM
11574 99.62 KF307687
tnc1 Pseudomonas geniculata strain
R6-798
Pseudomonas geniculata
ATCC 19374 99.71 KF307689
tnc2 Pseudomonas sp. DT1 Pseudomonas koreensis Ps
9-14 99.9 KF307691
p18 Pseudomonas plecoglossicida
S20411
Pseudomonas
plecoglossicida FPC951 100 KF307693
w2 Serratia marcescens strain
MUGA199
Serratia marcescens subsp.
sakuensis KRED 99.9 KF307696
tnc3 Stenotrophomonas rhizophila
strain HR89
Stenotrophomonas
rhizophila e-p10 99.62 KF307697
2.3.3 Phylogenetic Analysis
Evolutionary relatedness of the endophytic bacterial isolates was determined based on
their 16S rRNA gene sequences. For this, sequences were first aligned with ClustalX v2.1
and a phylogenetic tree was constructed using Mega5 software. The results revealed that all
bacteria significantly promoting canola root growth (MOSEL-t13, MOSEL-t15, MOSEL-p6,
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 46
MOSEL-tnc1, MOSEL-tnc2, MOSEL-tnc3, MOSEL-w2, MOSEL-w7) clustered together
(100% Bootstrap value). The isolates belonged to genera Enterobacter, Pantoea,
Pseudomonas, Serratia, and Stenotrophomonas (Figure 2.7). Since all the members included
in a single cluster are phylogenetically related, the present result indicates that the ability to
promote plant growth is evolutionarily conserved in the endophytic bacteria.
Table 2.3 Identification of endophytic bacteria resulting from direct isolation method based on the
partial 16S rRNA gene sequence. GenBank match similarity was ≥99% for all isolates while their
Eztaxon match similarity and GenBank accession is given below.
Strain ID
(MOSEL) GenBank closest match EzTaxon closest match
Similarity
(%)
Genbank
accession
r2 Acinetobacter sp. SZ-1 Acinetobacter gyllenbergii
1271 99.44 KF307663
n6 Acinetobacter sp. R4-413 Acinetobacter
nosocomialis LMG 10619 99.62 KF307664
t7 Acinetobacter gyllenbergii
A207
Acinetobacter parvus DSM
16617 99 KF307665
r8 Acinetobacter oleivorans
strain Z-A18
Acinetobacter pittii LMG
1035 99.33 KF307666
r4 Bacillus anthracis strain UM-
5
Bacillus anthracis ATCC
14578 100 KF307667
n5 Chryseobacterium
kwangjuense strain KJ1R5
Chryseobacterium
vrystaatense LMG 22846 97.28 KF307669
t15 Bacterium OX_LEAF4 Enterobacter asburiae
JCM 6051 99.43 KF307672
r7 Enterococcus casseliflavus
strain ALK061
Enterococcus casseliflavus
CECT969 99.52 KF307676
r13 Nocardioides albus Nocardioides albus KCTC
9186 99.52 KF307681
r15 Bacterium 405 Nocardioides kongjuensis
A2-4 98.67 KF307682
t13 Pantoea agglomerans strain
PGHL1
Pantoea vagans LMG
24199 99.81 KF307686
n9 Planomicrobium chinense
strain L10-2
Planomicrobium chinense
DX3-12 99.71 KF307688
t14 Pseudomonas putida strain
CSM10
Pseudomonas taiwanensis
BCRC 17751 99.78 KF307694
n12 Agrobacterium tumefaciens
strain R6-409
Rhizobium radiobacter
ATCC 19358 99.43 KF307695
n11 Streptomyces werraensis
strain 1165
Streptomyces eurocidicus
NRRL B-1676 99.52 KF307698
r5 Xanthomonas arboricolapv.
pruni strain BCRC80481
Xanthomonas gardneri
ATCC 19865 100 KF307699
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 47
Figure 2.7 Phylogenetic tree of endophytic bacteria from C. sativa (direct and selective isolation)
constructed with 16S rRNA gene sequences using the Neighbour-Joining method. Branch points show
bootstrap percentages (500 replicates). Bar 0.02 indicates changes per nucleotide position. Cluster
enclosed in red box contains isolates significantly promoting canola growth.
2.3.4 Plant cell-wall degrading enzymes
The isolates were examined for Cellulase and Pectinase production using qualitative tests
(Figure 2.8). All bacteria isolated from canola plants possessed Cellulase activity, and with
the exception of MOSEL-tnc3, all isolates also showed a positive pectinase activity. Most
isolates (88%) from C. sativa roots were also Cellulase positive, with the exception of
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 48
MOSEL-t7 and MOSEL-r7. While, only nine isolates (56%) were found to possess Pectinase
activity (Figure 2.9 and 2.10).
Figure 2.8 Pectinase (left) and Cellulase (right) activity of four bacterial isolates on Pectin and
Cellulose (CMC) containing medium.
Overall, some isolates showed a more pronounced Cellulase (MOSEL-w4, MOSEL-w12,
MOSEL-w13, MOSEL-tnc1, MOSEL-tnc3 and MOSEL-n5) and pectinase (MOSEL-w12,
MOSEL-w2.5, MOSEL-w13, MOSEL-w1, MOSEL-r13 and MOSEL-n11) activity than
others based on the size of zone of hydrolysis produced on respective media. Moreover, most
of the isolates possessed similar levels of Cellulase and Pectinase activity. Isolates with
pronounced activity were more abundant in the bacteria isolated from canola. Finally,
MOSEL-t7 and MOSEL-r7, isolated from the C. sativa roots, were the only two isolates
lacking both Cellulase and Pectinase activities.
2.3.5 Nutrient availability
Bacterial isolates were assessed for their ability to facilitate phosphorus and iron availability
for plant host. In the qualitative assay of phosphate solubilization (Figure 2.11), eight isolates
(44%) from canola solubilized tri-calcium phosphate. Such isolates were more abundant
(56%) in bacteria isolated from roots of C. sativa, and displayed more noticeable activity
apparent from larger halos formed around their colony. Overall, MOSEL-p6, MOSEL-t13
and MOSEL-t15 possessed the highest mineral phosphate solubilization ability (Figure 2.12
and 2.13). Moreover, thirteen isolates (72%) from canola produced siderophore, apparent
from the change in color of overlaid medium from blue to purple or orange by the bacteria
after incubation, while only nine isolates (56%) from C. sativa roots were siderophore
producers (Table 2.4 and 2.5).
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 49
Figure 2.9 Cellulase (blue bars) and Pectinase (orange bars) assay of endophytic bacteria isolated
from C. sativa using direct isolation. Values of zones of hydrolysis produced by bacteria have been
organized into three categories based on the size: 3, large (>1.0 cm); 2, medium (0.5-1 cm); 1, small
(<0.5 cm).
Figure 2.10 Cellulase (blue bars) and Pectinase (orange bars) assay of endophytic bacteria isolated
from C. sativa using selective isolation. Values of zones of hydrolysis produced by bacteria have been
organized into three categories: 3, large (>1.0 cm); 2, medium (0.5-1 cm); 1, small (<0.5 cm).
2
1 1
2
3
1
2
1 1
2
1 1
2
11
2 2
1
3
1 1
3
2
3
2
1 1 1
3
2 2
1
3
1 1 1
3
2
1
2
3
2 2
1 1 1
3
2
3
2
3 3
1 1 1 1
2
1
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 50
Figure 2.11 Mineral phosphate solubilization activities of four bacterial isolates on insoluble mineral
phosphate containing medium.
Figure 2.12 Mineral phosphate solubilization activity of bacteria isolated from C. sativa using direct
isolation. Values of zones of hydrolysis produced by bacteria have been organized into three
categories: 3, large (>1.0 cm); 2, medium (0.5-1 cm); 1, small (<0.5 cm).
2.3.6 Fungal cell-wall degrading enzyme
The bacterial isolates were tested for their Chitinase and Protease production ability using
qualitative tests. Three isolates from canola (16%) showed positive chitinase activity
(MOSEL-w2, MOSEL-13, and MOSEL-tnc3), forming clear halos around them on chitin
containing medium, while only MOSEL-r4 from C. sativa root showed positive activity. In
2 2 2
1
3
1
3
2
1 1
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 51
protease activity analysis, ten isolates (55%) from canola and seven (43%) from C. sativa root
were able to hydrolyze milk casein to produce zone of clearing on the test medium (Figure
2.14). Overall, four isolates, MOSEL-w2, MOSEL-w13, MOSEL-tnc3 and MOSEL-r4,
possessed both chitinase and protease activity (Table 2.4 and 2.5).
Figure 2.13 Mineral phosphate solubilization activity of bacteria isolated from C. sativa using
selective isolation. Values of zones of hydrolysis produced by bacteria have been organized into three
categories: 3, large (>1.0 cm); 2, medium (0.5-1 cm); 1, small (<0.5 cm).
Figure 2.14 Protease activity of bacteria isolated from C. sativa using selective isolation. Values of
zones of hydrolysis produced by bacteria have been organized into three categories: 3, large (>1.0
cm); 2, medium (0.5-1 cm); 1, small (<0.5 cm).
3
1 1 1 1
2
1
2
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 52
2.3.7 Antifungal Assay
Antifungal activity of the bacterial isolates against phytopathogenic fungi was examined
using dual culture assay (Figure 2.15). Four isolates from selective isolation (MOSEL-w2,
MOSEL-w7, MOSEL-w13 and MOSEL-tnc3) were effective against both A. niger and F.
oxysporum, while MOSEL-tnc2 was effective against A. niger only. Among the isolates from
C. sativa roots, MOSEL-r4, MOSEL-t14 and MOSEL-r5 were effective against both the test
fungi, whereas MOSEL-t13 and MOSEL-t15 were effective against F. oxysporum and A.
niger, respectively. Overall, MOSEL-w13 possessed the most prominent antifungal activity
against the two test fungi (Table 2.4 and 2.5).
Figure 2.15 Dual culture antifungal assay of five selected endophytic bacteria against
Aspergillus niger (left) and Fusarium oxysporum (right)
2.3.8 Production of IAA
All isolates were able to produce IAA like molecule. The amount of IAA produced ranged
from 0.2-5.1 µg/ml in the absence of tryptophan, the precursor of IAA. MOSEL-r8 (5.1
µg/ml) produced the highest amount of IAA among all the isolates followed by MOSEL-w16
(3.9 µg/ml) and MOSEL-w2 (3.02 µg/ml). Ability of the isolates to produce IAA was
increased by 1.5 to 4 fold in the presence of tryptophan (200 µg/ml). After supplementation
with tryptophan, maximum IAA production was observed for MOSEL-n2 (13.2 µg/ml)
followed by MOSEL-r8 (10 µg/ml) and MOSEL-t13 (7.7 µg/ml) (Figure 2.16 and 2.17).
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 53
Table 2.4 Protease production (PRO), Chitinase production (CHI), Siderophore production (SID),
Anti-Aspergillus niger (AN), and anti Fusarium oxysporum (FO) activities of endophytic bacteria
isolated from C. sativa using direct isolation.
Isolate PRO CHI SID AN FO
Acinetobacter gyllenbergii MOSEL-r2 + - - - -
Acinetobacter nosocomialis MOSEL-n6 - - + - -
Acinetobacter parvus MOSEL-t7 - - - - -
Acinetobacter pittii MOSEL-r8 - - - - -
Bacillus anthracis MOSEL-r4 +++ + + + +
Chryseobacterium sp. MOSEL-n5 ++ - + - -
Enterobacter asburiae MOSEL-t15 - - - + -
Enterococcus casseliflavus MOSEL-r7 + - - - -
Nocardioides albus MOSEL-r13 ++ - + - -
Nocardioides kongjuensis MOSEL-r15 - - + - -
Pantoea vagans MOSEL-t13 - - + - +
Planomicrobium chinense MOSEL-n9 - - - - -
Pseudomonas taiwanensis MOSEL-t14 + - + + +
Rhizobium radiobacter MOSEL-n12 - - - - -
Streptomyces eurocidicus MOSEL-n11 - - + - -
Xanthomonas gardneri MOSEL-r5 + - + + +
(+), activity present; (-), activity absent; (+), smaller halos around colonies (<0.5 cm); (++), medium
halos around colonies (0.5-1 cm); (+++), large halos around colonies (>1.0 cm).
2.3.9 In-vivo plant growth promotion assay
Bacterial isolates were examined for their ability to promote the growth of canola plants
using gnotobiotic roots elongation assay in water agar. Selected growth promoting bacteria
were also analyzed for growth promotion of salt stressed canola plants using the same assay.
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 54
Table 2.5 Protease production (PRO), Chitinase production (CHI), Siderophore production (SID),
Anti-Aspergillus niger (AN), and anti Fusarium oxysporum (FO) activities of endophytic bacteria
isolated from C. sativa using selective isolation.
Isolate PRO CHI SID AN FO
Chryseobacterium sp. MOSEL- w4 ++ - + - -
Chryseobacterium sp. MOSEL-p22 ++ - - - -
Curtobacterium flaccumfaciens MOSEL-w15 + - + - -
Enterobacter cancerogenus MOSEL-p6 - - - - -
Enterobacter cloacae MOSEL-w7 - - - + +
Exiguobacterium indicum MOSEL-w12 ++ - + - -
Microbacterium ginsengiterrae MOSEL-w2.16 - - - - -
Microbacterium sp. MOSEL-w2.5 ++ - + - -
Microbacterium phyllosphaerae MOSEL-w2.1 - - - - -
Paenibacillus sp. MOSEL-w13 +++ ++ + + +
Paenibacillus tundrae MOSEL-w1 - - + - -
Pantoea anthophila MOSEL-w6 - - + + -
Paracoccus marcusii MOSEL-w16 - - + - -
Pseudomonas geniculata MOSEL-tnc1 ++ - + - -
Pseudomonas koreensis MOSEL-tnc2 + - + + -
Pseudomonas plecoglossicida MOSEL-p18 - - + - -
Serratia marcescens MOSEL-w2 ++ +++ + + +
Stenotrophomonas rhizophila MOSEL-tnc3 ++ + + + +
(+), activity present; (-), activity absent; (+), smaller halos around colonies (<0.5 cm); (++), medium
halos around colonies (0.5-1 cm); (+++), large halos around colonies (>1.0 cm).
2.3.9.1 Canola gnotobiotic root elongation
Ability of the isolates to confer growth benefit on canola was assessed using gnotobiotic
assay in water agar and roots were measured after 5 days (Figure 2.18). The bacteria isolated
from two approaches performed differently in the assay. Isolates from canola were much
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 55
better in the growth promoting ability, where six isolates significantly enhanced root lengths
of the test plant (Least significant difference; p ≤ 0.05). However, the performance of the six
isolates did not differ significantly from each other. On an average, MOSEL-w7 (29.2%
increase), MOSEL-tnc1 (31.41%) and MOSEL-w2 (32.15%) produced longer root lengths
than MOSEL-p6 (17.39%), MOSEL-tnc2 (19.6%) and MOSEL tnc3 (16.28%). On the other
hand, only two isolates from C. sativa roots significantly enhanced root length of test plant,
where MOSEL-t13 (38.63%) performed better than MOSEL-t15 (16.97%). However, their
performance also did not vary significantly compared to each other, or compared to the six
isolates from canola (Figure 2.19 and 2.20).
Figure 2.16 IAA production by bacteria isolated from C. sativa using direct isolation (Blue bars,
without tryptophan; Orange bars, with tryptophan). Values represent mean of three replicates.
2.3.9.2 Confirmation of endophytic presence
The eight growth promoting bacteria were analyzed to confirm their endophytic presence in
bacterized canola plants grown in plant culturing media. All eight bacteria were recovered
from the surface sterilized canola plants inoculated with these bacteria, indicating their
endophytic presence. The endophytic bacterial counts were between 103-104 cfu/gfw of plant.
0
2
4
6
8
10
12
14
16
IAA
pro
du
ced
(µ
g/m
l)
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 56
Figure 2.17 IAA production by bacteria isolated from C. sativa using selective isolation (Blue bars,
without tryptophan; Orange bars, with tryptophan). Values represent mean of three replicates.
Figure 2.18 Root elongation of canola by three selected growth promoting bacteria under gnotobiotic
conditions. Scale indicates values in centimeters.
0
1
2
3
4
5
6
7
8
IAA
pro
du
ced
(µ
g/m
l)
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 57
Fig. 2.19 Canola gnotobiotic root elongation assay of endophytic bacteria isolated from C. sativa
roots using direct isolation. Each bar represents mean root length (±SE, n=12) of five day old plantlets
treated with sterile 0.03 M MgSO4 (Control) or bacterial suspension in 0.03 M MgSO4 (0.1±0.02 OD
at 600 nm). Green bars represent isolates significantly increasing root length and red bars significantly
decreasing root length compared to control (Least significant difference, p ≤ 0.05).
Fig. 2.20 Canola gnotobiotic root elongation assay of endophytic bacteria isolated from C. sativa
rhizosphere by selective isolation using canola. Each bar represents mean root length (±SE, n=12) of
five day old plantlets treated with sterile 0.03 M MgSO4 (Control) or bacterial suspension in 0.03 M
MgSO4 (0.1±0.02 OD at 600 nm). Green bars represent isolates significantly increasing root length
compared to control (Least significant difference, p ≤ 0.05).
5
6
7
8
9
10
11
12
13
14
Root
len
gth
(cm
)
5
6
7
8
9
10
11
12
13
Root
Len
gth
(cm
)
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 58
2.3.9.3 Canola gnotobiotic root elongation under salt stress
Three prominent plant growth promoting bacteria, MOSEL-tnc1, MOSEL-w2 and MOSEL-
t13 were also tested for their ability to ameliorate the inhibitory effects NaCl on canola
(Figure 2.21). Under 125 mM NaCl stress, plants showed stunted growth compared to non-
stressed plants, and under stress condition, plants treated with MOSEL-t13 and MOSEL-tnc1
produced significantly longer roots then non-bacterized plants(LSD; p ≤ 0.05). MOSEL-w2
treated plants also produced longer roots then control plants although the difference was
insignificant. Overall, bacterized plants showed better growth compared to non-bacterized
plants (Figure 2.22).
Figure 2.21 Root elongation of canola by three selected growth promoting bacteria under gnotobiotic
condition and 125 mM NaCl stress. Scale indicates values in centimeters.
2.3.10 Growth under salt stress
The three bacteria tested for salt tolerance were able to grow under most salt concentrations
tested. MOSEL-w2 (Turbidity 0.265±0.01) appeared to be most salt tolerant at 7% NaCl
followed by MOSEL-t13 (0.185±0.01) and MOSEL-tnc1 (0.08±0.01). At 10% salt
concentration, only MOSEL-w2 (0.05±0.01) showed measurable but little growth.
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 59
Figure 2.22 Canola gnotobiotic root elongation assay of three growth promoting bacteria in the
presence of 125 mM NaCl stress. Each bar represents mean root length (±SE, n=12) of five day old
plantlets treated with sterile 0.03M MgSO4 (Control) or bacterial suspension in 0.03 M MgSO4
(0.1±0.02 OD at 600 nm). Green bars belong to isolates significantly increasing root length under
stress compared to control (Least significant difference, p ≤ 0.05).
2.4 Discussion
In the present study, endophytic bacteria were isolated from Cannabis sativa and investigated
for their potential as bio-inoculants for canola, a commercial crop. Selective isolation
procedure yielded six bacteria that significantly promoted the root growth of test plant under
gnotobiotic conditions, as compared to two isolates from direct isolation. The bacteria were
also recovered from the surface sterilized bacterized canola plants confirming their
endophytic presence (Rashid et al., 2012). Although statistically insignificant, remaining
isolates from selective isolation also performed better in promoting canola growth as
compared to isolates from direct isolation. The difference in performance could be due to the
host plant type. Long et al. (2008) noticed this for plant growth promoting bacteria of
Solanum nigrum that were unable to produce growth enhancement in Nicotiana attenuate, a
non-host plant. Plant genotype can also influence the ability of bacteria to promote plant
growth. This was reported by Kim et al. (2012a) in their work on growth promotion of switch
grass cultivars by Bukholderia phytofirmans PsJN. Hence, selecting endophytic bacteria
using canola produced more isolates that positively affected the growth of the same host
3
4
5
6
7
8
9
Root
len
gth
(cm
)
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 60
plant. On the other hand, endophytic bacteria selected by C. sativa performed less efficiently
when tested on canola, an unrelated plant host.
The bacteria isolated from C. sativa roots represented endophytes selected by that plant from
the rhizosphere bacterial pool. These bacteria were found to be different from the isolates
selected by canola from the same pool. Hence, C. sativa and canola can take up their
respective endophytic bacteria differently. Germida et al. (1998) reported similar observation
for their work on canola and wheat plants grown in the same field. Nevertheless, the enriched
rhizospheric community of C. sativa did yield a unique set of microbes when selected using
canola plant. Most of these bacteria were not found to be part of the endophytic community
of canola reported by earlier researchers (Germida et al., 1998; Granér et al., 2003; Misko
and Germida, 2002; Siciliano and Germida, 1999). Further, Kusari et al. (2014) recently
reported their work on the endophytic bacteria of C. sativa sampled from Bedrocan BV,
Netherlands. They recovered only two bacterial genera with Bacillus being more predominant
than Mycobacterium. The isolates obtained from C. sativa roots in the present study appear to
be different from these findings, and more bacterial genera were recorded. Collectively, these
observations support the idea that endophytic community of a plant is defined by the nature
of its surrounding soil (McInroy and Kloepper, 1995; Rashid et al., 2012).
In the present work, most of the isolated bacteria produced Cellulase and Pectinase. This is
not surprising, since plant cell-wall degrading enzymes are known to play an important role
in the invasion and systematic dissemination of endophytic bacteria in the host tissues
(Reinhold-Hurek et al., 2006; Reinhold-Hurek and Hurek, 2011). Endophytic bacteria can
also make plant nutrients like phosphorus and iron more accessible for their hosts (Young et
al., 2013). A number of bacteria also solubilized inorganic phosphate, and the activity was
more pronounced in Acinetobacter, Enterobacter, Pantoea, Pseudomonas and Serratia.
These genera are frequently reported for their ability to solubilize phosphate (Sharma et al.,
2013).
All isolates were found to produce IAA like molecule albeit a moderate to low level. While
high IAA production is known to be a characteristic of plant pathogens and can cause
stunting of root growth (Malik and Sindhu, 2011; Kunkel and Chen, 2006), lower amounts
can increase plant growth (Marques et al., 2010). In the present study, many isolates did
promote root length in the inoculated plants compared to non-bacterized plants while only
few adversely affected root growth. Interestingly, two highest IAA producing bacteria,
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 61
Agrobacterium tumefaciens MOSEL-n12 and Acinetobacter pittii MOSEL-r8, produced
comparably lesser root lengths in canola than the bacteria that improved host root growth
significantly. In fact, bacteria producing IAA in the range of 4-8 µg/ml produced a more
enhanced root growth of the host plant. Long et al. (2008) also reported similar effects by
growth promoting bacteria on Solanum nigrum. Hence, plant growth promoting ability of
bacteria appears to be dependent on the amount of IAA produced by them, where lower
amounts tend to favor plant growth.
Endophytic bacteria can also benefit their host plant by discouraging the growth of
phytopathogens. They can accomplish this by using strategies like limiting nutrient
availability and colonization sites, by producing antagonistic substances, and by forming
biofilms (Compant et al., 2010). In the present work, dual culture assay identified useful
endophytic bacteria that retarded the growth of two phytopathogenic fungi, Aspergillus niger
and Fusarium oxysporum. Interestingly, all chitinase producing bacteria were antagonistic
towards the two test fungi, and most of them also produced protease. The antifungal ability of
bacteria can be due to their Chitinolytic and Proteolytic activity (Kim and Chung, 2004).
Among the antifungal bacteria, Paenibacillus sp.MOSEL-w13 exhibited the most prominent
antifungal activity against the two fungi. The isolate was also positive for various enzyme
activities tested. Paenibacillus are well known for their antifungal potential (Aktuganov et
al., 2008; Beatty and Jensen, 2002). However, the antifungal potential of P. hunanensis, the
bacteria most similar to MOSEL-w13, has not been reported before. Other interesting
antifungal isolates were Enterobacter cloacae MOSEL-w7, Enterobacter asburiae MOSEL-
t15, Pantoea vagans MOSEL-t13, Pseudomonas koreensis MOSEL-tnc2, Serratia
marcescens MOSEL-w2 and Stenotrophomonas rhizophila MOSEL-tnc3, and they also
significantly promoted root growth of canola.
A good number of isolates including most antifungal bacteria also produced siderophores.
Siderophore producing bacteria can discourage the growth of competing organisms by
limiting iron availability in the environment (Marques et al., 2010). Bacterial siderophore
production can also benefit plant host by improving its iron acquisition (Masalha et al.,
2000).
Most interesting plant growth promoting isolates were identified as Pseudomonas geniculata
MOSEL-tnc1, S. marcescens MOSEL-w2 and P. vagans MOSEL-t13. P. geniculata has been
reported as endophytic bacteria in switch grass and rice although it was not shown to be plant
Chapter 2
Agriculturally beneficial endophytic bacteria of wild plants 62
growth promoting (Nhu and Diep, 2014; Xia et al., 2013). The isolate was able to tolerate up
to 7% NaCl stress and also promoted growth of canola under salt stress. Interestingly, S.
marcescens MOSEL-w2 was the only isolate that showed activity in all the assays. The
isolate was able to produce plant and fungal cell-wall degrading enzymes, produced IAA and
siderophore, solubilized inorganic phosphate, retarded growth of phytopathogenic fungi, and
promoted canola growth under normal and stressed condition. It is a well-known plant
associated bacteria that was found to be endophytic and growth promoting in rice
(Gyaneshwar et al., 2000), and conferred cold tolerance in wheat (Selvakumar et al., 2007).
In the present study, the highest root elongation under normal and stressed conditions was
recorded for Pantoea vagans MOSEL-t13. The isolate also produced the highest IAA (7.7
µg/ml) among all the growth promoting bacteria and antagonized growth of F. oxysporum. A
strain of P. vagans has been commercialized as a bacterial biocontrol agent for fire blight
(Smits et al., 2011). As previously demonstrated, all three isolates belonging to Enterobacter
significantly promoted plant growth in the present study (Ahemad and Khan, 2010; Saleh and
Glick, 2001; Jha et al., 2012). As all the isolates that significantly promoted canola growth
were also phylogenetically related, the present study revealed that the ability to promote plant
growth is evolutionarily conserved in the studied endophytic bacteria.
Chapter 3
Plant growth promoting potential of endophytic bacteria
isolated from roots of wild Dodonaea viscosa L.
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 63
Plant growth promoting potential of endophytic bacteria isolated from roots of wild
Dodonaea viscosa L.
Abstract
Wild perennial shrub Dodonaea viscosa can tolerate harsh environmental conditions and is a
good candidate for isolating useful endophytic bacteria. The present work was aimed to
isolate endophytic bacteria from roots of Dodonaea viscosa and to determine their ability to
promote canola growth. Isolates were identified on the basis of 16S rRNA gene and screened
for various traits consistent with plant growth promotion. Out of 15 isolates, the 10 bacteria
that significantly promoted canola root growth in gnotobitic assay belonged to Agrococcus,
Bacillus, Microbacterium, Pseudomonas, Streptomyces and Xanthomonas, while others
positively affected canola root growth, albeit insignificantly. All isolates produced IAA, an
important plant hormone, where some produced quantities higher than others; the ability
improved in the presence of tryptophan. The isolates also produced plant cell-wall targeting
cellulase and pectinase, needed to systemically colonize host. Most isolates could improve
plant nutrient availability by solubilizing mineral phosphate and producing siderophores,
which are also important in biocontrol of plant pathogens. Members of Bacillus,
Pseudomonas and Streptomyces inhibited two pathogenic fungi in dual-culture assay, and
many isolates also produced fungal cell-wall targeting chitinase and protease. These results
confirm Dodonaea viscosa endophytic bacteria as PGPBs. Furhter investigation is needed to
establish their potential as bio-inoculants for crops and to identify molecular mechanisms of
plant growth promotion.
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 64
3.1. Introduction
Modern agricultural practices are heavily dependent on the use of chemical pesticides and
fertilizers to improve crop yield for meeting the demands of increasing human population.
This overuse can lead to various problems that include environmental contamination
affecting human health, disturbance of natural nutrient cycling, and damage to natural
microbial communities that support crop health (Enebak et al., 1998). This has lead to an
increased interest in ecofriendly organic farming practices that pose no threat the
environment (Esitken et al., 2005). In this regard, the use of bacteria as fertilizers and
pesticides has become an interesting method to improve crop productivity.
Endophytic bacteria are a good choice as bio-inoculants, as they develop a much closer
association with their host to impart growth benefits as compared to rhizospheric bacteria
(Compant et al., 2010). These plant beneficial endophytic bacteria inhabit the internal plant
tissues without cauing any harm to the host plant and can benefit their host in various ways
(Reiter and Sessitsch, 2006). They can safely be used as fertilizers or pesticides, without
exerting any ecological damage and environment hazard (Pavlov et al., 2011). They improve
plant growth by producing plant hormones, by increasing nutrient avalaiblility for plants, by
alleviating plant stress, and by inhibit plant pests and pathogens (Ahemed and Khan, 2011).
Many species of Alcaligenes, Arthrobacter, Azospirillum, Azotobacter, Bacillus,
Burkholderia, Enterobacter, Klebsiella, Pseudomonas, and Serratia have been reported as
plant beneficial endophytic bacteria (Ji et al., 2014). Thus, endophytic bacteria isolated from
untapped wild sources having plant beneficial traits may serve as bio-inoculants for the
commercial crops (Jasim et al., 2014).
Aims and objectives
In the present work, Dodonaea viscosa L. (Sanatha) was used as a host plant to isolate
endophytic bacteria. This woody and evergreen perennial wild plant remains unstudied for
the bacteria it harbours. D. viscosa is a native Australian plant, but is widely distributed
throughout the tropics and used for its medicinal effects (Rajamanickam et al., 2010).
Therefore, the present study isolated endophytic bacteria from wild D. visocosa to evaluate
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 65
their beneficial traits, including effects on Canola growth. The bacteria were also tested for
their antifungal ability against phytopathogenic fungi.
3.2 Materials and Methods
The study presented was carried out in the Molecular Systematics and Applied Ethnobotany
Laboratory (MOSEL), Department of Biotechnology, Quaid-i-Azam University, Islamabad.
The experiments performed included the isolation and identification of endophytic bacteria
from Dodonaea viscosa, and their characterization on the basis of various in-vivo and in-vitro
plant growth promotion and biocontrol assays. Detailed methods are as under and recipes are
provided in Appendix A.
3.2.1 Collection of plant samples
Wild Dodonaea viscosa L. was collected from three sites located within the campus area of
Quaid-i-Azam University, Islamabad. The samples were immediately brought to laboratory
and processed for isolation of endophytic bacteria.
3.2.2 Isolation of endophytic bacteria
Culturable bacteria were isolated from the roots of D. viscosa using a modified approach of
Rashid et al. (2012). The roots were washed with tap water to remove adering soil and
reduced to 2-3 cm cuttings and mixed together. The cuttings were then surface sterilized by
washing with 70% ethanol (2 minutes) followed by a wash with commercial bleach (5
minutes), and then washed 5 times with sterile distilled water. Water from the last wash was
plated on Tryptic Soy agar (TSA) to ensure no epiphytes were selected. About 5-6 cuttings
were macerated in 5 ml of sterile 0.03 M MgSO4 using an autoclaved mortar and pestle, and
kept in a laminar flow cabinet for 30 minutes at room temperature. The macerate (100 µl)
was serially diluted up to 10-3 using 900 µl of diluent (0.03 M MgSO4) in each dilution tube,
and 100 µl of each dilution was spread plated on half strength Tryptic Soya agar (TSA) and
Nutrient agar (NA), and on R2A agar medium. The inoculated media were incubated for 3-5
days at 30°C. Dilutions were plated in replicates on each growth medium.
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 66
3.2.3 Enumeration of endophytic bacteria
After 3-5 days incubation, several morphologically different colonies appeared on all the
above three types of media (TSA, R2A agar and NA). All the incubated plates were carefully
observed and the numbers of colonies were counted for each media plate, and finally bacteria
were enumerated as colony forming units per gram fresh weight (cfu/gfw) using the
following formula.
Plate
count
X
10 X Dilution
Factor X 50 ÷
Weight
of
roots
= cfu /
gfw
30-300
colonies
Cells in
1 ml of
dilution
Cells in
macerate
serially
diluted
Cells in
total
macerate
Grams
Cells
per
gram
root
tissue
3.2.4 Selection and maintenance of pure strains
Morphologically distinct bacterial colonies were selected from the isolation procedure on the
basis of color, shape, texture, size and gram reaction, The pure bacteria were maintained on
half strength TSA slants at 4°C.
3.2.5 Bacterial preservation in glycerol stock
Glycerol stocks are important for long-term storage of bacterial strains. Tryptic Soya broth
(TSB) medium was prepared and autoclaved for 20 minutes at 121°C. A pure bacterial
culture was inoculated into the broth using a wireloop, and the culture was incubated
overnight at 30°C. Next day, 700 µl of the overnight culture was mixed with 300 µl of 50%
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 67
glycerol solution (50% glycerol in 50% distilled water) in a cryovile. The prepared bacterial
glycerol stocks (15% glycerol) were immediately stored at -80ºC.
3.2.6 In-vivo plant growth promotion assay
Bacterial isolates were examined for their ability to promote canola plants using gnotobiotic
roots elongation assay on filter paper.
3.2.6.1 Seed Collection
Canola seeds were collected from National Agricultural Research Centre (NARC),
Islamabad.
3.2.6.2 Gnotobiotic Canola root elongation assay
Modified method of Penrose and Glick (2003) was used to determine the ability of
endophytic bacteria to enhance canola root elongation. Canola seeds were surface sterilized
by washing with 70% ethanol for 1 min and 20% commercial bleach (1% NaOCl) for 10 min.
Residual chemicals were removed by washing 10 times with sterile distilled water. Bacteria
were grown in half strength TSB for 48 hours, cells were harvested by centrifugation at 5000
rpm at 4°C and washed twice with 0.03 M MgSO4 and resuspended to an absorbance of about
0.1±0.02 at 600 nm. The suspension was used to treat the surface sterilized seeds for 1 hour at
room temperature. The bacterized seeds were then dried on sterile filter paper in petri plates
for 15 minutes. Then, the treated seeds were transferred to sterile petri plates containing filter
paper flooded with 5 ml sterile distilled water. Each treatment contained 18 seeds arranged in
6 plates (3 seeds per plate). Surface sterilized seeds treated with sterile 0.03 M MgSO4 were
used as a control. The prepared plates were incubated at 25°C and 60% relative humidity in a
plant growth chamber with 12 h light/dark cycles. Root emerging from the plantlets were
measured on day 5. The roots lengths of top 12 plantlets (showing highest root length) per
treatment were considered for further analysis. Treated plant root lengths were compared to
control plants by means of one way ANOVA and Least Significant Difference (LSD)
(pairwise comparison) at p value ≤0.05 using Statistix v8.1 software.
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 68
3.2.7 In-vitro plant growth promotion assays
The isolated endophytic bacteria were analyzed for different traits consistent with plant
growth promotion, plant colonization and biocontrol of phytopathogens. The details are as
under.
3.2.7.1 Indole acetic acid production
IAA production by the bacterial endophytes was estimated using the modified method of
Gordon and Weber (1951), as described in Section 2.2.9.1. Briefly, bacteria were grown in
TSB at 30˚C for 24 hours in the presence and absence of tryptophan (200 μg/ml). The cells
were harvested by centrifugation at 10,000 rpm for 10 minutes. The supernatant (1 part) was
mixed with Salkowski reagent (2 parts), mixture was incubated at room temperature for 25
minutes, and the reaction was analyzed at 535 nm. Amount of IAA produced by individual
strains was evaluated using the formula generated through the standard curve of IAA (Section
2.2.9.1.1). Experiment was performed in duplicate and values were averaged.
IAA produced (µg/ml) = (Sample Absorbance + 0.004) ÷ (0.0369)
3.2.7.2 Phosphate solubilization
The tri-calcium phosphate containing minimal medium was used to qualitatively measure of
bacterial phosphate solubilization (Kuklinsky-Sobral et al., 2004). The media was prepared
and sterilized by autoclaving. An overnight bacterial culture was spot inoculated on the
prepared media. The inoculated media was incubated for 2-3 days at 30°C. Bacteria
producing zone of clearing around the colony were taken as positive for the phosphate
solubilization activity. The experiment was performed in triplicate.
3.2.7.3 Siderophore production
Siderophore production by the isolates was tested using the CAS agar medium prepared
following a modified method of Schwyn and Neilands (1958) as described by Alexander and
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 69
Zuberer (1991). The media contents were prepared in four separate parts (Fe-CAS indicator
solution, 1; buffer solution, 2; nutrient solution, 3; casamino acid solution, 4). To prepare the
final media, sterile nutrient solution (cooled to 50°C) was mixed with sterile buffer solution
along with 30 ml filter-sterilized casamino acids solution, and indicator solution was added to
this mix with gentle stirring to mix the contents without forming bubbles. The media was
poured in the sterile plates and allowed to solidify. Overnight bacteria cultures were spot
inoculated on the prepared media and incubated at 30ºC for 48-72 hours. Production of a
yellow to orange halo around the bacterial colony confirmed siderophore production. The
experiment was performed in triplicates.
3.2.8 Plant cell-wall degrading enzymes
Isolated bacteria were examined for the ability to produce plant cell-wall targeting Cellulase
and Pectinase using qualitative assays.
3.2.8.1 Cellulase activity
Cellulose-congo red agar was used to analyze the cellulase production by the isolates as
described in Section 2.2.10.1 (Hendricks et al., 1995). Briefly, bacterial were spot inoculated
on the media and incubated for 3-5 days at 30ºC. Following incubation, the clearing zones
around colonies indicated Cellulase production. The test was performed in triplicate. Zones of
hydrolysis (cm) produced by bacteria were converted into three categories (large, >2.0 cm;
medium 1-2 cm; small, <1 cm) for plotting them in graph.
3.2.8.2 Pectinase activity
Pectin containing minimal media was used to identify Pectinase producing bacteria (Hankin
et al., 1971). Overnight grown bacteria were inoculated on the media and incubated at 30ºC
for 3-5 days. The zones of hydrolysis of pectin around bacterial colonies were visualized by
flooding culture plates with iodine solution (Ouattara et al., 2008). The experiment was
performed in triplicate. Zones of hydrolysis (cm) produced by bacteria were converted into
three categories (large, >2.0 cm; medium 1-2 cm; small, <1 cm) for plotting them in graph.
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 70
3.2.9 Fungal cell-wall degrading enzymes
Isolated bacteria were examined for the ability to produce fungal cell-wall targeting Protease
and Chitinase using qualitative assays.
3.2.9.1 Protease activity
The protease activity of selected bacterial strains was determined using skim milk agar
medium (Bibi et al., 2012) as described in section 2.2.11.1. Briefly, media was prepared by
mixing TSA with 1% skimmed milk. Overnight grown bacterial cultures were spot inoculated
on the prepared media and incubator at 30ºC for 2 days. Protease activity was confirmed by
the appearance of zones of clearing around the colonies. Test was performed in triplicate.
Zones of hydrolysis (cm) produced by the bacteria were converted into three categories
(large, >2.0 cm; medium 1-2 cm; small, <1 cm).
3.2.9.2 Chitinase activity
Chitinase activity was tested by using chitinase screening media containing chitin (Bibi et al.,
2012). Chitinase media was prepared by adding 0.6% w/v colloidal chitin to half strength
TSA as described in section 2.2.11.2. Bacteria were spot inoculated on media and incubated
at 30º C for 5 days. Appearance of clear zones around the bacteria indicated Chitinolytic
activity and the bacteria were noted as positive for the activity. The tests were performed in
triplicate.
3.2.10 Antagonistic activities against pathogenic fungi
Antifungal potential of the isolated bacteria was determined against Aspergillus niger and
Fusarium oxysporum using Dual culture method as described previously in section 2.2.12.
Test bacteria were inoculated on the sides and the fungi were inoculated in the center of agar
medium containing 1:1 ratio of potato dextrose agar (PDA) and TSA (Kumar et al., 2012).
Culture plates were incubated at 30°C for 5-7 days and bacterial colonies antagonizing fungal
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 71
growth were identified by presence of zone of inhibition at the point of interaction. The test
was performed in triplicate.
3.2.11 Molecular identification of endophytic bacterial
Bacterial isolates were identified based on their 16S rRNA gene sequence. For this, the test
bacteria were propagated on TSA by incubating at 30°C for 24 hours. The bacteria were then
processed for genomic DNA extraction, followed by PCR amplification of 16S rRNA gene,
purification of the PCR product, sequencing of the PCR product, and analyses of resulting
sequences for identification of bacteria.
3.2.11.1 Bacterial genomic DNA extraction
Purified bacterial colonies were processed for genomic DNA isolation as described in
previously in section 2.2.13.1. Briefly, each colony was carefully transferred to a PCR tube
containing 100 μl of lysis buffer. The tubes containing the mixture were heated at 95°C for
10 minutes in thermocycler followed by centrifugation at 14000 rpm for 10 minutes to pellet
the cell debris. The supernatant containing genomic DNA was collected and stored at -20°C
for further processing.
3.2.11.2 PCR amplification of 16S rRNA gene
Supernatant (containing genomic DNA) collected from above procedure was used as a
bacterial template for PCR reaction as described in section 2.2.13.2. Bacterial 16S rRNA
gene was amplified using the universal primers 27F and 1492R. PCR reaction mixture (50
µL) was prepared containing forward and reverse primers, template DNA, and PCR Master
Mix in PCR grade water. PCR amplification was performed with initial denaturation at 94°C
for 5 minutes, followed by 30 cycles of denaturation (94°C for 30s), annealing (55°C for 30s)
and extension (72°C for 1 minute) with a final extension at 72°C for 10 min. The resulting
PCR product (approximately 1500 bp) was visualized on 1% agarose gel containing ethidium
bromide and compared to a 1 kb ladder for size confirmation, as described in section 2.2.13.3.
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 72
3.2.11.3 PCR product purification
PCR products were purified using PureLink PCR Purification Kit (Invitrogen, USA)
according to provided instructions, as described in section 2.2.13.4. The purified DNA was
confirmed by agarose gel electrophoresis as described in section 2.2.13.3 and stored at -20°C
for further processing.
3.2.11.4 16S rRNA gene sequencing and analysis
For sequencing of 16S rRNA gene, the purified PCR products of amplified 16S rRNA gene
were sent to Macrogen, Inc. (South Korea). The sequences were analyzed for their quality
using BioEdit v7.0.5 program and trimmed. The trimmed sequences were used to identify
bacteria using Basic Local Alignment Search Tool (BLAST) search tool against the GenBank
database available at the National Center for Biotechnology Information Search database
(NCBI; https://www.ncbi.nlm.nih.gov/) website. The bacteria were identified based on their
maximum score and percentage similarity (≥99%) with other GenBank bacterial accession.
For determining bacterial similarity with type strains, Eztaxon server version 2.1 was used
(http://www.ezbiocloud.net/; Kim et al., 2012b). The sequences of the identified bacteria
were deposited at GenBank.
3.2.11.5 Phylogenetic analysis of endophytic bacteria
The evolutionary linkages among the isolates were assessed through phylogenetic analysis.
For this, multiple alignments were first performed for the 16S rRNA gene sequences of the
isolates using ClustalXv2.1. The aligned sequences were then constructed into a phylogenetic
tree based on Neighbor-Joining method (Bootstrap using 500 replicates) using MEGA5
software.
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 73
3.3 Results
The present work was carried out for the isolation, screening and characterization of
endophytic bacteria from Dodonaea viscosa. The bacteria were isolated from roots, and were
identified and then analyzed for different traits consistent with plant growth promotion, plant
invasion and biocontrol of phytopathogenic fungi. The details of the results are as follows:
3.3.1 Isolation of endophytic bacteria
After enumeration of isolated bacteria, a total of 15 distinct bacteria were selected on the
basis of colony size, morphology, shape, and color and growth pattern. Highest cell counts
were on R2A agar (1×107 cfu/gfw) followed by TSA (8.5×106 cfu/gfw) and NA (5×106
cfu/gfw) (Table 3.1). These selected colonies were further purified by repeated sub culturing.
Table 3.1 Number of bacterial isolates recovered from Dodonaea viscosa roots along with average
cell counts recovered on three growth media.
Source Direct Isolation
Total bacteria isolates 15
TSA 8.5×106 cfu/gfw
R2A 1×107 cfu/gfw
NA 5×106 cfu/gfw
3.3.2 Identification of endophytic bacteria
Bacteria were identified based on their 16S rRNA gene sequence. For this, genomic DNA
extracted from the overnight grown bacteria was used as a template for PCR reaction. PCR
amplification of the 16S rRNA gene of the isolates yielded a product close to 1500 bp. PCR
amplicons were sequenced commercially and sequence quality was analyzed using BioEdit
program. The sequencing electropherogram revealed that all sequences were clean and of
good quality. The resulting partial sequences were used to identify the endophytic isolates
using GenBank and Eztaxon databases.
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 74
Results from GenBank and Eztaxon analysis revealed that a diversity of bacterial genera were
isolated from Dodonaea viscosa roots. The identified bacteria belonged to 10 distinct genera
namely Agrococcus, Bacillus, Brevundimonas, Inquilinus, Microbacterium, Pseudomonas,
Rhizobium, Streptomyces, Stenotrophomonas, and Xanthomonas, (Figure 3.1). Bacillus was
the major genus representing 26% of all the isolated strains. Xanthomonas and Streptomyces
represent 13% each, while rest of the genera represented 7% of the total isolates.
Figure.3.1 Percentage of endophytic bacterial genera isolated from D. viscosa
Most of the isolates shared more than 99-100% homology to the closest type strain based on
the analysis of EzTaxon server. However, three isolates (MOSEL-RD3, MOSEL-RD25 and
MOSEL-RD40) shared less than 99% similarity to their respective type strains, while
MOSEL-RD14 was least similar (98.48%) to the closest type strain among all the tested
isolates. Furthermore, all isolates shared 99-100% similarity to a GenBank submission,
analyzed using BLAST program. The 16S rRNA gene sequences of identified endophytic
bacteria have been deposited at GenBank database, where each submission has been given a
unique accession number (Table 3.2)
0
5
10
15
20
25
30
Per
cen
tag
e
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 75
Table 3.2 Identification of endophytic bacteria isolated from Dodonaea viscosa roots. GenBank
match similarity was ≥99% for all isolates while their Eztaxon match similarity and GenBank
accession is given below.
Strain
(MOSEL) GenBank closest match
EzTaxon closest match
(type strain)
Similarity
(%)
Genbank
accession
RD1 Inquilinus limosus Inquilinus limosus AU476
99.71 KJ591012
RD2 Xanthomonas sp. Xanthomonas sacchari LMG
471 99.60 KJ591013
RD3 Streptomyces sp. Streptomyces alboniger
NBRC 12738 98.90 KJ591014
RD7 Bacillus idriensis Bacillus idriensis SMC
4352-2 99.30 KJ591015
RD9 Xanthomonas translucens Xanthomonas translucens
DSM 18974 99.80 KJ591016
RD12 Rhizobium huautlense Rhizobium huautlense S02 100.00 KJ591017
RD14 Microbacterium sp
Microbacterium
trichothecenolyticum IFO
15077
98.48 KJ591018
RD17 Streptomyces caeruleatus Streptomyces caeruleatus
GIMN4 99.90 KJ591019
RD19 Bacillus simplex Bacillus simplex NBRC
15720 100.00 KJ591020
RD23 Pseudomonas putida Pseudomonas taiwanensis
BCRC 17751 99.90 KJ591021
RD25 Brevundimonas sp.
Brevundimonas
subvibrioides ATCC 15264
98.90 KJ591022
RD27 Bacillus cereus Bacillus cereus ATCC 14579 100.00 KJ591023
RD28 Bacillus subtilis Bacillus subtilis NCIB 3610
99.90 KJ591024
RD36 Pseudomonas geniculata Pseudomonas geniculate
ATCC 19374 100.00 KJ591025
RD40 Agrococcus terreus Agrococcus terreus DNG5 98.60 KJ591026
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 76
3.3.3 Phylogenetic Analysis
Evolutionary relatedness of the endophytic bacterial isolates was determined based on
their 16S rRNA gene sequences. For this, sequences were first aligned with ClustalX v2.1
and a phylogenetic tree was constructed using Mega5 software. The results revealed that all
bacteria significantly promoting canola root growth (MOSEL-RD2, MOSEL-RD3, MOSEL-
RD7, MOSEL-RD9, MOSEL-RD14, MOSEL-RD17, MOSEL-RD19, MOSEL-RD23,
MOSEL-RD27, MOSEL-RD28, MOSEL-RD36, and MOSEL-RD40) clustered together in to
two separate clades (100% Bootstrap value). The isolates belonged to genera Agrococcus,
Bacillus, Microbacterium, Pseudomonas, Streptomyces, and Xanthomonas (Figure 3.2). Since
all the members included in a single cluster are phylogenetically related, the present result
indicates that the ability to promote plant growth is evolutionary conserved in the endophytic
bacteria.
Figure 3.2 Phylogenetic tree of endophytic bacteria isolated from Dodonaea viscosa roots constructed
with 16S rRNA gene sequences using the Neighbour-Joining method. Branch points show bootstrap
percentages (500 replicates). Bar 0.02 indicates changes per nucleotide position. Clusters enclosed in
red boxes contain isolates significantly promoting canola growth.
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 77
3.3.4 Production of IAA
All the isolates produced IAA and the ability imporved in the presence of tryptophan (Figure
3.3). IAA concentrations in the medium after 2 days ranged from 0.88-23.7 µg/ml with
tryptophan and from 0.36-9.02 µg/ml without tryptophan. Isolates in order Pseudomonas
taiwanensis (23.7 µg/ml), Agrococcus terreus (15.34 µg/ml), Pseudomonas geniculate (15.32
µg/ml), Bacillus cereus (10.8 µg/ml), Bacillus idriensis (10.12 µg/ml) and Bacillus subtilis
(8.5 µg/ml) were the highest IAA producing strains.
Figure 3.3 IAA production by bacteria isolated from Dodonaea viscosa roots (Blue bars, without
tryptophan; Orange bars, with tryptophan). Values represent mean of three replicates.
3.3.5 Nutrient availability
Bacterial isolates were assessed for their ability to facilitate phosphorus and iron availability
for plant host. Among the 15 isolates, some 12 isolates (80%) were phosphate solubilizer as
confirmed by clear zones around their colonies (Figure 3.4). These phosphate solubilizers
0
5
10
15
20
25
IAA
pro
du
ced
(µ
g/m
l)
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 78
belonged to the genera Bacillus, Brevundimonas, Inquilinus, Pseudomonas, Rhizobium,
Streptomyces, and Xanthomonas (Table 3.3). Furthermore, all isolates belonging to Bacillus
and Streptomyces were mineral phosphate solubilizers.
Figure 3.4 Tri-calcium phosphate medium plate showing phosphate solubilization activity of
Streptomyces caeruleatus MOSEL-RD17
Furthermore, about 60% isolates produced Siderophores indicated by the appearance of
orange halos around the bacterial colony on a blue media (Figure 3.5). Most prominent
Siderophore producing bacteria belonged to genera Bacillus and Streptomyces while others
belonged to Agrococcus, Microbacterium, and Pseudomonas (Table 3.3).
Figure.3.5 Siderophore production by Bacillus cereus MOSEL-RD27 on the test media.
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 79
Table 3.3 Phosphate solubilization and Siderophore production activity of endophytic bacteria
isolated from Dodonaea viscosa roots.
Isolate P solubilization Siderophore
Agrococcus terreus MOSEL-RD40 - +
Bacillus cereus MOSEL-RD27 + +
Bacillus idriensis MOSEL-RD7 + +
Bacillus simplex MOSEL-RD19 + -
Bacillus subtilis MOSEL-RD28 + +
Brevundimonas subvibrioides MOSEL-RD25 - -
Inquilinus limosus MOSEL-RD1 + -
Microbacterium trichothecenolyticum MOSEL-RD14 - +
Pseudomonas geniculata MOSEL-RD36 + +
Pseudomonas taiwanensis MOSEL-RD23 + +
Rhizobium huautlense MOSEL-RD12 + -
Streptomyces alboniger MOSEL-RD3 + +
Streptomyces caeruleatus MOSEL-RD17 + +
Xanthomonas sacchari MOSEL-RD2 + -
Xanthomonas translucens MOSEL-RD9 + -
(+), activity present; (-), activity absent.
3.3.6 Production of plant cell-wall degrading enzymes
The isoaltes were tested for their ability to produce plant cell-wall degrading enzymes
Cellulase and Pectinase. All strains showed strong Pectinase activity indicated by large zone
of hydrolysis on pectin containing media. Moreover, all isolates produced zones of hydrolysis
larger than 1 cm while 54% produced zones larger than 2 cm. The isolates with highest
activites belonged to the genera Bacillus, Microbacterium, Streptomyces, Xanthomonas
(Figure 3.6). Furthermore, all the isolates also displayed Cellulase activity indicated by zone
of hydrolysis produced on Cellulose (CMC) containing media. Most of the isolates (67%)
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 80
produced zones larger than 1 cm while 26% produced zones larger than 2 cm for the
Cellulase activity. The isolates producing highest zone sizes belonged to the genera Bacillus,
Microbacterium and Streptomyces. Finally, all isolates displaying strong Cellulase activity
were also prominent in their Pectinase activity (Figure 3.6).
Figure 3.6 Cellulase (blue bars) and Pectinase (orange bars) assay of endophytic bacteria isolated
from Dodonaea viscosa roots. Values of zones of hydrolysis produced by bacteria have been
organized into three categories based on the size: 3, large (>2 cm); 2, medium (1-2 cm); 1, small (<1
cm).
3.3.7 Production of Fungal cell-wall targeting enzyme
The bacterial isolates were tested for their Protease and Chitinase production ability using
qualitative tests (Figure 3.7). With the exception of Bacillus simplex MOSEL-RD19 and
Rhizobium huautlense MOSEL-RD12, all the isolates displayed protease activity. Moreover,
about 74% of the isolates produced zones larger than 1 cm while 34% produced zones larger
than 2 cm when tested for Protease activity. Xanthomonas was the prominent genera for
Protease activity followed by Agrococcus, Bacillus and Microbacterium. In case of Chitinase
1
3
2 2
3
1 1
3
2 2 2
3
1
2
1
2
3 3
2
3
2 2
3
2 2 2
3 3 3 3
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 81
activity, only 40% of the isolates were positive for the activity. These isolates belonged to
genera Bacillus Microbacterium, Pseudomonas and Streptomyces. Finally, all Chitinase
positive bacteria were also positive for Protease activity (Table 3.4)
Table 3.4 Protease production (PRO), Chitinase production (CHI), Anti-Aspergillus niger (AN), and
Anti-Fusarium oxysporum (FO) activities of endophytic bacteria isolated from Dodonaea viscosa
roots.
Isolate PRO CHI AN FO
Agrococcus terreus MOSEL-RD40 +++ - - -
Bacillus cereus MOSEL-RD27 ++ + + +
Bacillus idriensis MOSEL-RD7 ++ + + +
Bacillus simplex MOSEL-RD19 - - - -
Bacillus subtilis MOSEL-RD28 +++ + + +
Brevundimonas subvibrioides MOSEL-RD25 ++ - - -
Inquilinus limosus MOSEL-RD1 + - - -
Microbacterium trichothecenolyticum MOSEL-RD14 +++ - - -
Pseudomonas geniculata MOSEL-RD36 ++ + + +
Pseudomonas taiwanensis MOSEL-RD23 ++ + + +
Rhizobium huautlense MOSEL-RD12 - - - -
Streptomyces alboniger MOSEL-RD3 + + + +
Streptomyces caeruleatus MOSEL-RD17 ++ + + +
Xanthomonas sacchari MOSEL-RD2 +++ - - -
Xanthomonas translucens MOSEL-RD9 +++ - - -
(+), activity present; (-), activity absent; (+), smaller halos around colonies (<1 cm); (++), medium
halos around colonies (1-2 cm); (+++), large halos around colonies (>2 cm)
3.3.8 Antifungal Assay
Antifungal activity of the bacterial isolates against phytopathogenic fungi was examined
using dual culture assay (Figure 3.8). All the isolates were screened for antifungal activity
against Fusarium oxysporum and Aspergillus niger. About 47% of the isolates inhibited the
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 82
growth of the two phytopathogenic fungi. Bacillus and Streptomyces were the most
prominent genera in this activity followed by Pseudomonas. Interestingly, all active isolates
inhibited the growth of both the test fungi. Moreover, all the active isolates also displayed
Chitinase activity indicating strong correlation between these activities (Table 3.4).
Figure 3.7 Skimmed milk containing media showing Protease activity (left) and Colloidal chitin
media showing Chitinase activity (right) by Bacillus subtilis MOSEL-RD28
Figure 3.8 Anti-Aspergillus niger (left) and Anti-Fusarium oxysporum (right) activity of selected
endophytic bacteria isolated from Dodonaea viscosa roots.
3.3.9 Canola gnotobiotic root elongation assay
Canola root elongation assay was performed under controlled condition. Canola seeds were
inoculated and grown in petri plates on filter paper for five days. After five days root length
of emerging platelets was measured and results were compared with uninoculated control
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 83
platelets. Results revealed that 67% of the isolates significantly promoted canola root growth
(LSD; p ≤ 0.05) (Figure 3.9). Compared to the root lengths of non-bacterized control
(9.5±0.33), highest root elongation was done by B. subtilis MOSEL-RD28 (11.92±0.29),
followed by B. idriensis MOSEL-RD7 (11.82±0.34), X. sacchari MOSEL-RD2 (11.52±0.47),
B. cereus MOSEL-RD27 (11.16±0.40), X. translucens MOSEL-RD9 (11.06±0.43), P.
taiwanensis MOSEL-RD23 (10.96±0.28), P. geniculata MOSEL-RD36 (10.76±0.23), S.
alboniger MOSEL-RD3 (10.58±0.30), M. trichothecenolyticum MOSEL-RD14 (10.54±0.43)
and A. terreus MOSEL-RD40 (10.5±0.24).
Figure 3.9 Canola gnotobiotic root elongation assay of endophytic bacteria isolated from Dodonaea
viscosa roots. Each bar represents mean root length (±SE, n=12) of five day old plantlets treated with
sterile 0.03 M MgSO4 (Control) or bacterial suspension in 0.03 M MgSO4 (0.1±0.02 OD at 600 nm).
Green bars represent isolates significantly increasing root length and red bar significantly decreasing
root length compared to control (Least significant difference, p ≤ 0.05).
5
6
7
8
9
10
11
12
13
Ro
ot
len
gth
(cm
)
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 84
Most prominent genera for canola plant growth promotion were Bacillus, Pseudomonas and
Xanthomonas. Present study is the first report of Bacillus idriensis (MOSEL-RD7) as
endophytic growth promoting bacteria and possessed many plant beneficial traits.
Furthermore, most of the bacteria promoting canola root growth produced IAA in the range
of 2-10 µg/ml (Figure 3.3).
3.4 Discussion
In the present work, endophytic bacteria of Dodonaea viscosa roots were investigated
for their potential as bio-inoculants for canola, a commercial crop. A total of 15 endophytic
bacteria were isolated and were screened for different activities important for plant growth
promotion, plant invasion and biocontrol of phytopathogenic fungi. The endophytic bacterial
isolates possessed many plant growth promoting (PGP) traits including phosphare
solubilization, IAA production, and siderophore production. Bacillus was the predominant
bacterial genera this was also reported by Kim et al. (2011). Bacillus has also been reported
as an endophyte in Tomato, Polygonum cuspidatum and Aquilaria spp. (Figueiredo et al.,
2009; Krishnan et al., 2012; Feng et al., 2013). Futhermore, Bacillus and Pseudomonas have
been frequetly reported to endophytically colonize the plant roots and benefit their host
(Kumar et al., 2011). Similarly, Microbacterium genera isolated here as an endophyte was
also reported by Rashid et al. (2012) as a tomato endophyte. These findings are further
supported by the work of Kim et al. (2012c), as they isolated Actinobacteria (endophytic
Microbacterium) from herbaceous plants.
Plant cell-wall targeting Cellulases and Pectinases are important for the systemic plant
colonization and plant beneficial endophytic bacteria are known to produce these hydrolytic
enzymes (Verma et al., 2001). All the endophytic strains in the present work produced
Cellulase and Pectinase. Cellulases and pectinases are found to be important in root
colonization of microbes within host plant tissue for a deeper interaction (Reinhold-Hurek
and Hurek, 2011) and to protect plant host (Quadt-Hallmann and Kleopper, 1996). This trait
is more important for the establishment of these strains on a wide variety of plant hosts.
All the isolates produced IAA in lowers amounts and production increase 2-3 folds in the
presence of tryptophan. Few isolates Agrococcus terreus, Bacillus cereus, Bacillus idriensis,
Bacillus subtilis, Pseudomonas geniculate, and Pseudomonas taiwanensis showed higher
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 85
IAA production than other bacteria. Bacteria producing IAA in the range of 2-10 µg/ml were
mostly plant growth promoting. IAA producing bacteria are known to enhance root length
(Patten and Glick, 2002).
Most of the phosphate solubilizing isolates belonged to the genera Bacillus, Brevundimonas,
Inquilinus, Pseudomonas, Rhizobium, Streptomyces, and Xanthomonas. Bacillus,
Enterobacter, Pseudomonas and Serratia have been repored for their mineral phosphate
solubilizing potential to benefit plant growth (Frey-Klett et al., 2005; Hameeda et al., 2008).
Improved phosphorous nutrition can indeed influence overall plant health by improving root
development (Jones and Darrah, 1994). Bacteria belonging to the genera Bacillus,
Pseudomonas, Microbacterium and Streptomyces also produced siderophore. Numerous
reports have indentified Bacillus, Enterobacter, Pseudomonas and Streptomyces as
siderophore producers (Tian et al., 2009; Khamna et al., 2009). Siderophore production by by
the endophytic bacteria can improve plant growth and health by imcreasing iron availability
for the host plant and depleting iron for the pathogens to limit their growth Pieterse et al.,
2001; Glick, 2003).
Some endophytic isolates also produced fungal cell wall trgeting Chitinases and Proteases
The bacteria can be employ these enxymes to control plant fungal diseases. Bacterial strains
belonging to genera Bacillus, Pseudomonas and Streptomyces showed chitinase activity.
These strains also showed antifungal activity against Fusarium oxysporum and Aspergillus
niger. Azotobacter sp., Pseudomonas sp. and Bacillus sp. are reported for antifungal activity
(Ahmad et al., 2008). Degradation of fungal cell wall by Chitinases is reported by Gupta et al.
(2006). Kim and Chung (2004) reported that Proteases and Chitinases are involved in
inhibiting plant fungal pathogen to function as biological control agents. Infact,
Agrobacterium, Azotobacter, Bacillus, Enterobacter, Erwinia, Serratia, Streptomyces and the
fluorescent Pseudomonas strains can function capable as biocontrol agents (Narula et al.,
2009). Plant beneficial bacteria can also act as biocontrol agents by producing hydrogen
cyanide besides producing fungal cell-wall targeting enzymes (Hayat et al., 2010). Bacillus
subtilis and Bacilli cereus are the usual candidates for use as biocontrol agents (Nagórska et
al., 2007).
Chapter 3
Agriculturally beneficial endophytic bacteria of wild plants 86
All the endophytic bacteria isolated in this study showed at least one positive activity of plant
growth promotion. Roots were elongated by all isolates except Inquilinus limosus and
Rhizobium huautlense which showed negative effects i.e. root length value lower than the
negative. Canola root elongation assay results showed that Xanthomonas sacchari, Bacillus
idriensis, Xanthomonas translucens, Bacillus cereus and Bacillus subtilis significantly
promoted Canola root length as compared to negative control. Bacillus sp. and Pseudomonas
sp. have been stated to promote plant growth in grape wine, tomato, maize, rice and sugar
beet through various mechanisms (Chauhan et al., 2013). Patel et al. (2012) studied that
Pseudomonas were efficient in enhancing host plant roots. Improved root and shoot
development by Bacillus was reported by Vivas et al. (2003). More interestingly, all the
isolates reported here that significantly promoted canola growth are phylogenetically related,
indicating the ability to promote plant growth is evolutionary conserved.
The plant growth promotion can be strongly attributed to the ability of the bacteria to produce
IAA. Indeed phytohormone IAA can influence plant root growth and development and
thereby improves nutrient uptake from soil (Khalid et al., 2004). However, among all PGP
traits of the isolates, IAA production was the most predominant PGP traits, indicating its
importance for the endophytic growth. IAA can increase root size and surface area which can
lead to increased nutrient uptake by the plants (Li et al., 2008).
To conclude, endophytic bacteria reported here possess numerous traits consistent with PGP.
These bacteria can be exploited for beneficial effects on canola and other commercially
important crop plants. However, to fully harness their plant growth promoting and biocontrol
potential, further investigation is warranted.
Chapter 4
Comparative in-planta transcriptome profiling of selected
Burkholderia phytofirmans PsJN genes using qPCR
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 87
Comparative in-planta transcriptome profiling of selected Burkholderia phytofirmans
PsJN genes using qPCR
Abstract
Burkholderia phytofirmans PsJN is a well-known endophytic bacterium that can promote
growth of a variety of host plants. Only few studies have been done to decipher the
endophytic success of this bacterium. Present investigation is a comparative study to identify
selective expression of 15 bacterial genes during in-planta growth using relative
quantification qPCR. Strain PsJN was vacuum infiltrated into tomato plants and inoculum
dose was optimized for maximum bacterial extraction from leaf tissues. Analysis revealed
that bacteria were actively growing inside the leaf tissues. Since out of four inoculum doses
tested, the dose 109 cfu/ml produced the highest cells counts (108 cfu/gfw) on second day,
this dose was used to inoculate plants for gene expression study. The bacteria were also
grown on M9 minimal media for comparative analysis. Compared to M9 grown bacteria,
total bacterial RNA extracted from in-planta bacteria was lower in quantity and quality, but
RNA was analyzable using qPCR. Using rpoD as an endogenous control for qPCR, the gene
expression was compared between in-planta and M9 bacteria. Eight genes (Cellulase,
Pectinase, IAA degradation, ACC deaminase, β-xylosidase, β-galactosidase, Peroxidase and
one quorum sensing gene) were upregulated in in-planta bacteria, while three genes (IAA
synthesis, Flagella, and second quorum sensing gene) were downregulated. Expression of
Pili, Aerobactin, Hemagglutinin and Type 3 secretion system gene was similar between the
two growth conditions. Present investigation concludes that the bacteria are active in leaf
tissues and confirms expression of bacterial traits compatible with plant growth promotion
and invasion. The present comparative transcriptome profiling of strain PsJN will likely
better elucidate host-bacterial relationship and thus explicate endophytic role of B.
phytofirmans.
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 88
4.1 Introduction
Burkholderia phytofirmans PsJN is a well-known plant growth promoting endophytic
bacteria isolated from onion roots (Pillay and Nowak, 1997). The endophyte can form
beneficial association with a variety of plant hosts, including Arabidopsis thaliana, canola,
grape, maize, potato, switch-grass, tomato and wheat (Sessitsch et al., 2005; Sun et al., 2009;
Sheibani-Tezerji et al., 2015), and can establish endophytic and rhizospheric population in
high numbers (Compant et al., 2008). Many of its plant growth promoting traits have been
identified. These include regulating the plant growth related hormones, ethylene, auxin, and
cytokinins; enhancing plant resistance to plant pathogens; and improving plant adaptation to
environmental stresses like drought, cold, heat and salinity (Sessitsch et al., 2005; Kim et al.,
2012; Theocharis et al., 2012). Moreover, Strain PsJN can successfully establish endophytic
population by their ability to produce plant cell-wall degrading enzymes, cellulase and
pectinase (Compant et al., 2005a). Therefore, Strain PsJN serves to be a model endophytic
bacterium for identifying genes important in the endophytic success of bacteria.
Many plant beneficial endophytic bacteria have been studied to identify genes important in
developing an association and promote of plant growth. The genes identified include those
required for interaction with plant metabolism (Hardoim et al., 2008), production of
metabolites targeting plant pathogens (Mendes et al., 2007), detoxification of contaminants
(Yousaf et al., 2011), bacterial motility and attachment to host cells (Reinhold-Hurek and
Hurek, 2011), bacterial quorum sensing (Zúñiga et al., 2013), production of plant cell-wall
targeting enzymes (Reinhold-Hurek et al., 2006), regulation of plant hormones (Sun et al.,
2009; Zúñiga et al., 2013), environment sensing, and mitigation of oxidative stress (Sheibani-
Tezerji et al., 2015). These studies have made use of mutational approaches (Sun et al.,
2009), RNAseq transcriptome profiling (Sheibani-Tezerji et al., 2015), Relative
Quantification PCR (qPCR) (Zhao et al., 2016), and promoter capturing techniques like in-
vivo expression technology (IVET) and recombinase-based in-vivo expression technology
(RIVET) (Rediers et al., 2003; Ryan et al., 2008).
Although many traits revealing the lifestyle of endophytic bacteria have been identified, little
is known about bacterial physiology, response, and adaptation processes in-planta.
Investigation done by Sheibani-Tezerji et al. (2015) on the transcriptome of Strain PsJN
could not identify many genes deemed crucial for the endophytic colonization and growth
promotion of host plant. Since, Strain PsJN establishes in-planta population in low number,
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 89
getting sufficient quantities of high quality bacterial transcripts can be extremely challenging
(Compant et al., 2005a; Kim et al., 2012; Su et al., 2016). Therefore, a comparative
transcriptome profiling of strain PsJN can reveal a much better picture of bacterial traits
required for a successful host-bacterial relationship, that has not been reported earlier
(Sheibani-Tezerji et al., 2015).
Aims and objectives
Aim of the present work was to study the in-planta expression of 15 Burkholderia
phytofirmans PsJN genes important for plant growth promotion, plant invasion and
association. For this, expression of the genes was compared with the bacteria grown on M9
minimal media to identify the genes selectively expressed during in-planta bacterial growth.
The comparative transcriptome profiling of strain PsJN will likely better elucidate host-
bacterial relationship and thus explicate endophytic role of the bacterium.
4.2 Materials and Methods
4.2.1 Performance of experimental work
The experiments were performed in the Department of Plant and Microbial Biology,
University of California Berkeley, California, USA. All materials required for the
experimentation were provided by the department. The details of methods are as under and
recipes are provided in the Appendix A.
4.2.2 Propagation of Bacteria
Burkholderia phytofirmans strain PsJN was grown overnight in Kings B broth at 30°C
(Sessitsch et al., 2005). The cells were harvested through centrifugation at 5000 rpm for 10
min and suspended in 10 mM potassium phosphate and the suspension was used to inoculate
tomato plants. Four different cell densities (104, 106, 108, and 109 cfu/ml) were prepared for
inoculating the test plants.
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 90
4.2.3 Plant bacterization using Vacuum Infiltration
To ensure that maximum bacteria are introduced in to the plants to attain high cell densities,
Vacuum Infiltration technique was employed (Yu et al., 2013). For this, tomato plants were
grown for four weeks under greenhouse conditions using a standard potting mix. Plants were
then brought to the lab for inoculation with strain PsJN. About 1.5 L of bacterial suspension
was prepared to completely submerge plants during the inoculation process. The pots were
first covered with paper towels to prevent soil from contaminating the suspension during the
process and to prevent suspension from flooding the pot soil. The filtration assembly was
setup in a fume hood by connecting the vacuum chamber to the intermediate cooling flask
connected to a vacuum pump through flexible pipes. The cooling flask was placed in a bucket
containing dry ice to improve the suction process. The container filled with 1.5 L of bacteria
suspension was placed in the vacuum chamber and the tomato plants were inverted and
submerged, ensuring that only the plant part is dipped in the suspension. The vacuum pump
was switched on for about 3 minutes to allow leaf stomata to open and suck up the inoculum.
After bubbling, the pump was switched off and the vacuum was kept for about 2 minutes to
stabilize the suspension. Then, the vacuum was gradually released by removing the pipe
connected to the vacuum chamber, thus preventing the inoculum to escape from the opened
leaf stomata. The inoculated plants were dried at room temperature by placing them on lab
bench top for 1 hour. The bacterized plants were placed in green house to allow bacterial-
plant interactions to develop. Non-bacterized control plants were also placed in the green
house.
4.2.4 Bacterial estimates in the inoculated plants
To determine the ideal inoculation dose for obtaining high cell number from leaf tissues, the
tomato plants were inoculated with four different doses of bacterial suspension (104, 106, 108,
and 109 cfu/ml). In order to determine the abundance of bacteria post inoculation, three
leaves from bacterized plants were collected at day 0, 2, 4 and 6. The leaves were washed
with tap water, weighed and surface sterilized by dipping in a solution of 15% Hydrogen
Peroxide for 3 minutes. The residual chemical was removed by washing the sterilized leaves
(5 times) with sterile distilled water. To confirm the surface sterilization, small volume of
water from the last wash was plated on Kings B agar and incubating overnight at 30°C.
Sterilized leaves were macerated using mortar and pestle in 5 ml of 10 mM potassium
phosphate and 100 µl of macerate was serially diluted using the same buffer (900 µl diluent
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 91
in each tube). The dilutions were plated (100 µl) on Kings B Agar, incubated overnight at
30°C, and then bacteria were enumerated for tested dose and day of analysis using the
equation shown below.
Plate count
X
10 X Dilution
Factor X 50 ÷
Weight of
leaves = cfu / gfw
(30-300
colonies)
(cells in
dilution
tube)
Serial
Dilution
plated
(total cells
in
macerate)
grams
Cells per
gram leaf
tissue
The bacterial counts were converted to log values and plotted on graph using Microsoft Excel
program.
4.2.5 Bacterial Recovery for RNA extraction
Bacteria were recovered on day two post inoculation (plants inoculated with 109 cfu/ml
bacteria) using a modified approach of Yu et al. (2013) and four plants were processed at a
given time. To ensure protection of bacteria RNA during recovery process, RNA protective
solution was used to collect bacteria cells from bacterized leaves. A total of 30-50 leaves
were collected and submerged immediately in 1 L of ice cold Phenol-Ethanol Stop solution
(RNA protective solution), which is an acidic phenol RNA-stabilizing solution that protects
cellular RNA from degradation by RNases.
The leaves were evenly chopped into 0.5 cm squares while submerged in the ice cold
protective solution, and the plant mixture was sonicated for 10 min to dislodge the bacterial
cells from internal leaf tissue. The mixture was initially filtered through Whatman No. 1 filter
using a vacuum filtration flask to remove plant material, with repeated filter changes for a
better flow rate. The filtrate was centrifuged at 10,000 rpm for 10 min, and the pellet was
suspended in residual supernatant. To remove smaller plant matter, the resulting suspension
was filtered through a 5-μm filter, by repeatedly changing the filter for a better flow. The
bacterial cells were harvested from the final filtrate by centrifugation at 10,000 rpm for 10
min, and the pellets were stored at -80°C. The cells collected from four plants on a single day
served as a biological replicate, and three biological replicates were thus produced. Non-
bacterized control plants were processed following the same recovery process.
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 92
For a comparative study, strain PsJN was also propagated on a minimal media. For this, the
bacteria were grown overnight on M9 minimal agar at 30°C. Growth was removed with a flat
spatula and immediately transferred to 5 ml of ice cold RNA-Stop solution. The mixture was
vortexed for 30 seconds to evenly dissolve the cells in the protective solution. The mixture
was then centrifuged at 10,000 rpm for 5 minutes at -20°C, and the resulting pellets were
stored at -80°C.
4.2.6 RNA extraction from bacterial pellets
For RNA extraction, frozen cell pellets were thawed by keeping on ice for 5-10 minutes, and
three biological replicates were mixed two make one sample. Total RNA extraction from
these cells was performed using the TRIzol-RNeasy hybrid RNA extraction protocol. The
bacterial pellets were resuspended in 1 ml of TRIzol reagent (Invitrogen, USA) and were
transferred to 2 ml sterile screw-cap microcentrifuge tube. Cells were homogenized by
vigorous pipetting and vortex for 30 seconds their disruption. The homogenate was incubated
for 5 minutes at room temperature. About 200 µl of Chloroform was added to the
homogenate; mixture was shaken vigorously by hand for 15 seconds, and incubated at room
temperature for 2-3 minutes. The mixture was centrifuged for 15 minutes at 12,000 rpm at
4°C, resulting in three distinct phases; a botton red colored phenol-chloroform phase, a
middle white interphase, and a top colorless aqueous phase containing the bacterial RNA.
Using a micropipette, the top aqueous phase was carefully removed and transferred to a fresh
tube. An equal volume of pure RNA-free Ethanol was slowly added to the sample.
The mixture obtained through Trizol method was processed further using the RNeasy Mini
Kit (Qiagen, Germany) following the standard protocol. About 700 µl of the sample was
loaded into an RNeasy column seated in a collection tube and spun for 30 seconds at 10,000
rpm and the flow-through was discarded. About 350 μl buffer RW1 was added to the column
and spun for 30 seconds at 10,000 rpm and the flow-through was discarded. To eliminate the
contaminating genomic DNA, the column was then treat with RNase-free DNase I (Qiagen,
Germany) by adding 80 μl of prepared enzyme solution (10 μl DNase I stock solution in 70
μl Buffer RDD) right on the column membrane. The treated column was kept at room
temperature for 15 minutes. About 350 μl Buffer RW1 was added to the column and column
was centrifuge for 30 seconds at 10,000 rpm and flow-through was discarded. The column
was then shifted to a new collection tube. About 500 μl of RPE buffer (containing ethanol)
was loaded on the column, and the column was spun for 30 seconds at 10,000 rpm. The flow-
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 93
through Discard. The column was again treated with 500 μl of RPE buffer and now spun for
2 minutes at 10,000 rpm. To elute the purified RNA, the column was shifted to a new
microfuge tube (1.5 μl) and 50 μl of RNase-free water was directly added on to the RNeasy
silica-gel membrane. The tube was closed gently, and centrifuged for 1 min at 10,000 rpm.
The elution contain the purified bacterial RNA and was immediately stored at -80°C.
Integrity of the purified RNA samples was determined using an Agilent 2100 Bioanalyzer by
submitting the samples to qb3 facility (University of California, Berkeley), and the results
were provided to the lab. Quantity and purify of the extracted RNA was estimated using the
Nanodrop 1000 (Thermo Scientific, USA). Non-bacterized control plant pellets were
processed in the same manner.
The parameters to determine the quality and quantity of RNA from Nanodrop analysis are as
below:
Parameter Description Expected Result Quantity of RNA Measured in ng/µl Higher are better
Quality of RNA
260/280
ratio
Ratio of absorbance at 260 nm
and 280 nm. Measures purity
of Nucleic acids
~2.0 indicates pure RNA;
lower value indicates
DNA/protein contamination
~1.8 for Pure DNA; lower
value indicates DNA/protein
contamination
260/230
ratio
Ratio of absorbance at 260 nm
and 230 nm. A secondary
measure of nucleic acid purity
2.0-2.2; lower value indicates
presence of contaminants
The parameters to determine the integrity of purified RNA from Bioanalyzer analysis are as
below:
Parameter Description Expected Result
RNA Integrity Number (RIN)
Measures integrity of RNA;
measured from 1 to 10;
1 highly degraded RNA,
10 fully intact RNA
Higher are better; ideal value
is 10
23S / 16S ratio
Secondary measure for RNA
integrity; intact bacterial RNA
sample should have a ratio of
approximately 2:1 for 23S and
16S rRNA, respectively.
Higher are better; ideal value
is 2.0
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 94
4.2.7 cDNA synthesis from extracted RNA
First strand of cDNA was generated from extracted RNA using SuperScript II (Invitrogen
Life Technologies, U.S.A.) and random hexamers as primers. First, RNA-primer mixture was
prepared by adding 2 μl RNA sample to 1 μl 10 mM dNTP mix, around 2 μl random
hexamers (50 ng/μl) and 5 μl of RNase-free water to make a total volume of 10 μl. The RNA-
primer mixture was incubated at 65°C for 5 minutes, and was then placed on ice for 1 minute.
In a separate tube, a 2X reaction mix was prepared containing 10X RT buffer (2 μl), 25 mM
MgCl2 (4 μl), 0.1 M DTT (2 μl) and RNaseOUT (1 μl). The prepared 2X reaction mix (9 μl)
was added to RNA/primer mixture, the contents were mixed gently, and collected by brief
centrifugation using a short spin. The resulting mix was kept at room temperature for 2
minutes. About 1 μl of SuperScript II was added to the prepared mix. For a control reaction,
the same procedure was followed, but 1 μl RNases-free water was added instead of
SuperScript II. The final mix was kept at room temperature for 10 minutes and then incubated
at 42°C for 50 minutes using a thermocycler. The synthesis reaction was terminated by
keeping the mix at 70°C for 15 minutes. The mix containing the first strand cDNA was kept
on ice for some time and was then collected by a brief short spin. To degrade the RNA, the
mix was treated with 1 μl of RNase H and incubated for 20 minutes at 37°C. The synthesized
first strand cDNA was stored at -20°C. Non-bacterized control plant RNA was processed in
the same manner.
4.2.8 qPCR Primer designing
Fifteen genes (and two housekeeping genes for used for gene expression normalization and
bacterial RNA confirmation) of strain PsJN studied for in-planta gene expression (Table 4.1)
were selected for their involvement in plant growth promotion, plant invasion and infection.
Primers for the genes were designed, specifically for qPCR SYBR Green Fluorescent
Chemistries, using the Primer Blast (Primer3 software) provided at www.ncbi.nlm.nih.gov.
Strain PsJN genome sequences were accessed through GenBank database. For convenience,
the graphical view of the genome sequence was used to easily locate the target genes and
Primer Blast the gene region. The parameters for designing the primers were followed as
described by Thornton and Basu (2011). The length of the primers was kept between 18-24
bp. Melting temperatures (Tm) were kept between the optimal Tm of 63–64°C. The primer
pairs were designed to generate 80 and 200 bp of product. For a stable primer-template
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 95
duplex, GC clamps 1 to 2 were chosen for the primer selection. The rest of the parameters
were left at default values.
Table 4.1 Selected (15) strain PsJN genes used for expression analysis, their function, and their qPCR
primer sequences, and expected product size are given. Two bacterial housekeeping genes used as
endogenous control and bacterial detection in the in-planta samples are also provided.
Sr. # Gene Function Primers Product
(bp)
1. Bphyt_0126 Quorum Sensing
(luxI) F - AGTTCCAGCCCGAAACGTCG
R - GTCGGGCATGTCCCTGTTCC 120
2. Bphyt_0280 Siderophore
(Aerobactin) F - CGGCATTTCACCTTCGCTGC
R - GGCCGGGTTGAAGATGGAGG 98
3. Bphyt_0418 Hemagglutinin F - CGCCGACGACACGAATTTCC
R - GCGGCGACCTCGACAATACG 192
4. Bphyt_2078 Peroxidase F - CCAAAGGTGCCGACGAAACG
R - GCGAGCTGATCGGGATTTTCC 148
5. Bphyt_2156 IAA degradation
(iacC) F - GCTCGAGAACACCACCGACC
R - TCGACGATTTCGGGCACCAG 174
6. Bphyt_3289 Pili
(type IV pilin protein) F - CGACCCGAATGGACTCGACG
R - GTTGGCGGTGGCTGAAAACG 95
7. Bphyt_3832 Flagella
(fliC) F - ATGTCGGCAGCGAAGATCGG
R - TGGCCGTGTTGTTCTGGTCC 178
8. Bphyt_4275 Quorum Sensing
(luxI) F - ATCTGGTCGGCGAACGTCAC
R - AAACCGGCGGTGAGGAACAG 85
9. Bphyt_4858 Pectinase
(Endopolygalacturonase) F - GTCCGTTGAGCACCGAGGTC
R - GCGCCAACGGCAATCTGTTC 132
10. Bphyt_5212 Type 3 Secretion System F - CCGGGTCGATGCGTTTTGC
R - TGTAATGGCGCCGACAATGG 191
11. Bphyt_5397 ACC Deaminase F - ACCGGGTCGGCAACATTCAG
R - AGCCAGCCGGAATCGCATAC 153
12. Bphyt_5838 Cellulase
(Endoglucanase) F - TTACACGCAGTTGGGCGAGG
R - TTGAAGCCTTGCGGTCCAGG 105
13. Bphyt_5888 β-galactosidase F - GCGGCACGTCCCTGAAACC
R - CGACGGCGACATGCAAACC 110
14. Bphyt_6420 IAA Synthesis F - AGCGGATTTCGGATCGCTCG
R - AGCGTGTCCAACTGGCCTTG 161
15. Bphyt_6562 β-xylosidase F - GCTGGTGCTGTGTCCATTGC
R - GCGCCGATCCCATCGAAGAAG 127
- Bphyt_6584 rpoD
(qPCR control) F - CCCTCGCCGCTGAAGAAGAC
R - AGGCAGTCGCTCGTGAGTTG 160
- Bphyt_0737 dnaK
(bacterial detection) F - CGTTCCTGGGCGGTGAAGAC
R - TGCTGGCTCGACGACAGTTC 160
4.2.9 Standard PCR for cDNA analysis
Standard PCR was performed on the first strand cDNA samples to confirm presence of
bacterial cDNA generated from total RNA and to ensure effective elimination of bacterial
genomic DNA during DNase treatment. PCR was performed for three bacterial genes, ACC
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 96
Deaminase (Bphyt_5397), rpoD (Bphyt_6584), and dnaK (Bphyt_0737). For this, PCR
master mix (Invitrogen Superscript II Kit, USA) was prepared by mixing 5 μl of 10X PCR
buffer, 3 μl of 25 mM MgCl2, 1 μl of 10 mM dNTP mix, 1 μl each of 1 μM forward and
reverse primer (separate reaction for each gene), 1 μl of 1:10 dilution of first strand cDNA,
and 0.4 μl of Taq DNA polymerase (Invitrogen, USA). The final volume of the mix was
adjusted to 50 μl using RNase-free water. For the control reaction, 1 μl of the RT control
(prepared in section 4.3.7) was used instead of first strand cDNA and primers for all three
genes were added to same reaction tube. PCR amplification was performed with initial
denaturation at 94°C for 2 minutes, followed by 30 cycles of denaturation (94°C for 15s),
annealing (55°C for 30s) and extension (68°C for 1 minute) with a final extension at 72°C for
10 min. the amplified samples were stored at 4°C before analysis.
The resulting PCR product (approximately 150-160 bp) was visualized on 1% agarose gel
containing ethidium bromide and compared to a 1 kb ladder (ThermoFisher Scientific, USA)
for size confirmation. For this, about 1g agarose (Fisher Scientific, USA) was dissolved in 1×
TAE buffer and heated in microwave oven for mixing. The gel was cooled down and then 50
μl of 10 mg/ml ethidium bromide (ThermoFisher Scientific, USA) was added and mixed, and
the gel casted in the electrophoresis tray with the fitted comb. After casting, the tray
containing gel was shifted to electrophoresis chamber containing the 1× TAE buffer. The gel
was completely submerged in the tank buffer. About 5 μl of amplified DNA samples were
mixed with 1 μl 6x loading dye (ThermoFisher Scientific, USA) and loading into the wells of
the gel. The first well was loaded with a 100 bp ladder (ThermoFisher Scientific, USA) to
verify correct size amplicons. The power supply was connected and the electrophoresis was
performed at a constant voltage of 5 V/cm for 40 minutes. The DNA bands were analyzed
using Gel Doc System (Biorad, USA).
To verify the cDNA as bacterial, PCR for all three bacterial genes (single reaction tube) was
performed using the cDNA samples synthesized from non-bacterized control plants with
primers for all three genes. Absence of DNA bands was taken as confirmation that cDNA
from bacterized plants was of bacterial origin.
4.2.10 qPCR for in planta differential gene expression
To analyze the differential expression of genes for bacteria grown in planta, relative
quantification qPCR was performed for the selected bacterial genes (Table 4.1). For a
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 97
comparative analysis, cDNA prepared from the in-planta grown bacterial cells was used as a
test sample, while cDNA prepared from M9 cultured bacteria was used as a calibrator
sample. The rpoD was used as an endogenous control (internal control) to normalize the gene
expression between the test and calibrator samples (Savli et al., 2003; Wang et al., 2016).
SYBR® 2X Green PCR Master Mix (Applied Biosystems, USA) was used as qPCR master
mix and Applied Biosystems 7300 Real-Time PCR System (USA) was used to study relative
quantification of genes. A 25 μl qPCR reaction was prepared for each sample replicate by
mixing 12.5 μl of master mix, 1 μl 1:10 dilution of first strand cDNA strand (template), 1 μl
of 300 nM forward and reverse primers, and 10 μl of PCR grade water. Three replicates for
each gene were used. A profile for relative quantification qPCR was set on the Sequence
Detection Software v1.3 of AB7300 qPCR system with rpoD set as internal control. The
thermocycling conditions were set as follows: 2 minutes at 50°C, 10 min at 95°C, followed
by 45 cycles at 95°C for 15 s and 60°C for 1 min.
The completed qPCR run was analyzed using the Relative Quantification plugin provided
with the software. The software was operated according to the directions provided in the
software manual. Genes up and down regulated were identified using the graphical view of
the analyzed results. The results were exported into a Microsoft Excel Spreadsheet.
The amplified products obtained by qPCR amplification were analyzed using Dissociation
Curve Analysis to confirm a single product type. For this, a dissociation curve profile was set
on the qPCR software with a single cycle of 95°C for 15 minutes, 60°C for 30 minutes and
again 95°C for 15 minutes. The results were exported into a Microsoft Excel Spreadsheet.
4.3 Results
4.3.1 Bacterial estimates in the inoculated plants
The plants inoculated with four bacterial doses (104, 106, 108, and 109 cfu/ml) were tested on
day 0, 2, 4 and 6 to check the abundance of bacteria in leaf tissue (Figure 4.1 and 4.2). This
also allowed identifying best inoculation dose for maximal bacterial recovery for RNA
extraction.
Among the three doses initially tested (104, 106 and 108 cfu/ml), the maximum bacteria were
recovered from the highest of 108 cfu/ml dose on day 6 (5.59±0.15 log cfu/gfw). However,
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 98
recovery was not much different from day 2 and 4 (5.29±0.1 and 5.24±0.17 log cfu/gfw).
Dose 106 cfu/ml exhibited second highest abundance of bacteria with highest counts on day 6
(4.49±0.22 log cfu/gfw). The counts increased from day of inoculation (log cfu/gfw: Day 0,
3.39±0.06; Day 2, 3.83±0.15; Day 4, 4.34±0.14), indicating that bacterial population is
growing inside leaf issue. Dose 104 cfu/ml yielded least count among the bacterial doses
tested, with highest counts observed on day 6 (2.99±0.43 log cfu/gfw) that increased from the
day of inoculation (log cfu/gfw: Day 0, 2.32±0.06 log cfu/gfw; Day 2, 2.81±0.13; Day 4,
2.6±0.17). It was evident from these results that bacterial population was growing slowly in
the leaf tissue before reaching the highest achievable cell density of around 4.68x105 cfu/gfw
the tissue. Likely, any further increase in cell density would require treatment with a more
concentrated inoculum dose.
Figure 4.1 Bacterial counts in leaf tissue at four different day (0, 2, 4, 6) after inoculation with three
different dose of bacterial suspension (104 cfu/ml, blue; 106 cfu/ml, red; 108 cfu/ml, green), using
vacuum infiltration method.
On treatment with 109 cfu/ml bacterial suspension, the maximum bacterial counts post
inoculation were observed on day 2 (8.26±0.1 log cfu/gfw) which declined from day of
inoculation (Day 0, 7.8±0.19 log cfu/gfw). The counts continued to decline thereafter, with
the lowest counts observed for day 6 (log cfu/gfw: Day 6, 7.62±0.26, Day 4, 7.76±0.13).
0
1
2
3
4
5
6
7
0 2 4 6
Log
cfu
pe
r gr
am
Days
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 99
As the aim of the present study was to isolate maximum bacterial biomass that survives for
some time in-planta to allow plant specific bacterial gene expression to occur, the bacterial
cells from day 2 were collected for further process after inoculating the plants with 109 cfu/ml
bacterial suspension.
Figure 4.2 Bacterial counts in leaf tissue at four different days (0, 2, 4, 6) after inoculation with 109
cfu/ml bacterial suspension, using vacuum infiltration method.
4.3.2 RNA extraction from bacterial pellets
Bacterial pellets were recovered from a total of 12 bacterized plants and four plants were
processed at a given time (one biological replicate). The three combined biological replicates
were processed using TRIzol-RNeasy hybrid RNA extraction protocol, for both in-planta and
M9 grown bacteria, and analyzed for RNA quantity and quality.
Nanodrop analysis revealed that in-planta RNA sample contained about 14 ng/µl of total
RNA and the quality ratio for RNA purity were 2.16 (260/280) and 1.90 (260/230). The RNA
samples from M9 grown bacteria contained much higher RNA yield (101.2 ng/ul), and the
RNA purity was also much better (260/280 ratio, 2.16; 260/230 ratio, 2.41).
Bioanalyzer analysis examining the RNA integrity revealed that in-planta RNA sample
suffered moderate degradation during processing, as revealed by poor 16S rRNA and 23S
rRNA peaks and low RIN value (6.3) and 23s/16s ratio (1.1) (Figure 4.3). Nevertheless,
distinct bacterial 16S and 23S rRNA peaks were observed, indicating presence of bacterial
1
2
3
4
5
6
7
8
9
0 2 4 6
Log
cfu
pe
r gr
am
Days
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 100
RNA in the in-planta samples. Moreover, the contaminating plant RNA was also suspected to
be present, thereby compromising the overall results for bacterial RNA quality of the in-
planta sample. On the other hand, M9 bacterial RNA sample showed much better results and
clear and distinct peaks for the two bacterial RNA types were visible (Figure 4.4). The RIN
value (9.9) and the 23S/16S ratio (1.5) were also very high for the M9 sample, indicating a
high quality sample.
Figure 4.3 Bioanalyzer results for in-planta bacterial RNA samples. The peaks for 16S and 23S rRNA
are indicated along with a virtual gel of the run sample.
Figure 4.4 Bioanalyzer results for M9 bacterial RNA samples. The peaks for 16S and 23S rRNA are
indicated along with a virtual gel of the run sample.
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 101
4.3.3 Standard PCR for cDNA analysis
A standard PCR was run for three strain PsJN genes (ACC Deaminase, dnaK, rpoD) using
the first strand cDNA generated from bacterial RNA. The amplicons were analyzed using
agarose gel electrophoresis.
All tested genes were detected in both in-planta and M9 samples. The ACC deaminase gene
gave a faint band in both the samples, verified by the correct size amplicon band (Lane P1,
M1; 153 bp) visualized on the gel. The gene dnaK produced bands of variable intensity, with
a much thicker band in M9 sample (Lane P2, M2; 160 bp). This indicated that the expression
of this gene is not consistent between the two types of samples. The third gene, rpoD (Lane
P3, M3; 160 bp), produced intense bands in both the samples, indicating that gene has a high
expression independent of growth conditions. Both samples showed fairly consistent
expression of the rpoD.
L 100 bp Ladder M1 ACC Deaminase (Bphyt_5397)
P1 ACC Deaminase (Bphyt_5397) M2 dnaK (Bphyt_0737)
P2 dnaK (Bphyt_0737) M3 rpoD (Bphyt_6584)
P3 rpoD (Bphyt_6584) MC M9 RT control
PC In-plata RT control C Non-Bacterized plant
Figure 4.5 Agarose gel electrophoresis of three PCR amplified strain PsJN genes from in-planta (P1,
P2, P3) and M9 (M1, M2, M3) samples using the first strand cDNA as template. The respective RT
controls (PC and MC), non-bacterized plant sample (C), and 100 bp ladder (L) are also shown.
100 bp
200 bp
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 102
The lane PC and MC loaded with control reactions (amplified using RT-PCR control of in-
planta and M9 samples) showed no amplicon bands. This confirmed that the amplicons
generated for the three tested genes originated from bacterial RNA and not the contaminating
bacterial genomic DNA. Finally, Lane C was loaded with reaction performed with cDNA
samples of non-bacterized control plant. Again, no DNA band was detected in this last lane,
verifying that amplicons generated for the three test genes from bacterized plants cDNA
samples were in fact of bacterial origin and not from contaminating plant RNA (Figure 4.5).
4.3.4 qPCR for in-planta differential gene expression
Relative quantification qPCR was performed to explore the differential expression of 15
genes important for plant growth promotion and association. For this, expression of these
genes was compared between bacteria grown in-planta to the bacteria grown on M9 minimal
media using rpoD gene (Bphyt_6584) as an endogenous control (Figure 4.6). All amplicons
were tested by dissociation curve analysis to verify a single product type for both in-planta
and M9 samples.
Two plant growth hormone modulating genes studied presently showed increased expression
during in-planta bacterial growth. The gene involved in IAA degradation (Bphyt_2156) was
upregulated by 5.23 fold, had an average Ct value of 38.79 for in-planta grown bacteria and
31.34 for M9 grown bacteria, and a single product was detected with dissociation curve
analysis for both sample types (85.2°C). While ACC deaminase gene (Bphyt_5397),
targeting plant stress hormone ethylene, was slightly upregulated 1.93 fold during in-planta
growth. The average Ct values for this gene were 36.93 (in-planta) and 28.942 (M9) with a
single product type (87.2°C) detected by dissociation curve (Figure 7).
Three plant cell-wall targeting enzymes were also increasingly expressed in bacteria growing
in-planta. Cellulase gene (Bphyt_5838) was upregulated by 6.33 fold in the in-planta bacteria
with average Ct values of 33.09 (in-planta) and 25.86 (M9). The gene amplicons contained a
single product (87.0°C) identified through dissociation curve analysis. Compared to
Cellulase, Pectinase (Bphyt_4858) was upregulated to a higher level with 19.92 fold
increased expression in bacteria growing in-planta. The average Ct values for this gene were
39.45 (in-planta) and 34.551 (M9) with a single detected product (85.9°C). The third enzyme,
β-xylosidase (Bphyt_6562), was also highly upregulated in the in-planta bacteria with 14.05
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 103
fold increased expression compared to M9 bacteria. Average Ct values for this gene were
34.54 (in-planta) and 28.57 (M9) with a single product (85.2°C).
Sugar metabolism gene β-galactosidase (Bphyt_5888) was also upregulated during in-planta
growth of the bacteria. The expression of the gene increased by 9.26 fold during in-planta
bacterial growth with average Ct of 36.67(in-planta) and 29.99 (M9) and a single product was
verified (84.2°C).
Expression of two Quorum Sensing genes was different for the two bacterial growth
environments. One LuxI gene (Bphyt_0126) was upregulated during in-planta bacterial
growth by 5.02 fold. The Ct values for the gene were 39.25 (in-planta) and 31.79 (M9)
indicating overall low copy number of the transcripts. Again, a single amplicons was
confirmed by dissociation curve analysis (85.9°C). In contrast, the second LuxI gene
(Bphyt_4275) was downregulated by 0.43 fold during in-planta bacteria growth, with average
Ct values of 34.91 (in-planta) and 23.91 (M9). The gene product was verified by detecting a
single product (82.2°C).
Among the other genes downregulated was the gene for IAA synthesis. The Indole
Acetamide Hydrolase (Bphyt_6420) was downregulated 0.08 fold during in-planta bacterial
growth compared to M9 bacterial growth. This result is consistent with the finding that
expression of IAA degrading enzyme (Bphyt_2156) was upregulated during in-planta
bacterial growth, indicating that bacteria decrease the IAA concentration while growing in-
planta. The average Ct value for the gene were 41.34 (in-planta) and 28.97 (M9) with a single
product detected by dissociation curve (82.4°C). Similarly, the expression of flagellar protein
gene was also decreased during in-planta growth. The gene was downregulated by 0.131 fold
during in-planta growth with the average Ct values of 33.50 (in-planta) and 20.79 (M9) and a
single amplicon (87.1°C).
Interestingly, genes consistent with bacterial pathogenicity were also expressed more by the
host beneficial bacteria during in-planta growth. Among the three genes studied, Peroxidase
gene (Bphyt_2078) showed considerably high expression compared to the other two genes,
with 5.90 fold upregulation during in-planta bacterial growth. The average Ct values for the
gene were 32.62 (in-planta) and 25.28 (M9) with a single amplicon confirmed by dissociation
curve (85.4°C). The other two genes also showed an overall upregulation during in-planta
bacterial growth, but the expression was not much higher compared to M9 grown bacteria,
indicated by the overlapping RQ error range of the in-planta and M9 samples. Among these
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 104
two genes, a Type III secretion system gene (Bphyt_5212) was upregulated by 2.92 fold
during in-planta growth, with average Ct values of 40.70 (in-planta) and 34.45 (M9) and a
single gene product (88.6°C). The other gene, Hemagglutinin (Bphyt_0418), was only
slightly upregulated by 2.02 fold during in-planta growth with an average Ct values of 37.28
(in-plant) and 27.85 (M9) for the single product detected (88.2°C).
Figure 4.6 In-planta gene expression profile of 15 Burkholderia phyrofirmans PsJN genes versus M9
cultured bacteria using Relative Quantification qPCR (Green bars, upregulated genes; Red bars,
downregulated genes; Gray bars, no change).
Lastly, gene expression of two traits remained unchanged for the two bacterial growth
conditions studied. The Siderophore gene (Bphyt_0280) showed no change in the gene
expression with an average Ct values of 37.89 (in-planta) and 28.58 (M9) and displayed a
single product (81.2°C). The second gene, Pili (Bphyt_3289) which is important in bacterial
attachment to substratum and surfaces, was in fact slightly downregulated in-planta, but the
overall expression of the gene was similar to bacteria growing on M9 media. The expression
of the gene was 0.957 fold less in-planta with average Ct values of 37.51 (in-planta) and
28.65 (M9). However, by taking the RQ error range in to account for the two sample types,
the expression of the gene appeared to be very similar for in-planta and M9 bacteria. Again, a
-2
-1.5
-1
-0.5
0
0.5
1
1.5
2
Lo
g 1
0 R
ela
tive
Qu
an
tifica
tio
n
Genes
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 105
single product was confirmed by dissociation curve for ACC deaminase gene (86.1°C)
(Figure 4.7).
Figure 4.7 Dissociation curve analysis for ACCD gene (Bphyt_5397) for both M9 and in-planta
samples indicating a single product type.
4.4 Discussion
Present work was conducted to study the gene expression of 15 bacterial genes important for
plant growth promotion and association in the plant growth promoting Burkholderia
phytofirmans PsJN. For this, expression of these genes was compared between Strain PsJN
grown inside tomato plants to the bacterium grown on M9 minimal media using Relative
Quantification qPCR. Results indicated that the bacterium actively grows inside leaf tissues.
More importantly, during the in-planta growth, the bacterium expresses traits compatible with
plant growth promotion and invasion. The present comparative transcriptome profiling of
strain PsJN will likely better elucidate host-bacterial relationship and thus explicate
endophytic role of the bacterium.
Previously only few studies have reported strain PsJN gene expression in-planta. In the first
study, the research group did an RNAseq based transcriptome analysis for the bacterium
infecting potato plants with and without drought stress (Sheibani-Tezerji et al., 2015). While
the second study reported the in-planta expression of selected Strain PsJN genes involved in
iron transport and sequestration in Arabidopsis thaliana (Zhao et al., 2016). Although, in both
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 106
studies similar procedure was used for RNA and cDNA preparations, different shoot samples
were employed for bacterial RNA extraction. Both studies proposed similar findings
suggesting increased expression of iron acquisition and transport genes.
Presently, at start of this work, two important factors needed to be addressed that limited the
scope of the study in getting quality bacterial transcripts for any gene expression study. One
such factor was getting enough bacterial cells from plant tissue for mRNA extraction. Unlike
pathogenic bacteria, plant growth promoting bacteria are known to establish low cell numbers
in host tissue (Yu et al, 2013; Compant et al., 2010). Here, Strain PsJN was observed to
maintain a modest cell density (5.59±0.15 log cfu/gfw) in the tomato leaf tissue. Similar
counts have been reported for the bacterium endophytically colonizing switchgrass,
Arabidopsis thaliana and grapevine leaf tissues (Compant et al., 2005a; Kim et al., 2012; Su
et al., 2016). Endophytic bacterial population depends on many factors, including the type,
tissue and age of the plant host (Costa et al., 2012; Hardoim et al. 2015). Nevertheless, to get
high cell counts for maximum bacterial RNA extraction, plants were treated with a much
higher dose of 109 cfu/ml. Appreciable total bacterial RNA quantities were recovered using
this dose (14 ng/µl). The other two studies on Strain PsJN in-planta gene expression did not
report on the bacterial RNA quantities obtained from their extraction methods.
The other limiting factor for the present study was getting high quality bacterial RNA. Due to
poor half-life of bacterial RNA, rapidity of extraction and lysis of bacterial cells is very
important (Mangan et al., 1997; Jahn et al., 2008). Moreover, getting sufficient quantities of
high quality RNA also depends on plant inoculation and sampling methods (Kałużna et al.,
2016). The methods employed in the present work for bacterial inoculation, recovery and
total RNA extraction produced in-planta bacterial RNA of modest quality (RIN 6.3), while
high quality RNA was recovered from M9 grown bacterial (RIN 9.9). This difference in RNA
quality recovered from in-planta and M9 samples could be explained by the fact that bacterial
RNA extraction is affected by the type of bacteria species, plant material and the environment
from where bacteria have been isolated (Nolan et al., 2006). Nevertheless, RIN values higher
than 5 are considered sufficient for routine gene expression studies (Fleige and Pfaffl 2006;
Jeffries et al. 2014). The in-planta grown bacterial RNA obtained in the present study was in
fact analyzable for gene expression study conducted here.
In the present study, bacterial genes for plant cell-wall degrading enzymes were upregulated
during in-planta growth. Moreover their expression was highest compared to other genes
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 107
analyzed in the study. This indicates the importance of these genes for the bacterium for
effective colonization of tomato plants. The present finding also supports the work of
Compant et al. (2005a) on colonization of grapevine by Strain PsJN, who proposed the
possible role of cell-wall degrading Cellulase and Pectinase of Strain PsJN in systematically
colonization of the host. Importance of these enzymes in endophytic colonization was also
indicated in Bacillus strains in two separate studies, one involving overexpression of
Pectinase gene and the other involving deletion mutation of Cellulase gene (Fan et al., 2013;
Fan et al., 2016). Interestingly, Sheibani-Tezerji et al. (2015) did not find the transcripts of
these cell-wall targeting enzymes. Nevertheless, these enzymes are of prime importance in
the endophytic growth of a bacterium, and the present work confirms their expression during
endophytic growth Strain PsJN.
The bacterium also expressed enzymes for sugar metabolism during in-planta growth. β-
galactosidase and β-xylosidase were both significantly upregulated during in-planta growth,
indicating that the bacteria is metabolically active in the plant host. Enzymes like β-
xylosidase can convert hemicellulose into easily metabolizable sugars (Fouts et al., 2008;
Shao et al., 2011). Bacteria, both beneficial and pathogenic, can use these enzymes
synergistically with other plant cell-wall targeting enzymes to get carbon for their growth
(Mitter et al., 2013). In the present study, β-xylosidase was among the highly upregulated
genes, and expression was comparably similar to that of Cellulase and Pectinase genes.
Therefore, it may be assumed that strain PsJN expresses these enzymes for getting nutrients
during endophytic growth besides using them to systematically colonize the host. Sheibani-
Tezerji et al. (2015) also proposed the expression of sugar metabolism genes in strain PsJN
proposing that bacteria was metabolizing plant sugars to thrive inside plant host.
Endophytic bacteria can also improve plant growth by modulating the levels of plant-growth
related hormones. Of these, Indole Acetic Acid (IAA) can regulate several plant development
related processes by controlling both plant growth promotion and inhibition, including leaf
development and morphogenesis (Wang et al., 2005; Glick, 2012). Endophytic bacteria can
finely control the levels of IAA pool inside plant host by either degrading or producing these
hormones, thereby imparting growth effects on host plant (Leveau and Lindow, 2005). In the
present study, gene for IAA degradation was upregulated and one of the genes involved in
IAA synthesis was downregulated during in-planta bacterial growth. This indicates that the
bacterium probably responds to increased levels of IAA in plant host by degrading the
hormone, further supporting the previous explanation. Indeed, this finding also supports the
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 108
work of Zúñiga et al. (2013), who identified the importance of IAA degradation by Strain
PsJN to improve Arabidopsis thaliana growth. They noticed that iacC mutant Strain PsJN
(detective in IAA degradation) was unable to confer growth promoting effects on their plant
host that wild type Strain PsJN produced. In contrast to present work, Sheibani-Tezerji et al.
(2015) detected the transcripts for IAA synthesis genes and not the iacC transcript in their in-
planta Strain PsJN transcriptome. Nevertheless, further work is needed to precisely identify
the interplay of these gene functions during in-planta growth of beneficial bacterial.
The other tested gene involved in modulating plant hormone, was ACC deaminase. This
enzyme can target the precursor of plant hormone ethylene, which is expressed by plants
during stress and causes growth inhibition. Moreover, ethylene signaling is also involved in
the development of plant leaf from juvenile to adult phase (Schaller, 2012). Expression of the
enzyme by growth promoting endophytic bacteria can alleviate the inhibitory effect of
ethylene by reducing the levels of this hormone in plant tissues (Glick, 2012). Here, the gene
of ACC deaminase was only slightly upregulated during in-planta growth of Strain PsJN. Sun
et al. (2009) showed that ACC deaminase deletion mutant of Strain PsJN had impaired canola
growth promoting activity compared to wild type bacterium. However, Sheibani-Tezerji et al.
(2015) did not identify ACC deaminase transcripts in the in-planta grown PsJN
transcriptome. Therefore, the present work identifies for the first time the expression of ACC
deaminase gene by strain PsJN selectively during in-planta growth.
Bacterial attachment and motility are known to play a role in rhizosphere, rhizoplane and
endophytic competence of endophytic bacteria (Compant et al., 2010). In the present work,
one of the flagellar genes tested was downregulated in the in-planta bacteria, while gene of
Pili showed no change in expression between the two growth environments studied. Lack of
flagella might also improve the endophytic colonization by decreasing host defense response,
as studied for Salmonella infecting Medicago (Iniguez et al., 2005). Therefore, the exact role
of flagella mediated endophytic competence is still not known (Reinhold-Hurek and Hurek,
2011). However, the in-planta bacteria studied here did produce flagella, indicated by higher
transcript copy of the gene (Ct value 33.50), suggesting that the bacterial movement in the
plant endosphere. Besides, active movement might be more important for the bacteria in the
growth media, as bacteria flagellar gene expression was higher in M9 media. Sheibani-
Tezerji et al. (2015) proposed that active bacterial movement in plants is less important once
bacterial population has established itself. Further investigation might reveal a better picture
about the involvement of these traits in bacterial endosphere competence.
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 109
Bacterial quorum sensing (QS) is an important trait required for maintaining bacterial cell
population. A regulatory mechanism, QS is used by bacteria to regulate gene expression in a
cell density-dependent manner (Mitter et al., 2013). This mechanism can regulate various
functions required for establishing pathogenic or symbiotic relationships (Loh et al., 2002).
Two QS systems exist in strain PsJN, where the one has been implicated in the growth
promoting ability of the bacterium: Zúñiga et al. (2013) showed that stain PsJN defective in
one of the N-acyl homoserine lactone gene (Bphyt_0126), was inefficient in colonizing and
establishing a beneficial interaction with Arabidopsis thaliana. Their findings are supported
by the present study, where this gene was in fact upregulated during in-planta bacterial
growth. On the other hand, the second QS N-acyl homoserine lactone gene tested was slightly
downregulated in the in-planta bacteria. Zúñiga et al. (2013) noted that second quorum
system was not required by Strain PsJN for host colonization and growth promotion.
Furthermore, QS has been indicated to require bacterial cell densities greater then 107cfu/ml
(Deep et al., 2011). While endophytic bacteria are known to establish root endophytic
population between 105-107 cfu/gfw, strain PsJN is reported to maintain root endophytic
population between 104-107cfu/gfw in different host plants (Pillay and Nowak, 1997;
Compant et al., 2005a; Kim et al., 2012). In the present study, however, strain PsJN cell
densities were close to 108 cfu/gfw on the day of extraction (Day 2 post inoculation) because
a high inoculum dose (109 cfu/ml) was used to infiltrate host plant. Interestingly, strain PsJN
cell densities reported by Zúñiga et al. (2013) inside Arabidopsis thaliana roots were
unusually very high (108 cfu/mg fresh weight) for an endophytic bacterium, as much lower
bacterial counts (104 cfu/gfw) were latter reported by Su et al. (2015) for strain PsJN
endophytically colonizing Arabidopsis thaliana roots. Nevertheless, we can conclude from
this discussion that strain PsJN requires only one of the QS systems to competitively colonize
host plant to initiate beneficial interaction, and that this system can probably operate with cell
densities lower than 107 cfu/gfw.
Three bacterial pathogenesis genes were also investigated in the present study. Out of these,
only Peroxidase gene was significantly upregulated in the in-planta bacteria, indicating that
the bacteria were challenged inside host plant by oxidative stress. Endophytic bacteria can
often elicit an oxidative burst like defense response in their host plants (Mitter et al., 2013).
Strain PsJN has also been shown to induce host defense response in grapevines during
endophytic growth (Compant et al., 2005a). This induction can be linked to the fact that
endophytic bacteria produce cell-wall degrading enzymes to systematically colonize host, a
Chapter 4
Agriculturally beneficial endophytic bacteria of wild plants 110
characteristic also shared by plant pathogenic bacteria (Buonaurio, 2008). The other two
pathogenicity genes, Hemagglutinin gene and one Type III secretion system gene, despite
showing a slight increase, were not significantly upregulated in in-planta bacteria. Thus, these
functions are less important for endophytic competence of bacteria. Sheibani-Tezerji et al.
(2015) also did not observe the transcripts of these functions in Strain PsJN infecting potato
plants.
Conclusions
Conclusions
Agriculturally beneficial endophytic bacteria of wild plants 111
Conclusions
Wild perennial plants represent a rich source to isolate new and interesting bacteria with
biotechnological potential.
Wild Cannabis sativa and Dodonaea viscosa harbor many endophytic bacteria with
multiple plant growth promoting traits, which are also agriculturally beneficial.
Selective isolation method proposed in the present study can improve the isolation of
potential plant growth promoting endophytic bacteria.
The endophytic bacteria of C. sativa and D. viscosa can enhance the growth of non-host
canola plants.
The growth promoting endophytic bacteria isolated from C. sativa and D. viscosa are
phylogenetically related, indicating that this ability is evolutionary conserved.
IAA production is an important bacterial trait for plant growth promotion. The bacteria
that produce IAA in the range 2-10 µg/ml can generally have plant growth promoting
effects on canola plants. The plant growth promoting Burkholderia phytofirmans PsJN
expresses gene of IAA production very modestly during in-planta growth. Collectively,
this indicates that endophytic bacteria that produce lower amounts of IAA tend to be plant
growth promoting.
Endophytic bacteria isolated from C. sativa and D. viscosa also possesses the ability to
inhibit the growth of phytopathogenic fungi. The bacteria also produce fungal cell-wall
degrading enzymes and siderophore, which may play a role in inhibiting the fungal
growth.
Most of the endophytic bacteria produce plant cell-wall degrading enzymes needed for
plant colonization. The endophytic strain PsJN also expresses this trait during in-planta
growth.
Endophytic bacteria isolated from C. sativa and D. viscosa also possess the ability to
solubilize inorganic phosphate, thereby increasing phosphorus availability for the plants.
The most interesting isolates from C. sativa were Pantoea vagans MOSEL-t13,
Pseudomonas geniculata MOSEL-tnc1, Serratia marcescens MOSEL-w2, Enterobacter
asburiae MOSEL-t15, Pseudomonas koreensis MOSEL-tnc2, Stenotrophomonas
rhizophila MOSEL-tnc3, and Enterobacter cloacae MOSEL-w7. These bacteria had
multiple plant growth promoting traits, could promote canola growth under normal and
salt-stress conditions, and could inhibit the growth of phytopathogenic fungi.
Conclusions
Agriculturally beneficial endophytic bacteria of wild plants 112
Paenibacillus sp. MOSEL-w13 also deserves especial consideration, as the strain strongly
inhibited fungal growth, and showed only 97% similarity to the type strain, indicating that
the bacterium may be novel.
The most interesting isolates from D. viscosa were Bacillus subtilis MOSEL-RD28,
Bacillus idriensis MOSEL-RD7, Bacillus cereus MOSEL-RD27, Pseudomonas
geniculata MOSEL-RD36, and Streptomyces alboniger MOSEL-RD3. These bacteria had
multiple plant growth promoting traits, could promote canola growth, and could inhibit
the growth of phytopathogenic fungi.
Getting high quality and quantity bacterial RNA to study in-planta bacterial gene
expression is extremely challenging. The procedure followed in the present study allows
the extraction of RNA from in-planta grown bacteria that is analyzable through qPCR.
Thus, the procedure can be used to study the gene expression of endophytic bacteria that
are growing inside host plant.
The present gene expression study confirms for the first time that bacteria express ACC
deaminase while growing inside plants. By producing this enzyme, the plant beneficial
bacteria are known to modulate growth of their host plants.
Gene expression study concluded that the Burkholderia phytofirmans PsJN was active in
tomato leaves and expressed traits that are compatible with plant growth promotion and
invasion.
References
References
Agriculturally beneficial endophytic bacteria of wild plants 113
References
1. Afzal, M., Yousaf, S., Reichenauer, T.G., Kuffner, M. and Sessitsch, A., 2011. Soil
type affects plant colonization, activity and catabolic gene expression of inoculated
bacterial strains during phytoremediation of diesel. Journal of hazardous materials,
186(2), pp.1568-1575.
2. Ahemad, M. and Khan, M.S., 2010. Plant growth promoting activities of phosphate-
solubilizing Enterobacter asburiae as influenced by fungicides. EurAsian J BioSci,
4, pp.88-95.
3. Ahemad, M. and Khan, M.S., 2011. Functional aspects of plant growth promoting
rhizobacteria: recent advancements. Insight Microbiol, 1(3), pp.39-54.
4. Ahemad, M., 2015. Phosphate-solubilizing bacteria-assisted phytoremediation of
metalliferous soils: a review. 3 Biotech, 5(2), pp.111-121.
5. Ahmad, F., Ahmad, I. and Khan, M.S., 2008. Screening of free-living rhizospheric
bacteria for their multiple plant growth promoting activities. Microbiological
research, 163(2), pp.173-181.
6. Aktuganov, G., Melentjev, A., Galimzianova, N., Khalikova, E., Korpela, T. and
Susi, P., 2008. Wide-range antifungal antagonism of Paenibacillus ehimensis IB-Xb
and its dependence on chitinase and β-1, 3-glucanase production. Canadian journal of
microbiology, 54(7), pp.577-587.
7. Alain, K. and Querellou, J., 2009. Cultivating the uncultured: limits, advances and
future challenges. Extremophiles, 13(4), pp.583-594.
8. Alexander, D.B. and Zuberer, D.A., 1991. Use of chrome azurol S reagents to
evaluate siderophore production by rhizosphere bacteria. Biology and Fertility of
soils, 12(1), pp.39-45.
9. Allan, E., 2014. Metagenomics: Unrestricted access to microbial communities. pp.
397-398
10. Alvin, A., Miller, K.I. and Neilan, B.A., 2014. Exploring the potential of endophytes
from medicinal plants as sources of antimycobacterial compounds. Microbiological
research, 169(7), pp.483-495.
11. Andria, V., Reichenauer, T.G. and Sessitsch, A., 2009. Expression of alkane
monooxygenase (alkB) genes by plant-associated bacteria in the rhizosphere and
endosphere of Italian ryegrass (Lolium multiflorum L.) grown in diesel contaminated
soil. Environmental pollution, 157(12), pp.3347-3350.
References
Agriculturally beneficial endophytic bacteria of wild plants 114
12. Aravind, R., Kumar, A., Eapen, S.J. and Ramana, K.V., 2009. Endophytic bacterial
flora in root and stem tissues of black pepper (Piper nigrum L.) genotype: isolation,
identification and evaluation against Phytophthora capsici. Letters in applied
microbiology, 48(1), pp.58-64.
13. Arora, S., Patel, P.N., Vanza, M.J. and Rao, G.G., 2014. Isolation and
characterization of endophytic bacteria colonizing halophyte and other salt tolerant
plant species from coastal Gujarat. African Journal of Microbiology Research, 8(17),
pp.1779-1788.
14. Ashraf, M., Ahmad, M.S.A., Öztürk, M. and Aksoy, A., 2012. Crop improvement
through different means: challenges and prospects. In Crop Production for
Agricultural Improvement (pp. 1-15). Springer Netherlands.
15. Babu, A.G., Kim, J.D. and Oh, B.T., 2013. Enhancement of heavy metal
phytoremediation by Alnus firma with endophytic Bacillus thuringiensis GDB-1.
Journal of hazardous materials, 250, pp.477-483.
16. Babu, A.G., Shea, P.J., Sudhakar, D., Jung, I.B. and Oh, B.T., 2015. Potential use of
Pseudomonas koreensis AGB-1 in association with Miscanthus sinensis to remediate
heavy metal (loid)-contaminated mining site soil. Journal of environmental
management, 151, pp.160-166.
17. Bais, H.P., Weir, T.L., Perry, L.G., Gilroy, S. and Vivanco, J.M., 2006. The role of
root exudates in rhizosphere interactions with plants and other organisms. Annu. Rev.
Plant Biol., 57, pp.233-266.
18. Bal, A., Anand, R., Berge, O. and Chanway, C.P., 2012. Isolation and identification
of diazotrophic bacteria from internal tissues of Pinus contorta and Thuja plicata.
Canadian Journal of Forest Research, 42(4), pp.807-813.
19. Barac, T., Taghavi, S., Borremans, B., Provoost, A., Oeyen, L., Colpaert, J.V.,
Vangronsveld, J. and van der Lelie, D., 2004. Engineered endophytic bacteria
improve phytoremediation of water-soluble, volatile, organic pollutants. Nature
biotechnology, 22(5), pp.583-588.
20. Barka, E.A., Gognies, S., Nowak, J., Audran, J.C. and Belarbi, A., 2002. Inhibitory
effect of endophyte bacteria on Botrytis cinerea and its influence to promote the
grapevine growth. Biological Control, 24(2), pp.135-142.
21. Barka, E.A., Nowak, J. and Clément, C., 2006. Enhancement of chilling resistance of
inoculated grapevine plantlets with a plant growth-promoting rhizobacterium,
References
Agriculturally beneficial endophytic bacteria of wild plants 115
Burkholderia phytofirmans strain PsJN. Applied and Environmental Microbiology,
72(11), pp.7246-7252.
22. Bartz, J.A., 2005. Internalization and infiltration. In: Sapers, G.M., Gorny, J.R.,
Yousef, A.E. (Eds.), Microbiology of Fruits and Vegetables. CRC Press/Taylor and
Francis Group, pp. 75e94.
23. Barzanti, R., Ozino, F., Bazzicalupo, M., Gabbrielli, R., Galardi, F., Gonnelli, C. and
Mengoni, A., 2007. Isolation and characterization of endophytic bacteria from the
nickel hyperaccumulator plant Alyssum bertolonii. Microbial Ecology, 53(2), pp.306-
316.
24. Beatty, P.H. and Jensen, S.E., 2002. Paenibacillus polymyxa produces fusaricidin-
type antifungal antibiotics active against Leptosphaeria maculans, the causative
agent of blackleg disease of canola. Canadian Journal of Microbiology, 48(2),
pp.159-169.
25. Beneduzi, A., Moreira, F., Costa, P.B., Vargas, L.K., Lisboa, B.B., Favreto, R.,
Baldani, J.I. and Passaglia, L.M.P., 2013. Diversity and plant growth promoting
evaluation abilities of bacteria isolated from sugarcane cultivated in the South of
Brazil. Applied Soil Ecology, 63, pp.94-104.
26. Benizri, E., Baudoin, E. and Guckert, A., 2001. Root colonization by inoculated plant
growth-promoting rhizobacteria. Biocontrol science and technology, 11(5), pp.557-
574.
27. Berg, G. and Hallmann, J., 2006. Control of plant pathogenic fungi with bacterial
endophytes. In Microbial root endophytes (pp. 53-69). Springer Berlin Heidelberg.
28. Bhattacharjee, R.B., Singh, A. and Mukhopadhyay, S.N., 2008. Use of nitrogen-
fixing bacteria as biofertiliser for non-legumes: prospects and challenges. Applied
microbiology and biotechnology, 80(2), pp.199-209.
29. Bhore, S.J., Nithya, R. and Loh, C.Y., 2010. Screening of endophytic bacteria
isolated from leaves of Sambung Nyawa[Gynura procumbens(Lour.) Merr.] for
cytokinin-like compounds. Bioinformation, 5(5), pp.191-197.
30. Bibi, F., Yasir, M., Song, G.C., Lee, S.Y. and Chung, Y.R., 2012. Diversity and
characterization of endophytic bacteria associated with tidal flat plants and their
antagonistic effects on oomycetous plant pathogens. The Plant Pathology Journal,
28(1), pp.20-31.
References
Agriculturally beneficial endophytic bacteria of wild plants 116
31. Bodenhausen, N., Horton, M.W. and Bergelson, J., 2013. Bacterial communities
associated with the leaves and the roots of Arabidopsis thaliana. PloS one, 8(2),
p.e56329.
32. Bogas, A.C., Ferreira, A.J., Araújo, W.L., Astolfi-Filho, S., Kitajima, E.W., Lacava,
P.T. and Azevedo, J.L., 2015. Endophytic bacterial diversity in the phyllosphere of
Amazon Paullinia cupana associated with asymptomatic and symptomatic
anthracnose. SpringerPlus, 4(1), p.258.
33. Böhm, M., Hurek, T. and Reinhold-Hurek, B., 2007. Twitching motility is essential
for endophytic rice colonization by the N2-fixing endophyte Azoarcus sp. strain
BH72. Molecular plant-microbe interactions, 20(5), pp.526-533.
34. Buonaurio, R., 2008. Infection and plant defense responses during plant-bacterial
interaction. Plant-microbe interactions, pp.169-197.
35. Calvente, V., De Orellano, M.E., Sansone, G., Benuzzi, D. and Sanz de Tosetti, M.I.,
2001. Effect of nitrogen source and pH on siderophore production by Rhodotorula
strains and their application to biocontrol of phytopathogenic moulds. Journal of
industrial microbiology & biotechnology, 26(4), pp.226-229.
36. Carrell, A.A. and Frank, A.C., 2014. Pinus flexilis and Picea engelmannii share a
simple and consistent needle endophyte microbiota with a potential role in nitrogen
fixation. Frontiers in microbiology, 5, p.333.
37. Chanway, C.P., Shishido, M., Nairn, J., Jungwirth, S., Markham, J., Xiao, G. and
Holl, F.B., 2000. Endophytic colonization and field responses of hybrid spruce
seedlings after inoculation with plant growth-promoting rhizobacteria. Forest
Ecology and Management, 133(1), pp.81-88.
38. Chaturvedi, H., Singh, V. and Gupta, G., 2016. Potential of Bacterial Endophytes as
Plant Growth Promoting Factors. J Plant Pathol Microbiol, 7(376), p.2.
39. Chauhan, H., Bagyaraj, D.J. and Sharma, A., 2013. Plant growth-promoting bacterial
endophytes from sugarcane and their potential in promoting growth of the host under
field conditions. Experimental Agriculture, 49(01), pp.43-52.
40. Chebotar, V.K., Malfanova, N.V., Shcherbakov, A.V., Ahtemova, G.A., Borisov,
A.Y., Lugtenberg, B. and Tikhonovich, I.A., 2015. Endophytic bacteria in microbial
preparations that improve plant development (review). Applied Biochemistry and
Microbiology, 51(3), p.271.
41. Cho, H.S., Park, S.Y., Ryu, C.M., Kim, J.F., Kim, J.G. and Park, S.H., 2007.
Interference of quorum sensing and virulence of the rice pathogen Burkholderia
References
Agriculturally beneficial endophytic bacteria of wild plants 117
glumae by an engineered endophytic bacterium. FEMS microbiology ecology, 60(1),
pp.14-23.
42. Cipollini, D., Rigsby, C.M. and Barto, E.K., 2012. Microbes as targets and mediators
of allelopathy in plants. Journal of Chemical Ecology, 38(6), pp.714-727.
43. Cohen, A.C., Travaglia, C.N., Bottini, R. and Piccoli, P.N., 2009. Participation of
abscisic acid and gibberellins produced by endophytic Azospirillum in the alleviation
of drought effects in maize. Botany, 87(5), pp.455-462.
44. Compant, S., Clément, C. and Sessitsch, A., 2010. Plant growth-promoting bacteria
in the rhizo-and endosphere of plants: their role, colonization, mechanisms involved
and prospects for utilization. Soil Biology and Biochemistry, 42(5), pp.669-678.
45. Compant, S., Duffy, B., Nowak, J., Clément, C. and Barka, E.A., 2005b. Use of plant
growth-promoting bacteria for biocontrol of plant diseases: principles, mechanisms
of action, and future prospects. Applied and environmental microbiology, 71(9),
pp.4951-4959.
46. Compant, S., Kaplan, H., Sessitsch, A., Nowak, J., Barka, E.A. and Clément, C.,
2008. Endophytic colonization of Vitis vinifera L. by Burkholderia phytofirmans
strain PsJN: from the rhizosphere to inflorescence tissues. FEMS microbiology
ecology, 63(1), pp.84-93.
47. Compant, S., Reiter, B., Sessitsch, A., Nowak, J., Clément, C. and Barka, E.A.,
2005a. Endophytic colonization of Vitis vinifera L. by plant growth-promoting
bacterium Burkholderia sp. strain PsJN. Applied and Environmental Microbiology,
71(4), pp.1685-1693.
48. Conn, V.M. and Franco, C.M., 2004. Analysis of the endophytic actinobacterial
population in the roots of wheat (Triticum aestivum L.) by terminal restriction
fragment length polymorphism and sequencing of 16S rRNA clones. Applied and
environmental microbiology, 70(3), pp.1787-1794.
49. Conn, V.M., Walker, A.R. and Franco, C.M.M., 2008. Endophytic actinobacteria
induce defense pathways in Arabidopsis thaliana. Molecular Plant-Microbe
Interactions, 21(2), pp.208-218.
50. Coombs, J.T., Michelsen, P.P. and Franco, C.M., 2004. Evaluation of endophytic
actinobacteria as antagonists of Gaeumannomyces graminis var. tritici in wheat.
Biological Control, 29(3), pp.359-366.
51. Costa, L.E.D.O., Queiroz, M.V.D., Borges, A.C., Moraes, C.A.D. and Araújo,
E.F.D., 2012. Isolation and characterization of endophytic bacteria isolated from the
References
Agriculturally beneficial endophytic bacteria of wild plants 118
leaves of the common bean (Phaseolus vulgaris). Brazilian Journal of Microbiology,
43(4), pp.1562-1575.
52. de Weert, S., Vermeiren, H., Mulders, I.H., Kuiper, I., Hendrickx, N., Bloemberg,
G.V., Vanderleyden, J., De Mot, R. and Lugtenberg, B.J., 2002. Flagella-driven
chemotaxis towards exudate components is an important trait for tomato root
colonization by Pseudomonas fluorescens. Molecular Plant-Microbe Interactions,
15(11), pp.1173-1180.
53. Deep, A., Chaudhary, U. and Gupta, V., 2011. Quorum sensing and bacterial
pathogenicity: from molecules to disease. Journal of laboratory physicians, 3(1), p.4.
54. Deng, Y., Zhu, Y., Wang, P., Zhu, L., Zheng, J., Li, R., Ruan, L., Peng, D. and Sun,
M., 2011. Complete genome sequence of Bacillus subtilis BSn5, an endophytic
bacterium of Amorphophallus konjac with antimicrobial activity for the plant
pathogen Erwinia carotovora subsp. carotovora. Journal of bacteriology, 193(8),
pp.2070-2071.
55. Diallo, M.D., Reinhold-Hurek, B. and Hurek, T., 2008. Evaluation of PCR primers
for universal nifH gene targeting and for assessment of transcribed nifH pools in
roots of Oryza longistaminata with and without low nitrogen input. FEMS
microbiology ecology, 65(2), pp.220-228.
56. Dias, A.C., Costa, F.E., Andreote, F.D., Lacava, P.T., Teixeira, M.A., Assumpção,
L.C., Araújo, W.L., Azevedo, J.L. and Melo, I.S., 2009. Isolation of micropropagated
strawberry endophytic bacteria and assessment of their potential for plant growth
promotion. World Journal of Microbiology and Biotechnology, 25(2), pp.189-195.
57. Ding, T. and Melcher, U., 2016. Influences of plant species, season and location on
leaf endophytic bacterial communities of non-cultivated plants. PloS one, 11(3),
p.e0150895.
58. Ding, T., Palmer, M.W. and Melcher, U., 2013. Community terminal restriction
fragment length polymorphisms reveal insights into the diversity and dynamics of
leaf endophytic bacteria. BMC microbiology, 13(1), p.1.
59. Dong, Y., Iniguez, A.L. and Triplett, E.W., 2003. Quantitative assessments of the
host range and strain specificity of endophytic colonization by Klebsiella
pneumoniae 342. Plant and soil, 257(1), pp.49-59.
60. Dong, Z., Canny, M.J., McCully, M.E., Roboredo, M.R., Cabadilla, C.F., Ortega, E.
and Rodes, R., 1994. A nitrogen-fixing endophyte of sugarcane stems (a new role for
the apoplast). Plant Physiology, 105(4), pp.1139-1147.
References
Agriculturally beneficial endophytic bacteria of wild plants 119
61. Dörr, J., Hurek, T. and Reinhold‐Hurek, B., 1998. Type IV pili are involved in plant–
microbe and fungus–microbe interactions. Molecular microbiology, 30(1), pp.7-17.
62. Downing, K.J., Leslie, G. and Thomson, J.A., 2000. Biocontrol of the Sugarcane
Borer Eldana saccharina by Expression of the Bacillus thuringiensis cry1Ac7 and
Serratia marcescens chiA Genes in Sugarcane-Associated Bacteria. Applied and
environmental microbiology, 66(7), pp.2804-2810.
63. Duijff, B.J., GIANINAZZI‐PEARSON, V.I.V.I.E.N.N.E. and Lemanceau, P., 1997.
Involvement of the outer membrane lipopolysaccharides in the endophytic
colonization of tomato roots by biocontrol Pseudomonas fluorescens strain
WCS417r. New Phytologist, 135(2), pp.325-334.
64. Eevers, N., Gielen, M., Sánchez‐López, A., Jaspers, S., White, J.C., Vangronsveld, J.
and Weyens, N., 2015. Optimization of isolation and cultivation of bacterial
endophytes through addition of plant extract to nutrient media. Microbial
biotechnology, 8(4), pp.707-715.
65. Elbeltagy, A., Nishioka, K., Suzuki, H., Sato, T., Sato, Y.I., Morisaki, H., Mitsui, H.
and Minamisawa, K., 2000. Isolation and characterization of endophytic bacteria
from wild and traditionally cultivated rice varieties. Soil science and plant nutrition,
46(3), pp.617-629.
66. Enebak, S.A., Wei, G. and Kloepper, J.W., 1998. Effects of plant growth-promoting
rhizobacteria on loblolly and slash pine seedlings. Forest Science, 44(1), pp.139-144.
67. Esitken, A., Ercisli, S., Karlidag, H. and Sahin, F., 2005. Potential use of plant
growth promoting rhizobacteria (PGPR) in organic apricot production. In
Proceedings of the international scientific conference: Environmentally friendly fruit
growing, Polli, Estonia, 7-9 September, 2005 (pp. 90-97). Tartu University Press.
68. Ezawa, T., Smith, S.E. and Smith, F.A., 2002. P metabolism and transport in AM
fungi. Plant and Soil, 244(1), pp.221-230.
69. Fan, X., Yang, R., Qiu, S., Cai, X., Zou, H. and Hu, F., 2016. The Endo-β-1, 4-
Glucanase of Bacillus amyloliquefaciens is Required for Optimum Endophytic
Colonization of Plants. Journal of microbiology and biotechnology, 26(5), pp.946-
952.
70. Fan, X.J., Yang, R.X., Qiu, S.X. and Hu, F.P., 2013. Over-expression of pectinase
Gene in endophytic Bacillus strains and its effect on colonization. Chinese Journal of
Applied Environment Biology, 19(5), pp.805-810.
References
Agriculturally beneficial endophytic bacteria of wild plants 120
71. Feng, H., Li, Y. and Liu, Q., 2013. Endophytic bacterial communities in tomato
plants with differential resistance to Ralstonia solanacearum. African Journal of
Microbiology Research, 7(15), pp.1311-1318.
72. Fidalgo, C., Henriques, I., Rocha, J., Tacão, M. and Alves, A., 2016. Culturable
endophytic bacteria from the salt marsh plant Halimione portulacoides.
Environmental Science and Pollution Research, 23(10), pp.10200-10214.
73. Figueiredo, J.E.F., Gomes, E.A., Guimarães, C.T., Lana, U.G.D.P., Teixeira, M.A.,
Lima, G.V.C. and Bressan, W., 2009. Molecular analysis of endophytic bacteria from
the genus Bacillus isolated from tropical maize (Zea mays L.). Brazilian Journal of
Microbiology, 40(3), pp.522-534.
74. Fleige, S. and Pfaffl, M.W., 2006. RNA integrity and the effect on the real-time qRT-
PCR performance. Molecular aspects of medicine, 27(2), pp.126-139.
75. Forchetti, G., Masciarelli, O., Alemano, S., Alvarez, D. and Abdala, G., 2007.
Endophytic bacteria in sunflower (Helianthus annuus L.): isolation, characterization,
and production of jasmonates and abscisic acid in culture medium. Applied
Microbiology and Biotechnology, 76(5), pp.1145-1152.
76. Fouts, D.E., Tyler, H.L., DeBoy, R.T., Daugherty, S., Ren, Q., Durkin, A.S., Huot,
H., Shrivastava, S., Kothari, S., Dodson, R.J. and Mohamoud, Y., 2008. Complete
genome sequence of the N2-fixing broad host range endophyte Klebsiella
pneumoniae 342 and virulence predictions verified in mice. PLoS Genet, 4(7),
p.e1000141.
77. Frey‐Klett, P., Chavatte, M., Clausse, M.L., Courrier, S., Roux, C.L., Raaijmakers, J.,
Martinotti, M.G., Pierrat, J.C. and Garbaye, J., 2005. Ectomycorrhizal symbiosis
affects functional diversity of rhizosphere fluorescent pseudomonads. New
phytologist, 165(1), pp.317-328.
78. Gamalero, E., Lingua, G., Berta, G. and Lemanceau, P., 2003. Methods for studying
root colonization by introduced beneficial bacteria. Agronomie, 23(5-6), pp.407-418.
79. Gamalero, E., Lingua, G., Caprì, F.G., Fusconi, A., Berta, G. and Lemanceau, P.,
2004. Colonization pattern of primary tomato roots by Pseudomonas fluorescens
A6RI characterized by dilution plating, flow cytometry, fluorescence, confocal and
scanning electron microscopy. FEMS Microbiology Ecology, 48(1), pp.79-87.
80. Garbeva, P., Van Overbeek, L.S., Van Vuurde, J.W. and Van Elsas, J.D., 2001.
Analysis of endophytic bacterial communities of potato by plating and denaturing
References
Agriculturally beneficial endophytic bacteria of wild plants 121
gradient gel electrophoresis (DGGE) of 16S rDNA based PCR fragments. Microbial
ecology, 41(4), pp.369-383.
81. Germida, J.J., Siciliano, S.D., de Freitas, J.R. and Seib, A.M., 1998. Diversity of
root-associated bacteria associated with field-grown canola (Brassica napus L.) and
wheat (Triticum aestivum L.). FEMS Microbiology Ecology, 26(1), pp.43-50.
82. Glick, B.R., 2003. Phytoremediation: synergistic use of plants and bacteria to clean
up the environment. Biotechnology advances, 21(5), pp.383-393.
83. Glick, B.R., 2012. Plant growth-promoting bacteria: mechanisms and applications.
Scientifica, 2012.
84. Gordon, S.A. and Weber, R.P., 1951. Colorimetric estimation of indole acetic acid.
Plant physiology, 26(1), p.192.
85. Granér, G., Persson, P., Meijer, J. and Alström, S., 2003. A study on microbial
diversity in different cultivars of Brassica napus in relation to its wilt pathogen,
Verticillium longisporum. FEMS microbiology letters, 224(2), pp.269-276.
86. Gravel, V., Antoun, H. and Tweddell, R.J., 2007. Growth stimulation and fruit yield
improvement of greenhouse tomato plants by inoculation with Pseudomonas putida
or Trichoderma atroviride: possible role of indole acetic acid (IAA). Soil Biology
and Biochemistry, 39(8), pp.1968-1977.
87. Gupta, C.P., Kumar, B., Dubey, R.C. and Maheshwari, D.K., 2006. Chitinase-
mediated destructive antagonistic potential of Pseudomonas aeruginosa GRC 1
against Sclerotinia sclerotiorum causing stem rot of peanut. Biocontrol, 51(6),
pp.821-835.
88. Gupta, G., Panwar, J. and Jha, P.N., 2013. Natural occurrence of Pseudomonas
aeruginosa, a dominant cultivable diazotrophic endophytic bacterium colonizing
Pennisetum glaucum (L.) R. Br. Applied soil ecology, 64, pp.252-261.
89. Gyaneshwar, P., James, E.K., Mathan, N., Reddy, P.M., Reinhold-Hurek, B. and
Ladha, J.K., 2001. Endophytic colonization of rice by a diazotrophic strain of
Serratia marcescens. Journal of bacteriology, 183(8), pp.2634-2645.
90. Haas, D. and Keel, C., 2003. Regulation of antibiotic production in root-colonizing
Pseudomonas spp. and relevance for biological control of plant disease. Annual
review of phytopathology, 41(1), pp.117-153.
91. Hallmann, J. and Berg, G., 2006. Spectrum and population dynamics of bacterial root
endophytes. In Microbial root endophytes (pp. 15-31). Springer Berlin Heidelberg.
References
Agriculturally beneficial endophytic bacteria of wild plants 122
92. Hallmann, J., 2001. Plant interactions with endophytic bacteria (pp. 87-119). CABI
Publishing, New York.
93. Hallmann, J., Berg, G. and Schulz, B., 2006. Isolation procedures for endophytic
microorganisms. In Microbial root endophytes (pp. 299-319). Springer Berlin
Heidelberg.
94. Hallmann, J., Quadt-Hallmann, A., Mahaffee, W.F. and Kloepper, J.W., 1997.
Bacterial endophytes in agricultural crops. Canadian Journal of Microbiology,
43(10), pp.895-914.
95. Hameeda, B., Harini, G., Rupela, O.P., Wani, S.P. and Reddy, G., 2008. Growth
promotion of maize by phosphate-solubilizing bacteria isolated from composts and
macrofauna. Microbiological research, 163(2), pp.234-242.
96. Hankin, L., Zucker, M. and Sands, D.C., 1971. Improved solid medium for the
detection and enumeration of pectolytic bacteria. Applied Microbiology, 22(2),
pp.205-209.
97. Hansen, M., Kragelund, L., Nybroe, O. and Sørensen, J., 1997. Early colonization of
barley roots by Pseudomonas fluorescens studied by immunofluorescence technique
and confocal laser scanning microscopy. FEMS microbiology ecology, 23(4),
pp.353-360.
98. Hardoim, P.R., Hardoim, C.C., Van Overbeek, L.S. and Van Elsas, J.D., 2012.
Dynamics of seed-borne rice endophytes on early plant growth stages. PLoS One,
7(2), p.e30438.
99. Hardoim, P.R., van Overbeek, L.S. and van Elsas, J.D., 2008. Properties of bacterial
endophytes and their proposed role in plant growth. Trends in microbiology, 16(10),
pp.463-471.
100. Hardoim, P.R., Van Overbeek, L.S., Berg, G., Pirttilä, A.M., Compant, S.,
Campisano, A., Döring, M. and Sessitsch, A., 2015. The hidden world within plants:
ecological and evolutionary considerations for defining functioning of microbial
endophytes. Microbiology and Molecular Biology Reviews, 79(3), pp.293-320.
101. Hayat, R., Ali, S., Amara, U., Khalid, R. and Ahmed, I., 2010. Soil beneficial
bacteria and their role in plant growth promotion: a review. Annals of Microbiology,
60(4), pp.579-598.
102. He, H., Ye, Z., Yang, D., Yan, J., Xiao, L., Zhong, T., Yuan, M., Cai, X., Fang, Z.
and Jing, Y., 2013. Characterization of endophytic Rahnella sp. JN6 from Polygonum
References
Agriculturally beneficial endophytic bacteria of wild plants 123
pubescens and its potential in promoting growth and Cd, Pb, Zn uptake by Brassica
napus. Chemosphere, 90(6), pp.1960-1965.
103. Hendricks, C.W., Doyle, J.D. and Hugley, B., 1995. A new solid medium for
enumerating cellulose-utilizing bacteria in soil. Applied and Environmental
Microbiology, 61(5), pp.2016-2019.
104. Hori, K. and Matsumoto, S., 2010. Bacterial adhesion: from mechanism to control.
Biochemical Engineering Journal, 48(3), pp.424-434.
105. Hung, P.Q., Kumar, S.M., Govindsamy, V. and Annapurna, K., 2007. Isolation and
characterization of endophytic bacteria from wild and cultivated soybean varieties.
Biology and Fertility of Soils, 44(1), pp.155-162.
106. Hurek, T. and Reinhold-Hurek, B., 2003. Azoarcus sp. strain BH72 as a model for
nitrogen-fixing grass endophytes. Journal of Biotechnology, 106(2), pp.169-178.
107. Iniguez, A.L., Dong, Y., Carter, H.D., Ahmer, B.M., Stone, J.M. and Triplett, E.W.,
2005. Regulation of enteric endophytic bacterial colonization by plant defenses.
Molecular Plant-Microbe Interactions, 18(2), pp.169-178.
108. Ivleva, N.B., Groat, J., Staub, J.M. and Stephens, M., 2016. Expression of Active
Subunit of Nitrogenase via Integration into Plant Organelle Genome. PloS one, 11(8),
p.e0160951.
109. Jahn, C.E., Charkowski, A.O. and Willis, D.K., 2008. Evaluation of isolation
methods and RNA integrity for bacterial RNA quantitation. Journal of
microbiological methods, 75(2), pp.318-324.
110. James, E.K., Gyaneshwar, P., Mathan, N., Barraquio, W.L., Reddy, P.M., Iannetta,
P.P., Olivares, F.L. and Ladha, J.K., 2002. Infection and colonization of rice
seedlings by the plant growth-promoting bacterium Herbaspirillum seropedicae Z67.
Molecular Plant-Microbe Interactions, 15(9), pp.894-906.
111. Jasim, B., Joseph, A.A., John, C.J., Mathew, J. and Radhakrishnan, E.K., 2014.
Isolation and characterization of plant growth promoting endophytic bacteria from
the rhizome of Zingiber officinale. 3 Biotech, 4(2), pp.197-204.
112. Jeffries, M.K.S., Kiss, A.J., Smith, A.W. and Oris, J.T., 2014. A comparison of
commercially-available automated and manual extraction kits for the isolation of
total RNA from small tissue samples. BMC biotechnology, 14(1), p.94.
113. Jha, C.K., Patel, B. and Saraf, M., 2012. Stimulation of the growth of Jatropha
curcas by the plant growth promoting bacterium Enterobacter cancerogenus MSA2.
World Journal of Microbiology and Biotechnology, 28(3), pp.891-899.
References
Agriculturally beneficial endophytic bacteria of wild plants 124
114. Ji, S.H., Gururani, M.A. and Chun, S.C., 2014. Isolation and characterization of plant
growth promoting endophytic diazotrophic bacteria from Korean rice cultivars.
Microbiological research, 169(1), pp.83-98.
115. Jones, D.L. and Darrah, P.R., 1994. Role of root derived organic acids in the
mobilization of nutrients from the rhizosphere. Plant and soil, 166(2), pp.247-257.
116. Kałużna, M., Kuras, A., Mikiciński, A. and Puławska, J., 2016. Evaluation of
different RNA extraction methods for high-quality total RNA and mRNA from
Erwinia amylovora in planta. European Journal of Plant Pathology, 146(4), pp.893-
899.
117. Khalid, A., Arshad, M. and Zahir, Z.A., 2004. Screening plant growth‐promoting
rhizobacteria for improving growth and yield of wheat. Journal of Applied
Microbiology, 96(3), pp.473-480.
118. Khamna, S., Yokota, A. and Lumyong, S., 2009. Actinomycetes isolated from
medicinal plant rhizosphere soils: diversity and screening of antifungal compounds,
indole-3-acetic acid and siderophore production. World Journal of Microbiology and
Biotechnology, 25(4), p.649.
119. Khan, K.S. and Joergensen, R.G., 2009. Changes in microbial biomass and P
fractions in biogenic household waste compost amended with inorganic P fertilizers.
Bioresource technology, 100(1), pp.303-309.
120. Kim, O.S., Cho, Y.J., Lee, K., Yoon, S.H., Kim, M., Na, H., Park, S.C., Jeon, Y.S.,
Lee, J.H., Yi, H. and Won, S., 2012b. Introducing EzTaxon-e: a prokaryotic 16S
rRNA gene sequence database with phylotypes that represent uncultured species.
International journal of systematic and evolutionary microbiology, 62(3), pp.716-
721.
121. Kim, P.I. and Chung, K.C., 2004. Production of an antifungal protein for control of
Colletotrichum lagenarium by Bacillus amyloliquefaciens MET0908. FEMS
Microbiology Letters, 234(1), pp.177-183.
122. Kim, S., Lowman, S., Hou, G., Nowak, J., Flinn, B. and Mei, C., 2012a. Growth
promotion and colonization of switchgrass (Panicum virgatum) cv. Alamo by
bacterial endophyte Burkholderia phytofirmans strain PsJN. Biotechnology for
biofuels, 5(1), p.37.
123. Kim, T.U., Cho, S.H., Han, J.H., Shin, Y.M., Lee, H.B. and Kim, S.B., 2012c.
Diversity and physiological properties of root endophytic actinobacteria in native
herbaceous plants of Korea. The Journal of Microbiology, 50(1), pp.50-57.
References
Agriculturally beneficial endophytic bacteria of wild plants 125
124. Kim, W.I., Kim, S.N., Ryu, K.Y. and Park, C.S., 2011. Genetic diversity of
cultivable plant growth-promoting rhizobacteria in Korea. Journal of microbiology
and biotechnology, 21(8), pp.777-790.
125. Kloepper, J.W. and Ryu, C.M., 2006. Bacterial endophytes as elicitors of induced
systemic resistance. In Microbial root endophytes (pp. 33-52). Springer Berlin
Heidelberg.
126. Knauth, S., Hurek, T., Brar, D. and Reinhold‐Hurek, B., 2005. Influence of different
Oryza cultivars on expression of nifH gene pools in roots of rice. Environmental
Microbiology, 7(11), pp.1725-1733.
127. Krishnan, P., Bhat, R., Kush, A. and Ravikumar, P., 2012. Isolation and functional
characterization of bacterial endophytes from Carica papaya fruits. Journal of
applied microbiology, 113(2), pp.308-317.
128. Kuffner, M., De Maria, S., Puschenreiter, M., Fallmann, K., Wieshammer, G.,
Gorfer, M., Strauss, J., Rivelli, A.R. and Sessitsch, A., 2010. Culturable bacteria
from Zn‐and Cd‐accumulating Salix caprea with differential effects on plant growth
and heavy metal availability. Journal of applied microbiology, 108(4), pp.1471-1484.
129. Kuklinsky‐Sobral, J., Araújo, W.L., Mendes, R., Geraldi, I.O., Pizzirani‐Kleiner,
A.A. and Azevedo, J.L., 2004. Isolation and characterization of soybean‐associated
bacteria and their potential for plant growth promotion. Environmental Microbiology,
6(12), pp.1244-1251.
130. Kumar, A., Prakash, A. and Johri, B.N., 2011. Bacillus as PGPR in crop ecosystem.
In Bacteria in agrobiology: crop ecosystems (pp. 37-59). Springer Berlin Heidelberg.
131. Kumar, P., Dubey, R.C. and Maheshwari, D.K., 2012. Bacillus strains isolated from
rhizosphere showed plant growth promoting and antagonistic activity against
phytopathogens. Microbiological research, 167(8), pp.493-499.
132. Kunkel, B.N. and Chen, Z., 2006. Virulence strategies of plant pathogenic bacteria.
In The prokaryotes (pp. 421-440). Springer New York.
133. Kusari, P., Kusari, S., Lamshöft, M., Sezgin, S., Spiteller, M. and Kayser, O., 2014.
Quorum quenching is an antivirulence strategy employed by endophytic bacteria.
Applied microbiology and biotechnology, 98(16), pp.7173-7183.
134. Leveau, J.H. and Lindow, S.E., 2005. Utilization of the plant hormone indole-3-
acetic acid for growth by Pseudomonas putida strain 1290. Applied and
Environmental Microbiology, 71(5), pp.2365-2371.
References
Agriculturally beneficial endophytic bacteria of wild plants 126
135. Li, J.H., Wang, E.T., Chen, W.F. and Chen, W.X., 2008. Genetic diversity and
potential for promotion of plant growth detected in nodule endophytic bacteria of
soybean grown in Heilongjiang province of China. Soil Biology and Biochemistry,
40(1), pp.238-246.
136. Liu, X., Jia, J., Atkinson, S., Cámara, M., Gao, K., Li, H. and Cao, J., 2010.
Biocontrol potential of an endophytic Serratia sp. G3 and its mode of action. World
Journal of Microbiology and Biotechnology, 26(8), pp.1465-1471.Dong, Y.H.,
Wang, L.H., Xu, J.L.,
137. Lodewyckx, C., Vangronsveld, J., Porteous, F., Moore, E.R., Taghavi, S., Mezgeay,
M. and der Lelie, D.V., 2002. Endophytic bacteria and their potential applications.
Critical Reviews in Plant Sciences, 21(6), pp.583-606.
138. Loh, J., Pierson, E.A., Pierson, L.S., Stacey, G. and Chatterjee, A., 2002. Quorum
sensing in plant-associated bacteria. Current opinion in plant biology, 5(4), pp.285-
290.
139. Long, H.H., Schmidt, D.D. and Baldwin, I.T., 2008. Native bacterial endophytes
promote host growth in a species-specific manner; phytohormone manipulations do
not result in common growth responses. PLoS One, 3(7), p.e2702.
140. Lopez, B.R., Bashan, Y. and Bacilio, M., 2011. Endophytic bacteria of Mammillaria
fraileana, an endemic rock-colonizing cactus of the southern Sonoran Desert.
Archives of microbiology, 193(7), pp.527-541.
141. Ma, Y., Rajkumar, M., Luo, Y. and Freitas, H., 2011. Inoculation of endophytic
bacteria on host and non-host plants—effects on plant growth and Ni uptake. Journal
of hazardous materials, 195, pp.230-237.
142. Ma, Y., Rajkumar, M., Zhang, C. and Freitas, H., 2016. Beneficial role of bacterial
endophytes in heavy metal phytoremediation. Journal of environmental
management, 174, pp.14-25.
143. Malik, D.K. and Sindhu, S.S., 2011. Production of indole acetic acid by
Pseudomonas sp.: effect of coinoculation with Mesorhizobium sp. Cicer on
nodulation and plant growth of chickpea (Cicer arietinum). Physiology and
Molecular Biology of Plants, 17(1), pp.25-32.
144. Mangan, J.A., Sole, K.M., Mitchison, D.A. and Butcher, P.D., 1997. An effective
method of RNA extraction from bacteria refractory to disruption, including
mycobacteria. Nucleic acids research, 25(3), pp.675-676.
References
Agriculturally beneficial endophytic bacteria of wild plants 127
145. Marques, A.P., Pires, C., Moreira, H., Rangel, A.O. and Castro, P.M., 2010.
Assessment of the plant growth promotion abilities of six bacterial isolates using Zea
mays as indicator plant. Soil Biology and Biochemistry, 42(8), pp.1229-1235.
146. Marquez-Santacruz, H.A., Hernandez-Leon, R., Orozco-Mosqueda, M.C.,
Velazquez-Sepulveda, I. and Santoyo, G., 2010. Diversity of bacterial endophytes in
roots of Mexican husk tomato plants (Physalis ixocarpa) and their detection in the
rhizosphere. Genetics and Molecular Research, 9(4), pp.2372-2380.
147. Masalha, J., Kosegarten, H., Elmaci, Ö. and Mengel, K., 2000. The central role of
microbial activity for iron acquisition in maize and sunflower. Biology and Fertility
of Soils, 30(5), pp.433-439.
148. Matilla, M.A., Espinosa-Urgel, M., Rodríguez-Herva, J.J., Ramos, J.L. and Ramos-
González, M.I., 2007. Genomic analysis reveals the major driving forces of bacterial
life in the rhizosphere. Genome biology, 8(9), p.R179.
149. Mayak, S., Tirosh, T. and Glick, B.R., 1999. Effect of wild-type and mutant plant
growth-promoting rhizobacteria on the rooting of mung bean cuttings. Journal of
plant growth regulation, 18(2), pp.49-53.
150. McInroy, J.A. and Kloepper, J.W., 1995. Survey of indigenous bacterial endophytes
from cotton and sweet corn. Plant and soil, 173(2), pp.337-342.
151. Mei, C. and Flinn, B.S., 2010. The use of beneficial microbial endophytes for plant
biomass and stress tolerance improvement. Recent patents on biotechnology, 4(1),
pp.81-95.
152. Mendes, R., Pizzirani-Kleiner, A.A., Araujo, W.L. and Raaijmakers, J.M., 2007.
Diversity of cultivated endophytic bacteria from sugarcane: genetic and biochemical
characterization of Burkholderia cepacia complex isolates. Applied and
environmental microbiology, 73(22), pp.7259-7267.
153. Miliute, I., Buzaite, O., Baniulis, D. and Stanys, V., 2015. Bacterial endophytes in
agricultural crops and their role in stress tolerance: a review. Zemdirbyste-
Agriculture, 4(102), pp.465-478.
154. Misko, A.L. and Germida, J.J., 2002. Taxonomic and functional diversity of
Pseudomonads isolated from the roots of field-grown canola. FEMS microbiology
ecology, 42(3), pp.399-407.
155. Mitter, B., Petric, A., Shin, M.W., Chain, P.S., Hauberg-Lotte, L., Reinhold-Hurek,
B., Nowak, J. and Sessitsch, A., 2013. Comparative genome analysis of Burkholderia
References
Agriculturally beneficial endophytic bacteria of wild plants 128
phytofirmans PsJN reveals a wide spectrum of endophytic lifestyles based on
interaction strategies with host plants. Frontiers in plant science, 4, p.120.
156. Montañez, A., Blanco, A.R., Barlocco, C., Beracochea, M. and Sicardi, M., 2012.
Characterization of cultivable putative endophytic plant growth promoting bacteria
associated with maize cultivars (Zea mays L.) and their inoculation effects in vitro.
Applied Soil Ecology, 58, pp.21-28.
157. Nagórska, K., Bikowski, M. and Obuchowski, M., 2007. Multicellular behaviour and
production of a wide variety of toxic substances support usage of Bacillus subtilis as
a powerful biocontrol agent. Acta Biochimica Polonica-English Edition-, 54(3),
p.495.
158. Nair, D.N. and Padmavathy, S., 2014. Impact of endophytic microorganisms on
plants, environment and humans. The Scientific World Journal, 2014.
159. Narula, N., Kothe, E. and Behl, R.K., 2012. Role of root exudates in plant-microbe
interactions. Journal of Applied Botany and Food Quality, 82(2), pp.122-130.
160. Nautiyal, C.S., Bhadauria, S., Kumar, P., Lal, H., Mondal, R. and Verma, D., 2000.
Stress induced phosphate solubilization in bacteria isolated from alkaline soils.
FEMS Microbiology Letters, 182(2), pp.291-296.
161. Navarro, L., Dunoyer, P., Jay, F., Arnold, B., Dharmasiri, N., Estelle, M., Voinnet,
O. and Jones, J.D., 2006. A plant miRNA contributes to antibacterial resistance by
repressing auxin signaling. Science, 312(5772), pp.436-439.
162. Naveed, M., Mitter, B., Reichenauer, T.G., Wieczorek, K. and Sessitsch, A., 2014.
Increased drought stress resilience of maize through endophytic colonization by
Burkholderia phytofirmans PsJN and Enterobacter sp. FD17. Environmental and
Experimental Botany, 97, pp.30-39.
163. Newman, K.L., Chatterjee, S., Ho, K.A. and Lindow, S.E., 2008. Virulence of plant
pathogenic bacteria attenuated by degradation of fatty acid cell-to-cell signaling
factors. Molecular plant-microbe interactions, 21(3), pp.326-334.
164. Nhu, V.T.P. and Diep, C.N., 2014. Isolation, characterization and phylogenetic
analysis of endophytic bacteria in rice plant cultivated on soil of Phu Yen Province,
Vietnam. Am J Life Sci, 2(3), pp.117-127.
165. Nikolic, B., Schwab, H. and Sessitsch, A., 2011. Metagenomic analysis of the 1-
aminocyclopropane-1-carboxylate deaminase gene (acdS) operon of an uncultured
bacterial endophyte colonizing Solanum tuberosum L. Archives of microbiology,
193(9), pp.665-676.
References
Agriculturally beneficial endophytic bacteria of wild plants 129
166. Niu, D.D., Liu, H.X., Jiang, C.H., Wang, Y.P., Wang, Q.Y., Jin, H.L. and Guo, J.H.,
2011. The plant growth–promoting rhizobacterium Bacillus cereus AR156 induces
systemic resistance in Arabidopsis thaliana by simultaneously activating salicylate-
and jasmonate/ethylene-dependent signaling pathways. Molecular Plant-Microbe
Interactions, 24(5), pp.533-542.
167. Nolan, T., Hands, R.E. and Bustin, S.A., 2006. Quantification of mRNA using real-
time RT-PCR. Nature protocols, 1(3), pp.1559-1582.
168. Ouattara, H.G., Koffi, B.L., Karou, G.T., Sangaré, A., Niamke, S.L. and Diopoh,
J.K., 2008. Implication of Bacillus sp. in the production of pectinolytic enzymes
during cocoa fermentation. World Journal of Microbiology and Biotechnology,
24(9), pp.1753-1760.
169. Palaniappan, P., Chauhan, P.S., Saravanan, V.S., Anandham, R. and Sa, T., 2010.
Isolation and characterization of plant growth promoting endophytic bacterial isolates
from root nodule of Lespedeza sp. Biology and fertility of soils, 46(8), pp.807-816.
170. Park, M.S., Jung, S.R., Lee, M.S., Kim, K.O., Do, J.O., Lee, K.H., Kim, S.B. and
Bae, K.S., 2005. Isolation and characterization of bacteria associated with two sand
dune plant species, Calystegia soldanella and Elymus mollis. JOURNAL OF
MICROBIOLOGY-SEOUL-, 43(3), p.219.
171. Partida-Martinez, L.P.P. and Heil, M., 2011. The microbe-free plant: fact or artifact?.
Frontiers in plant science, 2, p.100.
172. Patel, D., Jha, C.K., Tank, N. and Saraf, M., 2012. Growth enhancement of chickpea
in saline soils using plant growth-promoting rhizobacteria. Journal of plant growth
regulation, 31(1), pp.53-62.
173. Patten, C.L. and Glick, B.R., 2002. Role of Pseudomonas putida indoleacetic acid in
development of the host plant root system. Applied and environmental microbiology,
68(8), pp.3795-3801.
174. Pavlo, A., Leonid, O., Iryna, Z., Natalia, K. and Maria, P.A., 2011. Endophytic
bacteria enhancing growth and disease resistance of potato (Solanum tuberosum L.).
Biological Control, 56(1), pp.43-49.
175. Penrose, D.M. and Glick, B.R., 2003. Methods for isolating and characterizing ACC
deaminase‐containing plant growth‐promoting rhizobacteria. Physiologia plantarum,
118(1), pp.10-15.
176. Penuelas, J., Rico, L., Ogaya, R., Jump, A.S. and Terradas, J., 2012. Summer season
and long‐term drought increase the richness of bacteria and fungi in the foliar
References
Agriculturally beneficial endophytic bacteria of wild plants 130
phyllosphere of Quercus ilex in a mixed Mediterranean forest. Plant Biology, 14(4),
pp.565-575.
177. Pérez-Miranda, S., Cabirol, N., George-Téllez, R., Zamudio-Rivera, L.S. and
Fernández, F.J., 2007. O-CAS, a fast and universal method for siderophore detection.
Journal of microbiological methods, 70(1), pp.127-131.
178. Perotti, R., 1926. On the limits of biological enquiry in soil science. Proc. Int. Soc.
Soil Sci., 2, pp.146-161.
179. Phetcharat, P. and Duangpaeng, A., 2012. Screening of endophytic bacteria from
organic rice tissue for indole acetic acid production. Procedia Engineering, 32,
pp.177-183.
180. Piccolo, S.L., Ferraro, V., Alfonzo, A., Settanni, L., Ercolini, D., Burruano, S. and
Moschetti, G., 2010. Presence of endophytic bacteria in Vitis vinifera leaves as
detected by fluorescence in situ hybridization. Annals of microbiology, 60(1),
pp.161-167.
181. Pieterse, C.M., Van der Does, D., Zamioudis, C., Leon-Reyes, A. and Van Wees,
S.C., 2012. Hormonal modulation of plant immunity. Annual review of cell and
developmental biology, 28, pp.489-521.
182. Pieterse, C.M., Van Pelt, J.A., Van Wees, S.C., Ton, J., Léon-Kloosterziel, K.M.,
Keurentjes, J.J., Verhagen, B.W., Knoester, M., Van der Sluis, I., Bakker, P.A. and
Van Loon, L.C., 2001. Rhizobacteria-mediated induced systemic resistance:
triggering, signalling and expression. European Journal of Plant Pathology, 107(1),
pp.51-61.
183. Pieterse, C.M., Zamioudis, C., Berendsen, R.L., Weller, D.M., Van Wees, S.C. and
Bakker, P.A., 2014. Induced systemic resistance by beneficial microbes. Annual
review of phytopathology, 52, pp.347-375.
184. Pillay, V.K. and Nowak, J., 1997. Inoculum density, temperature, and genotype
effects on in vitro growth promotion and epiphytic and endophytic colonization of
tomato (Lycopersicon esculentum L.) seedlings inoculated with a pseudomonad
bacterium. Canadian Journal of Microbiology, 43(4), pp.354-361.
185. Puente, M.E., Li, C.Y. and Bashan, Y., 2009a. Rock-degrading endophytic bacteria
in cacti. Environmental and Experimental Botany, 66(3), pp.389-401.
186. Puente, M.E., Li, C.Y. and Bashan, Y., 2009b. Endophytic bacteria in cacti seeds can
improve the development of cactus seedlings. Environmental and Experimental
Botany, 66(3), pp.402-408.
References
Agriculturally beneficial endophytic bacteria of wild plants 131
187. Quadt-Hallmann, A. and Kloepper, J.W., 1996. Immunological detection and
localization of the cotton endophyte Enterobacter asburiae JM22 in different plant
species. Canadian Journal of Microbiology, 42(11), pp.1144-1154.
188. Raaijmakers, J.M., Vlami, M. and De Souza, J.T., 2002. Antibiotic production by
bacterial biocontrol agents. Antonie van Leeuwenhoek, 81(1), pp.537-547.
189. Radzki, W., Mañero, F.G., Algar, E., García, J.L., García-Villaraco, A. and Solano,
B.R., 2013. Bacterial siderophores efficiently provide iron to iron-starved tomato
plants in hydroponics culture. Antonie Van Leeuwenhoek, 104(3), pp.321-330.
190. Rajamanickam, V., Rajasekaran, A., Anandarajagopal, K., Sridharan, D.,
Selvakumar, K. and Rathinaraj, B.S., 2010. Anti-diarrheal activity of Dodonaea
viscosa root extracts. Int. J. Pharm. Bio Sci, 1(4), pp.182-185.
191. Rajkumar, M., Ae, N. and Freitas, H., 2009. Endophytic bacteria and their potential
to enhance heavy metal phytoextraction. Chemosphere, 77(2), pp.153-160.
192. Rashid, S., Charles, T.C. and Glick, B.R., 2012. Isolation and characterization of new
plant growth-promoting bacterial endophytes. Applied soil ecology, 61, pp.217-224.
193. Rediers, H., Bonnecarrere, V., Rainey, P.B., Hamonts, K., Vanderleyden, J. and De
Mot, R., 2003. Development and application of a dapB-based in vivo expression
technology system to study colonization of rice by the endophytic nitrogen-fixing
bacterium Pseudomonas stutzeri A15. Applied and environmental microbiology,
69(11), pp.6864-6874.
194. Reinhold-Hurek, B. and Hurek, T., 1998. Life in grasses: diazotrophic endophytes.
Trends in microbiology, 6(4), pp.139-144.
195. Reinhold-Hurek, B. and Hurek, T., 2011. Living inside plants: bacterial endophytes.
Current opinion in plant biology, 14(4), pp.435-443.
196. Reinhold-Hurek, B., Maes, T., Gemmer, S., Van Montagu, M. and Hurek, T., 2006.
An endoglucanase is involved in infection of rice roots by the not-cellulose-
metabolizing endophyte Azoarcus sp. strain BH72. Molecular plant-microbe
interactions, 19(2), pp.181-188.
197. Reiter, B. and Sessitsch, A., 2006. Bacterial endophytes of the wildflower Crocus
albiflorus analyzed by characterization of isolates and by a cultivation-independent
approach. Canadian journal of microbiology, 52(2), pp.140-149.
198. Reiter, B., Pfeifer, U., Schwab, H. and Sessitsch, A., 2002. Response of endophytic
bacterial communities in potato plants to infection with Erwinia carotovora subsp.
atroseptica. Applied and Environmental Microbiology, 68(5), pp.2261-2268.
References
Agriculturally beneficial endophytic bacteria of wild plants 132
199. Romero, A., Carrion, G. and Rico-Gray, V., 2001. Fungal latent pathogens and
endophytes from leaves of Parthenium hysterophorus (Asteraceae). Fungal Diversity,
7, pp.81-87.
200. Roncato-Maccari, L.D., Ramos, H.J., Pedrosa, F.O., Alquini, Y., Chubatsu, L.S.,
Yates, M.G., Rigo, L.U., Steffens, M.B.R. and Souza, E.M., 2003. Endophytic
Herbaspirillum seropedicae expresses nif genes in gramineous plants. FEMS
microbiology ecology, 45(1), pp.39-47.
201. Rosenblueth, M. and Martínez-Romero, E., 2006. Bacterial endophytes and their
interactions with hosts. Molecular plant-microbe interactions, 19(8), pp.827-837.
202. Rout, M.E., Chrzanowski, T.H., Westlie, T.K., DeLuca, T.H., Callaway, R.M. and
Holben, W.E., 2013. Bacterial endophytes enhance competition by invasive plants.
American journal of botany, 100(9), pp.1726-1737.
203. Ryan, R.P., Germaine, K., Franks, A., Ryan, D.J. and Dowling, D.N., 2008. Bacterial
endophytes: recent developments and applications. FEMS microbiology letters,
278(1), pp.1-9.
204. Saito, A., Ikeda, S., Ezura, H. and Minamisawa, K., 2007. Microbial community
analysis of the phytosphere using culture-independent methodologies. Microbes and
Environments, 22(2), pp.93-105.
205. Saleh, S.S. and Glick, B.R., 2001. Involvement of gacS and rpoS in enhancement of
the plant growth-promoting capabilities of Enterobacter cloacae CAL2 and UW4.
Canadian Journal of Microbiology, 47(8), pp.698-705.
206. Santoyo, G., Moreno-Hagelsieb, G., del Carmen Orozco-Mosqueda, M. and Glick,
B.R., 2016. Plant growth-promoting bacterial endophytes. Microbiological research,
183, pp.92-99.
207. Savli, H., Karadenizli, A., Kolayli, F., Gundes, S., Ozbek, U. and Vahaboglu, H.,
2003. Expression stability of six housekeeping genes: a proposal for resistance gene
quantification studies of Pseudomonas aeruginosa by real-time quantitative RT-PCR.
Journal of Medical Microbiology, 52(5), pp.403-408.
208. Schaller, G.E., 2012. Ethylene and the regulation of plant development. BMC
biology, 10(1), p.9.
209. Scherling, C., Ulrich, K., Ewald, D. and Weckwerth, W., 2009. A metabolic
signature of the beneficial interaction of the endophyte Paenibacillus sp. Isolate and
in vitro–grown poplar plants revealed by metabolomics. Molecular plant-microbe
interactions, 22(8), pp.1032-1037.
References
Agriculturally beneficial endophytic bacteria of wild plants 133
210. Schulz, B., Wanke, U., Draeger, S. and Aust, H.J., 1993. Endophytes from
herbaceous plants and shrubs: effectiveness of surface sterilization methods.
Mycological research, 97(12), pp.1447-1450.
211. Schwyn, B. and Neilands, J.B., 1987. Universal chemical assay for the detection and
determination of siderophores. Analytical biochemistry, 160(1), pp.47-56.
212. Selvakumar, G., Mohan, M., Kundu, S., Gupta, A.D., Joshi, P., Nazim, S. and Gupta,
H.S., 2008. Cold tolerance and plant growth promotion potential of Serratia
marcescens strain SRM (MTCC 8708) isolated from flowers of summer squash
(Cucurbita pepo). Letters in applied microbiology, 46(2), pp.171-175.
213. Senthilkumar, M., Anandham, R., Madhaiyan, M., Venkateswaran, V. and Sa, T.,
2011. Endophytic bacteria: perspectives and applications in agricultural crop
production. In Bacteria in Agrobiology: Crop Ecosystems (pp. 61-96). Springer
Berlin Heidelberg.
214. Sessitsch, A., Coenye, T., Sturz, A.V., Vandamme, P., Barka, E.A., Salles, J.F., Van
Elsas, J.D., Faure, D., Reiter, B., Glick, B.R. and Wang-Pruski, G., 2005.
Burkholderia phytofirmans sp. nov., a novel plant-associated bacterium with plant-
beneficial properties. International Journal of Systematic and Evolutionary
Microbiology, 55(3), pp.1187-1192.
215. Sessitsch, A., Hardoim, P., Döring, J., Weilharter, A., Krause, A., Woyke, T., Mitter,
B., Hauberg-Lotte, L., Friedrich, F., Rahalkar, M. and Hurek, T., 2012. Functional
characteristics of an endophyte community colonizing rice roots as revealed by
metagenomic analysis. Molecular Plant-Microbe Interactions, 25(1), pp.28-36.
216. Sessitsch, A., Reiter, B. and Berg, G., 2004. Endophytic bacterial communities of
field-grown potato plants and their plant-growth-promoting and antagonistic abilities.
Canadian Journal of Microbiology, 50(4), pp.239-249.
217. Sessitsch, A., Reiter, B., Pfeifer, U. and Wilhelm, E., 2002. Cultivation-independent
population analysis of bacterial endophytes in three potato varieties based on
eubacterial and Actinomycetes-specific PCR of 16S rRNA genes. FEMS
microbiology ecology, 39(1), pp.23-32.
218. Sgroy, V., Cassán, F., Masciarelli, O., Del Papa, M.F., Lagares, A. and Luna, V.,
2009. Isolation and characterization of endophytic plant growth-promoting (PGPB)
or stress homeostasis-regulating (PSHB) bacteria associated to the halophyte
Prosopis strombulifera. ApplIed microbiology and Biotechnology, 85(2), pp.371-
381.
References
Agriculturally beneficial endophytic bacteria of wild plants 134
219. Shao, W., Xue, Y., Wu, A., Kataeva, I., Pei, J., Wu, H. and Wiegel, J., 2011.
Characterization of a novel β-xylosidase, XylC, from Thermoanaerobacterium
saccharolyticum JW/SL-YS485. Applied and environmental microbiology, 77(3),
pp.719-726.
220. Sharma, S., Aneja, M.K., Mayer, J., Schloter, M. and Munch, J.C., 2004. RNA
fingerprinting of microbial community in the rhizosphere soil of grain legumes.
FEMS microbiology letters, 240(2), pp.181-186.
221. Sharma, S.B., Sayyed, R.Z., Trivedi, M.H. and Gobi, T.A., 2013. Phosphate
solubilizing microbes: sustainable approach for managing phosphorus deficiency in
agricultural soils. SpringerPlus, 2(1), p.587.
222. Sharma, V.K. and Nowak, J., 1998. Enhancement of verticillium wilt resistance in
tomato transplants by in vitro co-culture of seedlings with a plant growth promoting
rhizobacterium (Pseudomonas sp. strain PsJN). Canadian Journal of Microbiology,
44(6), pp.528-536.
223. Sheibani-Tezerji, R., Rattei, T., Sessitsch, A., Trognitz, F. and Mitter, B., 2015.
Transcriptome profiling of the endophyte Burkholderia phytofirmans PsJN indicates
sensing of the plant environment and drought stress. MBio, 6(5), pp.e00621-15.
224. Sheng, X.F., Xia, J.J., Jiang, C.Y., He, L.Y. and Qian, M., 2008. Characterization of
heavy metal-resistant endophytic bacteria from rape (Brassica napus) roots and their
potential in promoting the growth and lead accumulation of rape. Environmental
Pollution, 156(3), pp.1164-1170.
225. Sheoran, N., Nadakkakath, A.V., Munjal, V., Kundu, A., Subaharan, K., Venugopal,
V., Rajamma, S., Eapen, S.J. and Kumar, A., 2015. Genetic analysis of plant
endophytic Pseudomonas putida BP25 and chemo-profiling of its antimicrobial
volatile organic compounds. Microbiological research, 173, pp.66-78.
226. Shi, Y., Yang, H., Zhang, T., Sun, J. and Lou, K., 2014. Illumina-based analysis of
endophytic bacterial diversity and space-time dynamics in sugar beet on the north
slope of Tianshan mountain. Applied microbiology and biotechnology, 98(14),
pp.6375-6385.
227. Shin, M.N., Shim, J., You, Y., Myung, H., Bang, K.S., Cho, M., Kamala-Kannan, S.
and Oh, B.T., 2012. Characterization of lead resistant endophytic Bacillus sp. MN3-4
and its potential for promoting lead accumulation in metal hyperaccumulator Alnus
firma. Journal of hazardous materials, 199, pp.314-320.
References
Agriculturally beneficial endophytic bacteria of wild plants 135
228. Siciliano, S.D. and Germida, J.J., 1999. Taxonomic diversity of bacteria associated
with the roots of field-grown transgenic Brassica napus cv. Quest, compared to the
non-transgenic B. napus cv. Excel and B. rapa cv. Parkland. FEMS Microbiology
Ecology, 29(3), pp.263-272.
229. Siciliano, S.D., Fortin, N., Mihoc, A., Wisse, G., Labelle, S., Beaumier, D., Ouellette,
D., Roy, R., Whyte, L.G., Banks, M.K. and Schwab, P., 2001. Selection of specific
endophytic bacterial genotypes by plants in response to soil contamination. Applied
and environmental microbiology, 67(6), pp.2469-2475.
230. Singh, L.P., Gill, S.S. and Tuteja, N., 2011. Unraveling the role of fungal symbionts
in plant abiotic stress tolerance. Plant signaling & behavior, 6(2), pp.175-191.
231. Smalla, K., 2004. Culture-independent microbiology. In Microbial Diversity and
Bioprospecting (pp. 88-99). American Society of Microbiology.
232. Smits, T.H., Rezzonico, F., Kamber, T., Blom, J., Goesmann, A., Ishimaru, C.A.,
Frey, J.E., Stockwell, V.O. and Duffy, B., 2011. Metabolic versatility and
antibacterial metabolite biosynthesis are distinguishing genomic features of the fire
blight antagonist Pantoea vagans C9-1. PLoS One, 6(7), p.e22247.
233. Song, Z., Ding, L., Ma, B., Li, W. and Mei, R., 1998. Studies on the population and
dynamic analysis of peanut endophytes. Acta Phytophylacica Sinica, 26(4), pp.309-
314.
234. Spaepen, S., Vanderleyden, J. and Remans, R., 2007. Indole-3-acetic acid in
microbial and microorganism-plant signaling. FEMS microbiology reviews, 31(4),
pp.425-448.
235. Srinivasan, R., Karaoz, U., Volegova, M., MacKichan, J., Kato-Maeda, M., Miller,
S., Nadarajan, R., Brodie, E.L. and Lynch, S.V., 2015. Use of 16S rRNA gene for
identification of a broad range of clinically relevant bacterial pathogens. PloS
one, 10(2), p.e0117617.
236. Sturz, A.V. and Nowak, J., 2000. Endophytic communities of rhizobacteria and the
strategies required to create yield enhancing associations with crops. Applied soil
ecology, 15(2), pp.183-190.
237. Su, F., Gilard, F., Guérard, F., Citerne, S., Clément, C., Vaillant-Gaveau, N. and
Dhondt-Cordelier, S., 2016. Spatio-temporal responses of Arabidopsis leaves in
photosynthetic performance and metabolite contents to Burkholderia phytofirmans
PsJN. Frontiers in plant science, 7.
References
Agriculturally beneficial endophytic bacteria of wild plants 136
238. Su, F., Jacquard, C., Villaume, S., Michel, J., Rabenoelina, F., Clément, C., Barka,
E.A., Dhondt-Cordelier, S. and Vaillant-Gaveau, N., 2015. Burkholderia
phytofirmans PsJN reduces impact of freezing temperatures on photosynthesis in
Arabidopsis thaliana. Frontiers in plant science, 6, p.810.
239. Suárez-Moreno, Z.R., Devescovi, G., Myers, M., Hallack, L., Mendonça-Previato,
L., Caballero-Mellado, J. and Venturi, V., 2010. Commonalities and differences in
regulation of N-acyl homoserine lactone quorum sensing in the beneficial plant-
associated Burkholderia species cluster. Applied and environmental microbiology,
76(13), pp.4302-4317.
240. Sun, L., Qiu, F., Zhang, X., Dai, X., Dong, X. and Song, W., 2008. Endophytic
bacterial diversity in rice (Oryza sativa L.) roots estimated by 16S rDNA sequence
analysis. Microbial ecology, 55(3), pp.415-424.
241. Sun, L., Wang, X. and Li, Y., 2016. Increased plant growth and copper uptake of host
and non-host plants by metal-resistant and plant growth-promoting endophytic
bacteria. International journal of phytoremediation, 18(5), pp.494-501.
242. Sun, L.N., Zhang, Y.F., He, L.Y., Chen, Z.J., Wang, Q.Y., Qian, M. and Sheng, X.F.,
2010. Genetic diversity and characterization of heavy metal-resistant-endophytic
bacteria from two copper-tolerant plant species on copper mine wasteland.
Bioresource Technology, 101(2), pp.501-509.
243. Sun, Y., Cheng, Z. and Glick, B.R., 2009. The presence of a 1-aminocyclopropane-1-
carboxylate (ACC) deaminase deletion mutation alters the physiology of the
endophytic plant growth-promoting bacterium Burkholderia phytofirmans PsJN.
FEMS microbiology letters, 296(1), pp.131-136.
244. Taghavi, S., Garafola, C., Monchy, S., Newman, L., Hoffman, A., Weyens, N.,
Barac, T., Vangronsveld, J. and van der Lelie, D., 2009. Genome survey and
characterization of endophytic bacteria exhibiting a beneficial effect on growth and
development of poplar trees. Applied and Environmental Microbiology, 75(3),
pp.748-757.
245. Terakado-Tonooka, J., Ohwaki, Y., Yamakawa, H., Tanaka, F., Yoneyama, T. and
Fujihara, S., 2008. Expressed nifH genes of endophytic bacteria detected in field-
grown sweet potatoes (Ipomoea batatas L.). Microbes and Environments, 23(1),
pp.89-93.
246. Theocharis, A., Bordiec, S., Fernandez, O., Paquis, S., Dhondt-Cordelier, S.,
Baillieul, F., Clément, C. and Barka, E.A., 2012. Burkholderia phytofirmans PsJN
References
Agriculturally beneficial endophytic bacteria of wild plants 137
primes Vitis vinifera L. and confers a better tolerance to low nonfreezing
temperatures. Molecular Plant-Microbe Interactions, 25(2), pp.241-249.
247. Thomas, P. and Upreti, R., 2014. Testing of bacterial endophytes from non-host
sources as potential antagonistic agents against tomato wilt pathogen Ralstonia
solanacearum. Advances in Microbiology, 2014.
248. Thornton, B. and Basu, C., 2011. Real‐time PCR (qPCR) primer design using free
online software. Biochemistry and Molecular Biology Education, 39(2), pp.145-154.
249. Tian, X.P., Zhi, X.Y., Qiu, Y.Q., Zhang, Y.Q., Tang, S.K., Xu, L.H., Zhang, S. and
Li, W.J., 2009. Sciscionella marina gen. nov., sp. nov., a marine actinomycete
isolated from a sediment in the northern South China Sea. International journal of
systematic and evolutionary microbiology, 59(2), pp.222-228.
250. Timmusk, S., Paalme, V., Pavlicek, T., Bergquist, J., Vangala, A., Danilas, T. and
Nevo, E., 2011. Bacterial distribution in the rhizosphere of wild barley under
contrasting microclimates. PLoS One, 6(3), p.e17968.
251. Torsvik, V. and Øvreås, L., 2002. Microbial diversity and function in soil: from
genes to ecosystems. Current opinion in microbiology, 5(3), pp.240-245.
252. Trivedi, P., Duan, Y. and Wang, N., 2010. Huanglongbing, a systemic disease,
restructures the bacterial community associated with citrus roots. Applied and
environmental microbiology, 76(11), pp.3427-3436.
253. Trivedi, P., Spann, T. and Wang, N., 2011. Isolation and characterization of
beneficial bacteria associated with citrus roots in Florida. Microbial ecology, 62(2),
pp.324-336.
254. Trognitz, F., Scherwinski, K., Fekete, A., Schmidt, S., Eberl, L., Rodewald, J.,
Schmid, M., Compant, S., Hartmann, A., Schmitt-Kopplin, P. and Trognitz, B., 2008.
Interaction between potato and the endophyte Burkholderia phytofirmans. na.
255. Tsavkelova, E.A., Cherdyntseva, T.A., Botina, S.G. and Netrusov, A.I., 2007.
Bacteria associated with orchid roots and microbial production of auxin.
Microbiological research, 162(1), pp.69-76.
256. Van Der Heijden, M.G., Bardgett, R.D. and Van Straalen, N.M., 2008. The unseen
majority: soil microbes as drivers of plant diversity and productivity in terrestrial
ecosystems. Ecology letters, 11(3), pp.296-310.
257. Verma, V.C., Singh, S.K. and Prakash, S., 2011. Bio‐control and plant growth
promotion potential of siderophore producing endophytic Streptomyces from
Azadirachta indica A. Juss. Journal of basic microbiology, 51(5), pp.550-556.
References
Agriculturally beneficial endophytic bacteria of wild plants 138
258. Visioli, G., D’Egidio, S., Vamerali, T., Mattarozzi, M. and Sanangelantoni, A.M.,
2014. Culturable endophytic bacteria enhance Ni translocation in the
hyperaccumulator Noccaea caerulescens. Chemosphere, 117, pp.538-544.
259. Vivas, A., Marulanda, A., Ruiz-Lozano, J.M., Barea, J.M. and Azcón, R., 2003.
Influence of a Bacillus sp. on physiological activities of two arbuscular mycorrhizal
fungi and on plant responses to PEG-induced drought stress. Mycorrhiza, 13(5),
pp.249-256.
260. Wang, H., Jones, B., Li, Z., Frasse, P., Delalande, C., Regad, F., Chaabouni, S.,
Latche, A., Pech, J.C. and Bouzayen, M., 2005. The tomato Aux/IAA transcription
factor IAA9 is involved in fruit development and leaf morphogenesis. The Plant Cell,
17(10), pp.2676-2692.
261. Wang, M., Tachibana, S., Murai, Y., Li, L., Lau, S.Y.L., Cao, M., Zhu, G.,
Hashimoto, M. and Hashidoko, Y., 2016. Indole-3-acetic acid produced by
Burkholderia heleia acts as a phenylacetic acid antagonist to disrupt tropolone
biosynthesis in Burkholderia plantarii. Scientific reports, 6.
262. Weisburg, W.G., Barns, S.M., Pelletier, D.A. and Lane, D.J., 1991. 16S ribosomal
DNA amplification for phylogenetic study. Journal of bacteriology, 173(2), pp.697-
703.
263. Whipps, J.M., 2001. Microbial interactions and biocontrol in the rhizosphere. Journal
of experimental Botany, 52(suppl 1), pp.487-511.
264. Woodward, A.W. and Bartel, B., 2005. Auxin: regulation, action, and interaction.
Annals of botany, 95(5), pp.707-735.
265. Xia, Y., Greissworth, E., Mucci, C., Williams, M.A. and De Bolt, S., 2013.
Characterization of culturable bacterial endophytes of switchgrass (Panicum
virgatum L.) and their capacity to influence plant growth. Gcb Bioenergy, 5(6),
pp.674-682.
266. Young, L.S., Hameed, A., Peng, S.Y., Shan, Y.H. and Wu, S.P., 2013. Endophytic
establishment of the soil isolate Burkholderia sp. CC-Al74 enhances growth and P-
utilization rate in maize (Zea mays L.). Applied soil ecology, 66, pp.40-47.
267. Yousaf, S., Afzal, M., Reichenauer, T.G., Brady, C.L. and Sessitsch, A., 2011.
Hydrocarbon degradation, plant colonization and gene expression of alkane
degradation genes by endophytic Enterobacter ludwigii strains. Environmental
pollution, 159(10), pp.2675-2683.
References
Agriculturally beneficial endophytic bacteria of wild plants 139
268. Yu, X., Lund, S.P., Scott, R.A., Greenwald, J.W., Records, A.H., Nettleton, D.,
Lindow, S.E., Gross, D.C. and Beattie, G.A., 2013. Transcriptional responses of
Pseudomonas syringae to growth in epiphytic versus apoplastic leaf sites.
Proceedings of the National Academy of Sciences, 110(5), pp.E425-E434.
269. Yuan, M., He, H., Xiao, L., Zhong, T., Liu, H., Li, S., Deng, P., Ye, Z. and Jing, Y.,
2014. Enhancement of Cd phytoextraction by two Amaranthus species with
endophytic Rahnella sp. JN27. Chemosphere, 103, pp.99-104.
270. Zachow, C., Fatehi, J., Cardinale, M., Tilcher, R. and Berg, G., 2010. Strain-specific
colonization pattern of Rhizoctonia antagonists in the root system of sugar beet.
FEMS microbiology ecology, 74(1), pp.124-135.
271. Zarei, M., Aminzadeh, S., Zolgharnein, H., Safahieh, A., Daliri, M., Noghabi, K.A.,
Ghoroghi, A. and Motallebi, A., 2011. Characterization of a chitinase with antifungal
activity from a native Serratia marcescens B4A. Brazilian Journal of Microbiology,
42(3), pp.1017-1029.
272. Zhang, D., Spadaro, D., Valente, S., Garibaldi, A. and Gullino, M.L., 2012. Cloning,
characterization, expression and antifungal activity of an alkaline serine protease of
Aureobasidium pullulans PL5 involved in the biological control of postharvest
pathogens. International journal of food microbiology, 153(3), pp.453-464.
273. Zhang, H.B., Zhang, X.F. and Zhang, L.H., 2001. Quenching quorum-sensing-
dependent bacterial infection by an N-acyl homoserine lactonase. Nature, 411(6839),
pp.813-817.
274. Zhang, X., Lin, L., Zhu, Z., Yang, X., Wang, Y. and An, Q., 2013. Colonization and
modulation of host growth and metal uptake by endophytic bacteria of Sedum
alfredii. International journal of phytoremediation, 15(1), pp.51-64.
275. Zhang, Y.F., He, L.Y., Chen, Z.J., Wang, Q.Y., Qian, M. and Sheng, X.F., 2011.
Characterization of ACC deaminase-producing endophytic bacteria isolated from
copper-tolerant plants and their potential in promoting the growth and copper
accumulation of Brassica napus. Chemosphere, 83(1), pp.57-62.
276. Zhao, S., Wei, H., Lin, C.Y., Zeng, Y., Tucker, M.P., Himmel, M.E. and Ding, S.Y.,
2016. Burkholderia phytofirmans inoculation-induced changes on the shoot cell
anatomy and iron accumulation reveal novel components of Arabidopsis-endophyte
interaction that can benefit downstream biomass deconstruction. Frontiers in plant
science, 7, p.24.
References
Agriculturally beneficial endophytic bacteria of wild plants 140
277. Zinniel, D.K., Lambrecht, P., Harris, N.B., Feng, Z., Kuczmarski, D., Higley, P.,
Ishimaru, C.A., Arunakumari, A., Barletta, R.G. and Vidaver, A.K., 2002. Isolation
and characterization of endophytic colonizing bacteria from agronomic crops and
prairie plants. Applied and environmental microbiology, 68(5), pp.2198-2208.
278. Zúñiga, A., Poupin, M.J., Donoso, R., Ledger, T., Guiliani, N., Gutiérrez, R.A. and
González, B., 2013. Quorum sensing and indole-3-acetic acid degradation play a role
in colonization and plant growth promotion of Arabidopsis thaliana by Burkholderia
phytofirmans PsJN. Molecular Plant-Microbe Interactions, 26(5), pp.546-553.
Appendix A
Appendix A
Agriculturally beneficial endophytic bacteria of wild plants 141
Appendix A
Table A1: 0.03 M MgSO4
Ingredients Quantity (g/L)
MgSO4.7H2O 7.39
Contents dissolved in distilled water.
Autoclave was done by heating at 121°C and 15 psi pressure for 20 minutes.
Table A2: Tryptic Soya Agar
Ingredients Quantity (g/L)
Tryptone Soya Agar (Oxoid CM0129) 30
Content dissolved in distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
For half strength media, 15 g was dissolved in 1 liter distilled water.
Table A3: Tryptic Soya Broth
Ingredients Quantity (g/L)
Tryptone Soya Broth (Oxoid CM0131) 40
Contents dissolved in distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
For half strength media, 20 g was dissolved in 1 liter distilled water.
Table A4: Nutrient agar (Half strength)
Ingredients Quantity (g/L)
Nutrient Agar (Oxoid CM0003) 14
Contents dissolved in distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Table A5: R2A Agar
Ingredients Quantity (g/L)
R2A Agar (Oxoid CM0906) 18.1
Contents dissolved in distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Appendix A
Agriculturally beneficial endophytic bacteria of wild plants 142
Table A6: 70% Ethanol
Ingredients Quantity (ml)
Ethanol (Scharlau ET00052500) 700
Distilled water 300
Table A7: 50% glycerol solution
Ingredients Quantity (ml)
R2A Agar (Scharlau GL00261000) 500
Distilled water 500
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Table A8: 20% Bleach solution
Ingredients Quantity (ml)
Clorox® regular 200
Distilled water 800
Table A9: 0.5% Water agar
Ingredients Quantity (g/L)
Agar technical (Oxoid LP0013) 5
Contents dissolved in distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Table A10: 0.5% Water agar with 25 mM NaCl
Ingredients Quantity (g/L)
Agar technical (Oxoid LP0013) 5
NaCl 1.46
Contents dissolved in distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Table A11: Murashige and Skoog Basal Salt medium
Ingredients Quantity (g/L)
MS basal salts (Sigma-Aldrich M5524) 4.3
Sucrose 30
Agar technical (Oxoid LP0013) 8
Contents dissolved in distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Appendix A
Agriculturally beneficial endophytic bacteria of wild plants 143
Table A12: Tryptic Soya Broth with Tryptophan (200 µg/ml)
Ingredients Quantity (g/L)
Tryptone Soya Broth (Oxoid CM0131) 40
Tryptophan (Scharlau TR04000025) 0.2
Contents dissolved in distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
For half strength media, 20 g was dissolved in 1 liter distilled water.
Table A13: Indole Acetic Acid Stock
Ingredients Quantity
IAA (Sigma-Aldrich I2886) 0.005 grams
Ethanol 20 ml
Distilled Water As needed to make 1000 ml total volume
Table A14: Salkowski Reagent
Solution A: 0.5 M FeCl3
Ingredients Quantity (g/L)
FeCl3.6H2O 135.15
Distilled Water added to make 1 L total volume
Solution B: 35 % HClO4
Ingredients Quantity (ml)
HClO4 650
Distilled water 350
Reagent
Ingredients Quantity (ml)
Solution A 20
Solution B 980
Table A15: Tri-calcium phosphate minimal medium (Kuklinsky-Sobral et al., 2004)
Ingredients Quantity (g/L)
Glucose 10
NH4Cl 5
NaCl 1
MgSO4.7H2O 1
Ca3(HPO4)2 0.8
Agar 15
Contents dissolved in distilled water.
pH was adjusted to 7.2
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Appendix A
Agriculturally beneficial endophytic bacteria of wild plants 144
Table A16: Chrome-Azurol S (CAS) Agar (Pérez-Miranda et al., 2007)
Solution A
Ingredients Quantity (g/ 990 ml)
Chrome Azurol S (CAS) 0.060
Hexadecyltrimetyl ammonium bromide
(HDTMA)
0.073
Piperazine-1,4-bis (2- ethanesulfonic acid)
(PIPES)
30.24
Agarose 9
Contents dissolved in distilled water.
Solution B
Ingredients Quantity (10 ml)
FeCl3.6H2O 0.002 grams
HCl 0.008 ml
H2O Up to 10 ml
Final Media
Solution A 10 ml
Solution B 990 ml
Contents dissolved in distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Table A17: Cellulose Congo Red Agar (Hendricks et al., 1995)
Ingredients Quantity (g/L)
K2HPO4 0.5
MgSO4 0.25
CMC (Sigma-Aldrich 419273) 1.88
Congo Red 0.20
Gelatin 2.0
Tap water 100 ml
Agar 15
Contents dissolved in distilled water.
pH was adjusted to 7.0
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Table A18: Pectin Minimal Agar (Hankin et al., 1971)
Ingredients Quantity (g/L)
(NH4)2SO4 1
Na2HPO4 6
KH2PO4 3
Polygalacturonic acid (Pectin) 5
Agar 15
Contents were dissolved in distilled water.
pH was adjusted to 7.0
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Appendix A
Agriculturally beneficial endophytic bacteria of wild plants 145
Table A19: Pectin Minimal Agar (Hankin et al., 1971)
Ingredients Quantity (g/L)
Iodine 3
Potassium Iodide 15
Contents were dissolved in distilled water to a final volume of 1 L.
Table A20: Skimmed Milk Agar (Bibi et al., 2012)
Solution A
Ingredients Quantity (g)
2X Tryptone Soya Broth (Oxoid CM0131) 80
Contents dissolved in 500 ml distilled water.
pH was adjusted to 7.0
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Solution B
Ingredients Quantity (g)
Skimmed milk 40 grams
Contents dissolved in 500 ml distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Full Media
Solution A 500 ml
Solution B 500 ml
The two solutions were mixed after autoclaving prior to pouring in petri plates
Table A21: Colloidal Chitin Agar (Bibi et al., 2012)
Ingredients Quantity (g/L)
Tryptone Soya Broth (Oxoid CM0131) 40
Colloidal Chitin 6
Agar 15
Contents dissolved in distilled water.
pH was adjusted to 7.0
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Table A22: Dual Culture Antifungal Agar (Bibi et al., 2012)
Ingredients Quantity (g/L)
Tryptone Soya Agar (Oxoid CM0129) 15
Potato Dextrose Agar (Oxoid CM0139) 19.5
Contents dissolved in distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Appendix A
Agriculturally beneficial endophytic bacteria of wild plants 146
Table A23: Chrome-Azurol S (CAS) Agar (Alexander and Zuberer, 1991).
Solution 1 (Fe-CAS indicator solution)
Ingredients Quantity
Solution B (Table A16) 10 ml
CAS dye solution (0.06 g dye in 50 ml H2O) 50 ml
HDTMA solution (0.073 g in 40 ml H2O) 40 ml
The Solution B was fist mixed with CAS dye solution.
The resulting solution was slowly added to HDTMA solution with constant mixing.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Solution was cooled to 50°C.
Solution 2 (Buffer solution)
Ingredients Quantity (g/L)
PIPES 30.24 g
KH2PO4 0.3
NaCI 0.5
NH4Cl 1.0
Agar 15
Contents were dissolved in 750 ml distilled water.
pH was adjusted to 6.8 using 50% KOH.
Final volume was adjusted to 800 ml using distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Solution was cooled to 50°C.
Solution 3 (Nutrient solution)
Ingredients Quantity (g)
Glucose 2
Mannitol 2
MgSO4.7H2O 0.473
CaCl2 0.011
MnSO4.H2O 0.00117
H3BO3 0.0014
CuSO4.5H2O 0.00004
ZnSO4.7H2O 0.0012
Na2MoO4.2H2O 0.001
Contents dissolved in 70 ml distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Solution was cooled to 50°C.
Solution 4 (Casamino acid solution)
Ingredients Quantity (g)
Casamino acid 3
Contents dissolved in distilled water to a final volume of 30 ml.
Solution was filter sterilized.
CAS Media
Solution 1 100 ml
Solution 2 800 ml
Solution 3 70 ml
Solution 4 30 ml
Solution 2,3 and 4 were mixed first and the solution 1 was slowly added to the mix.
Appendix A
Agriculturally beneficial endophytic bacteria of wild plants 147
Table A24: M9 Minimal Agar
Solution A (20% Glucose)
Ingredients Quantity (g/L)
Glucose 200
Contents dissolved in distilled water.
Solution was filter sterilized.
Solution B (1 M CaCl2)
Ingredients Quantity (g/L)
CaCl2 110.98
Contents were dissolved in distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Solution C (1 M MgSO4)
Ingredients Quantity (g/L)
MgSO4 120.36
Contents dissolved in distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Solution D (5× M9 Salts)
Ingredients Quantity (g/L)
M9 Salts (Sigma-Aldrich M6030) 56.4
Contents dissolved in distilled water.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Solution E (Water Agar)
Ingredients Quantity (g)
Agar 15
Content dissolved in distilled water to a final volume of 780 ml.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
M9 Media
Solution A 20 ml
Solution B 200 ml
Solution C 0.1 ml
Solution D 2 ml
Solution E 780 ml
Table A25: Kings Broth B
Ingredients Quantity (g/L)
Peptone 20
K2HPO4 1.5
MgSO4.7H2O 1.5
Contents dissolved in distilled water.
pH was adjusted to 7.2.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Appendix A
Agriculturally beneficial endophytic bacteria of wild plants 148
Table A26: Kings Agar B
Ingredients Quantity (g/L)
Peptone 20
K2HPO4 1.5
MgSO4.7H2O 1.5
Agar 15
Contents dissolved in distilled water.
pH was adjusted to 7.2.
Autoclaving was done by heating at 121°C and 15 psi pressure for 20 minutes.
Table A27: 10 mM potassium phosphate
Kits Quantity (g/L)
KH2PO4 1.36
Content was dissolved in distilled water.
Table A28: Cell Lysis Buffer
Solution A (1 M Tris)
Ingredients Quantity (g/L)
Tris (hydroxymethyl) aminomethane Base 121.4
Content was dissolved in distilled water.
pH was adjusted to 8.0 using HCL (concentrated)
Solution B (0.5 M EDTA)
Ingredients Quantity (g/L)
Ethylenediaminetetraacetic acid (EDTA) 186.1
Content were dissolved in distilled water with constant mixing and maintaining pH at 8.0
pH was maintained at 8.0 by gradually adding NaOH (pellets)
Solution C (10% Triton X)
Ingredients Quantity (ml)
Triton X 100 ml
Distilled H2O 900 ml
Lysis Solution (1 L)
Solution A 20 ml
Solution B 4 ml
Solution C 100 ml
Distilled H2O 876 ml
Table A29: TAE buffer (50×)
Ingredients Quantity (g/L)
Tris (hydroxymethyl) aminomethane Base 242 g
Glacial acetic acid 57.1 ml
0.5 M EDTA (Solution B, Table A28) 100 ml
Contents dissolved in distilled water to a final volume of 1 L.
1×TAE was prepared by mixing 20 ml of 50× in 980 ml of distilled water.
Appendix A
Agriculturally beneficial endophytic bacteria of wild plants 149
Table A30: 1% Agarose
Kits Quantity (g/L)
Agarose 10
Content was dissolved in 1×TAE (Table A29)
Table A31: Phenol-Ethanol Stop Solution
Kits Quantity (ml)
Water-Saturated Phenol (Invitrogen
AM9710)
5
Ethanol 95
Distilled Water 900
Table A32: Commercial Kits and Reagents
Ingredients Make
GoTaq® Green Master Mix Promega, USA (M7122)
GeneRuler 1 kb DNA Ladder ThermoFisher Scientific, USA (SM0311)
Ethidium Bromide Solution (10 mg/mL) ThermoFisher Scientific, USA (17898)
DNA Gel Loading Dye (6X) ThermoFisher Scientific, USA (R0611)
PureLink® PCR Purification Kit Invitrogen, USA (K310001)
TRIzol® Reagent Invitrogen, USA (15596026)
RNeasy Mini Kit Qiagen, Germany (74104)
RNase-free DNase I Qiagen, Germany (79254)
SuperScript First-Strand Synthesis System Invitrogen, USA (11904-018)
GeneRuler 100 bp Plus DNA Ladder ThermoFisher Scientific, USA (SM0321)
SYBR® Green PCR Master Mix Applied Biosystems, USA (4309155)
Table A33: Software and Services
Tools Link
BioEdit v7.0.5 http://www.mbio.ncsu.edu/BioEdit/bioedit.html
BLAST https://blast.ncbi.nlm.nih.gov/Blast.cgi
Eztaxon http://www.ezbiocloud.net/
ClustalXv2.1 http://www.clustal.org/clustal2/
MEGA5 http://www.megasoftware.net/
Statistix 8.1 http://statistix.software.informer.com/8.1/
Macrogen, Inc. http://www.macrogen.com/
qb3 facility http://qb3.berkeley.edu/
Sequence Detection Software v1.3 Applied Biosystems, USA
Appendix B
Appendix B
Agriculturally beneficial endophytic bacteria of wild plants 150
Table B1: IAA dilutions with their respective absorbance values.
Dilution IAA concentration
(μg/ml)
Absorbance (535 nm)
Replicate 1 Replicate 2 Average
1 0.313 0.007 0.009 0.008
2 0.625 0.016 0.022 0.019
3 1.25 0.039 0.040 0.040
4 2.5 0.092 0.090 0.091
5 5.00 0.178 0.181 0.180
Table B2: Cellulase (CEL), Pectinase (PEC), Phosphate solubilization (PHO), Protease
(PRO), Chitinase (CHI), and Indole Acetic Acid (IAA, without tryptophan; IAA-T, with
tryptophan) activities of endophytic bacteria isolated from Cannabis sativa (Direct method).
Values represent average of three replicates.
Isolate CEL
(cm)
PEC
(cm)
PHO
(cm)
PRO
(cm)
CHI
(cm)
IAA
(µg/ml)
IAA-T
(µg/ml)
Acinetobacter gyllenbergii MOSEL-r2 0.8 - 0.6 0.3 - 4.56 7.2
Acinetobacter nosocomialis MOSEL-n6 0.4 0.4 0.8 - - 2.54 4.02
Acinetobacter parvus MOSEL-t7 - - - - - 2.02 3.14
Acinetobacter pittii MOSEL-r8 0.4 - 0.8 - - 5.14 10.68
Bacillus anthracis MOSEL-r4 1.0 0.8 0.5 2.1 0.4 1.68 3.04
Chryseobacterium sp. MOSEL-n5 1.3 0.9 - 0.4 - 2.12 3.26
Enterobacter asburiae MOSEL-t15 0.4 0.3 2 - - 1.94 4.28
Enterococcus casseliflavus MOSEL-r7 - - 0.4 0.4 - 1.84 4
Nocardioides albus MOSEL-r13 0.6 1.2 - 0.7 - 1.34 4.56
Nocardioides kongjuensis MOSEL-r15 0.4 0.4 - - - 0.24 1
Pantoea vagans MOSEL-t13 0.3 - 1.1 - - 2.92 7.7
Planomicrobium chinense MOSEL-n9 0.8 - - - - 0.92 3.52
Pseudomonas taiwanensis MOSEL-t14 0.4 0.3 0.7 0.4 - 3.64 4.82
Rhizobium radiobacter MOSEL-n12 0.4 - 0.4 - - 3.8 13.34
Streptomyces eurocidicus MOSEL-n11 0.8 1.5 0.4 - - 0.98 1.8
Xanthomonas gardneri MOSEL-r5 0.4 0.9 - 0.4 - 1.4 5.1
Appendix B
Agriculturally beneficial endophytic bacteria of wild plants 151
Table B3: Cellulase (CEL), Pectinase (PEC), Phosphate solubilization (PHO), Protease
(PRO), Chitinase (CHI), and Indole Acetic Acid (IAA, without tryptophan; IAA-T, with
tryptophan) activities of endophytic bacteria isolated from Cannabis sativa (Selective
method). Values represent average of three replicates.
Isolate CEL
(cm)
PEC
(cm)
PHO
(cm)
PRO
(cm)
CHI
(cm)
IAA
(µg/ml)
IAA-T
(µg/ml)
Chryseobacterium sp. MOSEL- w4 2.2 0.9 - 0.8 - 0.51 1.29
Chryseobacterium sp. MOSEL-p22 0.9 0.6 - 0.8 - 0.4 1.4
Curtobacterium flaccumfaciens MOSEL-w15 0.4 0.4 - 0.4 - 1.8 5.1
Enterobacter cancerogenus MOSEL-p6 0.4 0.4 1.1 - - 2.92 6.94
Enterobacter cloacae MOSEL-w7 0.4 0.3 0.4 - - 2.38 4.56
Exiguobacterium indicum MOSEL-w12 1.9 1.8 0.3 1 - 2.22 4
Microbacterium ginsengiterrae MOSEL-w2.16 0.8 0.8 - - - 0.62 2.69
Microbacterium sp. MOSEL-w2.5 1 1.5 - 0.7 - 0.13 1.6
Microbacterium phyllosphaerae MOSEL-w2.1 0.4 0.9 - - - 0.15 1.48
Paenibacillus sp. MOSEL-w13 1.9 2 0.4 1.8 0.9 0.2 0.82
Paenibacillus tundrae MOSEL-w1 0.3 1.8 - - - 1.4 3.01
Pantoea anthophila MOSEL-w6 0.3 0.3 0.3 - - 1.6 3.5
Paracoccus marcusii MOSEL-w16 0.4 0.4 - - - 3.9 5.36
Pseudomonas geniculata MOSEL-tnc1 1.5 0.4 - 0.8 - 1.2 5.42
Pseudomonas koreensis MOSEL-tnc2 0.8 0.4 0.7 0.4 - 1.78 6.5
Pseudomonas plecoglossicida MOSEL-p18 0.4 0.7 0.4 - - 1.84 2.92
Serratia marcescens MOSEL-w2 0.9 0.4 0.8 0.7 1.1 3.02 5.64
Stenotrophomonas rhizophila MOSEL-tnc3 1.7 - - 0.8 0.4 1.92 4.02
Appendix B
Agriculturally beneficial endophytic bacteria of wild plants 152
Table B4: Cellulase (CEL), Pectinase (PEC), Phosphate solubilization (PHO), Protease
(PRO), Chitinase (CHI), and Indole Acetic Acid (IAA, without tryptophan; IAA-T, with
tryptophan) activities of endophytic bacteria isolated from Dodonaea viscosa roots. Values
represent average of three replicates.
Isolate CEL
(cm)
PEC
(cm)
PHO
(cm)
PRO
(cm)
CHI
(cm)
IAA
(µg/ml)
IAA-T
(µg/ml)
Inquilinus limosus MOSEL-RD1 0.8 1.3 0.5 0.7 - 0.44 1.28
Xanthomonas sacchari MOSEL-RD2 1.5 1.9 0.6 2.0 - 1.38 4.06
Streptomyces alboniger MOSEL-RD3 2.1 1.7 0.4 0.6 0.5 1.06 3.26
Bacillus idriensis MOSEL-RD7 1.7 1.7 0.7 1.8 0.4 2.46 10.12
Xanthomonas translucens MOSEL-RD9 0.6 1.6 0.8 2.1 - 0.84 2.54
Rhizobium huautlense MOSEL-RD12 1.3 1.2 0.5 - - 0.36 0.88
Microbacterium trichothecenolyticum MOSEL-
RD14 2.3 1.8 - 2.1 - 1.24 7.1
Streptomyces caeruleatus MOSEL-RD17 0.8 1.8 0.5 1.7 0.6 0.8 2.86
Bacillus simplex MOSEL-RD19 1.5 1.2 0.6 - - 1.18 2.32
Pseudomonas taiwanensis MOSEL-RD23 1.8 1.2 0.7 1.5 0.5 9.02 23.7
Brevundimonas subvibrioides MOSEL-RD25 0.5 1.1 - 1.4 - 0.9 3.44
Bacillus cereus MOSEL-RD27 2.1 1.7 0.7 1.5 0.6 5.32 10.8
Bacillus subtilis MOSEL-RD28 2.3 1.5 0.9 2.2 0.4 2.26 8.5
Pseudomonas geniculata MOSEL-RD36 1.7 1.4 0.5 1.2 0.5 3.72 15.32
Agrococcus terreus MOSEL-RD40 0.9 1.2 - 2.2 - 2.54 15.34
Appendix B
Agriculturally beneficial endophytic bacteria of wild plants 153
Table B5: Canola gnotobiotic root elongation assay of endophytic bacteria isolated from
Cannabis sativa (Direct method). Values represent mean of 12 replicates along with the
respective standard error values. LSD based pairwise comparison (p ≤ 0.05) of means
analyzed using one way ANOVA is also shown, where means having the same letter are not
statistically different from each other.
Isolate Mean Root
length (cm)
Standard
Error (cm)
Statistical
comparison
Acinetobacter gyllenbergii MOSEL-r2 9.48 0.48 BC
Acinetobacter nosocomialis MOSEL-n6 10.08 0.57 BC
Acinetobacter parvus MOSEL-t7 9.70 0.47 BC
Acinetobacter pittii MOSEL-r8 9.13 0.26 CD
Bacillus anthracis MOSEL-r4 10.38 0.41 BC
Chryseobacterium sp. MOSEL-n5 9.50 0.50 BC
Enterobacter asburiae MOSEL-t15 10.88 0.64 B
Enterococcus casseliflavus MOSEL-r7 9.93 0.41 BC
Nocardioides albus MOSEL-r13 10.07 0.53 BC
Nocardioides kongjuensis MOSEL-r15 9.42 0.61 CD
Pantoea vagans MOSEL-t13 12.88 0.54 A
Planomicrobium chinense MOSEL-n9 8.01 0.31 DE
Pseudomonas taiwanensis MOSEL-t14 9.97 0.29 BC
Rhizobium radiobacter MOSEL-n12 9.57 0.36 BC
Streptomyces eurocidicus MOSEL-n11 7.01 0.5 E
Xanthomonas gardneri MOSEL-r5 10.07 0.71 BC
Control 9.23 0.38 CD
Appendix B
Agriculturally beneficial endophytic bacteria of wild plants 154
Table B6: One-way ANOVA test report generated by Statistix v8.1 done for the comparison
of root lengths of canola plants treated with endophytic bacteria (gnotobiotic root elongation
assay) isolated from Cannabis sativa (Direct method). LSD All-Pairwise comparisons test of
means is also shown.
One-Way ANOVA
Source DF SS MS F P V001 16 140.983 8.81145 5.72 0.0000
Error 85 130.935 1.54041
Total 101 271.918
Grand Mean 9.7892 CV 12.68
Chi-Sq DF P Bartlett's Test of Equal Variances 11.7 16 0.7653
Cochran's Q 0.1170
Largest Var / Smallest Var 7.4578
Component of variance for between groups 1.21184
Effective cell size 12
V001 Mean V001 Mean control 9.233 r4 10.383
n11 7.017 r5 10.067
n12 9.617 r7 10.267
n5 9.500 r8 9.133
n6 10.083 t13 12.883
n9 8.017 t14 9.967
r13 10.067 t15 10.883
r15 9.417 t7 10.000
r2 9.883
Observations per Mean 12
Standard Error of a Mean 0.5067
Std Error (Diff of 2 Means) 0.7166
LSD All-Pairwise Comparisons Test of V002 by V001
(Comparison shown in table B5)
Alpha 0.05 Standard Error for Comparison 0.7166
Critical T Value 1.988 Critical Value for Comparison 1.4247
There are 5 groups (A, B, etc.) in which the means are not significantly different from one another.
Appendix B
Agriculturally beneficial endophytic bacteria of wild plants 155
Table B7: Canola gnotobiotic root elongation assay of endophytic bacteria isolated from
Cannabis sativa (Selective method). Values represent mean of 12 replicates along with the
respective standard error values. LSD based pairwise comparison (p ≤ 0.05) of means
analyzed using one way ANOVA is also shown, where means having the same letter are not
statistically different from each other.
Isolate Mean Root
length (cm)
Standard
Error (cm)
Statistical
comparison
Chryseobacterium sp. MOSEL- w4 9.38 0.32 CDEF
Chryseobacterium sp. MOSEL-p22 8.95 0.52 EF
Curtobacterium flaccumfaciens MOSEL-
w15 10.03 0.46 CDEF
Enterobacter cancerogenus MOSEL-p6 10.62 0.59 ABCD
Enterobacter cloacae MOSEL-w7 11.67 0.50 AB
Exiguobacterium indicum MOSEL-w12 9.38 0.50 CDEF
Microbacterium ginsengiterrae MOSEL-
w2.16 10.30 0.67 BCDE
Microbacterium sp. MOSEL-w2.5 9.32 0.38 CDEF
Microbacterium phyllosphaerae MOSEL-
w2.1 9.47 0.41 DEF
Paenibacillus sp. MOSEL-w13 8.62 0.65 F
Paenibacillus tundrae MOSEL-w1 8.67 0.46 F
Pantoea anthophila MOSEL-w6 10.20 0.38 CDE
Paracoccus marcusii MOSEL-w16 10.35 0.56 BCDE
Pseudomonas geniculata MOSEL-tnc1 11.87 0.38 A
Pseudomonas koreensis MOSEL-tnc2 10.80 0.58 ABC
Pseudomonas plecoglossicida MOSEL-p18 9.87 0.73 CDEF
Serratia marcescens MOSEL-w2 11.93 0.64 A
Stenotrophomonas rhizophila MOSEL-tnc3 10.55 0.50 ABCD
Control 9.03 0.43 EF
Appendix B
Agriculturally beneficial endophytic bacteria of wild plants 156
Table B8: One-way ANOVA test report generated by Statistix v8.1 done for the comparison
of root lengths of canola plants treated with endophytic bacteria (gnotobiotic root elongation
assay) isolated from Cannabis sativa (Selective method). LSD All-Pairwise comparisons test
of means is also shown.
One-Way ANOVA
Source DF SS MS F P V001 18 112.691 6.26060 3.85 0.0000
Error 95 154.493 1.62625
Total 113 267.184
Grand Mean 10.053 CV 12.69
Chi-Sq DF P Bartlett's Test of Equal Variances 8.53 18 0.9697
Cochran's Q 0.1043
Largest Var / Smallest Var 5.3209
Component of variance for between groups 0.77239
Effective cell size 12
V001 Mean V001 Mean control 9.033 w15 10.033
p18 9.867 w16 10.350
p22 8.950 w2 11.933
p6 10.617 w2.1 9.317
tnc1 11.867 w2.16 10.300
tnc2 10.800 w2.5 9.467
tnc3 10.550 w4 9.383
w1 8.667 w6 10.200
w12 9.383 w7 11.667
w13 8.617
Observations per Mean 12
Standard Error of a Mean 0.5206
Std Error (Diff of 2 Means) 0.7363
LSD All-Pairwise Comparisons Test of V002 by V001
(Comparison shown in table B7)
Alpha 0.05 Standard Error for Comparison 0.7363
Critical T Value 1.985 Critical Value for Comparison 1.4617
There are 6 groups (A, B, etc.) in which the means are not significantly different from one another.
Appendix B
Agriculturally beneficial endophytic bacteria of wild plants 157
Table B9: Canola gnotobiotic root elongation assay of endophytic bacteria isolated from
Dodonaea viscosa roots. Values represent mean of 12 replicates along with the respective
standard error values. LSD based pairwise comparison (p ≤ 0.05) of means analyzed using
one way ANOVA is also shown, where means having the same letter are not statistically
different from each other.
Isolate Mean Root
length (cm)
Standard
Error (cm)
Statistical
comparison
Inquilinus limosus MOSEL-RD1 8.1 0.250998 H
Xanthomonas sacchari MOSEL-RD2 11.52 0.467333 ABC
Streptomyces alboniger MOSEL-RD3 10.58 0.295635 CDE
Bacillus idriensis MOSEL-RD7 11.82 0.342637 AB
Xanthomonas translucens MOSEL-RD9 11.06 0.427317 ABCDE
Rhizobium huautlense MOSEL-RD12 8.56 0.208806 GH
Microbacterium trichothecenolyticum
MOSEL-RD14 10.54 0.430813 DE
Streptomyces caeruleatus MOSEL-RD17 10.26 0.428486 DEF
Bacillus simplex MOSEL-RD19 10.42 0.274591 DEF
Pseudomonas taiwanensis MOSEL-RD23 10.96 0.276767 BCDE
Brevundimonas subvibrioides MOSEL-RD25 10.14 0.374967 EF
Bacillus cereus MOSEL-RD27 11.16 0.398246 ABCD
Bacillus subtilis MOSEL-RD28 11.92 0.287054 A
Pseudomonas geniculata MOSEL-RD36 10.76 0.233666 CDE
Agrococcus terreus MOSEL-RD40 10.5 0.240832 DE
Control 9.5 0.330151 FG
Appendix B
Agriculturally beneficial endophytic bacteria of wild plants 158
Table B10: One-way ANOVA test report generated by Statistix v8.1 done for the
comparison of root lengths of canola plants treated with endophytic bacteria (gnotobiotic root
elongation assay) isolated from Dodonaea viscosa roots. LSD All-Pairwise comparisons test
of means is also shown.
One-Way ANOVA
Source DF SS MS F P V001 15 82.752 5.51677 9.61 0.0000
Error 64 36.736 0.57400
Total 79 119.488
Grand Mean 10.487 CV 7.22
Chi-Sq DF P Bartlett's Test of Equal Variances 6.87 15 0.9611
Cochran's Q 0.1189
Largest Var / Smallest Var 5.0092
Component of variance for between groups 0.98855
Effective cell size 12
V001 Mean V001 Mean control 9.500 rd25 10.140
rd1 8.100 rd27 11.160
rd12 8.560 rd28 11.920
rd14 10.540 rd3 10.580
rd17 10.260 rd36 10.760
rd19 10.420 rd40 10.500
rd2 11.520 rd7 11.820
rd23 10.960 rd9 11.060
Observations per Mean 12
Standard Error of a Mean 0.3388
Std Error (Diff of 2 Means) 0.4792
LSD All-Pairwise Comparisons Test of V002 by V001
(Comparison shown in table B9)
Alpha 0.05 Standard Error for Comparison 0.4792
Critical T Value 1.998 Critical Value for Comparison 0.9572
There are 8 groups (A, B, etc.) in which the means are not significantly different from one another.
Appendix B
Agriculturally beneficial endophytic bacteria of wild plants 159
Table B11: Canola gnotobiotic root elongation assay of three plant growth promoting
bacteria under 125 mM NaCl stress. Values represent mean of 12 replicates along with the
respective standard error values. LSD based pairwise comparison (p ≤ 0.05) of means
analyzed using one way ANOVA is also shown, where means having the same letter are not
statistically different from each other.
Isolate Mean Root
length (cm)
Standard
Error (cm)
Statistical
comparison
Pseudomonas geniculata MOSEL-tnc1 7.1 0.48 A
Serratia marcescens MOSEL-w2 6.78 0.48 AB
Pantoea vagans MOSEL-t13 7.4 0.46 A
Control 5.58 0.56 B
Appendix B
Agriculturally beneficial endophytic bacteria of wild plants 160
Table B12: One-way ANOVA test report generated by Statistix v8.1 done for the
comparison of root lengths of canola plants treated with three endophytic bacteria
(gnotobiotic root elongation assay) under 125 mM NaCl stress. LSD All-Pairwise
comparisons test of means is also shown.
One-Way ANOVA
Source DF SS MS F P V001 3 9.5495 3.18317 2.58 0.0401
Error 16 19.7760 1.23600
Total 19 29.3255
Grand Mean 6.7150 CV 16.56
Chi-Sq DF P Bartlett's Test of Equal Variances 0.16 3 0.9830
Cochran's Q 0.3169
Largest Var / Smallest Var 1.4714
Component of variance for between groups 0.38943
Effective cell size 12
V001 Mean control 5.5800
t13 7.4000
tnc1 7.1000
w2 6.7800
Observations per Mean 12
Standard Error of a Mean 0.4972
Std Error (Diff of 2 Means) 0.7031
LSD All-Pairwise Comparisons Test of V002 by V001
(Comparison shown in table B11)
Alpha 0.05 Standard Error for Comparison 0.7031
Critical T Value 2.120 Critical Value for Comparison 1.4906
There are 2 groups (A and B) in which the means are not significantly different from one another.
Appendix B
Agriculturally beneficial endophytic bacteria of wild plants 161
Table B13: Bacterial cell counts observed in the leaves of tomato plants inoculated with four
Burkholderia phytofirmans PsJN inoculum doses measured at different days post inoculation.
The values are in log colony forming units per gram fresh weight (log cfu/gfw), and average
counts along with standard error are also shown.
Dose 104 cfu/ml
Day Replicate
Average Standard
Error 1 2 3 4 5
0 2.20 2.43 2.24 2.17 2.47 2.32 0.06
2 2.75 2.66 3.11 2.45 3.10 2.81 0.13
4 3.09 2.89 2.24 2.49 2.30 2.60 0.17
6 1.73 3.19 3.48 3.55 3.02 2.99 0.43
Dose 106 cfu/ml
Day Replicate
Average Standard
Error 1 2 3 4 5
0 3.15 3.39 3.41 3.48 3.51 3.39 0.06
2 3.87 3.75 3.87 3.80 3.86 3.83 0.04
4 4.09 4.07 4.63 3.93 4.68 4.34 0.14
6 4.60 4.60 5.01 5.03 4.12 4.49 0.22
Dose 108 cfu/ml
Day Replicate
Average Standard
Error 1 2 3 4 5
0 4.78 4.93 4.43 4.75 4.66 4.71 0.08
2 4.94 5.29 5.41 5.54 5.28 5.29 0.1
4 4.61 5.16 5.59 5.34 5.51 5.24 0.17
6 5.03 5.69 5.88 5.78 5.58 5.59 0.15
Dose 109 cfu/ml
Day Replicate
Average Standard
Error 1 2 3 4 5
0 8.49 8.07 8.35 7.99 8.4 8.26 0.10
2 8.34 7.72 7.83 7.94 7.18 7.80 0.19
4 8.09 7.67 7.82 7.92 7.31 7.76 0.13
6 7.81 7.05 8.16 6.97 8.13 7.62 0.26
Appendix B
Agriculturally beneficial endophytic bacteria of wild plants 162
Table B14: Relative quantification qPCR analysis data of 15 Burkholderia phytofirmans
PsJN genes used for in-planta gene expression study along with the exogenous control gene
(rpoD).
Gene Sample Ct
SE
Avg
Ct
Avg
dCt
dCt
SE ddCt RQ
RQ
min
RQ
max
Log
RQ
Log
RQR DC
ACCD
Bphyt_5397
In-planta 0.17 36.93 2.06 0.21 -0.95 1.93 1.21 3.08 0.29 0.20 87.2
M9 0.04 28.94 3.01 0.06 0.00 1.00 0.90 1.12 0.00 0.05 87.2
IAA
degradation
Bphyt_2156
In-planta 0.21 38.79 2.69 0.29 -2.39 5.23 2.78 9.84 0.71 0.27 85.2
M9 0.09 31.34 5.08 0.10 0.00 1.00 0.83 1.21 0.00 0.08 85.2
LuxI 1
Bphyt_0126
In-planta 0.07 39.25 4.51 0.12 -2.33 5.02 3.47 7.27 0.70 0.16 85.9
M9 0.13 31.79 6.84 0.13 0.00 1.00 0.78 1.28 0.00 0.10 85.9
LuxI 2
Bphyt_4275
In-planta 0.07 34.91 0.17 0.13 1.22 0.43 0.29 0.63 -0.37 0.16 82.2
M9 0.07 23.91 -1.05 0.08 0.00 1.00 0.86 1.16 0.00 0.06 82.2
Cellulase
Bphyt_5838
In-planta 0.21 33.10 -1.66 0.33 -2.66 6.33 3.37 11.86 0.80 0.27 87
M9 0.14 25.86 1.01 0.21 0.00 1.00 0.63 1.58 0.00 0.16 87
Pectinase
Bphyt_4858
In-planta 0.02 39.45 5.34 0.21 -4.32 19.92 12.42 31.94 1.30 0.20 85.9
M9 0.23 34.55 9.66 0.24 0.00 1.00 0.63 1.58 0.00 0.16 85.9
B-xylosidase
Bphyt_6562
In-planta 0.43 34.54 -0.19 0.44 -3.81 14.05 5.33 37.01 1.15 0.42 85.2
M9 0.05 28.57 3.62 0.05 0.00 1.00 0.90 1.11 0.00 0.05 85.2
Pili
Bphyt_3289
In-planta 0.47 37.51 1.90 0.51 0.06 0.96 0.36 2.55 -0.20 0.43 86.1
M9 0.05 28.65 1.83 0.05 0.00 1.00 0.91 1.10 0.00 0.04 86.1
Flagella
Bphyt_3832
In-planta 0.07 33.50 -1.23 0.13 2.93 0.13 0.10 0.17 -0.88 0.12 87.1
M9 0.12 20.79 -4.16 0.13 0.00 1.00 0.78 1.28 0.00 0.11 87.1
Indole
Acetamide
Hydrolase
Bphyt_6420
In-planta 0.34 41.34 5.72 0.39 3.57 0.08 0.04 0.20 -1.08 0.37 82.4
M9 0.09 28.97 2.15 0.09 0.00 1.00 0.84 1.19 0.00 0.07 82.4
Aerobactin
Bphyt_0280
In-planta 0.11 37.89 2.77 0.23 -0.05 1.03 0.62 1.73 0.01 0.22 81.2
M9 0.01 28.58 2.82 0.02 0.00 1.00 0.95 1.05 0.00 0.02 81.2
Peroxidase
Bphyt_2078
In-planta 0.34 32.62 -2.14 0.42 -2.56 5.90 2.64 13.19 0.77 0.35 85.4
M9 0.07 25.28 0.42 0.17 0.00 1.00 0.72 1.39 0.00 0.06 85.4
β-galactosidase
Bphyt_5888
In-planta 0.26 36.67 1.92 0.36 -3.21 9.26 4.61 18.61 0.97 0.30 84.2
M9 0.02 29.99 5.13 0.16 0.00 1.00 0.74 1.35 0.00 0.13 84.2
Hemagglutinin
Bphyt_0418
In-planta 0.28 37.28 0.29 0.28 -1.02 2.02 0.87 4.71 0.30 0.37 88.2
M9 0.01 27.85 1.31 0.06 0.00 1.00 0.90 1.11 0.00 0.05 88.2
T3SS
Bphyt_5212
In-planta 0.19 40.70 6.98 0.26 -1.55 2.92 1.36 6.26 0.47 0.33 88.6
M9 0.26 34.45 8.53 0.27 0.00 1.00 0.59 1.69 0.00 0.23 88.6
rpoD
Bphyt_6584
In-planta 0.07 33.86 - - - - - - - - 88.5
M9 0.04 26.09 - - - - - - - - 88.5
Ct SE, Ct standard error; AvgCt, average Ct; Avg dCt , average ∆Ct; dCt SE, ∆Ct standard error; ddCt, ∆∆Ct;
RQ, relative quantification; RQ min, relative quantification minimum; RQ max, relative quantification
maximum; LogRQ, log relative quantification; LogRQR, Log relative quantification range; DC, dissociation
curve.
Publications