A~$~&f~Ml~ :PR:M/2 @Tf/~ fllR;JW/ .J ~~

6 Analysis of PRM1, PRM2 and PRM3 genes

6.1 Introduction

During spermatogenesis the histones of sperm are replaced by the transition nuclear

proteins (TNPs) followed by their own replacement by protamines (PRMs). Both TNPs

and PRMs are highly basic testis specific proteins required for the sperm chromatin

compaction. The compaction of the sperm chromatin is required for condensation of the

sperm nucleus into hydrodynamic shape and sperm DNA integrity. It has been

suggested that disturbances in nuclear condensation might result in male infertility

(Aoki & Carrell, 2003; Carrell et al., 2007; Oliva, 2006). In humans, three protamine genes,

namely PRMl, PRM2 and PRM3 have been shown to be present on chromosome 16p in a

single cluster along with the TNP2 gene. The PRMl and PRM2 genes have been studied

extensively but the role and the expression of PRM3 is controversial. It has been shown

that haploinsufficiency of PRMl or PRM2 causes infertility in mice (Cho et al., 2001). The

ratio of protamines (PRM1/PRM2 = ~1) is suggested to be more important than their

absolute amount and the altered ratio has been shown to be associated with male

infertility in many studies (Balhorn et al., 1988; Steger et al., 2001). But it is not well

established what causes the deregulation of protamines.

Many groups have evaluated the coding sequences of PRMl and PRM2 genes to identify

relevant mutations that can explain the idiopathic infertility. Earlier studies on infertile

men have identified many novel SNPs in coding region of protamine genes (Imken et al.,

2009; Ravel et al., 2007; Tuttelmann et al., 2009), but so far only one study has evaluated

the 5' and 3' UTRs of the protamine genes (Hammoud et al., 2007). As no comprehensive

evaluation of the full coding region of protamine genes is available till date, in the

present study a sequence analysis of the promoters, 5' and 3' UTRs, introns and exons of

all three protamine genes was performed in Indian infertile and fertile men. Promoters,

5' and 3' UTRs and introns were included in analysis because these regions are known to

play critical role in transcription and translation regulation of protamine genes. A total

of 527 Indian men were chosen for this study, which includes 278 infertile (104 NOA, 103

OAT and 71 OA) and 249 fertile men as a control.

6.2 Results A total of 28 ntd variants were identified in three PRM genes; of these seven were found

in PRMl, 13 were in PRM2 and eight were in PRM3 gene (Table 6.1 and Fig 6.1).

Genotype distributions of all the variants were in Hardy-Weinberg equilibrium in both

infertile and fertile men suggesting there was no stratification in the samples analyzed.

75

..7lnafj;sis if :P:RM1, P:RM2 amf :P:RM3 genes

Of these 28 polymorphisms, only eight had been previously reported while 16 were the

novel (Table 6.1). Among the 28 variants identified in present study 14 were found in 5'

Upstream regions, two in 5' UTRs, two in 3' UTRs, three in introns while seven were in

exons.

6.2.1 Sequence Analysis of PRM1 gene

In the PRMl gene seven variants were observed; of these three were novel mutations,

· three were reported in database and one, although not reported in dbSNP, but had been

studied in other population for its role with infertility (Table 6.1 and Fig. 6.1). Mutation

g.-238G>A was in upstream and was detected in an OAT and NOA man (Table 6.1 and

Fig. 6.1a). The novel mutation g.-226G>A was only detected in an OA man, but not in

any other man (Table 6.1 and Fig. 6.1b). The SNP g.-191C>A (rs2301365) in upstream of

PRMl gene did not show any significant difference between infertile and fertile control

men (Table 6.1). The non-synonymous novel mutation g.23G>A in exon 1, causing

p.Arg8His change, and a known silent mutation g.54G>A (rs35262993) were detected in

a NOA man, but not in any other NOA or in any other category of men (Table 6.1, Fig

6.1c and 6.1d). The synonymous SNP g.230C>A (rs737008) did not show significant

difference when infertile men or their subcategories were compared with fertile men

(Table 6.1). In the 3'UTR novel mutation g.335A>T was detected in an OAT man, but not

in any other category (Table 6.1 and Fig. 6.1e).

6.2.2 Sequence analysis PRM2 gene

In the PRM2 gene 13 variants were detected; of these, eight were novel, two had been

reported in dbSNP and the remaining two, although not reported in dbSNP, had been

found in earlier studies (Table 6.1 and Fig. 6.1). In upstream of PRM2 gene the novel

SNP g.-321C>T was detected. This SNP was found in men of all categories and showed

overall minor allele frequency (MAF) of approx 0.039 and did not show significant

difference between infertile men and fertile men (Table 6.1 and Fig. 6.1£). The novel

mutation g.-242C> T was detected in upstream of a NOA man but not in any other

man(Table 6.1 and Fig. 6.1g). The SNP g.-226G>A, which was earlier detected in men of

Utah (Hammoud et al., 2007), was found in men of all categories and had overall MAF

0.134, but did not show significant difference between infertile and fertile men (Table

6.1). Novel mutations g.-187G>T and g.-120G>C were detected in heterozygous

condition a fertile and in an OA man, respectively (Table 6.1, Fig. 6.1h and 6.1i). The rare

novel mutations g.-85G> T and g.-67C> T were detected in two different NOA men, but

not in any other man (Table 6.1, Fig. 6.1j and 6.1k). In exon 1 the synonymous novel

mutation g.120C>T was found in an OA man whereas a non-synonymous novel

mutation g.164G>A, causing p.Arg55His change, was only observed in a NOA man

76

Mutation "' g.-238G>A 0)

f.2 g.-226G>A g § Q."191C>A ·- C>

E 8 g.23G>A ro <.9 • e ?§. g,54G>A a. ~ g.230C>A

0 ' .. .gJ35A>T .

g.-321 C>T g.~24~6>T ·· g.-226G>A

. "' gA87G>T en ·. ,.··. .'

~···· [.2 g.-120G>C ' <~>.,,. 8 ·. ··,a· ·s· G . · ' ··:s:,· g .g.· . >T·. . 'E o · ·. ro. ; 8 g.-67C> T

,~~~\ ~ ··i:m~~r ·:i·:r;}:~t·:. t;i~~;~ ·

i: g,7309G>A · .. · C> . '

~ g.-197C>T (") M '- ... ' ..

Q) g g.~170C>T c C> . '

·E 8 g.-139G>A -E ~ ·.·g,;25C>,T 0::: ~ g.-12G>T

I- ..

5 ·9.258C:>G g.299G>A

Amino Acid Change

p.Arg8His

Allele frequency (Genotype distribution) Region rs No. Infertile men Fertile men

5' Upstream 0.004 A (0, 2, 276) 0,000(0, 0, 249) 5' Upstream Novel 0.002 A (0, 1, 277) 0.000 (0, 0, 249) 5'Upstream rs2301365 0.156A(10,67,201) 0.183(13,65,17·1) Exon 1 Novel 0.002 A (0, 1, 277) 0.000 (0, 0, 249) Ex6n .1 rs352q2993 0.002 A (0, 1; 277) · 6,000 (0, o, 249) Exon 2 rs737008 0.482 A (65, 138, 75) 0.446 (53, 116, 80) a·ut~ .. · ... N.over:,< ·' .o.002T(0,1,277) o:oo6(0;•0,249)·· 5' Upstream Novel 0.038 T (1, 19, 258) 0.040 (2, 16, 231)

. 5.~-·up'§tr~am :. · Nbv~l'>·~: · O,OQ2 T (0, 1; 277) O,QOO (0,-0; 249) .. 5' Upstream 0.128 A (3, 65, 210) 0.141 (5, 60, 184)

· . --: · · ·" ·'·· ·"',·~,:~p~tr~~m··: Novei. · : · o.oo.n T (o;.o, 21a) o.ooi(o,); 248) · 5' Upstream Novel 0.002 A (0, 1, 277) 0.000 (0, 0, 249)

:•: 5'UIR.':: N" 'i'':k· .· .. o002T(O 1 277) oooo'(o:0249)··· .. . .. ,~' .. :·.\ .. :·._:; .. ·.. . .. ov~.-.~·~· .... ~·· , .. ,, .. .: ... , ··'···;., .· 5' UTR 0.002 T (0, 1, 277) 0.000 (0, 0, 249)

.::.::.~::.::•. •';;~;·,::Exdo~f''::~:: · .. NoveL, .O.OQ2T(0,1,2?7) b.666@Q;249j:. ·. p.Arg55His Exon 1 Novel 0.002 A (0, 1, 277) 0.000 (0, 0, 249)

·. ;;;; .. T ·lntron,ct'.· '··fs'1646622 0.245C(19,98,161) 0.285(2_3;96,13,0). lntron 1 rs2070923 0.417 C (49, 134, 95) 0.440 (47, 125, 77)

~ ~ .lntror(1 · .. , .. Nover. •. · · . o.ooo A'(O, o, 278) o.qo~ (0,\ 248). 3' UTR 0.004 C (0, 2, 276) 0.000 (0, 0, 249)

' < •• . : S,'Upstr~alll: • · Novel o.'oo4 A (O, 2, 276) o,oop'(o,•o·, 249) . 5' Upstream Novel 0.000 T (0, 0, 278) 0.002 (0, 1, 248)

.:s~:uP.S.tre~.il)'.} ::~: Novel • • · .. p.oo9 T (O; s, 273) o;OQ4 {O, 2,246)> 5' Upstream Novel 0.002 A (0, 1, 277) 0.004 (0, 2, 246)

· .'5! ypsJr~am.· rs23611'i7.• · • 0.371C(38, 130, 110) 0:452(55;·115; 79) 5' Upstream Novel 0.007 T (0, 4, 274) 0.000 (0, 0, 249)

p:His?6Gfr1'' Exon. , •.. · rs35598356' .. 0.110G(3!55,220) .0:110(!?,.45,199) p.Arg100Gin Exon rs429744 0.101 G (4, 48, 226) 0.094 (2, 43, 204)

OR (95% Cl) P-value ND ND

1.205 (0.873-1.664) 0,25600 ND NQ.

0.864 (0.678-1.102) 0.23904 ··. t'lb: .. ··

1.066 (0.571-1.991) 0.84116 ·Nb:.·.

1.117 (0.784-1.593) 0.54020 . NO 't '·'

ND 'No> ''<,·

ND . NQ!. ·•

ND 1 ;232.(0,9~~"1 ,621}0.13598 1.096 (0 .859-1.400) 0.46122

. ND··. ND

: ND . ' •.

ND 'NO·

. '•

ND 1.40,0 (t0~4-t792) 0.00735

ND .1,;007 (0:685~ 1.463) 0.96,986 0.930 (0.619-1 .399) 0.72922

Detected in NOA, OAT

OA All

NOA NOA All

OAT All

NOA All N

OA NOA NOA OA

NOA All All N

OAT NOA

N All

NOA, N All

NOA,OAT All All

1 =Tanaka eta/., 2003, 2 = Aoki eta/., 2006, 3 = Ravel eta/., 2007, 4 = Hammoud eta/., 2007, 5 = Ga'zquez eta/., 2008, 6 = lmken eta/., 2008, 7 = Tuttelmann eta/., 2009.

Reference 4

6,5,4,3

7,6;3;2 .. 7,6, 3, 2,1

4

6

7,2, 1 ·. 7, 2, 1

4

6

6 6

Table 6.1 Frequency distribution of polymorphisms found in the PRM1, PRM2 and PRM3 genes, risk for infertility (odds ratio (ORs)] and the references where these polymorphisms were reported earlier. Frequencies of minor alleles and genotype distribution (in parenthesis) for all polymorphisms are given. The minor allele is also mentioned in column 'Infertile men'. Nucleotides are numbered relative to Translation start site. Abbreviations: NOA: Azoospermia; OAT= Oligoasthenoteratozoospermia; F = Fertile men; All = SNP detected in all categories of men.

77

CACTCGGGGGC TGCCCGCCTCT CTGTCGCAGCC CGCCAGAG ACA

~ ~ rtJI11iYY1Y!J ~it CACTCRGGGGC TGCCCRCCTCT CTGTCRCAGCC CGCCARAG ACA

~ 1\

~ !l~ft ~f1:t]J (a) g.-238G>A (b) g.-226G>A (c) g.23G>A (d) g.54G>A

CCACCATCCAA T T CAC C T A C T G GGTGCCAGGGC GCTGGGCAGGG

0!J:iljJ_ ~ ~ hl~ I . '

.

CCACCWTCCAA G GT GCYA GGGC GCTGGKCAGGG

btJtiJ ~ rti1~ (e) g.335A>T (f) g.-321 C> T (g) g.-242C> T (h) g.-187G>T

CCCGGGG AGCC CCAAGGGCAGG GCCTCCGCCCT GAGCACGTCGA

~~~ ~~ 1\ f

~ ~~ . \~ CCCGGSGAGCC CCAAGKGCAGG GCCTCYGCCCT GAGCAYGTCGA

~ ~~ fl ~ "

~ ~~ I ~ - - ~ - ..:..--. --

(i) g.-120G>C 0) g.-85G>T (k) g.-67C> T (I) g.120C> T

TAGGCGCAGAC A CCC CGT C CCC CAAGTGAGGCC GAG GAG TC T G T

~ ~] f~01D -· ,.,__ - . ~N&ifJfu TAGGCRCAGAC ACCCCRT CCCC CAAGTSAGGCC GAG GAR TC T G T

~ ~ ~ ffiirfli1 £J .11 ) (m) g.164G>A (n) g.378G>A (o) g.532G>C (p) g.-309G>A

CTGGCCCCAGT CTCCCCTGTGG CTGAGGTGTGA GACAGGCAACG

[i'frw_JVJf& llt{W ~{~ , {1/1 ~ 1 v . ·.u \ cJM}£M ~ CTGGCYCCAGT CTCCCYTGTGG C T GAG RT GT G A GACAGKCAACG

tr~ ,I. ~ ~ '

~- . ~ lj L:_-o- ' -- J (q) g.-197C>T (r) g.-170C> T (s) g.-139G>A (t) g.-12G>T

Fig. 6.1 Electropherograms of novel polymorphisms in the PRM1, PRM2 and PRM3 genes shown in Table 6.1. Mutations (a) to (e), (f) to (o) and (p) to (t) were detected in PRM1, PRM2 and PRM3 genes, respectively.

78

.Ana/j;sis if :P:R.MI, PRM2 ana P'RM3 genes

(Table 6.1, Fig. 6.11 and 6.1m). In intron of PRM2 gene the SNPs g.298G>C (rs1646022)

and g.373C>A (rs2070923) were observed; however, they did not show significant

difference when compared between the infertile and the fertile men (Table 6.1). The

novel mutation, g.378G>A, was observed in a fertile man but not in any other man

(Table 6.1 and Fig 6.1n). Finally, in 3'UTR mutation g.532G>C, which was earlier

reported in men of Utah (Hammoud et al., 2007), was observed in two OAT men in

heterozygous condition (Table 6.1 and Fig. 6.1o).

6.2.3 Sequence Analysis of PRM3 gene

Since, at the beginning of this study, the expression pattern and the RNA structure of the

PRM3 gene was not known, the SNPs detected in the 5' region of the PRM3 predicted

open reading frame were initially classified in the 5' Upstream category (Table 6.1). In

the 5' upstream, the novel mutation g.-309G>A was detected in two azoospermic men

whereas the novel mutation g.-197C>T was only detected in a fertile man (Table 6.1, Fig.

6.1p and 6.1q). Two more novel mutations, g.-170C>T and g.-139G>A, were detected in

heterozygous condition in upstream of the PRM3 gene of both infertile and fertile men

(Table 6.1, Fig. 6.1r and 6.1s). These mutations did not show significant difference

between infertile and fertile men. Polymorphism g.-25C> T (rs2301127) in upstream of

PRM3 gene showed significant difference between infertile and fertile men (Table 6.1).

This difference was significant when Bonferroni correction for multiple testing was

applied (p = 0.05/9 = 0.0056). When infertile men of different categories (NOA, OAT and

OA) were separately analyzed, statistically significant difference was only observed

when OAT men were compared with fertile men (OR= 1.673, 95% CI = 1.191-2.349, p =

0.00288), but not with NOA or OA men. The novel mutation g.-12G>T was observed in

heterozygous condition in four infertile men (two NOA and two OAT), but not in any

other man (Table 6.1 and 6.1t). The non-synonymous SNPs g.258C>G (rs35598356) and

g.299G>A (rs429744), causing p.His86Gln and p.Arg100Gln change respectively, did not

show any significant difference between infertile and fertile control men (Table 6.1).

6.2.4 LD and haplotype analysis of the PRM genes

Of all the 21 variants identified in analysis of three PRM genes, eight had MAF (overall)

> 10% (Table 6.1). Haplotype block structure analysis of these eight SNPs using

Haploview software showed that five of these eight SNPs (g.-191C>A, g.230C>A, g.-

226G>A, g.298G>C and g.373C>A) were in the same haplotype block when "Solid spine

of LD" definition was used for haplotype block construction (D' > 0.8). All these five

SNPs were in the coding region of PRM1 and PRM2 genes (two in PRM1 and rest three

in PRM2 gene), whereas the remaining three SNPs (g.-25C> T, g.258C>G and g.299G>A)

79

.Anafj;sis of 'P:R.:MI, 'P:R.:M2 amf 'P:R.:M3 genes

PRM1 PRM2 PRM3

1:\ ~:~ < u < lj < A 1-~ A A A 1\ 1\

~ Y. Y. Y. lj

"' Oi "' co .., "" 00

N <71 " N VI en I N .., I N N

c:il c:il g, ci> en en

8

LowO' High 0' I Low LOD

Fig. 6.2 Pairwise LD structure in the PRM1, PRM2 and PRM3 genes. Eight SNPs in Table 6.1 with minor allele frequency >10% used for LD analysis. SNPs of PRM1 and PRM2 genes were in same haplotype block (D' > 0.8) when "Solid spine of LD" definition was used for haplotype block construction.

Haplotype Freguenc~ (%) number Haplotype Infertile men Controls OR (95% Cl), p value

PRM-H1* CCGGA 38.3 (213) 37.6 (187) Reference

PRM-H2 CAGGC 15.6 (87) 13.5 (67) 1.14, (0.784-1.657), 0.492 PRM-H3 AAGCC 14.7 (82) 15.9 (79) 0.911' (0.632-1.314), 0.619 PRM-H4 CCAGA 12.2 (68) 13.9 (69) 0.865, (0.587-1.276), 0.465

PRM-H5 CAGCC 9.5 (53) 11.2 (56) 0.831, (0.544-1.269), 0.391 PRM-H6 CAGGA 7.6 (42) 3.8 (19) 1.941, (1.091-3.454), 0.022

Table 6.2 Prevalence of the haplotypes in PRM1 and PRM2 genes among infertile and fertile men. SNPs g.-191C>A, g.230C>A, g.-226G>A, g.298G>C and g.373C>A were used to construct haplotypes.

in PRM3 gene were neither in LD with other SNPs nor forming any haplotype block

(Fig. 6.2).

Haplotyping using PHASE v2.1.1 and the five SNPs from PRMl and PRM2 genes, which

were in the haplotype block, revealed 19 haplotypes (PRM-H1 to -H19) of which 7 had

frequency > 1.5% in both case and control samples (Table 6.2). A case-control analysis

rejected the hypothesis that, in aggregate, haplotypes were randomly distributed

between the case and control populations (p = 0.02). Comparison of haplotype

80

.:4nafysis of1-'R.J11J, 1-'R.JI12 ana1-'R.JI13 genes

frequencies between case and controls suggested haplotype PRM-H6 (Table 6.2)

conferred marginally significant risk for male infertility. This difference was not

significant when Bonferomii correction for multiple testing was applied (p = 0.05/7 =

0.00834).

6.2.5 Expression analysis of the PRM3 gene

As the SNP g.-25C>T (rs2301127) in upstream of PRM3 gene showed significant

difference between infertile and fertile control men (Table 6.1) and since it was not

known whether this gene is expressed in humans, expression analysis of this gene was

performed in different human tissues. Spatial expression of PRM3 gene was analyzed in

various human tissues including placenta, lung, liver, heart, spleen, brain and testis.

Semiquantitative RT-PCR, using primers specific to PRM3 gene showed that, like the

other two PRM genes, PRM3 is also specifically expressed in testis (Fig. 6.3). Intron

flanking PRMl specific primers were designed to amplify the PRMl gene and to rule out

any contamination of DNA in the RNA sample.

N P Lu Li H s 8 T - ~ . - - . - - - .. . -

PRM3 •. - ,:, ' - - :-; - . . ...... • - :! ~ - '

. - -

PRM1

f3ACT/N

Fig. 6.3 Spatial expression profile of the PRM3 gene in various tissues using RT-PCR. As other two PRM genes, PRM3 was also specifically expressing in testis. The BACTIN was used as an internal control. As there are no introns in PRM3, PRM1 was amplified to rule out the possibility of presence of genomic DNA as intron flanking primers of PRM1 give amplification of 291 bp with genomic DNA, testifying that this product of 200 bp was amplified with the mRNA. Abbreviations: N = Negative, P = Placenta, Lu = Lung, Li = Liver, H = Heart, S = Spleen, B = Brain and T = Testis.

As PRM3 gene was showing testis specific expression, its expression level was compared

in testicular tissues of obstructive and non-obstructive infertile men to identify if there is

any difference in its expression level. For this, RNA was isolated from testicular tissues

of six obstructive and five non-obstructive azoospermic men. After eDNA preparation,

Real Time RT-PCR was performed. Comparison of expression level of the PRM3 gene

between obstructive and non-obstructive azoospermic men showed that in non­

obstructive men expression of the PRM3 gene was 41.04 folds reduced as compared to

obstructive azoospermic men (Fig. 6.4).

81

..JliUl/j;sis if P'R.M1, P'R.M2 am£ P'R.M3 genes

Fig. 6.4 Real-time RT-PCR analysis of the PRM3 gene expression in testicular tissues of obstructive and non-obstructive infertile men. In comparison of non-obstructive men approximately 41 folds higher expression of PRM3 was seen in obstructive infertile men.

6.2.6 5' and 3' RACE analysis of the PRM3 gene

Since PRM3 gene was reported in the databases only as a predicted gene, with no

information regarding its transcript structure, 5' and 3' RACE was done to map the

transcriptional start and end points of the PRM3 gene, as exact transcript structure of

PRM3 gene was not known.

The 5' RACE analysis helped in the identification of sequence in the upstream region,

extending towards the 5' end of the predicted ORF. Gene-specific antisense primer and

nested primer from the predicted region of the PRM3 gene revealed the transcription

start point to be 62 ntds upstream from the AUG of the predicted region (Fig. 6.5 and

6.6).

Similarly, the 3' RACE analysis identified sequence downstream to the predicted

transcript of PRM3 gene. Gene-specific primer and nested primer showed that the

transcription continued till 83 more nucleotides downstream the stop codon. Moreover,

at the 3' end of the transcript poly A tail was observed at five different nucleotides

within the span of 6 nucleotides (Fig. 6.5 and 6.6).

82

~

UPM

a.

-NUP

ATG

I

c.

PRM3

-P3_RACE_R I -P3_RACE_R 2

Q:; '0 '0 ro

..J

a. _Q 0 0 5' 3'

Primary RACE PCR

.Analysis t!/P'RM!, PJ?. . .'M2 anaPR.J.(;,qenes

d.

b.

Q:; '0 "D ro ..J a.

_Q 0 ;:?

ATG

I PRM3

P3_RACE_F I

5'

-P3_RACE_F2

3

Secondary RACE PCR

-+-­UPM -NUP

Fig. 6.5 RACE reactions to isolate full length PRM3 gene transcript expressed in testis. (a) Strategy used to perform 5' RACE , (b) Strategy used to perform 3'RACE, (c) and (d) Gel images 5' and 3' RACE reactions of Primary and Secondary RACE, respectively . Secondary RACE was performed using nested primers.

CTCGCAGCCCCTTCACCCACCGCCTCACCTCCTTGCCCAGAGAGACAGGCAACGTAGACCATG GGTTCCCGCTGTGCCAAGCTCAACACAGGCCAGAGCCCAGGCCACAGCCCAGGCCACAGCACG GGCCATGGCCGGGGCCACGAATCCTCCATGAAAAAGCTCATGGCCTGTGTGAGTCAGGATAAC

TTCTCCTTGTCATCAGCGGGCGAGGAAGAGGAGGAAGAGGAGGAGGAGGGGGAAGAGGAGGAG AAAGAAGAGCTGCCGGTGCAGGGCAAGCTGCTGCTGCTGGAGCCTGAGCGGCAGGAGGAGGGC CACAAGGACAACGCCGAGGCCCAGCAGAGCCCCGAGCCCAAGCGGACACCCTCCTGi\CCc't; : !1

ACGAAGGC C C AGGAAGGGACGCC CACTGCTGCTCC GGCGAC AGTGTTCAGAGA}\GAGTC AA' i ' A iVv'\li.GTCTC TGAGC /\. !1)\/\C~TCTC 'I"'

!\i\.f\l\ ~ .. ; 'fC TC '1'C.;l'\GC;I\<~ "". ,.. , , . . , "\ >I

"i""\l...:!\._.:!/"\.t-1~

Fig. 6.6 Sequence of the transcript of PRM3 gene. The sequence in black color shows the one predicted in database. The red color sequences show the sequences of upstream and downstream of predicted transcript that were obtained after 5' and 3' RACE , respectively . The sequences in blue color show the alternative transcription stop sites.

83

6.2. 7 Cloning of the 3'UTR of PRM2 gene and analysis of

luciferase activity Mutation g.532G>C in 3' UTR of PRM2 gene which was detected in two OAT men (Table

6.1), had earlier been detected in infertile men of Utah with abnormal PRM1 I PRM2

ratio, but not in any man with normal ratio of the two protamines (Hammoud et al,

2007). As it is known that many regulatory proteins bind the 3'UTR of the PRM2 gene

and regula te its expression, the reporter assay was designed to study the role of this

mutation (Fig. 6.7) .

a.

b.

SV40 late poly(A) signal

,, Mutant (C )

.:.:·

\ ~IG Xbai~BamHI

Fig. 6.7 Cloning of the 3'UTR of PRM2 gene in tailless pGL3 promoter vector. (a) Strategy of cloning of 3'UTR with wildtype (G) and mutant (C) alleles. (b) Fold-change obtained when plasmid having wildtype or mutant allele were transfected in HEK-293 cells.

The 3'UTfR of the PRM2 gene with wildtype (G) and mutant (C) nucleotides were

cloned in tailless pGL3 promoter vector (Fig. 6.7a). The tailless vector does not have the

3'UT R of luciferase gene. The constructs with 3'UTRs (of PRM2 gene) with wildtype (G)

84

..Jl.na{ysis if PR'M1, PR'Jvt2 ana PR'M3 genes

and mutant (C) nucleotides were transfected in HEK-293 cell lines and data was

normalized by the co-transfection of the Bgal gene. The luciferase activity analysis

showed that the activity was approximately 16.5% reduced in the mutant construct,

suggesting the role of this mutation in the expression of the PRM2 gene (Fig. 6.7b).

6.3 Discussion

Protamines are highly basic major sperm nuclear proteins which replace the majority of

histones in elongating spermatids (Carrell et al., 2007; Oliva, 2006). In the present

analysis of the coding sequences of the three PRM genes 28 nucleotide variants were

found: this included 16 novel and 12 reported, which had been studied earlier for their

role in infertility (Table 6.1).

The g.-25C> T (rs2301127) in the PRM3 gene showed significant association with male

infertility and it was found to express specifically in testis but not in any other tissue

(Table 6.1, Fig. 6.3). Moreover, PRM3 displayed very high level of difference when its

expression was compared between obstructive and non-obstructive azoospermic men

(Fig 6.4). The novel mutation in PRM2 gene g.532G>C, which was found only in OAT

men appears to affect the expression of the PRM2 gene as the mutant construct had a

16.5% reduction in the expression level of the reporter gene (Fig 6.7).

In the PRMl seven variants, including three novel and four earlier studied, were

observed (Table 6.1). Mutation g.-238G>A was observed in an OAT and NOA man,

whereas earlier this had been observed in both infertile and fertile men (Hammoud et al.,

2007). The SNP g.-191C>A (rs2301365) has been earlier looked at by four studies and the

results of three of these studies correlate well with present study, suggesting that this

polymorphism is not associated with infertility (Hammoud et al., 2007; Imken et al., 2009;

Ravel et al., 2007). The MAF observed in these studies is also comparable with results in

present study. Nevertheless a recent study has shown the association of g.-191C>A with

abnormal sperm morphology and increased protamine PRM1 I PRM2 ratio in infertile

men (Gazquez et al., 2008). The silent mutation g.54G>A (rs35262993) was observed only

in single NOA man (Table 6.1), though in previous studies it had been observed in both

infertile and fertile men (Imken et al., 2009; Tuttelmann et al., 2009); but the frequency of

'A' allele was very low in both the studies. In another study this site was not at all

polymorphic (Ravel et al., 2007). In PRM1 gene Tuttelmann et al. (2009) observed non­

synonymous SNP g. 102G> T (rs35576928) in both infertile and fertile men. The allelic

frequency of this SNP was exactly the same with the g.54G>A, but this SNP has not been

observed in any other study including this one. Synonymous SNP g.230C>A (rs737008)

has been reported by many studies prior to present study (Imken et al., 2009; Ravel et al.,

85

..:4.nafj;sis ifP:R'MI, P:R'M2 amfPR'M3 genes

2007; Tuttelmann et al., 2009; Aoki et al., 2006; Tanaka et al., 2003); 'A' was major allele in

an study by Tuttelmann et al. (2009) with overall frequency 0.692, whereas in present

study it was minor allele (with overall MAF 0.465; Table 6.1). In other studies too, 'A'

was found to be minor allele, but allelic frequencies were different from present study.

Although the allele frequencies were different in most of the studies, this SNP was not

found to be associated with the infertility in any of the study. In the 3'UTR of PRMl

gene, a rare SNP, g.340A>G was observed in two previous studies (Hammoud et al.,

2007; Tanaka et al., 2003): but this site was not polymorphic in the present study and all

the men had 'G' allele at this position.

In the PRM2 gene thirteen variants, including eight novel and four studied earlier, were

observed. Most of the novel mutations were in the 5' Upstream and 5'UTR of PRM2 gene

and specifically found in infertile men, except for g.-321C> T (Table 6.1). As most of the

earlier studies, except one (Hammoud et al., 2007), did not focus on upstream and

downstream regions of PRM genes, it is possible that though these mutations may have

been present in the populations analyzed, they remained undetected. In the 5'UTR, g.-

67C> T mutation was identified in a NOA man (Table 6.1); interestingly this mutation

was observed only in one NOA man in an earlier study (Imken et al., 2009), suggesting

that it may have role in the etiology of azoospermia. In exon 1 of the PRM2 gene, two

infertile men specific novel mutations were identified earlier (Tuttelmann et al., 2009);

these mutations were not identified in present study, but two other infertile men specific

mutations were observed, and one of these was non-synonymous (Table 6.1). The

common SNPs g.298G>C (rs1646022) and g.373C>A (rs2070923) in intron 1 of PRM2

gene had been studied in three previous studies (Aoki et al., 2006; Tanaka et al., 2003;

Tuttelmann et al., 2009); these reports suggested that these two polymorphism are not

associated with infertility. Present results match with the previous results, though for the

g.298G>C in the study by Tuttelmann et al. (2009) 'G' was the minor allele with overall

frequency 0.457, whereas in other studies, including present study, 'C' was the minor

allele (overall MAF 0.264 in present study; Table 6.1). For SNP g.373C>A, 'A' was the

minor allele in all previous and in present study, though, with some differences in allele

frequencies. Another SNP g.694C> T (rs424908) has been reported in the 3'UTR of PRM2

gene, but this site was not polymorphic in samples analyzed in present study and all the

samples had 'T' at this site.

The g.532G>C mutation in the 3'UTR of the PRM2 gene was observed in two OAT men

(Table 6.1). In an earlier study this mutation had been observed in infertile men with

abnormal PRM1 I PRM2 ratio, but not in any fertile man and the authors speculated its

role in infertility (Hammoud et al., 2007). As it is known that the 3'UTRs of PRMl and

86

.Jlna[ysis of P:R.M1, PRM2 ana PRM3 genes

PRM2 genes play role regulation of translation and subcellular localization of protein

(Braun et al., 1989; Kwon & Hecht, 1991; Kwon & Hecht, 1993), the infertile men specific

mutations can cause the PRM imbalance and infertility in these men. Hence, the reporter

assay was performed which showed that the mutant leads to approximately 16.5%

reduction in the activity (Fig 6.7b). Although the difference is very small, the reduction

in the activity of mutant was consistent. Attempts were made to perform the same

experiment in human testicular germ cell line (Tcam-2); but this experiment did not

work as the transfection efficiency was reduced beyond measurable range. Present

results suggest that this mutation can affect the PRM2 amount synthesized. As the ratio

of PRM1 /PRM2 is important for the maintenance of fertility, this mutation could be the

cause of infertility in these men.

Until this study, the PRM3 gene had not been studied as widely as PRMl and PRM2

genes for its role in causing infertility; specifically only one study had included this locus

in their study before present study (Imken et al., 2009). PRM3 is an acidic protein with

numerous glutamic acid residues whereas the other genes in this cluster (PRM1, PRM2

and TNP2) are basic. Imken et al. (2009) had observed three novel mutations in the PRM3

gene, but none of them were found in present study on Indian men. Nevertheless, five

novel mutations were detected in PRM3, which were not found earlier. Moreover, g.-

25C> T (rs2301127) in the 5'upstream region of the PRM3 gene showed significant

difference between infertile and fertile men. This mutation did not show significant

difference in the population studied by Imken et al. (2009), although as compared to

fertile men, the frequency of the 'C' allele was increased in their study as well. The

common SNPs g.258C>G (rs35598356) and g.299G>A (rs429744) did not show significant

difference between fertile and infertile men in neither present study (Table 6.1) nor the

previous one (Imken et al., 2009). For g.258C>G, 'G' was the minor allele with overall

MAF 0.2, and for g.299G>A, 'A was minor allele with overall MAF 0.4. These were the

minor alleles in present study as well, but the MAF were 0.10 and 0.098, respectively.

A recent study on Prm3 knockout mice showed that this protein affects sperm motility

and its expression patterns exhibit similarities to Prml, Prm2, and Tnp2 (Grzmil et al.,

2008). As the expression of PRM3 gene was not known in human and since for the first

time, an association between g.-25C> T with infertility was found, it became mandatory

to understand the role of the PRM3 gene in infertility. Hence, the expression of PRM3

was analyzed in various tissues; this analysis showed that like other two PRM genes it

has testis specific expression, though this was low, when compared to the other two

PRM genes. Earlier, the expression of PRM3 had been shown in mouse, rat and bull but

its expression in human was not evident, as the signal was very week (Kramer &

87

Ylnafysis o/ P:RMI, P:RM2 ana P:RM3 genes

Krawetz, 1998). Furthermore, since the RNA of PRM3 was predicted in databases (NCBI

accession no. NM_021247), the 5' and 3' RACE analysis was performed to elucidate the

exact transcript structure (Fig. 6.6). RACE analysis showed that the SNP g.-25C>T is not

in the 5' upstream region of the PRM3 gene, but in the 5'UTR region. The expression

levels of PRM3 gene in the testicular tissues of obstructive and non-obstructive

azoospermic men were compared. Though, the expression of PRM3 was considerably

reduced in NOA men, it was detectable by Real-Time PCR (Fig. 6.4). On the other hand,

when the expression of the PRMl and PRM2 genes was looked at, it could not be

detected in non-obstructive infertile men (data not shown); this was despite the fact that

their expression level was much higher in obstructive men as compared to PRM3. These

observations suggest that the cell specificity of PRM3 may not be the same as of the other

two PRM genes which are specifically expressed in spermatids and later stages of sperm

development (haploid cells). Since, non-obstructive men were the cases of

spermatogenesis failure (i.e. no spermatids), the detection of PRM3 expression in testis of

these men suggests that, in addition to spermatids, it may be expressed in other cells as

well.

In the present study, for the first time, the association of the PRM3 gene polymorphisms

with male infertility has been demonstrated. The PRM3, like the other two PRM genes,

has testis-specific expression. Moreover, two infertile men specific mutations were found

in PRM2 gene. Earlier studies have also found these mutations only in infertile men,

suggesting that they play a role in the infertility of these men. The reporter assay was

done which showed that the mutation in the 3'UTR of PRM2 gene affects its expression.

More studies on this locus are warranted to elucidate on the role of this locus in causing

infertility.

88