Embed Size (px)
Citation preview
1
Detection of viable Cryptosporidium parvum in soil by reverse transcription real time 1
PCR targeting hsp70 mRNA 2
Zhanbei Liang,1 and Ann Keeley
2* 3
National Research Council1; and National Risk Management Research Laboratory, U.S. 4
Environmental Protection Agency, Ada, OK 7482012*
5
6
*Corresponding author. Mailing address: Ground Water and Ecosystems Restoration 7
Division, National Risk Management Research Laboratory, Office of Research and 8
Development, U.S. Environmental Protection Agency, 919 Kerr Research Drive, Ada, 9
OK 748201. Phone: (580) 436-8890. FAX: (580) 436-8709. E-mail: [email protected] 10
11
Abstract 12
Extraction of high-quality mRNA from Cryptosporidium parvum is a key step in 13
PCR detection of viable oocysts in environmental samples. Current methods for 14
monitoring oocysts are limited to water samples; therefore, the goal of this study was to 15
develop a rapid and sensitive procedure for Cryptosporidium detection in soil samples. 16
The effectiveness of five RNA extraction methods were compared (mRNA extraction 17
with the Dynabeads®
mRNA DIRECTTM
kit after chemical and physical sample 18
treatments, and total RNA extraction methods using the FastRNA®
Pro Soil-Direct, 19
PowerSoil®
Total RNA, E.Z.N.A.TM
soil RNA, and Norgen Soil RNA Purification kits) 20
for the direct detection of Cryptosporidium with oocysts-spiked sandy, loamy and clay 21
soils using TaqMan reverse transcription PCR. The study also evaluated the presence of 22
inhibitors by synthesis and incorporation of an internal positive control (IPC) RNA into 23
reverse transcription amplifications, used different facilitators (bovine serum albumin, 24
yeast RNA, Salmon DNA, skim milk powder, casein, polyvinylpyrrolidone, sodium 25
Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.00677-11 AEM Accepts, published online ahead of print on 29 July 2011
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
2
hexametaphosphate, and Salmonella typhi) to mitigate RNA binding on soil components, 26
and applied various treatments (β- mercaptoethanol and bead beating) to inactivate 27
RNase and ensure the complete lysis of oocysts. The results of spiking studies showed 28
that Salmonella cells most efficiently relieved binding of RNA. With the inclusion of 29
Salmonella during extraction, the most efficient mRNA method was Dynabeads®
with a 30
detection limit of 1.5×102 oocysts g
-1 of sandy soil. The most efficient total RNA method 31
was PowerSoil®
with detection limits of 1.5×102, 1.5×10
3, and 1.5×10
4 C. parvum 32
oocysts g-1
soil; for sandy, loamy, and clay samples, respectively. 33
INTRODUCTION 34
As an important enteric protozoon of worldwide health concern, Cryptosporidium 35
parvum is one of the major waterborne causative agents of gastrointestinal illness in 36
humans (17). The infectious form of C. parvum, the oocyst, is highly resistant to 37
environmental stress and hence can remain viable in the environment for months (56). 38
Viability tests are important in the detection of C. parvum oocyst in environmental 39
samples since only viable oocysts pose a threat to public health (37). The massive 40
devastating consequence of the waterborne cryptosporidiosis outbreak in Milwaukee, 41
Wisconsin in 1993, also illustrates the potential destructive effect of C. parvum during 42
accidental or intentional contamination scenarios (39, 46). Our previous study showed 43
that surface soil can serve as a major source of C. parvum introduced to the environment 44
by cattle ranching (30). Once contaminated, soil serves as a constant source of oocysts to 45
surface water bodies by runoff and potentially to groundwater by infiltration. The current 46
detection methods, however, are mostly confined to water. For fast responses to land 47
management practices or intentional contamination events, rapid and sensitive methods 48
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
3
that simultaneously recover and detect viable oocycts in soil are needed. Traditionally, 49
animal infectivity (16), in vitro cell culture (13, 60), in vitro excystation (7), and staining 50
by fluorogenic vital dyes (10, 56) were used to determine the viability of C. parvum 51
oocysts. Prior to those assays, oocysts should be separated from environmental matrix 52
through various purification procedures, which resulted in the loss of oocysts, variable 53
recovery rates, and often interfere with the oocysts’ integrity (1, 8, 35). The detection 54
assays are also expensive, time consuming, and labor intensive, which could further limit 55
their applicability in making quick and accurate identification of viable C. parvum from 56
soil. 57
In addition to vital dye staining, another microscopic method for the detection of 58
Cryptosporidium oocysts in soil, include fluorescence in situ hybridization (FISH) that 59
targets a variable region of the small-subunit (SSU) rRNA. Results from several 60
investigations have demonstrated that both microscopic assays correlate with results from 61
the standard mouse infectivity and in vitro excystation assays (10, 26). However, the 62
interpretation of viability from both assays must be undertaken cautiously, since the tests 63
are known to overestimate viability (7, 10, 28, 50). Therefore, the extent to which rRNA 64
probes are useful for oocysts viability studies depend on the decay rate of SSU rRNA in 65
the environment, which likely varies depending on different environmental conditions 66
(28). Some of the bias that also may interfere with the quantification of viable oocyst is 67
due to the high autofluorescence properties of soil particles. 68
Previous investigations have shown that the production of mRNA was correlated 69
with the viability of C. parvum oocysts (42, 63). Methods combined reverse transcription 70
(RT) with PCR targeted mRNA coding for various proteins, including heat shock protein 71
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
4
(hsp) 70 (5, 24, 29, 57, 63), β-tubulin (68), amyloglucosidase (27), and CP2 (38) from 72
purified suspension or water samples. Assays targeting hsp70 mRNA are advantageous 73
for enhancing the sensitivity of RT-PCR since hsp70 mRNA is produced in abundance in 74
response to heat or other stresses. Compared with conventional PCR, real time PCR is 75
more rapid, sensitive, and specific. Reverse transcription real time PCR (qRT-PCR) has 76
also been reported to quantify hsp70 mRNA from viable oocysts in manure (21). 77
However, until now, no qRT-PCR method targeting C. parvum hsp70 mRNA has been 78
reported to assess oocysts viability in soil. 79
The extraction of high purity mRNA from soil matrices is the key for a successful 80
RT-PCR. Although many soil RNA extraction procedures have been described (4, 18, 81
19, 23, 36, 44, 47, 52); in practice, however, the efficient recovery of mRNA from soil 82
remains a challenge. Three interfering factors may include: (i) mRNA is prone to 83
degradation by RNase, which is ubiquitous in soil environments; (ii) soils are rich in 84
humic substances, which could be co-extracted with mRNA and inhibit the subsequent 85
RT-PCR reaction even at minute concentration; and (iii) mRNA binds to naturally 86
present soil components such as clay. This is particularly problematic for soil with very 87
low biomass (6), such as subsurface soil. 88
An alternative to conventional soil-RNA extraction methods is the usefulness of 89
commercially available isolation kits. Kits are time efficient and have the potential to 90
expedite and standardize sample processing and thus increase the throughput and 91
reliability of extraction procedures. As could be expected, the selection of appropriate 92
methods can influence the outcome of the C. parvum oocysts viability determination in 93
terms of quality and quantity of RNA recovered (14, 52, 59) and the sensitivity and 94
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
5
specificity of RT-PCR (22). The significant differences in the physical-chemical 95
properties of various soils (i.e., organic matter, clay content, and pH) may lead to variable 96
efficiencies of nucleic acid extraction methods (9, 58). Therefore, it became necessary to 97
modify the existing methods to overcome the matrix impact of the soil texture and type. 98
In this study the efficiencies of five commercial RNA extraction methods, with or 99
without modifications, were evaluated for the extraction of RNA from C. parvum oocysts 100
seeded into different soils (i.e., sand, clay and loam) using TaqMan qRT-PCR targeting 101
hsp70 mRNA. The extraction methods used represent major methodologies commercially 102
available for RNA extraction from soil, including spin column chromatography using 103
resin or filter membrane, high binding matrix, and magnetic bead purification. The 104
effectiveness of several facilitators to relieve RNA binding on soil components was also 105
assessed. A foreign internal positive control (IPC) RNA was incorporated into qRT-PCR 106
assay to detect potential inhibitors present in RNA samples. Based on the study results, 107
we developed a procedure for the rapid and accurate detection of viable C. parvum 108
oocysts in soil using a combination of physical and chemical treatments followed by the 109
Dynabeads®
mRNA DIRECTTM
kit for mRNA extraction and the addition of IPC RNA 110
as well as Salmonella cells to qRT-PCR mixtures. This study is the first to demonstrate 111
the extraction of C. parvum oocysts from soil. 112
MATERIALS AND METHODS 113
Cryptosporidium oosysts 114
Suspensions of flow cytometry sorted C. parvum (Iowa isolate) shipped in 115
antibiotic solution from Waterborne, Inc., were used for oocysts studies. A preparation of 116
3×105 oocysts in 50 µl phosphate-buffered saline was used for each spiking experiment: 117
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
6
mRNA-soil extraction efficiency and/or the effect of RNA extraction facilitators for the 118
relief of RNA binding on soil components. Preparations of 3×101 to 3×10
5 oocysts in 50 119
µl phosphate-buffered saline were used for the evaluation of detection sensitivity. Final 120
concentrations of oocysts preparations were made by serial dilution of concentrated stock 121
solutions in phosphate-buffered saline each day and were counted by hemocytometer 122
using a Zeiss Axiophot2 epifluorescence microscope (Carl Zeiss, Thornwood, NY) as 123
described by EPA Method 1623 (65). Oocysts stock solutions were stored at 4ºC and 124
used within 60 days of isolation from infected calves. 125
Soil samples 126
Environmental soil samples were collected at various locations to represent sand, 127
loam, and clay from the vicinity of Byrd’s Mill Spring, the water supply of the city of 128
Ada, OK. After removing stones and plant residues, each soil batch was homogenized 129
separately (2-mm sieve), and stored at 4ºC. Soils were analyzed by the Soil Analytical 130
Laboratory in Oklahoma State University (Stillwater, OK) for particle size and organic 131
matter content (Table 1). 132
In addition to the environmental soil samples, the following soil components were 133
purchased for oocysts spiking experiments: reference Ca-rich montmorillonite clay 134
(STX-1b, Gonzales County, TX) from Source Clays Repository of Clay Minerals 135
Society; and ground silica sand (SIL-CO-SIL®
90, top size 90 µm) from U.S. Silica 136
(Berkeley Springs, WV), which was acid washed as described previously (41, 55) to 137
remove residual iron and organic matter. 138
On each extraction day, soil aliquots ranging from 0.5 to 2.0 g, as per the 139
manufacturer’s recommendations were spiked with oocysts and were thoroughly mixed 140
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
7
by vortexing followed by incubation (5 min, 25ºC). The spiked samples were then 141
subjected to heat induction for hsp70 mRNA production (if needed) by incubation (20 142
min, 45ºC) followed by immersion in ice water to terminate heat induction. Oocysts 143
isolates inactivated by incubating at 95ºC for 20 min were subjected to the same 144
extraction as a negative control. 145
(m)RNA extraction 146
A total of 446 soil samples were extracted. Prior to all extraction procedures, 147
solutions and plasticwares were made RNase free by diethylpyrocarbonate (DEPC) 148
treatment, glassware were baked overnight (200ºC), and pipettors and bench top of the 149
work areas were wiped with UltraClean®
Lab cleaner (MoBio, Carlsbad. CA) to 150
inactivate RNase. 151
With the exception of mRNA extraction from isolates of oocysts (3×105) as positive 152
controls, which were first mixed with lysis/binding buffer (200 µl) of the Dynabeads®
153
mRNA DIRECT™
kit (Invitrogen, Carlsbad, CA) and then were subjected to 6 cycles of 154
freeze (liquid N2, 1 min)-thaw (65ºC, 1 min) to disrupt oocysts, which was followed by 155
the precipitation of residual cell wall by centrifugation (17000 ×g, 3 min) and mixing of 156
the supernatant with 1.5 mg of pre-washed Dynabeads Oligo(dT)25 in accordance with 157
the manufacturer’s protocol. One of the following five methods was used to extract total 158
RNA (methods 1- 4) or mRNA (method 5) from spiked soil or sand/clay mixtures 159
following the manufacturer-recommended protocols. The following modifications, 160
however, apply to all methods: (i) addition of β- mercaptoethanol (BME) to lysis buffer 161
at the final concentration of 10 µl ml-1
at on-set of the extraction process to inactivate 162
RNase, and (ii) replacing vortexing with three cycles of bead beating (40 sec each at 4400 163
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
8
rpm) using FastPrep®
-24 homogenizer (MP Biomedical, Solon, OH) to ensure the 164
complete lysis of oocysts. 165
(i) Method 1, total RNA extraction with the FastRNA®
Pro Soil-Direct kit 166
Briefly, 0.5 g spiked environmental soil (sand, loam, or clay) mixed with lysing 167
matrix E and RNApro Soil lysis solution of the FastRNA®
Pro Soil-Direct kit (MP 168
Biomedicals, Solon, OH) were subjected to bead beating. Released RNA was recovered 169
using phenol-chloroform extraction, precipitated using isopropanol, washed with ethanol, 170
and resuspended into DEPC water. RNA was then bound to the RNAMATRIX, cleaned 171
by a washing buffer, and eluted in DEPC water as described in the manufacturer-172
recommended protocol. 173
(ii) Method 2, total RNA extraction with the PowerSoil®
Total RNA Isolation 174
kit 175
Briefly, 2 g spiked environmental soil (sand, loam, or clay) were treated with a 176
series of solutions from the PowerSoil®
Total RNA Isolation kit (Mo Bio, Carlsbad, CA) 177
and then processed with bead beating. Total RNA was isolated by phenol-chloroform 178
extraction, precipitated by isopropanol, captured on RNA capture column, washed and 179
eluted with the elution buffer, and recovered by a final isopropanol precipitation as 180
described in the manufacturer-recommended protocol. 181
(iii) Method 3, total RNA extraction with E.Z.N.A.TM
soil RNA kit 182
Briefly, a 15 ml tube containing 2 g spiked environmental soil (sand, loam, or clay), 183
glass beads, and a series of lysis solutions from the E.Z.N.A.TM
soil RNA kit (Omega 184
Bio-Tek, Norcross, GA) were subjected to bead beating. RNA was isolated by using 185
phenol-chloroform extraction twice, bound to HiBind RNA column packed with 186
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
9
proprietary matrix, cleaned with a wash buffer, and eluted from packed column by DEPC 187
water as described in the manufacturer-recommended protocol. 188
(iv) Method 4, total RNA extraction with Norgen Soil total RNA Purification 189
kit 190
Briefly, 0.5 g spiked environmental soil (sand, loam or clay) was mixed with lysis 191
solution from the Norgen Soil total RNA purification kit (Norgen Biotek, Thorold, ON, 192
Canada) and subjected to bead beating. RNA in the supernatant mixed with binding 193
solution I and II was then bound on the proprietary resin in the spin column. Impurity 194
was washed away using washing solution and RNA eluted with the elution buffer as 195
described in the manufacturer-recommended protocol. 196
(v) Method 5, mRNA extraction using physical and chemical treatments prior 197
to Dynabeads®
mRNA DIRECTTM
kit 198
The method was developed using the following oocysts spiked soils: (i) acid 199
washed quartz sand, (ii) mixture of reference Ca-rich montmorillonite clay STX-1b and 200
acid washed quartz sand, and (iii) environmental sand, loam, or clay. Briefly, 0.5 g 201
spiked soil sample was transferred into 2 ml tube containing a mixture of glass beads 202
with various diameters (2 mm, 0.2g; 1mm, 0.2 g; 0.5 mm, 0.2 g) and 1ml of mRNA 203
extraction buffer [4 M guanidinium thiocyanate, 0.1 M Trizma base, 1% dithiothreitol, 204
0.5% N-Lauroylsarcosine sodium (pH 8.0)] and was subjected to three bead beating 205
cycles (40 sec each at 4400 rpm, set 6.0) by FastPrep®
-24 homogenizer (MP Biomedical, 206
Solon, OH) (physical treatment step). The sample was then centrifuged (14000 × g, 5 207
min), the supernatant was mixed thoroughly with 800 μl Phenol-Chloroform-Isoamyl 208
alcohol (25:24:1, vol/vol) (Amresco Inc, Solon, OH) (chemical treatment step) and 209
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
10
centrifuged again (14000 ×g, 5 min at 4ºC). RNA in the supernatant was precipitated 210
using 600 µl of ice cold isopropanol. Dynabeads®
mRNA DIRECTTM
kit (Invitrogen, 211
Carlsbad, CA) was then used to process the sample by following the manufacturer-212
recommended protocol. Briefly, RNA precipitation was resuspended into 400 µl 213
Dynabeads lysis/binding buffer and mixed with 1.5 mg Dynabeads Oligo(dT)25. 214
Following hybridization (15 min, 25ºC) with continuous mild rolling, Dynabeads 215
Oligo(dT)25 were isolated using magnetic concentrator, washed three times with buffer A 216
and B each. The resulting mRNA was then eluted from the Dynabeads Oligo(dT)25 by 217
incubating the beads (80ºC, 2 min) in 15 µl Tris-HCl. 218
Total RNA or mRNA was kept on ice and subjected to purification (if necessary) 219
immediately. To remove residual co-extracted DNA, 10 μl eluted (m)RNA was then 220
subjected to DNase treatment using TURBO DNA-freeTM
Kit (Ambion/Applied 221
Biosystems, Foster City, CA) by following the manufacturer’s recommended protocol. 222
After the final elution, RNA samples were subjected to an additional centrifugation step 223
(10000 ×g, 90 sec) to completely remove the inactivation reagent that might interfere 224
with the downstream enzymatic reaction. RNA extraction efficiency was defined by the 225
Ct values obtained with TaqMan RT-PCR, which indicated the suitability of the extracted 226
RNA for RT-PCR. RNA extraction/purification, DNase treatment, and RT-PCR assays 227
were conducted on the same day. 228
Quantitative reverse transcription real-time PCR 229
The evaluations of different RNA extraction methods, RNA extraction with 230
facilitators, and different treatments for removing inhibitory material were assessed by 231
quantitative reverse transcription real time PCR (qRT-PCR) targeting hsp70 gene of C. 232
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
11
parvum. PCR primers, probes, and oligonucleotides used in this study are listed in Table 233
2 along with their sequences. 234
All reverse transcription reactions were conducted with a GeneAMP PCR system 235
9700 (Applied Biosystems, Foster City, CA) using either the TaqMan Reverse 236
Transcription (TR) system or High Capacity RNA-to-cDNA master mix (HC) (Applied 237
Biosystems, Foster City, CA). TR was used to evaluate the effect of Salmonella during 238
RNA extraction in preventing mRNA degradation. HR was used for all other reverse 239
transcription unless otherwise stated. For TR, each reaction (20µl volume) contained 2 μl 240
(m)RNA, 1×TaqMan RT buffer, 5.5 mM MgCl2, 500 µM of each deoxynucleoside 241
triphosphate, 2.5 μM of either oligo(dT)16 or random primer, 8 U RNase inhibitor and 25 242
U of reverse transcriptase. The reaction mixtures were incubated for 10 min at 25ºC and 243
then at 48ºC for 30 min, followed by 95ºC for 5 min to inactivate the reverse 244
transcriptase. To test for DNA contamination of the RNA extracts after the DNase 245
treatment, control reaction mixtures were prepared as described above, but reverse 246
transcriptase was not added. For HC, 1µl of (m)RNA was mixed with 1 × RNA-to-247
cDNA master mix in a 10 µl reaction volume. The reactions were performed by 248
incubating the sample at 25ºC for 5 min, 42ºC for 30 min, and 85ºC for 5 min. 249
Contamination of gDNA was tested for using master mix without reverse transcriptase 250
(-)RT included in the kit. 251
Immediately following the RT reaction, quantitative PCR were performed using 252
ABI 7500 Real Time PCR system (Applied Biosystems, Foster City, CA). The 20 μl 253
qPCR mixture contained 2 μl of RT product, 600 nM each of forward (CP-hsp70f) and 254
reverse primer (CP-hsp70r), 300nM of TaqMan probe (CP-hsp70p), DEPC treated 255
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
12
DNase free water and 1×TaqMan Universal PCR master mix [including optimized 256
concentration of AmpliTaq Gold®
DNA Polymerase, dNTPs with dUTP, passive 257
reference ROX dye (Applied Biosystems, Foster City, CA)]. The thermal protocol 258
consisted of 5 min polymerase activation at 95ºC, followed by 45 cycles of 15 sec 259
denaturation at 95ºC, and 1 min annealing/extension at 60ºC. 260
Construction of RNA internal positive control fragment 261
A RNA fragment was added to each sample as the internal positive control (IPC) 262
during the reverse transcription to monitor the efficiency of extraction procedure and 263
detect the presence of inhibitors. The assay we selected targeted a 101 bp fragment of the 264
Solanum tuberosum phyB gene (Genbank accession no. Y14572), which encodes a 265
species-specific regulatory photoreceptor involved in the pathway that results in the 266
purple coloration of potato root (51). This DNA sequence was selected since it did not 267
share homology with any of the other PCR targets used in the lab and was not present in 268
the samples analyzed. Oligo of this fragment was commercially synthesized and HPLC-269
purified (Integrated DNA Technologies, Inc., Coralville, IA). Double strand DNA (D1) 270
was obtained from oligo by amplifying with a primer pair Spud-f and Spud-r. To 271
introduce 5′ and 3′ terminal primer homology for Cp-hsp70f and Cp-hsp70r, D1 was 272
1/1000 diluted and used as template for amplification with primer pair Cp-spudf and Cp-273
spudr. The resultant DNA fragment (D2) was purified with Qiagen PCR purification kit 274
(Qiagen, Valencia, CA), diluted to 1/1000 and amplified with primer T7-hsp70f. The T7-275
hsp70f was designed to introduce the T7 RNA polymerase promoter site to the 5′ 276
terminal. To obtain RNA copy D2 flanked with T7 promoter site at its 5′ terminal was 277
purified with Qiagen PCR purification kit and subjected to in vitro transcription using the 278
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
13
T7 MEGAscript kit (Ambion/Applied Biosystems, Foster City, CA) following the 279
manufacturer’s instructions. Briefly, 2.5µl template DNA (80 ng/µl) was mixed with 280
NTP, reaction buffer, and T7 RNA polymerase in a final reaction volume of 20 µl and 281
incubated (37ºC, 6 hr). Template DNA was removed by adding 1 µl TURBO DNase to 282
the reaction product and incubating (15 min, 37ºC). RNA was purified using MEGAclear 283
RNA purification kit (Ambion/Applied Biosystems, Foster City, CA) according to the 284
manufacturer’s instructions. The absence of DNA was confirmed by direct PCR using 285
Cp-hsp70f and Cp-hsp70r. The identity of the RNA IPC was confirmed by reverse 286
transcription and Taqman RT-PCR. The RNA IPC concentration was estimated by A260 287
using NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE) and the 288
copy number was calculated based on concentration. RNA IPC was serially diluted to a 289
final concentration that gave a Ct value between 33.5 to 34 when tested by RT-PCR and 290
stored (-80ºC) in 50 µl aliquots. 291
RNA binding trials 292
Method 5 extraction procedures were used to confirm the binding of RNA on soil 293
particles when spiked with 3×105 C. parvum oocysts. RNA extraction was performed 294
using the following soil combinations: (i) two aliquots of acid washed quartz sand of 295
different quantities (0 g, 0.25 g, 0.5 g, and 1 g). EDTA was also added to only one 296
aliquot to a final concentration of 50 mM before the lysis, and (ii) 0.5 g mixture of 297
reference montmorillonite clay STX-1b and acid washed quartz sand with the following 298
ratios (0, 2%, 10%, 20%, 30%, 40%, 50% of clay). Resultant RNA in each of the elution 299
was quantified by RT-PCR. 300
RNA extraction facilitators 301
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
14
Method 5 extraction procedures were used to evaluate the effectiveness of different 302
facilitators to relieve RNA binding on soil components using 15% clay sand mixture 303
(0.5g) spiked with 3×105 C. parvum oocysts. Extraction facilitators tested were bovine 304
serum albumin (BSA) (Sigma-Aldrich, St Louis, MO), S. cerevisiae RNA (RNAY) 305
(Sigma-Aldrich, St Louis, MO), Salmon sperm DNA (Sigma-Aldrich, St Louis, MO), 306
skim milk powder (SM) (Difco, Detroit, MI), casein from bovine milk (Sigma-Aldrich, St 307
Louis, MO), polyvinylpyrrolidone (PVP) (molecular weight ~360,000) (Sigma-Aldrich, 308
St Louis, MO), Sodium Hexametaphosphate (SMP) (Fisher Scientific, Wilmington, DE) 309
and Salmonella typhi (ATCC No: 700931, American Type Culture Collection, Manassas, 310
VA). Final concentration per gram of soil included: Salmon DNA (10 mg), BSA (20 mg), 311
RNAY (20 mg), skim milk (40 mg), casein (40 mg), PVP (40 mg), SMP (100 mg), and 312
Salmonella typhi (108 cells). Using method 5, each facilitator was added prior to the bead 313
beating step to the lysis tube and then processed as instructed. RNA in the elution was 314
quantified by RT-PCR. 315
Facilitators proven to be effective to enhance RNA recovery (RNAY and 316
Salmonella ) were further tested on the three environmental soils (clay, loam, sand) to 317
determine the optimal concentration by changing the amount of facilitators in the 318
extraction. RNA extractions from the three soils were then evaluated by other methods 319
(methods 1 - 4) with the presence of most effective facilitator in its optimal 320
concentration. 321
The effect of Salmonella cells in preventing RNA degradation during extraction 322
was tested by using various concentrations (0, 2×107, 1×10
8 cell/g) in 0.5 g pure sand 323
spiked with 3×105 oocysts. RNA was extracted using method 1. Reverse transcription 324
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
15
was performed with TaqMan Reverse Transcription system (TR) using either Oligo(dT)16 325
or Random hexamers as primer. 326
Removal of humic substances 327
Two factors were considered in determining if additional cleanup steps were 328
required to remove PCR inhibitors: (i) absorbance measurements, and (ii) the level of 329
PCR inhibition. Nanodrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE) 330
was used to evaluate the ability of each kit to remove humic substances, which absorb 331
light around 320 nm (48). Soil samples: reference clay, acid washed sand; and 332
environmental clay, loam, and sand were extracted without C. parvum oocysts. Light 333
absorbance of non-spiked extracts was then measured at 320 nm. The level of PCR 334
inhibition was determined when the extracts from non-spiked soil samples were mixed 335
with RNA IPC and then evaluated with RT-PCR. 336
RNA purity was enhanced by two methods: (i) soil pretreatment using Al2 (SO4)3, 337
and (ii) RNA purification after extraction. The pretreatment procedure that was used to 338
precipitate soil humic substances is as follows. Briefly, soil (0.5 g) spiked with C. 339
parvum oocysts was mixed with 500 μl of phosphate buffer (0.1 M NaH2PO4-Na2HPO4, 340
pH 6.6) and 500 μl of 0.1 M Al2 (SO4)3, and subjected to mild vortexing (2 min). The 341
superfluous Al3+
was precipitated by adjusting the pH to 8.0 by adding 250 µl 1 M 342
NaOH. The mixture was then centrifuged (3500 ×g, 2 min), and the supernatant was 343
removed. RNA was then extracted using method 5 with RNAy as the facilitator. 344
To purify RNA after the extraction, two different cleanup kits were used following 345
the manufacturer’s protocols: (i) RNeasy®
MinElute®
Cleanup kit (Qiagen, Valencia, 346
CA), and (ii) MicroSpin S-400 HR spin column (GE Healthcare, Little Chalfont, UK). 347
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
16
Briefly, for the RNeasy®
MinElute®
Cleanup kit, an eluted sample was mixed with 348
RNase free water and 100% ethanol, and then transferred to silica-membrane spin 349
column to accomplish RNA binding. Impurity was washed away and RNA eluted in 14 350
μl of RNase-free water. The MicroSpin S-400 HR spin column was based on the gel 351
filtration. The sample was applied slowly to the top-center of the pre-made resin bed in 352
the spin column. The spin column was then spun (735 ×g, 2 min) to elute the RNA. 353
Statistical analysis 354
The extraction efficiency as represented by Ct values (the number of cycles when a 355
fluorescence signal above the threshold was detected, defined by the mean plus four 356
times the SD of the fluorescence signal of the reference dye) obtained from TaqMan RT-357
PCR was used to determine the most efficient method for RNA extraction for each soil 358
type. The methods were compared by One-way ANOVA analysis on Ct values. A post 359
hoc Tukey’s test with a 95% mean confidence interval was performed. The efficiency of 360
each facilitator to enhance RNA extraction was compared by One-way ANOVA analysis 361
on Ct values obtained and a post hoc Tukey’s test. The most efficient facilitator(s) was 362
(were) determined as the one with the lowest Ct value(s). 363
RESULTS 364
A total of 446 soil samples were extracted during this study. Each soil sample size 365
was defined by the commercially available kits and ranged from 0.5 to 2 grams. Without 366
reverse transcription no qPCR amplification was observed for samples treated with 367
DNase. No RT-PCR amplification was detected for heat inactivated oocysts when 368
isolated from or spiked onto soil, indicating that the amplifications observed were caused 369
by target hsp70 mRNA extracted from viable C. parvum oocysts. 370
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
17
Efficiency of extraction kits with oocysts spiked soils following the 371
manufacturers’ protocols 372
Five methods were tested to extract RNA from 0.5 to 2 grams of soil spiked with 373
3×105 C. parvum oocysts. Positive controls using mRNA extracted from 3×10
5 C. 374
parvum oocysts by Dynabeads®
mRNA DirectTM
kit yielded mean Ct values of 26.5±0.87 375
(means±SD) in RT-PCR. No RNA extract from any type of the soil with any method 376
using the manufacturer’s protocol yielded detectable hsp70 cDNA in RT-PCR, even after 377
additional purification or dilution to alleviate the RT-PCR inhibition. However IPC RNA 378
added before reverse transcription showed amplification for sandy soil using methods 1, 379
2, 4 and 5; for loamy soil using methods 2, 4 and 5; and for clay using methods 2 and 4 as 380
shown in Figure 1. Factors other than inhibition were believed responsible for the failure 381
of amplification. Therefore, modifications to the procedures were required to successfully 382
extract RNA from soil in our experimental setting. 383
Effect of facilitators on RNA extraction 384
Two tests verified the binding of RNA on soil particles. In the first test, Ct values 385
increased from 33.8 with no sand to 37.0 with 1 gram of sand. The addition of 50 mM 386
EDTA reduced the Ct values by 2 to 3 units as shown in Table 3. In the second test, mean 387
Ct values increased from 32.4 with no clay to 37.7 with 10 percent clay, while no 388
amplification was observed in samples with clay content of more than 10 percent as 389
shown in Table 4. 390
The effects of facilitators to relieve (m)RNA binding on soil particles during 391
extraction with method 5 were examined with a reference clay/quartz sand mixture of 392
15:85 by weight as shown in Table 5. Pure sand and reference clay STX-1 were used to 393
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
18
exclude the influence of enzyme inhibitors and no amplification was observed from 394
samples without facilitator. The addition of RNAY at 20 mg/g and Salmonella typhi at 395
concentration of 108 cells/g soil significantly enhanced the extraction of mRNA with Ct 396
values of 32.4 and 32.3, respectively. SM and casein at a concentration of 40 mg/g 397
greatly increased the yield of C. parvum RNA with a Ct value of 33.7 and 34.0, 398
respectively. Salmon DNA at a concentration of 10 mg/g improved the extraction of 399
RNA with a Ct value of 38.6. BSA slightly enhanced the extraction of RNA from soil 400
with a Ct value of 39.2. In contrast, PVPP and SMP did not relieve the binding of RNA 401
on soil particles as no signals were observed for samples with these two facilitators. 402
One-way ANOVA analysis revealed that the Ct values for RNA obtained by using 403
RNAY, Salmon DNA, Salmonella, casein, SM, and BSA as facilitators were significantly 404
different (p<0.05, n=18). Tukey’s post-test analyses found no significant differences 405
between Ct values using RNAY and Salmonella. It was noted that during the phenol-406
chloroform extraction step a white gel-like structure was formed between the two phases 407
when using SM or casein as facilitator, thus made the subsequent separation process very 408
difficult. Since most of the soil RNA extraction kits included a step of phenol- 409
chloroform extraction, SM and casein were excluded in further tests. 410
Next, the efficiency of RNAY and Salmonella on RNA extraction was tested on 411
oocysts spiked sandy and loamy soil with method 5. For sandy soil (Table 6), the addition 412
of RNAY at a concentration as low as 4 mg/g of soil significantly relieved binding of 413
RNA and thus enhanced its extraction with 3 replicates yielding consistent amplifications 414
with a Ct value of 36.9. In the range from 4 to 20 mg/g of soil the Ct value decreased 415
with the increase in the amount of RNAY added. The lowest mean Ct value (30.58±0.52) 416
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
19
was obtained from samples with RNA at a concentration of 20 mg/g of soil. The Ct value 417
remained unchanged when RNAY was between 20 to 80 mg/g of soil. The inclusion of 418
Salmonella, at the onset of the extraction process, at a level as low as 2×107 cells per 419
gram of soil greatly improved the RNA extraction efficiency with a mean Ct value of 420
36.31±0.60. However, increasing the concentration of Salmonella from 2×107 to 2×10
8 421
cells per gram of soil led to the decrease of Ct values from 36.3 to 31.2. The addition of 422
salmonella at concentrations higher than 2×108 cells per gram of soil reduced the yield of 423
mRNA as evidenced by the increase of Ct values compared with that of 2×108 cells per 424
gram of soil. One-way ANOVA analysis on the Ct value was performed to compare the 425
efficiency of RNAY, and Salmonella at its optimum concentration on RNA extraction 426
from sandy soil. No significant difference was observed between mean Ct values 427
(P=0.35). No amplification was observed for loamy soil irrespective of which facilitator 428
was included. 429
The effect of Salmonella in preventing RNA degradation during extraction is shown 430
in Table 7. Without the addition of Salmonella, the difference between Ct values obtained 431
using Oligo (dT)16 and Random primer was 3.16; with the addition of 2×107 Salmonella 432
(cells/g of soil), this difference lowered to 0.39; in the presence of 1×108 Salmonella 433
(cells/g of soil), the difference lowered even more to -0.12. 434
Inhibitor removal performance assessment 435
RNA extracts by method 5 from loamy soil spiked with 3×105 C. parvum oocysts 436
and different concentration of RNAY or Salmonella were further purified with either 437
MicroSpin S-400 HR spin column or RNeasy®
MinElute®
Cleanup Kit to remove RT-438
PCR inhibitor. Hsp70 mRNA in approximately 43% (13/30) of the extract was detected 439
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
20
after purification with the MicroSpin S-400 HR spin column. Purification using RNeasy®
440
MinElute®
method resulted in hsp70 mRNA in 87% (26/30) of the extracts being 441
detected. 442
Soil spiked with oocysts following pretreatment with Al2(SO4)3 was subjected to 443
RNA extraction using method 5 in the presence of RNAY at an optimal concentration. 444
No amplification was observed in RT-PCR for any type of the soil. IPC RNA, however, 445
showed amplification for all of the three environmental soils. 446
Comparison of (m)RNA extraction efficiencies of 5 methods using modified 447
protocols 448
The following modifications were thus made to the manufactures’ recommended 449
protocols to optimize the extraction of RNA from soils. BME (20 µl/ml solution for 450
sandy soil, and 40 μl/ml solution for loamy and clay soil) and EDTA with a final 451
concentration of 50 mM were included in the lysis solution for all methods. Salmonella 452
was used as RNA extraction facilitator at a concentration of 2×108, 4×10
8, and 8×10
8cells 453
per gram for sandy, loamy, and clay soil, respectively. After DNase treatment to remove 454
the residual DNA, the RNA extract was used directly for TaqMan reverse transcription 455
PCR. For samples that did not show successful amplification, an additional purification 456
using RNeasy®
MinElute®
Cleanup Kit was performed before RT-PCR. For method 2, 457
the garnet bead in the lysis tube was replaced by a bead mixture of various diameters (2 458
mm, 0.4g; 1mm, 0.4 g; 0.5 mm, 0.4 g) before extraction to ensure higher (m)RNA yield. 459
The comparative efficiencies of the five RNA extraction methods were evaluated on three 460
environmental soils spiked with 3×105 oocysts of C. parvum. 461
For sandy soil, successful amplifications were achieved using methods 1, 2, 4 and 5 462
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
21
without further purification. Mean Ct values were 31.7, 30.5, 34.5 and 30.3 for methods 463
1, 2, 4 and 5, respectively. RNA extracted by method 3 required further purifications to 464
be detected by RT-PCR (Ct value 38.9). One-way ANOVA analysis on the Ct value 465
indicated that the difference in extraction efficiency of the five RNA extraction methods 466
was significant (P<0.05). Post-hoc Turkey’s test revealed no significant differences 467
between Ct values for method 2 and method 5 (P=0.097). The differences, however, were 468
significant when Ct values for the two methods were compared to Ct values for the other 469
three methods (P<0.05). 470
RNA extracts from loamy soil by method 2 and 4 were RT-PCR amplifiable 471
without further purification, with Ct values of 32.7 and 37.44, respectively. Purification 472
was required for RNA extracted from loamy soil by method 1, 3 and 5 to be successfully 473
amplified by RT-PCR. Ct values for methods 1, 3, and 5 after purification were 39.1, 474
40.2 and 36.6, respectively. Significant differences in the extraction efficiency were 475
revealed by One-way ANOVA analysis on Ct value (P<0.05). Pair-wise comparisons of 476
Ct values by post-hoc tests indicated significant differences between all comparisons. 477
RNA extractions from clay appeared to be the most difficult. With the exception of 478
method 2, no other method produced RT-PCR suitable RNA extract, even after the 479
additional purification by RNeasy®
MinElute®
Cleanup Kit. The mean Ct value for 480
extracts by method 2 was 34.0. 481
Detection limits are defined as the lowest oocysts level for which all three replicates 482
can be detected as indicated by the Ct value. Table 8 shows the detection limit of RT-483
PCR using mRNA extracted from three soils by all five methods. Methods 2 and 5 484
yielded mRNA detections at the lowest concentration by RT-PCR from sandy soil. 485
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
22
Detection limits using mRNA extracted from sandy soil with method 2 and 5 were 486
1.5×102 and 6×10
2 oocysts per gram of soil, respectively. Method 2 yielded mRNA with 487
a detection limit of 1.5×103 oocysts per gram of loamy soil, which was the lowest 488
concentration among all methods. The detection limit for clay was 1.5×104 oocysts per 489
gram of soil using method 2. 490
DISCUSSION 491
Information concerning the viability of C. parvum oocysts is required when 492
developing a rapid estimate of a risk to human health. Heat shock protein (hsp) mRNA 493
decays shortly after cell death (40), therefore it can be correlated with the viability of C. 494
parvum oocysts (63) and used as viability marker. The advantage of targeting hsp70 495
mRNA is that the transcripts are present in higher copy numbers than with other mRNAs, 496
which improves the overall sensitivity of detection. While reverse transcription PCR (RT-497
PCR) targeting hsp70 mRNA has been proposed in determining the viability of C. 498
parvum oocyst in water (24, 29, 63) or manure samples (21), this study is the first for the 499
detection of viable oocysts in soil. The method relies largely on the efficiency of RNA 500
extraction from a soil matrix as well as the reduction of inhibitors. 501
The literature describes only one other investigation where RNA extraction was 502
evaluated with respect to soil samples (14), however, in that study RNA extraction kits 503
were compared utilizing soil spiked with high concentration of virus MS2 RNA (more 504
than 107 PFU g
-1 soil). It is not typical for human pathogens, such as C. parvum oocysts, 505
to be present in soil in such high concentrations. In this study five RNA isolation methods 506
were evaluated for extracting (m)RNA from C. parvum oocysts in sandy, loamy, or clay 507
soil using real time RT-PCR targeting hsp70 mRNA. 508
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
23
Failure to detect hsp70 mRNA by RT-PCR from all samples in the initial extraction 509
attempt might have been caused by the inhibitory effect of humic substances co-extracted 510
from soil or the low recovery of m(RNA) in the extracts. Amplification of IPC RNA for 511
some of the extracts (Figure 1) indicated that the inhibitory effect was not the main 512
reason for the failure of amplification, at least for samples that showed positive IPC RNA 513
signals. This was further supported by the observation that, even after purification or 514
dilution to relieve the inhibition, hsp70 mRNA still could not be detected. The amount of 515
mRNA in the C. parvum oocysts spiked was sufficient to be detected in our experimental 516
setting when the recovery rate was high since a positive control using mRNA extract 517
from isolate of C. parvum oocysts of the same number yielded a Ct value of 26.5±0.87. 518
Factors that may have contributed to the low (m)RNA recovery rate include 519
insufficient lysis of oocysts, degradation of the released (m)RNA by RNase in the soil 520
matrix, or the adsorption of released RNA on soil components (clay, sand mineral, and 521
organic matter). It is unlikely that the oocysts were incompletely disrupted since bead 522
beating was used for all five extraction methods. This technique has been recommended 523
to disrupt cells in soil aggregates during nucleic acid extraction (49) and proven to be 524
effective at disrupting oocysts (21). The chance of mRNA being degraded by RNase in a 525
soil matrix is small since it was inactivated by BME before the lysis began. Therefore, 526
the failure to detect (m)RNA by RT-PCR was probably caused by an unsuccessful 527
extraction due to adsorption of (m)RNA on soil components after they were released 528
from oocysts. The results of previous studies suggest that the adsorption of DNA on soil 529
colloids poses a serious challenge to its extraction from soil (20, 53, 67). Compared to 530
DNA, reports of RNA adsorption by soil components are relatively rare (64), however, in 531
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
24
our study, two tests using pure sand and reference clay confirmed the binding of (m)RNA 532
on soil components. Since the process of DNA/RNA adsorption on soil particles is 533
prompted primarily by bivalent cations (54), the inclusion of 50 mM EDTA in the lysis 534
solution partially alleviated the adsorption of RNA (lower Ct value) due to its chelating 535
effect (25). EDTA alone proved inadequate to mitigate binding of RNA on soil with clay 536
contents higher than 10 percent (Table 4) since clay has a much higher binding capacity 537
than sand. 538
Various additives have been shown to increase the efficiency of DNA extraction 539
from soil by reducing its binding site availability (20, 45, 67, 69). In this study the 540
addition of additives (SM, Casein, Salmon DNA, BSA, RNAY) did improve the 541
extraction of RNA to various extents. Although improving RNA extraction was the main 542
focus in the selection of the appropriate facilitators, other factors, such as simplifying the 543
method and lowering costs were also considered. RNAY was initially found to be the 544
most efficient approach to deal with the adsorption of (m)RNA on soil colloids during 545
RNA extraction using method 5. When total RNA extraction methods 1, 2, 3, and 4 were 546
used, after the lysis step, the presence of excessive extraneous RNA, far exceeded the 547
capacity of binding matrix; however, the binding of target RNA was significantly 548
lowered, and thus influenced its detection (data not shown). Moreover, the high expense 549
of RNAY increased the cost of detection by $24 per sample (three replicates). Therefore, 550
RNAY was not used for further experiment. 551
The effectiveness of using Salmonella to increase the yield of (m)RNA during RNA 552
extraction indicated that its debris during cell disrupting, including cell wall components, 553
protein and nucleic acid, competed for binding sites on soil colloids and thus reduced the 554
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
25
binding of C. parvum oocysts (m)RNA. The inclusion of 2×108 Salmonella cells per 555
gram of sandy soil has the same effect as 20 mg of RNAY in alleviating mRNA 556
adsorption on soil components in the extraction of C. parvum mRNA from sandy soil 557
using method 5. In contrast to RNAY, the debris of Salmonella were removed during the 558
isolation steps and thus did not interfere with RNA binding on the matrix during the 559
purification steps with the total RNA extraction methods. So Salmonella provided an 560
economical alternative to mitigate C. parvum (m)RNA adsorption during RNA extraction 561
from soil. Furthermore, under natural scenarios, C. parvum are released into environment 562
in animal feces together with high concentrations of bacterial indicators (11). It is 563
estimated that in one gram of feces there are approximately 1011
bacteria(66). Therefore, 564
this simple rationale of using prokaryotic biomass to assist eukaryotic nucleic acid 565
extraction from complex environmental matrix can be generalized and applied in similar 566
studies. 567
The utility of Salmonella during the lysis step of the extraction not only improved 568
the yield of (m)RNA, as evidenced by the decreased mean Ct values; it also reduced the 569
degradation of mRNA, as demonstrated by declines in the differences of mean Ct values 570
between Oligo(dT)16 and random primers (Table 7). The variation in the mRNA-primer 571
hybridization as well as mRNA structural changes during the extraction procedures might 572
also have accounted for the observed differences in mean Ct values using different primer 573
sets with or without Salmonella. Eukaryotic mRNA degradation is initiated by the 574
shortening of the polyA tail (33), which results in the lower efficiency of reverse 575
transcription and ultimately the higher Ct values in RT-PCR using Oligo(dT)16. However, 576
the integrity of polyA tail rarely influences the efficiency of reverse transcription using 577
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
26
random primers and hence the Ct value in RT-PCR. The observed difference of mean Ct 578
value of 3.16 in the absence of Salmonella was significantly reduced to 0.39 when 1×107 579
Salmonella cells were used per gram of soil, suggesting less degradation or shedding of 580
mRNA. 581
The inclusion of IPC RNA in reverse transcription enabled the identification of 582
false negative results due to the presence of inhibitory substances. Unlike previous 583
studies that used a housekeeping gene RNA to monitor RNA extraction and amplification 584
efficiency, our developed IPC RNA was not present in the environmental samples tested. 585
Therefore, being independent of the substrate tested, the detection of IPC RNA by 586
TaqMan reverse transcription PCR suggested that the efficiency of extraction methods to 587
remove inhibitors was sufficient. Non-amplification of IPC RNA indicated the 588
interference of a PCR inhibitor to RT-PCR. When using housekeeping genes as internal 589
control, their exact initial amount is unknown in most cases due to different transcription 590
levels. In some cases they might not be present in environmental samples, while in others 591
they might far exceed amount of target mRNA, resulting in a competitive reverse 592
transcription and PCR amplification which significantly affects the sensitivity, precision 593
and accuracy of the assay. In the case of IPC RNA, the amount of IPC RNA is set at a 594
low level to limit its influence. 595
All five RNA methods tested utilized a direct extraction procedure without isolating 596
C. parvum oocysts from the soil matrix. Indirect procedures that extract RNA from 597
microorganisms after they were separated from soil matrix have been suggested to 598
improve purity by reducing humic contents (62), which is more appropriate for soil with 599
high levels of humic substances. A commercial soil RNA indirect extraction kit is 600
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
27
available for the effective isolation of bacterial RNA from soil (FastRNA®
Pro Soil-601
Indirect Kit, MP Biomedicals, Solon, OH). Due to the size of C. parvum oocysts (~5 602
µm), further amendments to this kit may make it more suitable for the extraction of C. 603
parvum RNA from soil as both the centrifugation step and the cheesecloth filtration 604
during the separation procedure could eliminate the oocysts from subsequent RNA 605
extraction. 606
Method 2 (2 gram sample) and method 5 (0.5 gram sample) were found to be the 607
most efficient with respect to extracting RNA from sandy soil. Differences in the amount 608
of soil processed are evidenced by using qRT-PCR to show that sensitivities of 609
approximately 150 and 600 C. parvum oocysts per gram of soil were obtained 610
respectively (method 2 versus method 5) using extracted RNA. For loam and clay method 611
2 was the most efficient, with detection limit of 1.5×103 and 1.5×10
4 C. parvum oocysts 612
per gram, respectively. Previous studies reported that single viable C. parvum oocyst had 613
been detected by RT-PCR targeting hsp70 mRNA from environmental water samples 614
(29, 63). Since water samples may not contain a complex environmental matrix, which 615
efficiently binds RNA during extraction, and contains a lower content of PCR inhibitors, 616
making comparisons between water samples and soil samples is untenable. The only 617
comparable study (21) reported a detection limit of around 5000 C. parvum oocysts per 618
ml of manure using quantitative reverse transcription PCR targeting hsp70 mRNA. It 619
should be noted however that the method used in that study is not suitable to be adopted 620
for soil: 1) a sample size of 60 to 90 µl manure is insignificant to be used for soil 621
processing, 2) component and texture of soil matrix are more heterogonous and complex 622
than manure, and 3) absorption of mRNA on soil is strong as compared to manure. 623
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
28
Furthermore, in that study before RNA extraction manure samples were washed three 624
times to reduce dissolved inhibitory compounds. In our study using the modified 625
procedures a comparable detection limit was observed without any pretreatment of loamy 626
soil, a much lower detection limit was obtained for sandy soil. Since 30 to 100 C. parvum 627
oocysts can cause human infections (15), further modifications can be made to our 628
methods to detect lower number of oocysts in soil samples by reducing the influence of 629
humic substance. For instance, mRNA extraction under low pH (pH 5.0) has been 630
suggested to be essential to minimize the co-extraction of humic acids from soil samples 631
and to increase the stability of mRNA (47). The pH of the lysis buffer and phenol-632
chloroform mixture could be adjusted to 5.0 for soil samples with high humic acid 633
content. Additionally novel mutant Taq and Klen-taq enzymes that are resistant to PCR 634
inhibitors have recently been identified (31). Combining our modified RNA extraction 635
methods with RT-PCR using an inhibitor resistant enzyme might also significantly 636
facilitate the detection of viable C. parvum oocyst in soil samples with high inhibitor 637
contents. 638
In conclusion, the development of C. parvum specific TaqMan RT-PCR assays, as 639
described in this study, provides a valuable new approach for the assessment of viable C. 640
parvum in environmental soil samples. Using optimized (m)RNA extraction method in 641
combination with RT-PCR, viable C. parvum oocysts were detected from soil samples 642
without the need of previous oocysts purification or any pretreatment to reduce inhibitory 643
substances. The procedure from RNA extraction to RT-PCR can be completed within 8 644
hours. In contrast to other viability testing methods such as animal infectivity assays, in 645
vitro cell culture, and in vitro excystation, our optimized detection methods provide much 646
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
29
faster, less expensive, and more accurate tools to reveal the presence and viability of C. 647
parvum oocysts in soil. 648
Soil is an important vehicle through which C. parvum oocysts can reach water 649
sources (61) indirectly through runoff from land grazed by livestock (2, 30, 32), directly 650
by runoff from soil containing manure, i.e. fertilizer, or vertical transport though 651
preferential flow paths to groundwater (3, 12, 34, 35, 43). Information on the viability of 652
C. parvum oocysts in soil will be important for rapid responses in making risk analysis 653
and management decisions in cases of contamination due to unintentional release of C. 654
parvum oocysts such as spreading manure on farms. The modified method combined 655
with TaqMan RT-PCR might be an important step in the standardization of identification 656
and detection of viable C. parvum oocysts in soil samples. 657
ACKNOWLEDGEMENTS 658
This research was funded by the National Homeland Security Research Center 659
through the U.S. Environmental Protection Agency (EPA). 660
This article has not been subjected to internal policy review of the U.S. EPA. 661
Therefore, the research results do not necessarily reflect the views of the agency or its 662
policy. 663
REFERENCES 664
1. Arrowood, M. J. 2002. In vitro cultivation of Cryptosporidium species. Clin. 665
Microbiol. Rev. 15:390-400. 666
2. Atherholt, T. B., M. W. LeChevallier, W. D. Norton, and J. S. Rosen. 1998. 667
Effect of rainfall on Giardia and crypto. Journal American Water Works 668
Association 90:66-80. 669
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
30
3. Atwill, E. R., L. L. Hou, B. A. Karle, T. Harter, K. W. Tate, and R. A. 670
Dahlgren. 2002. Transport of Cryptosporidium parvum oocysts through 671
vegetated buffer strips and estimated filtration efficiency. Appl. Environ. 672
Microbiol. 68:5517-5527. 673
4. Bailly, J., L. Fraissinet-Tachet, M. C. Verner, J. C. Debaud, M. Lemaire, M. 674
Wesolowski-Louvel, and R. Marmeisse. 2007. Soil eukaryotic functional 675
diversity, a metatranscriptomic approach. ISME Journal 1:632-642. 676
5. Bajszar, G., and A. Dekonenko. 2010. Stress-induced hsp70 gene expression 677
and inactivation of Cryptosporidium parvum oocysts by chlorine-based oxidants. 678
Appl. Environ. Microbiol. 76:1732-1739. 679
6. Barton, H. A., N. M. Taylor, B. R. Lubbers, and A. C. Pemberton. 2006. DNA 680
extraction from low-biomass carbonate rock: An improved method with reduced 681
contamination and the low-biomass contaminant database. J. Microbiol. Methods 682
66:21-31. 683
7. Black, E. K., G. R. Finch, R. TaghiKilani, and M. Belosevic. 1996. 684
Comparison of assays for Cryptosporidium parvum oocysts viability after 685
chemical disinfection. FEMS Microbiol. Lett. 135:187-189. 686
8. Bukhari, Z., and H. V. Smith. 1995. Effect of 3 concentration techniques on 687
viability of Cryptosporidium-Parvum oocysts recovered from bovine feces. J. 688
Clin. Microbiol. 33:2592-2595. 689
9. Burgmann, H., M. Pesaro, F. Widmer, and J. Zeyer. 2001. A strategy for 690
optimizing quality and quantity of DNA extracted from soil. J. Microbiol. 691
Methods 45:7-20. 692
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
31
10. Campbell, A. T., L. J. Robertson, and H. V. Smith. 1992. Viability of 693
Cryptospordium-parvum oocysts - correlation of in vitro excystation with 694
inclusion or exclusion of fluorogenic vital dyes. Appl. Environ. Microbiol. 695
58:3488-3493. 696
11. Cox, P., M. Griffith, M. Angles, D. Deere, and C. Ferguson. 2005. 697
Concentrations of pathogens and indicators in animal feces in the Sydney 698
watershed. Appl. Environ. Microbiol. 71:5929-5934. 699
12. Davies, C. M., N. Altavilla, M. Krogh, C. M. Ferguson, D. A. Deere, and N. J. 700
Ashbolt. 2005. Environmental inactivation of Cryptosporidium oocysts in 701
catchment soils. J. Appl. Microbiol. 98:308-317. 702
13. Di Giovanni, G. D., F. H. Hashemi, N. J. Shaw, F. A. Abrams, M. W. 703
LeChevallier, and M. Abbaszadegan. 1999. Detection of infectious 704
Cryptosporidium parvum oocysts in surface and filter backwash water samples by 705
immunomagnetic separation and integrated cell culture-PCR. Appl. Environ. 706
Microbiol. 65:3427-3432. 707
14. Dineen, S. M., R. Aranda, M. E. Dietz, D. L. Anders, and C. M. Robertson. 708
2010. Evaluation of commercial RNA extraction kits for the isolation of viral 709
MS2 RNA from soil. J. Virol. Methods 168:44-50. 710
15. Dupont, H. L., C. L. Chappell, C. R. Sterling, P. C. Okhuysen, J. B. Rose, 711
and W. Jakubowski. 1995. The infectivity of Cryptosporidium-parvum in 712
healthy-volunteers. N. Engl. J. Med. 332:855-859. 713
16. Enriquez, F. J., and C. R. Sterling. 1991. Cryptosporidium infections in inbred 714
strains of mice J. Protozool. 38:S100-S102. 715
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
32
17. Fayer, R. 2004. Cryptosporidium: a water-borne zoonotic parasite. Vet. Parasitol. 716
126:37-56. 717
18. Felske, A., B. Engelen, U. Nubel, and H. Backhaus. 1996. Direct ribosome 718
isolation from soil to extract bacterial rRNA for community analysis. Appl. 719
Environ. Microbiol. 62:4162-4167. 720
19. Fleming, J. T., W. H. Yao, and G. S. Sayler. 1998. Optimization of differential 721
display of prokaryotic mRNA: Application to pure culture and soil microcosms. 722
Appl. Environ. Microbiol. 64:3698-3706. 723
20. Frostegard, A., S. Courtois, V. Ramisse, S. Clerc, D. Bernillon, F. Le Gall, P. 724
Jeannin, X. Nesme, and P. Simonet. 1999. Quantification of bias related to the 725
extraction of DNA directly from soils. Appl. Environ. Microbiol. 65:5409-5420. 726
21. Garces-Sanchez, G., P. A. Wilderer, J. C. Munch, H. Horn, and M. Lebuhn. 727
2009. Evaluation of two methods for quantification of hsp70 mRNA from the 728
waterborne pathogen Cryptosporidium parvum by reverse transcription real-time 729
PCR in environmental samples. Water Res. 43:2669-2678. 730
22. Gobet, P., and S. Toze. 2001. Relevance of Cryptosporidium parvum hsp70 731
mRNA amplification as a tool to discriminate between viable and dead oocysts. J. 732
Parasitol. 87:226-229. 733
23. Griffiths, R. I., A. S. Whiteley, A. G. O'Donnell, and M. J. Bailey. 2000. Rapid 734
method for coextraction of DNA and RNA from natural environments for analysis 735
of ribosomal DNA- and rRNA-based microbial community composition. Appl. 736
Environ. Microbiol. 66:5488-5491. 737
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
33
24. Hallier-Soulier, S., and E. Guillot. 2003. An immunomagnetic separation-738
reverse transcription polymerase chain reaction (IMS-RT-PCR) test for sensitive 739
and rapid detection of viable waterborne Cryptosporidium parvum. Environ. 740
Microbiol. 5:592-598. 741
25. Jacobsen, C. S., and O. F. Rasmussen. 1992. Development and application of a 742
new method to extract bacterial-DNA from soil based on separation of bacteria 743
from soil with cation-exchange resin. Appl. Environ. Microbiol. 58:2458-2462. 744
26. Jenkins, M., J. M. Trout, J. Higgins, M. Dorsch, D. Veal, and R. Fayer. 2003. 745
Comparison of tests for viable and infectious Cryptosporidium parvum oocysts. 746
Parasitol. Res. 89:1-5. 747
27. Jenkins, M. C., J. Trout, M. S. Abrahamsen, C. A. Lancto, J. Higgins, and R. 748
Fayer. 2000. Estimating viability of Cryptosporidium parvum oocysts using 749
reverse transcriptase-polymerase chain reaction (RT-PCR) directed at mRNA 750
encoding amyloglucosidase. J. Microbiol. Methods 43:97-106. 751
28. Jex, A. R., H. V. Smith, P. T. Monis, B. E. Campbell, and R. B. Gasser. 2008. 752
Cryptosporidium - Biotechnological advances in the detection, diagnosis and 753
analysis of genetic variation. Biotechnol. Adv. 26:304-317. 754
29. Kaucner, C., and T. Stinear. 1998. Sensitive and rapid detection of viable 755
giardia cysts and Cryptosporidium parvum oocysts in large-volume water 756
samples with wound fiberglass cartridge filters and reverse transcription-PCR. 757
Appl. Environ. Microbiol. 64:1743-1749. 758
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
34
30. Keeley, A., and B. R. Faulkner. 2008. Influence of land use and watershed 759
characteristics on protozoa contamination in a potential drinking water resources 760
reservoir. Water Res. 42:2803-2813. 761
31. Kermekchiev, M. B., L. I. Kirilova, E. E. Vail, and W. M. Barnes. 2009. 762
Mutants of Taq DNA polymerase resistant to PCR inhibitors allow DNA 763
amplification from whole blood and crude soil samples. Nucleic Acids Res. 764
37:e40. 765
32. Kistemann, T., T. Classen, C. Koch, F. Dangendorf, R. Fischeder, J. Gebel, 766
V. Vacata, and M. Exner. 2002. Microbial load of drinking water reservoir 767
tributaries during extreme rainfall and runoff. Appl. Environ. Microbiol. 68:2188-768
2197. 769
33. Korner, C. G., M. Wormington, M. Muckenthaler, S. Schneider, E. Dehlin, 770
and E. Wahle. 1998. The deadenylating nuclease (DAN) is involved in poly(A) 771
tail removal during the meiotic maturation of Xenopus oocytes. EMBO J. 772
17:5427-5437. 773
34. Kuczynska, E., D. G. Boyer, and D. R. Shelton. 2003. Comparison of 774
immunofluorescence assay and immunomagnetic electrochemiluminescence in 775
detection of Cryptosporidium parvum oocysts in karst water samples. J. 776
Microbiol. Methods 53:17-26. 777
35. Kuczynska, E., and D. R. Shelton. 1999. Method for detection and enumeration 778
of Cryptosporidium parvum oocysts in feces, manures, and soils. Appl. Environ. 779
Microbiol. 65:2820-2826. 780
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
35
36. Lamar, R. T., B. Schoenike, A. Vandenwymelenberg, P. Stewart, D. M. 781
Dietrich, and D. Cullen. 1995. Quantitation of fungal messenger-RNAs in 782
complex substrates by reverse transcription PCR and its application to 783
phanerochaete chrysosporium-colonized soil. Appl. Environ. Microbiol. 61:2122-784
2126. 785
37. LeChevallier, M. W., W. D. Norton, and R. G. Lee. 1991. Occurrence of 786
Giardia and Cryptosporidium spp in surface-water supplies. Appl. Environ. 787
Microbiol. 57:2610-2616. 788
38. Lee, S. U., M. Joung, M. H. Ahn, S. Huh, H. Song, W. Y. Park, and J. R. Yu. 789
2008. CP2 gene as a useful viability marker for Cryptosporidium parvum. 790
Parasitol. Res. 102:381-387. 791
39. Lindquist, H. D. A., S. Harris, S. Lucas, M. Hartzel, D. Riner, P. Rochele, 792
and R. DeLeon. 2007. Using ultrafiltration to concentrate and detect Bacillus 793
anthracis, Bacillus atrophaeus subspecies globigii, and Cryptosporidium parvum 794
in 100-liter water samples. J. Microbiol. Methods 70:484-492. 795
40. Lindquist, S., and R. Petersen. 1990. Selective translation and degradation of 796
the heat-shock messenger-RNAs in drosophila. Enzyme 44:147-166. 797
41. Litton, G. M., and T. M. Olson. 1993. Colloid deposition rates on silica bed 798
media and artifacts related to collector surface preparation methods. Environ. Sci. 799
Technol. 27:185-193. 800
42. Mahbubani, M. H., A. K. Bej, M. Perlin, F. W. Schaefer, W. Jakubowski, 801
and R. M. Atlas. 1991. Detection of giardia cysts by using the polymerase chain-802
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
36
reaction and distinguishing live from dead cysts. Appl. Environ. Microbiol. 803
57:3456-3461. 804
43. Mawdsley, J. L., A. E. Brooks, and R. J. Merry. 1996. Movement of the 805
protozoan pathogen Cryptosporidium parvum through three contrasting soil types. 806
Biol. Fertility Soils 21:30-36. 807
44. McGrath, K. C., S. R. Thomas-Hall, C. T. Cheng, L. Leo, A. Alexa, S. 808
Schmidt, and P. M. Schenk. 2008. Isolation and analysis of mRNA from 809
environmental microbial communities. J. Microbiol. Methods 75:172-176. 810
45. Meguro, N., Y. Kodama, M. T. Gallegos, and K. Watanabe. 2005. Molecular 811
characterization of resistance-nodulation-division transporters from solvent- and 812
drug-resistant bacteria in petroleum-contaminated soil. Appl. Environ. Microbiol. 813
71:580-586. 814
46. Meinhardt, P. L. 2005. Water and bioterrorism: Preparing for the potential threat 815
to US water supplies and public health. Annu. Rev. Public Health 26:213-237. 816
47. Mettel, C., Y. Kim, P. M. Shrestha, and W. Liesack. 2010. Extraction of 817
mRNA from Soil. Appl. Environ. Microbiol. 76:5995-6000. 818
48. Miller, D. N. 2001. Evaluation of gel filtration resins for the removal of PCR-819
inhibitory substances from soils and sediments. J. Microbiol. Methods 44:49-58. 820
49. Miller, D. N., J. E. Bryant, E. L. Madsen, and W. C. Ghiorse. 1999. 821
Evaluation and optimization of DNA extraction and purification procedures for 822
soil and sediment samples. Appl. Environ. Microbiol. 65:4715-4724. 823
50. Neumann, N. F., L. L. Gyurek, L. Gammie, G. R. Finch, and M. Belosevic. 824
2000. Comparison of animal infectivity and nucleic acid staining for assessment 825
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
37
of Cryptosporidium parvum viability in water. Appl. Environ. Microbiol. 66:406-826
412. 827
51. Nolan, T., R. E. Hands, W. Ogunkolade, and S. A. Bustin. 2006. SPUD: A 828
quantitative PCR assay for the detection of inhibitors in nucleic acid preparations. 829
Anal. Biochem. 351:308-310. 830
52. Ogram, A., W. H. Sun, F. J. Brockman, and J. K. Fredrickson. 1995. Isolation 831
and characterization of RNA from low-biomass deep-subsurface sediments. Appl. 832
Environ. Microbiol. 61:763-768. 833
53. Ogram, A. V., M. L. Mathot, J. B. Harsh, J. Boyle, and C. A. Pettigrew. 1994. 834
Effects of DNA polymer length on its adsorption to soils. Appl. Environ. 835
Microbiol. 60:393-396. 836
54. Paget, E., L. J. Monrozier, and P. Simonet. 1992. Adsorption of DNA on clay-837
minerals - protection against DNAseI and influence on gene-transfer. FEMS 838
Microbiol. Lett. 97:31-39. 839
55. Redman, J. A., S. L. Walker, and M. Elimelech. 2004. Bacterial adhesion and 840
transport in porous media: Role of the secondary energy minimum. Environ. Sci. 841
Technol. 38:1777-1785. 842
56. Robertson, L. J., A. T. Campbell, and H. V. Smith. 1992. Survival of 843
Cryptosporidium-parvum oocysts under various environmental pressures. Appl. 844
Environ. Microbiol. 58:3494-3500. 845
57. Rochelle, P. A., D. M. Ferguson, T. J. Handojo, R. DeLeon, M. H. Stewart, 846
and R. L. Wolfe. 1997. An assay combining cell culture with reverse 847
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
38
transcriptase PCR to detect and determine the infectivity of waterborne 848
Cryptosporidium parvum. Appl. Environ. Microbiol. 63:2029-2037. 849
58. Sagova-Mareckova, M., L. Cermak, J. Novotna, K. Plhackova, J. Forstova, 850
and J. Kopecky. 2008. Innovative methods for soil DNA purification tested in 851
soils with widely differing characteristics. Appl. Environ. Microbiol. 74:2902-852
2907. 853
59. Sessitsch, A., S. Gyamfi, N. Stralis-Pavese, A. Weilharter, and U. Pfeifer. 854
2002. RNA isolation from soil for bacterial community and functional analysis: 855
evaluation of different extraction and soil conservation protocols. J. Microbiol. 856
Methods 51:171-179. 857
60. Slifko, T. R., D. Freidman, J. B. Rose, and W. Jakubowski. 1997. An in vitro 858
method for detecting infectious Cryptosporidium oocysts with cell culture. Appl. 859
Environ. Microbiol. 63:3669-3675. 860
61. Smith, H. V., and J. B. Rose. 1998. Waterborne cryptosporidiosis: Current 861
status. Parasitol. Today 14:14-22. 862
62. Steffan, R. J., J. Goksoyr, A. K. Bej, and R. M. Atlas. 1988. Recovery of DNA 863
from soils and sediments. Appl. Environ. Microbiol. 54:2908-2915. 864
63. Stinear, T., A. Matusan, K. Hines, and M. Sandery. 1996. Detection of a single 865
viable Cryptosporidium parvum oocyst in environmental water concentrates by 866
reverse transcription-PCR. Appl. Environ. Microbiol. 62:3385-3390. 867
64. Taylor, D. H., and A. T. Wilson. 1979. Adsorption of yeast RNA by allophane. 868
Clays Clay Miner. 27:261-268. 869
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
39
65. United States Environmental Protection Agency. 2005. Method 1623: 870
Cryptosporidium and Giardia in water by IFA/IMS/FA. Publication EPA 815-R-871
05-002. U.S.Environmental Protection Agency, Washington, D.C. 872
66. Vaahtovuo, J., M. Korkeamaki, E. Munukka, M. K. Viljanen, and P. 873
Toivanen. 2005. Quantification of bacteria in human feces using 16S rRNA-874
hybridization, DNA-staining and flow cytometry. J. Microbiol. Methods 63:276-875
286. 876
67. Volossiouk, T., E. J. Robb, and R. N. Nazar. 1995. Direct DNA extraction for 877
PCR-mediated assays of soil organisms. Appl. Environ. Microbiol. 61:3972-3976. 878
68. Widmer, G., E. A. Orbacz, and S. Tzipori. 1999. -tubulin mRNA as a marker 879
of Cryptosporidium parvum oocyst viability. Appl. Environ. Microbiol. 65:1584-880
1588. 881
69. Yoshida, N., N. Takahashi, and A. Hiraishi. 2005. Phylogenetic 882
characterization of a polychlorinated-dioxin-dechlorinating microbial community 883
by use of microcosm studies. Appl. Environ. Microbiol. 71:4325-4334. 884
885
886
887
-0.2
0
0.2
0.4
0.6
0.8
1
26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
Fluorescence
Ct value
A
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
40
888
889
Figure 1: TaqMan reverse transcription real-time PCR detection of IPC RNA mixed 890
before reverse transcription with extract from sand (A), loam (B) and clay (C) samples 891
using extraction method 1 (solid square), method 2 (open triangle), method 3 (solid 892
circle), method 4 (solid triangle) and method 5 (open square). Open circle indicates 893
amplification of IPC RNA only. The fluorescence increase is plotted versus the cycle 894
number of RT-PCR (plot start from cycle 26). 895
896
-0.1
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
Fluorescence
Ct value
B
-0.1
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
Fluorescence
Ct value
C
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
41
Table 1. Environmental soil characteristics used for spiking and RNA extraction trials. 897
Soil
classification
pHa
Organic matter b
(%)
Textures (%)
sand silt clay
Sand 6.8 0.48 97.5 2.5 0
Sandy loam 7.2 0.97 77.5 12.5 10
Clay 7.1 2.64 25 30 45
898
a Measured after equilibration with distilled water. 899
b Mass loss of dried material during ignition. 900
901
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
42
Table 2. PCR primers, probes, and oligos used for detection of C. parvum and RNA IPC construction. 902
Oligonucleotide
Target Sequence (5’-3’) Reference(s)
Type Name
Primer pair 1 CP-hsp70f C. parvum
hsp70
gene
AACTTTAGCTCCAGTTGAGAAAGTACTC
21
CP-hsp70r CATGGCTCTTTACCGTTAAAGAATTCC
Primer pair 2 Spud-f
IPC
AACTTGGCTTTAATGGACCTCCA
51
Spud-r ACATTCATCCTTACATGGCACCA
Primer pair 3 Cp- spudf IPC
AACTTTAGCTCCAGTTGAGAAAGTACTCAACTTGGCTTTAAT
GGACCTCCA
This study
Cp- spudr
CATGGCTCTTTACCGTTAAAGAATTCCACATTCATCCTTACA
TGGCACCA
Primer pair 4 T7-hsp70f IPC
TAATACGACTCACTATAGGGAGAAACTTTAGCTCCAGTTGA
GAAAGTACTC This study
T7-hsp70r TAATACGACTCACTATAGGGAGACATGGCTCTTTACCGTTAA
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
43
AGAATTCC
Probe Cp-hsp70P
C. parvum
hsp70gene
6FAM-AATACGTGTAGAACCACCAACCAATACAACATC-
BHQ1
21
Probe Spud-p IPC CY5-TGCACAAGCTATGGAACACCACGT-BHQ2 51
IPC IPC
AACTTGGCTTTAATGGACCTCCAATTTTGAGTGTGCACAAGC
TATGGAACACCACGTAAGACATAAAACGGCCACATATGGTG
CCATGTAAGGATGAATGT
51
903
904
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
44
Table 3. Detection of hsp70 mRNA in C. parvum oocysts spiked in different amount of 905
quartz sand with method 5. 906
Sample
(g)
Mean Ct value by method 5 (Ct±SD)
without EDTA with 50mM EDTA
0 33.80±0.27 30.82±0.17
0.25 33.99±0.22 31.42±0.23
0.5 34.76±0.23 32.41±0.18
1 37.29±0.46 33.66±014
A minimum of 5 replicates were used. 907
908
Table 4. Detection of hsp70 mRNA in C. parvum oocysts spiked in 0.5 g quartz 909
sand/reference montmorillonite clay mixture extracted with method 5. 910
Clay ratio (%) Mean Ct value by method 5 (Ct±SD)
0 32.41±0.18
2 34.57±0.34
10 37.73±1.01
≥20 Undetected
A minimum of 5 replicates were used. 911
912
913
914
915
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
45
Table 5. Detection of hsp70 mRNA in C. parvum oocysts spiked in 0.5g montmorillonite 916
clay/quartz sand mixture (15% clay) extracted with method 5 in the presence of different 917
facilitators and the Ct value of IPC RNA. 918
Facilitator added
hsp70 mRNA
mean Ct value
IPC RNA
mean Ct value
BSA 20mg 39.26±0.26 33.26±0.08
RNAYa 10mg 32.44±0.16 33.37±0.32
DNA 5mg 38.66±0.57 33.45±0.31
Casein 20mg 34.10±0.19 33.33±0.09
Skim milk 20mg 33.73±0.40 33.22±0.16
Salmonella 5×107 cell 32.33±0.05 33.29±0.10
PVPP 20mg undetected 33.37±0.14
SMP 50mg undetected 33.26±1.51
No addition undetected 33.38±0.02
aRNAY: S. cerevisiae RNA 919
A minimum of 5 replicates were used. 920
921
Table 6. Detection of hsp70 mRNA in C. parvum oocysts spiked in 0.5g sandy soil 922
extracted with method 5 in the presence of S. cerevisiae RNA (RNAY) or Salmonella and 923
the Ct value of IPC RNA. 924
Facilitator added
hsp70 mRNA
mean Ct value
IPC RNA
mean Ct value
2mg RNAY 36.94±0.42 35.03±0.59
5mg RNAY 33.19±0.06 34.31±0.15
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
46
10mg RNAY 30.58±0.52 34.57±0.11
20mg RNAY 30.62±0.34 34.69±0.22
40mg RNAY 30.63±0.17 34.73±0.12
1×107 Salmonella 36.31±0.60 34.14±0.37
2×107 Salmonella 35.16±0.13 34.58±0.09
5×107
Salmonella 33.02±0.16 35.16±0.34
1×108 Salmonella 31.20±0.07 35.14±0.22
2×108 Salmonella 32.38±0.43 34.64±0.19
A minimum of 5 replicates were used. 925
926
Table 7. Detection of hsp70 mRNA in C. parvum oocysts spiked in 0.5g quartz sand 927
extracted with method 1 in the presence of different amount of Salmonella by qRT-PCR. 928
Two types of primers (Random or Oligo(dT)16) were used in the reverse transcription 929
reaction. 930
Salmonella cells
Mean Ct value
Random primer Oligo(dT)16 difference
0 33.46 36.62 3.16
1×107 31.84 32.23 0.39
5×107 30.99 30.87 -0.12
1×108 31.36 31.25 -0.11
A minimum of 5 replicates were used. 931
932
933
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
47
Table 8. Limit of detection of qRT-PCR using C. parvum hsp70 mRNA extracted from 934
three soils by various extraction methods. 935
Extraction
method
sandy loamy clay
LOD a Average Ct
b LOD Average Ct LOD Average Ct
Method 1 6×103 38.65±0.66 6×10
5 39.16±0.80 n/a n/a
Method 2 1.5×102 40.33±0.09 1.5×10
3 38.00±0.90 1.5×10
4 37.30±0.61
Method 3 1.5×105 38.92±0.27 1.5×10
5 40.2
c n/a n/a
Method 4 6×104 37.76±0.25 6×10
5 37.44±0.29 n/a n/a
Method 5 6×102 40.84±0.45 6×10
4 39.15±0.16 n/a n/a
aLimit of detection was defined as the lowest concentration for which three out of three 936
replicates produced a positive result (unit: oocysts g-1
). 937
bAverage Ct value is expressed as mean ± standard deviation. 938
conly one out of three replicates is RT-PCR detectable. 939
A minimum of 3 replicates was used. 940
on May 25, 2018 by guest
http://aem.asm
.org/D
ownloaded from
