ADDRESSING ABIOTIC STRESS TOLERANCE IN ICE ORYZA … › ~saibo › projectos2011 › TeseTiago2008.pdf · Addressing Abiotic Stress Tolerance in Rice (Oryza sativa L.) Through a

ADDRESSING ABIOTIC STRESS TOLERANCE IN RICE

(ORYZA SATIVA L.) THROUGH A TRANSGENIC APPROACH

TIAGO LOURENÇO

Dissertation presented to obtain the PhD degree in Biology by Instituto de Tecnologia Química e Biológica da Universidade

Nova de Lisboa

Oeiras, Julho de 2008

Tiago Lourenço

Financial support from FCT (Fundação para a Ciência e Tecnologia) and

FSE (Fundo Social Europeu) in the scope of Quadro Comunitário de

apoio through PhD fellowship SFRH/BD/10615/2002 and for the research

project POCTI/BIA-BCM/56063/2004.

Work performed at: Plant Genetic Engineering Laboratory

Instituto de Tecnologia Química e Biológica

Avenida da Republica, Quinta do Marquês

2780-157 Oeiras

Portugal URL:http://www.itqb.unl.pt/Research/Plant_Sciences/Plant_Genetic_Engineering/

ii

http://www.itqb.unl.pt/Research/Plant_Sciences/Plant_Genetic_Engineering/

Addressing Abiotic Stress Tolerance in Rice (Oryza sativa L.) Through a Transgenic Approach

PhD Supervisors: Professor M. Margarida Oliveira - Head of the Plant Genetic Engineering laboratory at ITQB (Oeiras, Portugal).

- Assistant Professor with Aggregation at Faculdade de Ciências da Universidade

de Lisboa.

Professor Cândido Pinto Ricardo - Head of the Plant Biochemistry laboratory at ITQB (Oeiras, Portugal).

- Emeritus Full Professor from the Instituto Superior de Agronomia da

Universidade Técnica de Lisboa.

iii

Tiago Lourenço

iv


To the memory of my Mother and Grandmother

To the beautiful heart and love of my wife and daughter

v

Tiago Lourenço

vi


“What is a scientist after all? It is a curious man looking through a

keyhole, the keyhole of nature, trying to know what's going on.” Jacques Yves Cousteau

vii

Tiago Lourenço

viii


Acknowledgments During these years, there were several people and organizations that I would like to acknowledge for their help during my research work, PhD thesis writing and support in general…

- First of all, I would like to acknowledge the Fundação para a Ciência e Tecnologia (FCT) for the PhD scholarship that financially supported me throughout 4-years through the grant SFRH/BD/10615/2002 and also for the project POCTI/BIA-BCM/56063/2004 that supported most of the research performed.

- To Instituto de Tecnologia Química e Biológica (ITQB) for allowing me to perform my PhD research in a good working environment and for providing the facilities to do so.

- To Professora Margarida Oliveira for being not only my PhD supervisor, with always new ideas and helpful comments on how to improve our work, but also for being someone who would find time (on her tight schedule) to listen to our problems (professionally or personal).

- To Professor Cândido Pinto Ricardo for accepting to be also my PhD supervisor and for always being available for scientific discussions regarding my PhD research.

- To Dr. Nelson Saibo for giving new insights to my research when it seemed to be in a dead-end! Your fresh ideas gave my work a new boost and helped me to reach my goals. Furthermore, your friendship made the failures more bearable and the small successes celebrated (with moderation of course!). You are a good friend, for a Sporting fan…

- To Dr. Swapan Datta for opening the door of his lab in the International Rice Research Institute (IRRI, Los Baños, The Philippines). The transformation procedure used (particle bombardment) did not work the way we would expect, but 3-months were in fact short! Nevertheless, I learned everything I know of rice tissue culture there. My stay in IRRI helped me to grow not only as a researcher but also as a person.

- To Dr. Pieter B. F. Ouwerkerk for allowing me to learn and to do the Yeast One-Hybrid screening in his lab (Institute of Biology, University of Leiden, The Netherlands) and also for the rice transformation protocol with Agrobacterium. You always helped me with my doubts and questions (even the boring ones), but I believe that was because you know I can always send you some Pastéis de Belém!!!

- To Dr. José Ramalho (Instituto de Investigação de Ciências Tropicais) for teaching me how to use the conductivemeter and for the planning of the cold acclimation test.

- To Professor Jorge Marques da Silva and the Departamento de Biologia Vegetal from Faculdade de Ciências da Universidade de Lisboa for the loan of the Mini-PAM fluorometer used in the physiological analysis and the fundamental explanations on how to use it!

- To Dr. Timothy Close for the HvCBF4 cDNA clone that was used in part of my work.

- To Dr. Ko Shimamoto for sending the GATEWAY®-based vector (pANDA) for the RNA interference (RNAi) work.

- To Helena Raquel for always caring. You have been always a good friend and an inspiration for always chasing your dreams. Keep dreaming!

ix

Tiago Lourenço

- To Rita Batista for being a good friend with a good dose of craziness. Keep yourself young!

- To Ana Margarida Santos for all the good talks that would always make me laugh. I hope you will always keep a young spirit in you.

- To all members, former and present, of the Engenharia Genética de Plantas (EGP) laboratory (Milene, Pedro Barros, Duarte, Tânia, Ana Paula Santos, Jayamani, Isabel Abreu, Miguel, Lénia,…and all the others that I can not remember at the moment). You made the lab a good place to work and also to laugh. Without your friendship I probably would have gone crazy sooner!

- To the girls (Célia, Sónia, Margarida, Liliana, Ana Milhinhos, Marta and I hope I am not forgetting anyone) in the Pinus (or Forest Biotech, whatever) laboratory. For all the times I went to your laboratory to “collect” material and you all looked the other side!!!

- To Eugénia for always being available for our medium requests for yesterday!!!

- To all the friends I have made at the ITQB. André, Isabel, Rita, Ana, Marta, Sandra, just to mention a few. Always willing to help if I had a doubt on your field of expertise.

- To the ITQB maintenance group for always trying to put in practice our ideas for an optimal greenhouse for rice and for helping to guarantee that everything works properly.

- To all the friends I have made during my stay at IRRI. Mayank, Vilas, Ravi, Gayatri, Niranjan, Paul, Jill and Adam. You have always made me feel like at home. The IRRI and The Philippines experience is something I will always remember. I would also like to acknowledge all the technicians in the Tissue Culture lab (Datta’s lab), by the time of my stay there, for all the support and friendship.

- To Zé Eduardo. My dear friend for a long time. Who would guess on the 10th grade we would be working in the same building for the last 8 years?!? Despite not seeing each other too often (PhD can be a handful of work, you know?) I always knew I could count on you for talking, laughing… however counting on me to run marathons or half-marathons…forget it! Wish you all the best in life.

- To Nuno Prista for always having a new point of view to look at and for being a good friend since faculty times. I hope you can come back to this side of the ocean to be closer to friends!

- To my lab sister Sónia (the woman that never grows old). We shared more than the mess of our desk! We shared stories, failures, successes, past, present and future of our work in the lab. We also shared our personal stories like good friends and helped each other whenever possible. I wish you the best in your life and in your work as “Engenheira”. Just believe in you and fight your way through life!

- To all my friends (outside science) that supported me throughout these years. I will not refer names since I am afraid to forget someone. You all had the patience to listen when I talked full of passion about my work even when you did not understand a single word!!! For that and for a lot more, I thank you all!!!

x


- To Ana Claúdia my best friend outside science. You have always been there for us whenever we needed it. You are an inspiration for your persistence in your studies. Who would take a pharmaceutical degree immediately after a law degree?!? I wish you all the best for your personal life as well professionally and as you can see, research can be really funny at least when you strike good results!!!

- To Lídia and Zé Luís. For all the love and support you gave me and my family. Without you, my life would be sometimes chaotic. Thank you for everything.

- To my father… sometimes we do not connect too well, but I try to understand it is the way you are. We went through a lot together after mom died. I always knew you wanted me to finish this work and how proud you will be. I just want you to know that I love you very much, even when I am upset with you. Thank you for being the wonderful person you are and for being my father. I am proud to be your son.

- To my brother and sisters (Pedro, Vanda and Ana), to my nephews and nieces (Guilherme, Duarte, Miguel, Rafael, Laura and Rita), to my brothers- and sister-in-law (Alexandre, Rui and Sofia), for always being there and caring for me. I love you all.

- To my Aunts Mimi and Lurdes, for all the care and support they gave me throughout all these years.

- To all my family. For always caring. - To my mother and grandmother. It is so sad you both aren’t here to see

me finish this… I miss you every single day… I know that wherever you are, you are looking for me and feeling proud. I always loved you. Thank you for all the care and love you gave me. Miss you a lot!

- To my dear wife Andreia. Thank you for all the patience and love you gave me. For all the times I got home late from lab and for all the times I had to leave to go to congresses, to go somewhere else develop my work or to work on weekends. Thank you for taking care of our wedding even when I went to The Philippines for 3 months! Thank you for being such a good mother to our lovely daughter and such a wonderful wife to me. I love you very much and I hope we can together have a good life even if I have to come home late…AMO-TE!!!

- Last, but definitely not the least, to the light of my days my lovely daughter Matilde. When you smile my rainy days turn to colourful rainbows, you take away all my sadness. I hope you grow strong and happy. Keep smiling for us and keep turning our days to pure joy. Love from dad!

xi

Tiago Lourenço

xii


I, Tiago Filipe dos Santos Lourenço, declare by my honour to have active

participation in the following research papers:

- Batista R, Saibo N, Lourenço T, Oliveira MM (2008) Microarray analyses

reveal that plant mutagenesis may induce more transcriptomic changes than

transgene insertion. Proc Natl Acad Sci U S A 105: 3640-3645.

Tiago Lourenço generated the unstable transgenic lines used in this work and

also participated in the discussion of the results.

- Saibo N, Lourenço T, Oliveira MM (2008) Transcription factors and regulation

of photosynthetic and related metabolism under environmental stresses. Annals

of Botany (submitted).

Tiago Lourenço’s ‘Transcription Factors (TFs) involved in abiotic stress

responses’ sub-chapter from the PhD thesis General Introduction is part of the

review.

- Lourenço T, Saibo N, Batista R, Pinto Ricardo C, Oliveira MM (2008)

Overexpression of HvCBF4 in rice (Oryza sativa L.) causes differential gene

expression and stress tolerance. (submitted)

Tiago Lourenço has done the research work and wrote the manuscript.

- Lourenço T, Saibo N, Pinto Ricardo C, Oliveira MM Isolation and

characterization of the rice (Oryza sativa L.) OsHOS1 gene. (in preparation)

Tiago Lourenço has done the research work and wrote the manuscript.

- Lourenço T, Saibo N, Negrão S, Ouwerkerk PBF, Pinto Ricardo C, Oliveira MM Isolation and preliminary characterization of two ERF transcription factors

binding to the OsHOS1 promoter. (in preparation) Tiago Lourenço has done the research work and wrote the manuscript.

xiii

Tiago Lourenço

xiv


List of Abbreviations ABA – abscisic acid 3-AT – 3-amino-1,2,4-triazole APS – ammonium persulfate AP2/ERF – APETALA2/Ethylene responsive factor bp – base pair cm – centimetre cDNA – complementary DNA CBF/DREB1 – C-repeat binding factor/Dehydration responsive element binding factor 1 ºC – degrees Celsius DRE – dehydration responsive element DNA – deoxyribonucleic acid 2,4-D – 2,4-dichlorophenoxyacetic acid DTT – dithiothreitol DSBs – double-strand breaks EDTA – ethylene diamine tetraacetic acid ETR – electron transfer rate FT – factor de transcrição Fw – forward g – Grams GMO – genetically modified organism h – hour(s) HOS1 – high expression of osmotically responsive gene 1 HR – homologous recombination ICE1 – inducer of CBF expression 1 IRRI – International Rice Research Institute ITQB – Instituto de Tecnologia Química e Biológica kDa – Kilo Dalton Kg – Kilograms L – Litre LMW – low molecular weight M – Molar MAPK - mitogen activated protein kinase µg – micrograms µL – microlitre min - minutes mg – miligrams mL – mililitre mM – milimolar mmol – milimol MW – molecular weight ng – nanograms NHEJ – non-homologous end joining NLS – nuclear localization signal NT – non-transformed qN – non-photochemical quenching qP – photochemical quenching PAGE – polyacrylamide gel electrophoresis

xv

Tiago Lourenço

PAR – photosynthetic active radiation PEG – polyethylene glycol PCR – polymerase chain reaction pmol – picomol PR – pathogen related P5CS - ∆-pyrroline 5-carboxylase synthetase TBE buffer – Tris/Borate/EDTA buffer TCA – trichloroacetic acid TEMED – tetramethylethylenediamine T-DNA – transfer DNA TF – transcription factor RAV - Related to ABI3/VP1 RING finger motif – Really interesting new gene finger motif RNA – ribonucleic acid RNAi – RNA interference rpm – rotation per minute RT – room temperature RT-PCR – reverse transcriptase-PCR Rv – reverse RWC – relative water content SB – sample buffer SDS – sodium dodecyl sulfate SSC buffer – sodium chloride-sodium citrate buffer SUMO – small ubiquitin-related modifier UV – ultraviolet v – volume

xvi


General Abstract Abiotic stresses such as cold, drought, and high-salt are major constrains to crop

productivity worldwide, and the mechanisms by which plants respond to stress

are still not fully understood. Our research addressed the processes by which

transcription factors (TFs) are involved in the regulation of the abiotic stress

response in rice (Oryza sativa L.). In addition, we have also isolated and studied

the transcriptional regulation of a rice gene encoding HOS1, an ubiquitin-

proteasome pathway protein, putatively involved in the cold stress response

regulation. To achieve our goal, we have used a transgenic approach with an

Agrobacterium-mediated protocol to either overexpress a barley TF (HvCBF4) or

to silence (through RNA interference, RNAi) the expression of OsHOS1. The

HvCBF4 overexpression was driven by either a constitutive (maize Ubi1) or an

abiotic stress-inducible promoter (Arabidopsis RD29A). The Ubi::HvCBF4 plants

showed increased tolerance to drought, but not to cold or high-salt stress, while

AtRD29A::HvCBF4 plants did not show tolerance to any of the studied stresses. A

differential gene expression profile was observed in the two transgenic rice lines

overexpressing the HvCBF4 under the control of the two different promoters. The

global transcriptome changes induced by the expression of the HvCBF4 were

also analyzed using a Rice Whole Genome Affymetrix GeneChip® microarray for

the AtRD29A::HvCBF4 plants grown under control conditions. Although these

plants did not show increased stress tolerance at the physiological level, they

showed an induction of many stress-responsive genes. The transgenic OsHOS1

silencing plants submitted to cold stress showed an increased expression of

stress-responsive genes (e.g. OsDREB1A and P5CS) without, however, showing

any increase in cold tolerance when compared to non-transformed plants. To

study the transcriptional regulation of OsHOS1, we have used a Yeast One-

Hybrid screening to isolate TFs that bind to the selected promoter. We have

isolated two AP2/ERF family TFs that could bind to the OsHOS1 promoter. One

of the TFs, which had never been reported before, showed a cold repressed

expression while the other TF had a constitutive expression under normal and

cold conditions. We may conclude from this PhD work that, the different

expression levels of HvCBF4 transgene, induced by the two promoters tested,

xvii

Tiago Lourenço

was responsible for different transcriptome profiles. Additionally, the Ubi::HvCBF4

showed improved tolerance to drought associated with increased photochemical

efficiency under stress. Despite the RD29A::HvCBF4 transgene modulates the

expression of many stress-responsive genes, the RD29A promoter seems to be

unsuitable for rice transformation when we aim to improve tolerance to abiotic

stress. Regarding the OsHOS1 gene, we conclude that it may have a function in

rice, similar to that observed in Arabidopsis, however, further analyses are

required to assess its function in the rice cold responsive pathway. The two

isolated AP2/ERF TFs must be further analyzed in order to understand their

function in the regulation of the OsHOS1 and abiotic stress response.

xviii


Resumo Geral O frio, a secura e a elevada salinidade, são alguns dos factores abióticos que

limitam severamente a produtividade agrícola a nível mundial. Os processos

utilizados pelas plantas para responderem a estes factores de stress não são

completamente conhecidos. O nosso trabalho teve como objectivo estudar os

mecanismos através dos quais os factores de transcrição (FTs) estão envolvidos

na regulação da resposta ao stress abiótico em arroz (Oryza sativa L.). Para

além disso, interessou-nos também isolar e estudar a regulação da expressão do

OsHOS1, um gene envolvido na via de ubiquitinação de proteínas e potencial

regulador da resposta ao frio. Para atingir os nossos objectivos, utilizámos uma

estratégia de transformação genética mediada por Agrobacterium, de modo a

sobre-expressar um FT de cevada (HvCBF4) ou a silenciar (via RNA de

interferência, RNAi) a expressão de OsHOS1. A sobre-expressão de HvCBF4 foi

feita sob o controlo de um promotor constitutivo (Ubi1 de milho) ou de um de

resposta a stress abiótico (RD29A de Arabidopsis). As plantas Ubi::HvCBF4

revelaram uma maior tolerância à secura, mas não ao frio nem à salinidade

elevada, enquanto que as plantas RD29A::HvCBF4 não se mostraram mais

tolerantes a qualquer um dos stresses estudados. As alterações na expressão

génica global resultante da introdução do FT foram analisadas recorrendo ao

chip Rice Whole Genome GeneChip® da Affymetrix usando para o efeito apenas

as plantas RD29A::HvCBF4 crescidas em condições controlo. Apesar destas

plantas terem revelado indução da expressão de muitos genes que respondem a

sinais de stress, os estudos fisiológicos não revelaram qualquer tolerância aos

stresses impostos. Entre as duas linhas transgénicas usando os diferentes

promotores observou-se uma expressão diferencial de genes resultante do

diferente nível de expressão do transgene. As plantas transgénicas com o gene

OsHOS1 silenciado quando submetidas a condições de frio, exibiram um

aumento da expressão de genes de resposta ao stress (ex. OsDREB1A e P5CS)

sem contudo apresentarem qualquer aumento de tolerância comparativamente

às plantas não-transformadas. Para estudar os mecanismos de regulação da

transcrição do OsHOS1, recorremos à técnica de Yeast One-Hybrid para

identificar FTs que pudessem interagir com o promotor do gene seleccionado.

xix

Tiago Lourenço

Neste ensaio foram isolados dois FTs da família dos AP2/ERF. Um dos FTs

isolado ainda não estava descrito e o seu gene revelou uma regulação negativa

da sua expressão pelo frio, enquanto que o outro FT é expresso

constitutivamente em condições controlo e de frio. Deste trabalho de

Doutoramento pode concluir-se que as variações nos níveis de expressão do

transgene HvCBF4, em resultado dos dois diferentes promotores, causaram

expressão diferencial de genes associados à resposta ao stress. As plantas com

o promotor Ubi1 em que existe expressão constitutiva do transgene HvCBF4,

exibiram uma maior tolerância à secura associada a uma capacidade

fotossintética mais elevada, em condições de stress. Apesar do transgene

RD29A::HvCBF4 alterar a expressão de vários genes de resposta ao stress, o

promotor RD29A não parece ser eficaz na transformação de arroz com o

objectivo de aumentar a tolerância ao stress abiótico. Quanto ao gene OsHOS1,

este aparenta ter, em arroz, uma função semelhante à observada em

Arabidopsis, contudo são necessárias mais análises para comprovar a sua

verdadeira função na regulação da resposta ao frio. Os dois FTs AP2/ERF

isolados terão de ser caracterizados de forma a podermos entender qual a sua

função na regulação da expressão do OsHOS1 e da resposta ao stress abiótico.

xx


Table of Contents

Acknowledgments…………………………………………….……………………….ix

List of Abbreviations…………………………………….…………………………...xv

General Abstract………………………………………….…………………………xvii

Resumo Geral…………………………………………………….…………………..xix

Chapter 1…………………………………………………………..……………………..1 General Introduction and Thesis Outline Chapter 2……….…….……….….……….……….……….…….….….….….………27 Overexpression of HvCBF4 in rice (Oryza sativa L.) causes differential gene expression and stress tolerance Chapter 3………………………………………………………….……………………61 Isolation and characterization of the rice (Oryza sativa L.) OsHOS1 gene Chapter 4….….………….….….….……….…………………….………….….……..81 Isolation and preliminary characterization of two ERF transcription factors binding to the OsHOS1 promoter Chapter 5….….……….………….……………………………………….…………..107 General Conclusions and Future Perspectives Appendix…….……….……………….……….………………………….…………..113 Protocols

xxi

Tiago Lourenço

xxii

Chapter 1 General Introduction and Thesis Outline Saibo, N.(1), Lourenço, T.(1) and Oliveira, M. M.(1,2) Transcription factors and regulation of photosynthetic and related metabolism under environmental stresses. Annals of Botany (submitted) (1) ITQB/IBET, Quinta do Marquês, 2784-505 Oeiras, Portugal (2) Dep. Biologia Vegetal, Fac. Ciências de Lisboa, 1749-016 Lisboa,

Tiago Lourenço

Chapter Index General Introduction……….…….….….….…….….…….….…….…..…….………3 Rice domestication…..….….….….…..…..…..….…..….…...…....……...….4 Rice in Portugal….….…...….….….….….….…..….….….….…...…..…..….6 Genetic transformation procedures…..….….…..….….….….….…....….….7 Agrobacterium-mediated gene transfer mechanism.…….…….…...….…..8 Agrobacterium as a tool for plant functional genomics and

biotechnology.….….…….…..….….….…..….….…..…….….….….….….…9 Genetic modified organisms and society…….…..….…..…….….…........11 How to protect plant crops in a changing environment….…...…...…..….12 Transcription factors (TFs) involved in abiotic stress responses…..........12 The CBF/DREB regulon…..…..…..…..….…….………..…………13 The NAC and ZF-HD regulon……….…..………………..….….....16 The AREB/ABF regulon….………………..….….……..……..……17 The MYC/MYB regulon..…..………….………..…………….……..18 Transcription factors with no relation to known regulons.…........19

Thesis Outline….….….…..….….….….….…….………..….….……….……….….21 References……….……….….…………….……………….……….…………….…..22

2


General Introduction

Rice is an annual plant belonging to the grasses family

(Poaceae/Gramineae). The Poaceae family is one of the largest plant families

with approx. 10000 species and also the largest by far in biomass and land cover.

This family includes several of the economically most important crops like rice

(Oryza sativa), maize (Zea mays), wheat (Triticum aestivum), barley (Hordeum

vulgare), oat (Avena sativa) and rye (Secale cereale).

Rice is the staple food of 2/3 of the world population and it is cultivated on

11% of the worlds’s land (Khush, 1997). Rice is commonly identified as the Oryza

sativa species although the genus Oryza has 21 wild relatives and two cultivated

species (Oryza sativa and Oryza glaberrima). Oryza sativa is distributed globally

but predominantly grown in Asia while Oryza glaberrima is grown to a limited

scale in West Africa. The members of this genus have n=12 chromosomes and

most of them are diploid (2n) although some are tetraploid. Interspecific breeding

is possible but it is difficult to recover fertile offspring (Vaughan et al., 2003).

Rice has been considered a model plant among cereals. It has a

relatively small genome (approx. 300Mb), a high degree of synteny with other

economically important crops, there are available protocols for genetic

transformation and several T-DNA tag mutants across the genome. Rice was the

first crop to have its genome fully sequenced (IRGSP, 2005).

The genus Oryza has probably originated 130 million years ago in the

Gondwanaland as a wild grass. The different species of the genus were

distributed by different continents (Asia, Africa, the Americas and Australia) after

the break of the super-continent (Khush, 1997). The two cultivated rice species

(O. sativa and O. glaberrima) evolved differentially from the common ancestor

wild grass due to different geographical localization after the break of the super-

continent of Gondwanaland. The domestication of O. sativa and O. glaberrima

occurred in Asia and Africa respectively. The O. sativa wild ancestors are thought

to be Oryza rufipogon (perennial plants) and Oryza nivara (annual plants). The

ancestors from where O. glaberrima was domesticated are thought to be O.

longistaminata (perennial plant) and O. barthii (formerly known as O. breviligulata)

3

Tiago Lourenço

(annual plant). Rice domestication is being extensively studied particularly in

Oryza sativa.

The Oryza sativa species has two major subspecies, indica and japonica.

These two subspecies have distinct phenotypic and ecological characteristics.

The indica ssp. has longer and thinner grains and japonica ssp. can be grown in

colder and drier environments and at higher altitudes and latitudes. The two

subspecies are also partially reproductively isolated by a post-zygotic barrier

(Sang and Ge, 2007a). In a recent study, Garris and colleagues (Garris et al.,

2005) used a sample of 234 rice accessions which were genotyped with 169

nuclear SSRs and two chloroplast sequences. Five distinct groups were identified

corresponding to the major indica (indica and aus) and japonica (tropical japonica,

formerly known as javanica; temperate japonica and aromatic) subspecies. The

analysis revealed a higher genetic proximity between the indica and the aus

subgroup, and between the tropical japonica, temperate japonica and aromatic.

The indica subgroup had a higher genetic diversity than the japonica subgroup

revealing a larger founding population and a less severe selection procedure in

the first, or eventually a more significant crossing with wild rice species. This

study also showed that temperate japonica rice is probably derived from tropical

japonica.

Rice domestication The domestication of rice (Oryza sativa) is thought to have started 10000

years ago in the foothills of the Himalayas and Southern China. The early farmers

looked for beneficial traits like reduced shattering plants to maximize the number

of seeds that could be harvested, reduced seed dormancy, synchronization of

seed maturation, reduction of tiller number, increase of panicle length and

branches, and reduction in grain coloration (Sweeney and McCouch, 2007; Sang

and Ge, 2007a).

The oldest archaeological evidence of rice use by humans dates from

11000-12000 BC in China, however it is still under debate if these findings

correspond to domesticated rice or not (Sweeney and McCouch, 2007).

Nevertheless, it seems clear that rice grains retrieved from sites in China from

4


around 4000 BC had phenotypic characteristics similar to mature modern O.

sativa rice grains and thus corresponding to domesticated rice.

The diversification of the two O. sativa subspecies indica and japonica is

still immersed in several doubts. However, recent molecular studies support the

hypothesis that indica and japonica were domesticated independently (Rakshit et

al., 2007). The divergence must have occurred long before rice domestication

events from wild populations that were already divergent at the time of

domestication.

Several traits have been identified as essential for rice domestication like

the QTLs (quantitative trait loci) sh4 and qSH1 which are related to reduced grain

shattering. Reduced grain shattering was a fundamental condition for effective

field harvest and thus domestication. The sh4 carries a functional mutation

caused by single nucleotide substitution that results in an amino acid substitution

from leucine to asparagine in a predicted MYB3-DNA binding region (Li et al.,

2006). The sh4 gene is thought to code for a transcription factor due to the

nuclear localization of the protein. The mutation may cause alterations in the DNA

binding activity of this transcription factor. The mutation caused deficient

development of the tissue located between the pedicle and the grain, the

abscission zone. The incomplete development of this tissue leads to reduced

shattering of the grain which was a trait selected in the past for facilitating manual

harvest. Curiously, all the five different rice subgroups previously identified had

the sh4 mutation (Li et al., 2006; Lin et al., 2007). This could mean that this

mutation occurred prior to the divergence of indica and japonica.

Indica varieties have higher grain shattering than japonica and in

temperate japonicas another QTL, qSH1, was found to also regulate grain

shattering. A single nucleotide polymorphism (SNP) upstream of a gene

homologous to the Arabidopsis replumless (RPL) (Konishi et al., 2006), present in

this QTL, is responsible for its silencing. This effect prevents the development of

the abscission zone and thus reduces grain shattering in the temperate japonicas.

This SNP mutation is therefore a cis-regulatory mutation different from the sh4

one (a trans-regulatory mutation) (Konishi et al., 2006).

The presence of sh4 in all cultivars also brings to light the hypothesis that

cultivated rice could have originated only once, which contradicts the phylogenetic

5

Tiago Lourenço

evidence of independent domestication of indica and japonica (Rakshit et al.,

2007). Two new hypothesis for rice domestication were raised in a recent paper

by Sang and Ge (2007b). One hypothesis suggests that an early cultivar, already

carrying several fundamental domestication traits, was dispersed through several

geographical locations where it crossed with local wild populations of O. nivara

and O. rufipogon. The indica and japonica cultivars would have originated from

those crosses in different geographical localizations. The other hypothesis

suggested (Sang and Ge, 2007b) is the existence of different semi-domesticated

populations with enough domestication traits, enabling early farmers to select the

different traits combined in naturally occurring crosses. The artificial selection

process of the early farmers was very strong and rapidly fixed the sh4 mutation in

all the cultivars.

Rice in Portugal The first time rice grains arrived to Europe was through the returning

members of Alexander the Great campaign in India in 324 BC. However, the

culture was only established in the European continent around the XVth-XVIth

century (Khush, 1997).

Rice in Portugal was probably introduced by the Moors in the Xth century

during their occupation (Jayamani et al., 2007). Rice is an important culture in

Portuguese history and traditional gastronomy. The Portuguese are related to the

spread of rice all over the world during the Discoveries period. For instance,

Portuguese priests were responsible for the introduction of tropical japonicas in

Guinea-Bissau from where they spread to other African countries. Portuguese

derived words for rice can still be found in local vocabulary, although O.

glaberrima was already established in the region with own words (Sweeney and

McCouch, 2007). The Portuguese were also responsible for the introduction of

rice in Brazil (Khush, 1997).

Today, rice occupies a very important place in the Portuguese

gastronomy. Portuguese are by far the largest European rice consumers with

17.8 kg/capita/year while Spain, the second largest consumer, has only 7.1

kg/capita/year consumption. Nevertheless, Portugal only produces approximately

60% of the internal needs.

6


Rice in Portugal is cultivated mainly in the riverbeds of Sado, Tejo and

Mondego (South to North, respectively). The rice cultivated in Portugal is mainly

japonica, representing nearly 80% of the total rice growing area, while the

remaining is indica-type rice with japonica genetic background (Jayamani et al.,

2007). Recently, Portuguese rice varieties (japonica ssp.) are being recovered in

breeding programs supported by biotechnology tools (Marker Assisted Selection,

MAS) aiming to improve yield and introgress blast resistance (resistance to the

fungus Magnaporthe oryzae) while maintaining the grain quality (Jayamani et al.,

2007; Negrão et al., unpublished results). Besides blast sensitivity, rice production

in Portugal is also limited due to abiotic stresses: high salt irrigation water in Sado

River and low temperatures in Mondego.

Besides conventional breeding strategies and marker assisted selection,

genetic improvement of rice can also be achieved by genetic engineering.

Protocols for efficient genetic transformation are also crucial to study gene

function either by overexpression or gene silencing (RNA interference, RNAi).

However, like the other cereals, rice is not a natural host of Agrobacterium, and

for several years, attempts to transform rice using this biological vector were a

complete failure and various alternative protocols were thus developed. General

aspects of plant genetic transformation stratagies are discussed below.

Genetic transformation procedures Transformation methods employing Agrobacterium-mediated gene

transfer have been well established for a number of dicots (Lloyd et al., 1986;

Clough and Bent, 1998) but, until a few years ago, monocots have been difficult

to transform. Cereals like rice, maize, wheat and other economically important

crops are not natural hosts of Agrobacterium which complicated the development

of efficient transformation protocols. In alternative, other techniques were

developed to overcome this limitation such as direct gene transfer protocols

(electroporation or polyethyleneglycol for protoplast permeabilization, intact cell

electroporation, and particle bombardment) (de la Riva et al., 1998).

The improvement of tissue culture techniques and the use of modified

and more virulent Agrobacterium strains started to make possible the

transformation of naturally non-host plants. Claims of genetic transformation of

7

Tiago Lourenço

monocots (rice and maize) using Agrobacterium-mediated protocols (Raineri et

al., 1990; Gould et al., 1991) were criticised (Potrykus, 1990) by lack of strong

evidence of stable genetic transformation and possible silent infection of

regenerated plants with the bacteria. However, few years later, the first reports of

stable genetic transformation of monocots were published, first with the clear

analysis of T-DNA integration in the rice genome (Chan et al., 1993; Hiei et al.,

1994) and a few years later with identical confirmation in maize and wheat (Ishida

et al., 1996; Cheng et al., 1997).

Agrobacterium-mediated gene transfer mechanism Agrobacterium is a natural occurring soil bacterium that infects wound

sites of dicots, causing the crown gall tumour-like disease (Smith and Townsend,

1907). This soil bacterium has the ability to transfer part of its plasmid DNA,

known as T-DNA (transferred DNA), to the genome of the host plant. The T-DNA

is a very well defined portion of DNA, flanked by two sequences of 25 bp

imperfect, direct repeats, known as right and left borders. In Agrobacterium

tumefaciens, the T-DNA carries an opine-catabolism gene and several

oncogenes that are responsible for the tumour-like growth in the host plants. The

Agrobacterium captures the host-plant machinery to produce opines (compounds

derived from amino acids and sugar-cetoacids) that are the bacteria main source

of carbon and nitrogen (Tzfira and Citovsky, 2006). To achieve this, the bacteria

first colonize the plant wound for which it is attracted because of the phenolic

compounds produced. Closer to the wound site there is the induction of the

bacterial virulence, generation of the T-DNA complex, T-DNA transfer and finally

integration in the plant genome (de la Riva et al., 1998). To transfer the T-DNA,

the bacteria uses own factors but also “requests” plant factors to help in the

transfer and integration of the T-DNA (Tzfira and Citovsky, 2002). The vir genes

located in the Agrobacterium Ti-plasmid, and the bacterial chromosomal genes

(chv) are responsible for encoding most of the bacterial virulence proteins that

help in the transfer of the single-stranded (ss) T-DNA molecule. Once inside the

plant cell cytoplasm, the T-DNA travels protected by bacterial molecules (VirE2),

it is imported to the plant cell nucleus where it is integrated in the plant genome

(Tzfira and Citovsky, 2006). Along the path inside the plant cell, the T-DNA

8


coated with bacterial molecules is too large to reach the plant nucleus by

diffusion. Recent studies (Salman et al., 2005) have suggested that the transfer

mechanism of the T-DNA inside the plant cell cytoplasm, is helped by the plant

cytoskeleton through an yet to identify dynein-like plant motor. The nuclear import

also seems to be an active process. The bacterial molecules that coat the T-DNA

are essential in this proces (Tzfira et al., 2002) because they interact with host

proteins, recruiting the plant nuclear import machinery for translocation of the T-

DNA complex. Inside the nucleus, how T-DNA integration occurs is still a question

in debate, but is seems clear that it is a process that relies exclusively on host

factors, especially because none of the bacterial factors has a DNA-repair

mechanism (essential for integration of ssT-DNA in the plant genome).

Nevertheless, the T-DNA complex needs to be directed to the site of integration

and stripped of its coating proteins (probably using the proteasome complex)

(Tzfira et al., 2004). Some host factors such as the CAK2M (plant ortholog of

cyclin-dependent kinase-activating kinases), the TBT (TATA-box binding protein)

and H2A histone have been already proposed as important for T-DNA integration

in plant cells (Mysore et al., 2000; Friesner and Britt, 2003) along with the double-

strand breaks (DSBs) in the DNA chain (Chilton and Que, 2003). Although, the

exact molecular integration mechanism is still unknown, the important is that the

plant cell DNA-repair mechanisms assume the ssT-DNA as a broken molecule to

incorporate in the genome.

Agrobacterium as a tool for plant functional genomics and biotechnology The Agrobacterium ability to transfer DNA portions to plant genomes was

found useful to transfer genes of interest. To meet this goal, native T-DNA was

disarmed of the opine-catabolism and of the oncogenes, and in their place genes

of interest have been inserted (co-integrative vectors) or small independent

plasmids were cloned in the bacteria (binary vectors). The Agrobacterium-

mediated transformation system has several advantages over other direct gene

transfer methods and, when it works, it is preferentially used instead of direct

gene transfer mechanisms. In general, in the Agrobacterium-mediated gene

transfer system the transgene copy-number is reduced and transgene co-

suppression is potentially lower.

9

Tiago Lourenço

Agrobacterium has thus been used as a genetic engineering tool to

transform dicots, the natural hosts to the Agrobacterium genus. Genetic

improvements in the Ti-helper plasmids, new and more virulent Agrobacterium

strains and isolates, more efficient binary vectors and improved tissue culture

strategies, have expanded the Agrobacterium capacity to transform non-host

plants like monocots and more recently even other non-plant hosts like yeast,

mushrooms, and even human cells (Lacroix et al., 2006). This unique capacity of

the Agrobacterium to transfer a portion of DNA of interest has been exploited by

scientists worldwide to study gene function either overexpressing or silencing a

target gene, to generate T-DNA insertion mutants (Jeon et al., 2000; Jeong et al.,

2002), and also to generate plants with improved nutritional value (Parkhi et al.,

2005) and increased biotic and abiotic tolerance (Cao et al., 2005; Ito et al.,

2006). Nevertheless, and to overcome patents and intellectual property rights,

bacteria other than from the Agrobacterium genus are being tested to deliver

foreign genes to plants (Broothaerts et al., 2005).

Still, and despite the advances in Agrobacterium-mediated gene transfer,

there are recalcitrant species to Agrobacterium infection. The transient expression

(achieved by particle bombardment) of plant-host factors, such as the histone

H2A or the VIP1 protein, were found to increase susceptibility to Agrobacterium

infection leading to higher transformation rates (Mysore et al., 2000; Tzfira et al.,

2002).

Another important line of research is to improve the rate of homologous

recombination (HR) in the Agrobacterium-mediated transformation for gene

targeting in plants. In mouse, gene targeting by HR has been a common practice

for the last years (Evans et al., 2001). The T-DNA integration in the plant-host

genome is thought to occur preferentially in DSBs and repaired by non-

homologous end-joining (NHEJ) other than HR which occurs at very low rates.

The expression of key proteins of the HR and NHEJ pathway have stimulated T-

DNA integration through HR (Gherbi et al., 2001; van Attikum et al., 2001; Shaked

et al., 2005). However, the improvement of HR in plants with yeast factors

(Shaked et al., 2005) may cause some alterations in the plant phenotype and thus

may affect the functional characterization of certain endogenous genes (Terada et

al., 2007). In a recent paper, Terada and co-workers (2007) suggested a strong

10


positive-negative selection instead of modified rice cultivars in order to retrieve

true gene targeting through HR. In their work, the authors claimed gene targeting

by HR with a frequency of 2% per surviving callus. Nevertheless, there may be

still a long way until this technique becomes effective and common for gene

functional analysis in plants.

Genetic modified organisms and society Probably Smith and Townsend (1907) could not imagine how the soil

bacterium they identified (Agrobacterium) would influence plant functional

genomics and biotechnology in the years after. Genetic modified organisms

(GMO) are of extreme usefulness, not only in plant functional genomics but also

for cultivar improvement either to cope with environmental stress factors or to

improve nutritional characteristics. However, genetically modified plants have

raised public concerns in such a way that no other GMO has risen. Passionate

debates over the benefits/hazards of plant GMO were/are held a little all over the

world and several GMO experimental and agricultural fields have been destroyed

by the so-called “environmental groups” for publicity. Nevertheless, a fast growing

population is raising food problems especially in growing economies and third-

world countries. The use of cereals and other food crops for the production of

biofuel has strongly increased the prices of several grain crops. The

consequences for poor populations in third-world countries are devastating and,

for instance in Haiti, public riots have occurred due to high-priced rice, causing

the government to resign.

New and higher yielding crop cultivars are needed to cope with the

increasing population and the increasing demand for biofuel (McLaren, 2005).

Plant biotechnology is a way to improve plant crops but not the answer for all

problems. Nevertheless, this technology should not be discarded due to public

concerns unless strong scientific evidences of hazards to human health are

demonstrated. Recently, a transcriptomic study comparing gene expression using

a high-throughput technique (GeneChip, Affymetrix), in stable and unstable lines

of transgenic and γ-irradiated mutant rice plants (Batista et al., 2008), has shown

that transgenesis may induce less gene expression changes in the host plant

than mutagenesis. However, γ-irradiated mutant plants have been used for

11

Tiago Lourenço

human consumption for several years without any concerns regarding food

security.

How to protect plant crops in a changing environment To increase plant protection in a changing environment improved new

cultivars should have increased abiotic and biotic stress tolerance/resistance.

Understanding the mechanisms that underlie the stress tolerance responses will

help in the development of new stress-tolerant cultivars, useful in a changing

world environment, in which temperature changes and insufficient water are some

of the most certain constrains we will have to face.

These environmental adverse conditions that plants face involve

alterations in protein turnover and gene expression. The latter is mediated by

transcription factors (TFs), which in turn are regulated by abiotic stress signals

such as ABA, the redox state, and possibly the ATP/NADPH content. TFs play an

important role in abiotic stress acclimation modulating the expression of stress-

responsive genes. It is known that most plants share some homologue genes

involved in abiotic stress responses, although different plants show different

levels of stress tolerance. These phenotypes are mostly explained by differences

in stress-responsive gene expression regulated by TFs.

Transcription factors (TFs) involved in abiotic stress responses Responses to abiotic stress involve the production of important metabolic

proteins such as those involved in the synthesis of osmoprotectants and of

regulatory proteins operating in the signal transduction pathway such as kinases

or TFs. Given that most of these responses imply control of gene expression, TFs

play a critical role in the abiotic stress response. TFs can control the expression

of many genes by binding to the cis-acting element present in the promoter of the

target gene. A group of genes controlled by a certain type of TF is known as

regulon. In the plant response to abiotic stresses, at least four different regulons

can be identified (Fig. 1): (1) the CBF/DREB regulon, (2) the NAC (NAM, ATAF

and CUC) and ZF-HD (zinc-finger homeodomain) regulon, (3) the AREB/ABF

(ABA-responsive element binding protein / ABA binding factor) regulon, and (4)

the MYC (myelocytomatosis oncogene) / MYB (myeloblastosis oncogene)

12


regulon. The first two regulons are ABA–independent, and the last two are ABA-

dependent. We explain below how these regulons are controlled and how TFs

may be involved in the regulation of photosynthesis as an abiotic stress response.

SIZ1SIZ1

Drought, High salinityBiotic stress

and wounding

Cold

ICE1ICE1

ICE1ICE1

??

??

ZAT12ZAT12

DRE/CRTDRE/CRTSTZ/ZAT10STZ/ZAT10

??

?? ??

SignalSignal perceptionperception

ABAABA ABAABA--independentindependent

DREB2DREB2

DREB2DREB2

ZFZF--HDHDNACNAC

NACRNACRrpsrps--1like1like

ERD1ERD1 RD29ARD29A

AREB/ABFAREB/ABFMYBMYBMYCMYC

AREB/ABFAREB/ABF

ABREABRE

RD29BRD29BMYBRMYBRMYCRMYCR

RD22RD22

JasmonicJasmonicacidacid

CBF4/DREB1dCBF4/DREB1d

CBF3/DREB1ACBF3/DREB1A CBF1/DREB1BCBF1/DREB1B

CBF2/DREB1CCBF2/DREB1C

HOS1HOS1

Figure 1. Transcriptional network of abiotic stress responses. Transcription factors are shown in ovals. Transcription factors modifying enzymes are shown in circles. The small triangles correspond to post-translational modifications. Blue squares with question marks represent putative MYC ICE1-like transcription factors that may activate the CBF1-2/DREB1b-c. The green boxes represent the cis-elements present in stress-responsive genes. The green boxes with question marks represent putative cis-elements on the promoter of stress-responsive genes. The small circle corresponds to the sumoylation modification by SIZ1 of the ICE1 transcription factor. The dashed block line from SIZ1 to HOS1 represents competition for binding places on the ICE1 transcription factor. SIZ1 blocks the access of HOS1 to the ubiquitination sites on the ICE1. We also represented the CBF4/DREB1d transcription factor. The CBF4/DREB1d (Knight et al., 2004) is a DRE cis-element binding factor but ABA-dependent. The CBF/DREB regulon

This regulon is mainly involved in cold stress response and is probably

the one that has drawn more attention from scientists worldwide. This regulon is

conserved throughout the plant kingdom, including in plants that do not cold

acclimate (e.g. tomato, rice) (Dubouzet et al., 2003). In 1994, (Yamaguchi-

Shinozaki and Shinozaki, 1994) identified in the promoter of the RESPONSIVE

TO DEHYDRATION 29A (RD29A), a gene which is induced by drought-, high-

salinity, and cold, two major cis-acting elements (conserved DNA sequences

where the TFs bind). One of the cis-acting elements was the ABA-responsive

13

Tiago Lourenço

element (ABRE) and the other was the C-repeat/dehydration-responsive element

(CRT/DRE) which is ABA-independent. The core motif of this cis-acting element

is CCGAC and the TFs that bind to it were named CRT binding factor or DRE

binding protein 1 (CBF/DREB1) (Gilmour et al., 1998; Liu et al., 1998).

CBF/DREB1 gene expression is quickly and transiently induced by cold stress,

and in turn CBF/DREB1 TFs activate the expression of several other genes (e.g.

genes encoding osmoprotectants and antioxidants). On the other hand, DREB2

genes are constitutively expressed (not induced by stress) but their target genes

are only induced upon dehydration. This indicates that DREB2 factors are

activated through post-translational modifications in order to regulate downstream

genes (Sakuma et al., 2006).

The overexpression of CBF/DREB1 genes in Arabidopsis resulted in

plants with improved tolerance to abiotic stress (Jaglo-Ottosen et al., 1998;

Kasuga et al., 1999). These transgenic plants showed higher survival rates when

exposed to salt, drought, and low temperatures. This improved tolerance was

correlated with altered levels of transcripts encoding proteins associated with

stress adaptation, such as key enzymes in the soluble sugars biosynthesis. When

CBF/DREB1s from Arabidopsis were overexpressed in other plants, the result

was similar to that previously observed in Arabidopsis (Hsieh et al., 2002;

Pellegrineschi et al., 2004) revealing a conserved signalling and response

mechanism even between dicots and monocots. Various studies have

demonstrated that improved stress tolerance by overexpression of CBF/DREB1

genes is associated with increased photochemical efficiency and photosynthetic

capacity (Hsieh et al., 2002; Savitch et al., 2005; Oh et al., 2007). These plants

normally show a dwarf phenotype that can be reverted through the exogenous

application of gibberellins (GAs). However, the microarray expression analysis of

these plants did not reveal any gene encoding GA enzymes affected by the

overexpression of the CBF/DREB1 (Fowler and Thomashow, 2002). Instead, this

study revealed that most genes related to carbohydrates metabolism and

photosynthesis were repressed and thus contributed to reduced growth.

STZ/ZAT10, a TF that acts downstream of CBF3/DREB1A (Fig. 1), has been

implicated in the repression of genes with a DNL box/EAR-like cis-element in their

promoter region (Nakashima and Yamaguchi-Shinozaki, 2006). This means that

14


STZ factor may be involved in growth retardation through repression of

photosynthesis and carbohydrate metabolism genes observed in both the wild

type plants under abiotic stress and plants overexpressing CBF/DREB1 genes

(e.g. CBF3/DREB1A). It would be interesting to analyse all the promoters of the

photosynthesis and carbohydrate metabolism related genes and search for DNL

box/EAR-like cis-elements. To bypass the growth retardation effect, CBF/DREB1

genes have been expressed in transgenic plants under the control of a stress-

inducible promoter, namely the RD29A promoter (Kasuga et al., 2004). These

plants have also shown an enhanced abiotic stress tolerance without totally

compromising the yield (Pino et al., 2007). However, it seems that the use of the

Arabidopsis RD29A promoter is more efficient in driving the expression of

CBF/DREB1 genes in dicots rather than in monocots, or at least in rice ((Ito et al.,

2006); Lourenço et al., unpublished results).

The control of this regulon is not as simple as one might expect (Fig. 1).

The Arabidopsis mutant cbf2/dreb1c has revealed that CBF2/DREB1C is a

negative regulator of CBF1/DREB1B and CBF3/DREB1A gene expression

(Novillo et al., 2004). However, CBF2/DREB1C shares several target genes with

the ZAT12 (Vogel et al., 2005), a TF that can be in a parallel regulon to the

CBFs/DREBs. ZAT12 overexpressing plants had a small but consistent increase

in freezing tolerance and the induction of the CBFs/DREBs genes in response to

cold is reduced. This indicates that ZAT12 also plays a role in the negative

regulatory circuit that leads to decline in expression of CBF/DREB. The

CBF/DREB1 regulon is controlled upstream by the INDUCER OF CBF

EXPRESSION 1 (ICE1) protein (Chinnusamy et al., 2003). The ICE1 protein is a

MYC-type bHLH (basic helix-loop-helix) TF that regulates the expression of the

CBF3/DREB1A. The ICE1 protein is present at normal growth temperatures but

its activation requires cold-induced post-translational modification(s) (e.g.

phosphorylation). In addition, the ICE1 protein is negatively regulated by the

HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES 1 (HOS1)

protein. HOS1 is a RING E3 ligase that targets the ICE1 protein for ubiquitination

and subsequent degradation (Dong et al., 2006). Under normal conditions, HOS1

is a cytoplasmatic protein, but upon low temperature, HOS1 is translocated to the

nucleus where it will target ICE1 for degradation. Recently, it was found that ICE1

15

Tiago Lourenço

ubiquitination can be blocked by SIZ1-dependent sumoylation (Miura et al., 2007

a), a process that conjugates SUMO (for small ubiquitin-related modifier) to a

protein substrate (Miura et al., 2007 b). SIZ1 is a SUMO E3 ligase that mediates

ICE1 sumoylation (binds SUMO to a target protein). This modification activates

and/or stabilizes ICE1 protein, thus facilitating its activity controlling the

expression of CBF3/DREB1A gene. The mechanism by which ICE1 protein is

activated by sumoylation through SIZ1 is still not fully understood. Another TF

with a regulatory function in this process is MYB15 (Agarwal et al., 2006). The

MYB15 is a negative regulator of the CBF/DREB1 genes possibly through

interaction with their promoter region. This TF seems to be negatively regulated

by a sumoylated ICE1 form, as a modification affecting the sumoylation site of

ICE1 leads to an increased MYB15 transcript level and reduced CBF3/DREB1A

expression. The cold response through the CBF/DREB1 regulon is thus a strictly

regulated mechanism that may have evolved to avoid unwanted negative effects

in plants. In fact, CBF/DREB1 uncontrolled expression in certain environments

may lead to dwarf phenotypes and reduced yields.

The NAC and ZF-HD regulon An ABA-independent pathway was unveiled when it was observed that

EARLY RESPONSIVE TO DEHYDRATION STRESS 1 (ERD1) gene transcripts

accumulated before the accumulation of ABA in response to dehydration and high

salinity, suggesting the presence of an ABA-independent pathway (Nakashima et

al., 1997). Promoter analysis of ERD1 revealed TFs belonging to the NAC family

and zinc finger homeodomain (ZF-HD) as essential to the activation of the ERD1

gene (Tran et al., 2007). However, overexpression of NAC genes in Arabidopsis

enhanced drought tolerance without activation of the ERD1 gene, suggesting that

other interacting factors may be necessary to control the expression of ERD1

under stress conditions (Tran et al., 2004). Recently, a STRESS-RESPONSIVE

NAC1 (SNAC1) was cloned from an upland rice variety and overexpressed in a

low land rice (cv. Nipponbare) (Hu et al., 2006). Expression studies revealed that

under drought stress, SNAC1 is predominantly expressed in the guard cells.

When compared to NT, rice plants overexpressing SNAC1 showed drought

tolerance at anthesis and increased drought and salt tolerance at the vegetative

16


stage. The plants overexpressing SNAC1 did not show the common, unwanted,

dwarf phenotype of those overexpressing CBF/DREB1 (Ito et al., 2006), revealing

a different stress response mechanism. The increased drought tolerance may be

in part due to the reduced transpiration rate (increased stomatal closure) and to

an increased ABA sensitivity. Interestingly, the photosynthesis rate was not

significantly affected by the overexpression of the SNAC1 gene. Authors claim

that usually rice leaves may function with more open stomata than necessary to

have a normal photosynthetic rate. The strong induction of SNAC1 by drought in

guard cells suggests an effect in stomatal closure (Hu et al., 2006). AtMYB60 and

AtMYB61 are two R2R3-MYB TFs already known to be involved in stomatal

dynamics in Arabidopsis (Cominelli et al., 2005; Liang et al., 2005). In addition,

the overexpression of SNAC1 up-regulates a rice R2R3-MYB gene (UGS5) with a

NAC recognition site in its promoter region (Hu et al., 2006). However, the

relationship between SNAC1 and the TFs implicated in stomatal closure is not

known. This connection needs to be further investigated to understand the

regulatory mechanisms underlying stomatal movement under drought stress.

SNAC1 also induced the expression of genes encoding proteins related to both

osmotic adjustment (such sorbitol transporter and exoglucanase) and stability of

cell membranes, which can be related to the stress response.

The AREB/ABF regulon The overexpression of key enzymes in ABA biosynthesis (e.g. 9-cis-

epoxycarotenoid dioxygenase; NCED) or mutation in ABA degrading enzymes

(e.g. cytochrome P450 CYP707A family member) resulted in transgenic plants

with enhanced drought tolerance (Shinozaki and Yamaguchi-Shinozaki, 2007).

The ABA responsive element (ABRE) motif is a cis-acting element present in the

ABA-responsive genes. The ABRE-binding factors (ABF) or ABRE-binding

proteins (AREB) are bZIP (basic leucine zipper) TFs that bind to the ABRE motif

and activate the ABA-dependent gene expression (Choi et al., 2000). Some of

these TFs, such as AREB1 and AREB2, require a post-translational modification

for their maximum activation (Uno et al., 2000). This post-translational

modification is probably an ABA-dependent phosphorylation. A family of protein

kinases, the Snf1-related kinases family, has been implicated in the ABA-signal

17

Tiago Lourenço

transduction pathway. Members of this family (SnRK2) play an important role in

controlling stomatal closure and are activated by drought, salinity and ABA

(Mustilli et al., 2002; Yoshida et al., 2002). The overexpression of SRK2C caused

hypersensivity to ABA and improved drought tolerance with reduced transpiration

rate (Umezawa et al., 2004). These data suggest that SnRK2s protein kinases

activate TFs influencing osmotic stress-responsive genes. Recently Baena and

co-workers (Baena-Gonzalez et al., 2007), have implicated other members

(KIN10 and KIN11 from the SnRK1 group) of the Snf1-related protein kinases

family with a pivotal role in the sensing of sugar and energy depletion due to

photosynthesis inhibition in response to diverse stresses and conditions, such as

hypoxia, herbicide and darkness. Promoter analysis of DARK INDUCED 6 (DIN6),

a KIN10-activated gene, revealed that the G-box (CACGTG) is essential to the

DIN6 activation by KIN10. The authors screened for bZIP TFs that bind to the G-

box cis-element in Arabidopsis and found that the co-expression of the KIN10 and

the G-BOX BINDING FACTOR 5 (GBF5) had a synergistic effect on the DIN6

expression. These results indicate that this family of Snf1-related protein kinases

may play an important role controlling the activation of stress-related TFs.

The MYC/MYB regulon The expression of the drought inducible gene RESPONSIVE TO

DEHYDRATION 22 (RD22) from Arabidopsis was found to be induced by ABA

(Abe et al., 2003). The promoter region of RD22 contains MYC (CANNTG) and

MYB (C/TAACNA/G) cis-element recognition sites. MYC and MYB TFs only

accumulate after accumulation of ABA. In Arabidopsis, it was found that for

activation of the RD22 gene expression both AtMYC and AtMYB have to work

cooperatively. Overexpression of these TFs resulted in enhanced sensitivity to

ABA and drought tolerance. Microarray studies in transgenic plants

overexpressing these TFs revealed that not only ABA-related stress genes were

differentially regulated, but also jasmonic acid-related genes (Fig. 1), thus

indicating a crosstalk pathway between abiotic and biotic stress responses (Abe

et al., 2003).

18


Transcription factors with no relation to known regulons

Although many of the TFs identified are involved in the described

regulons, some TFs are involved in other response mechanisms. In recent years,

two new genes, HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES

9 and 10 (HOS9 and HOS10), have been associated to cold stress response (Zhu

et al., 2004; Zhu et al., 2005). HOS9 is a homeodomain TF with similarity to the

Arabidopsis proteins WUSCHEL (WUS) and PRESSED FLOWER (PRS), and

HOS10 is a R2R3-type MYB protein (Van Buskirk and Thomashow, 2006). Both

mutants hos9 and hos10 show freezing hyper-sensitivity, but interestingly, also

have enhanced expression of RD29A gene and other cold-responsive genes

without changes in the CBF/DREB1 regulon. We could expect that HOS9 and

HOS10 act as negative regulators of cold-stress responsive genes, but the

increased Arabidopsis sensitivity to cold ruled out this hypothesis. The absence of

the respective transcripts in the mutants probably resulted in expression of cold-

responsive genes in order to cope with the increased cold sensitivity. The hos10

mutant has reduced NCED transcript levels and consequently plants do not

accumulate ABA, revealing a critical role of this TF regarding different abiotic

stresses. Nevertheless, additional studies have to be performed in order to clarify

the function of these TFs in the abiotic stress response.

HARDY (HRD) is an AP2-ERF type TF isolated from Arabidopsis. The

HRD gene is expressed mainly in the inflorescence tissue, most probably to

protect this tissue from desiccation in a very important and sensitive stage of the

plant life cycle. Rice plants overexpressing HRD showed drought tolerance and

improved water use efficiency (WUE) (Karaba et al., 2007). Interestingly, when

grown under normal greenhouse conditions, they do not show reduced growth,

seed yield and germination rate, instead they show an increased leaf canopy with

more tillers. The transgenic plants also had higher root biomass under drought

stress, being considered a drought adaptation to collect the scarce water in the

soil. Whether higher root biomass is associated with a faster water uptake or with

a larger volume exploited is not known. These HRD-lines showed a reduced

transpiration rate (due to lower stomatal conductance) and higher than NT net

carbon assimilation rate under drought and well irrigated conditions

corresponding to an increased WUE. No difference was observed for the

19

Tiago Lourenço

maximum quantum efficiency of PSII (Fv/Fm) between NT and transgenic plants;

however, the efficiency of the PSII reaction centre (Fv’/Fm’) was higher in the

HRD-overexpressing than in the NT plants. This higher efficiency of PSII is in

agreement with the improved photosynthetic capacity observed in the transgenic

plants. The increased number of bundle sheath cells in the transgenic plants can

support the improved photosynthetic assimilation. HRD belongs to the AP2-ERF

IIIb group while the related CBF/DREB genes belong to the AP2-ERF IIIc

(Nakano et al., 2006). Microarray analysis revealed that HRD-overexpressing

plants induce the expression of genes repressed by drought stress, suggesting a

protective influence on essential processes, such as protein biosynthesis and

carbohydrate metabolism. Despite some similarities, these transgenic plants

induce different genes when compared to the CBF/DREB1 overexpressing plants

which may account for the differences observed (absence of stunted growth) and

the unique responses to stress of these plants.

20


Thesis Outline

With this thesis, we aimed to understand several aspects of the abiotic

stress (such as cold, drought or high salt) response mechanism in rice (Oryza

sativa L.), by focusing on the regulation of the CBF/DREB1 regulon.

With a fast growing world population, especially in developing countries,

arable land is becoming scarce. Poor and marginal lands are being used for

agriculture, with lower crop productivity and leading to the permanent loss of

those soils. In a changing environment, crops with better abiotic stress tolerance

will be needed to maintain high levels of production to feed the population.

Research is needed to understand how plants respond to abiotic stress and how

this mechanism is regulated so that more tolerant crops with lower yield losses

due to stress can be obtained.

As main approach, in our work, we studied the overexpression of a barley

(Hordeum vulgare L.) transcription factor (HvCBF4) through transgenesis in rice.

The rice cultivar used for genetic transformation was ‘Nipponbare’, a typical

temperate japonica extensively used in transformation protocols and already

sequenced.

We used a barley transcription factor because barley is able to cold

acclimate and tolerate lower temperatures as compared to rice. In initial

experiments the variety Taipei 309 was used, with a direct gene transfer

approach (particle bombardment) to deliver the HvCBF4 to rice. However, this

strategy was unsuccessful since no transgenic plant could be retrieved.

Agrobacterium-mediated protocols were then used with ‘Nipponbare’, to deliver

the HvCBF4 gene to rice. In order to understand the function of this TF, we

analyzed the transgenic plants at both the molecular and the physiological levels.

Besides the characterization of transgenic plants overexpressing a

transcription factor from the CBF/DREB1 regulon, another goal of our research

was to understand how this regulon is controlled in rice. Integrating on-going

studies in the group, regarding how ICE1 transcription factor can control the

CBF/DREB1 genes expression in rice, we thought that it could also be of interest

to analyze if rice also has an ubiquitin-mediated regulation of the ICE1 protein

through the HOS1. So, we decided to isolate the rice orthologue of the

21

Tiago Lourenço

Arabidopsis HOS1 gene and to analyze its function. Transgenic plants were

generated to silence the OsHOS1 gene expression through RNA interference

(RNAi) and these plants were analyzed at molecular level and compared to non-

transformed plants. The regulation of OsHOS1 gene expression was also

investigated and new transcription factors were isolated in a Yeast One-Hybrid

screening.

The importance of our research to the knowledge of abiotic stress

response and tolerance in rice will be discussed in the following three research

chapters, and in the General Conclusions and Future Perspectives.

References Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Arabidopsis AtMYC2

(bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 15: 63-78

Agarwal M, Hao Y, Kapoor A, Dong CH, Fujii H, Zheng X, Zhu JK (2006) A R2R3 type MYB transcription factor is involved in the cold regulation of CBF genes and in acquired freezing tolerance. J Biol Chem 281: 37636-37645

Baena-Gonzalez E, Rolland F, Thevelein JM, Sheen J (2007) A central integrator of transcription networks in plant stress and energy signalling. Nature 448: 938-942

Batista R, Saibo N, Lourenco T, Oliveira MM (2008) Microarray analyses reveal that plant mutagenesis may induce more transcriptomic changes than transgene insertion. Proc Natl Acad Sci U S A 105: 3640-3645

Broothaerts W, Mitchell HJ, Weir B, Kaines S, Smith LM, Yang W, Mayer JE, Roa-Rodriguez C, Jefferson RA (2005) Gene transfer to plants by diverse species of bacteria. Nature 433: 629-633

Cao Y, Wu Y, Zheng Z, Song F (2005) Overexpression of the rice EREBP-like gene OsBIERF3 enhances disease resistance and salt tolerance in transgenic tobacco. Physiological and Molecular Plant Pathology 67: 202-211

Chan MT, Chang HH, Ho SL, Tong WF, Yu SM (1993) Agrobacterium-mediated production of transgenic rice plants expressing a chimeric alpha-amylase promoter/beta-glucuronidase gene. Plant Mol Biol 22: 491-506

Cheng M, Fry JE, Pang S, Zhou H, Hironaka CM, Duncan DR, Conner TW, Wan Y (1997) Genetic Transformation of Wheat Mediated by Agrobacterium tumefaciens. Plant Physiol 115: 971-980

Chilton MD, Que Q (2003) Targeted integration of T-DNA into the tobacco genome at double-stranded breaks: new insights on the mechanism of T-DNA integration. Plant Physiol 133: 956-965

Chinnusamy V, Ohta M, Kanrar S, Lee BH, Hong X, Agarwal M, Zhu JK (2003) ICE1: a regulator of cold-induced transcriptome and freezing tolerance in Arabidopsis. Genes Dev 17: 1043-1054

Choi H, Hong J, Ha J, Kang J, Kim SY (2000) ABFs, a family of ABA-responsive element binding factors. J Biol Chem 275: 1723-1730

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743

Cominelli E, Galbiati M, Vavasseur A, Conti L, Sala T, Vuylsteke M, Leonhardt N, Dellaporta SL, Tonelli C (2005) A guard-cell-specific MYB transcription factor regulates stomatal movements and plant drought tolerance. Curr Biol 15: 1196-1200

de la Riva GA, González-Cabrera J, Vázquez-Padrón R, Ayra-Pardo C (1998) Agrobacterium tumefaciens: a natural tool for plant transformation. Electronic Journal of Biotechnology [online] 1

22


Dong CH, Agarwal M, Zhang Y, Xie Q, Zhu JK (2006) The negative regulator of plant cold responses, HOS1, is a RING E3 ligase that mediates the ubiquitination and degradation of ICE1. Proc Natl Acad Sci U S A 103: 8281-8286

Dubouzet JG, Sakuma Y, Ito Y, Kasuga M, Dubouzet EG, Miura S, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) OsDREB genes in rice, Oryza sativa L., encode transcription activators that function in drought-, high-salt- and cold-responsive gene expression. Plant J 33: 751-763

Evans MJ, Smithies O, Capecchi MR (2001) Mouse gene targeting. Nature Medicine 7: 1081-1090 Fowler S, Thomashow MF (2002) Arabidopsis transcriptome profiling indicates that multiple

regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell 14: 1675-1690

Friesner J, Britt AB (2003) Ku80- and DNA ligase IV-deficient plants are sensitive to ionizing radiation and defective in T-DNA integration. Plant J 34: 427-440

Garris AJ, Tai TH, Coburn J, Kresovich S, McCouch S (2005) Genetic structure and diversity in Oryza sativa L. Genetics 169: 1631-1638

Gherbi H, Gallego ME, Jalut N, Lucht JM, Hohn B, White CI (2001) Homologous recombination in planta is stimulated in the absence of Rad50. EMBO Rep 2: 287-291

Gilmour SJ, Zarka DG, Stockinger EJ, Salazar MP, Houghton JM, Thomashow MF (1998) Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional activators as an early step in cold-induced COR gene expression. Plant J 16: 433-442

Gould J, Devey M, Hasegawa O, Ulian EC, Peterson G, Smith RH (1991) Transformation of Zea mays L. Using Agrobacterium tumefaciens and the Shoot Apex. Plant Physiol 95: 426-434

Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6: 271-282

Hsieh TH, Lee JT, Charng YY, Chan MT (2002) Tomato plants ectopically expressing Arabidopsis CBF1 show enhanced resistance to water deficit stress. Plant Physiol 130: 618-626

Hu H, Dai M, Yao J, Xiao B, Li X, Zhang Q, Xiong L (2006) Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice. Proc Natl Acad Sci U S A 103: 12987-12992

IRGSP (2005) The map-based sequence of the rice genome. Nature 436: 793-800 Ishida Y, Saito H, Ohta S, Hiei Y, Komari T, Kumashiro T (1996) High efficiency transformation of

maize (Zea mays L.) mediated by Agrobacterium tumefaciens. Nat Biotechnol 14: 745-750 Ito Y, Katsura K, Maruyama K, Taji T, Kobayashi M, Seki M, Shinozaki K, Yamaguchi-Shinozaki

K (2006) Functional analysis of rice DREB1/CBF-type transcription factors involved in cold-responsive gene expression in transgenic rice. Plant Cell Physiol 47: 141-153

Jaglo-Ottosen KR, Gilmour SJ, Zarka DG, Schabenberger O, Thomashow MF (1998) Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance. Science 280: 104-106

Jayamani P, Negrão S, Martins M, Maçãs B, Oliveira MM (2007) Genetic Relatedness of Portuguese Rice Accessions from Diverse Origins as Assessed by Microsatellite Markers. Crop Science 47: 879-886

Jeon JS, Lee S, Jung KH, Jun SH, Jeong DH, Lee J, Kim C, Jang S, Yang K, Nam J, An K, Han MJ, Sung RJ, Choi HS, Yu JH, Choi JH, Cho SY, Cha SS, Kim SI, An G (2000) T-DNA insertional mutagenesis for functional genomics in rice. Plant J 22: 561-570

Jeong DH, An S, Kang HG, Moon S, Han JJ, Park S, Lee HS, An K, An G (2002) T-DNA insertional mutagenesis for activation tagging in rice. Plant Physiol 130: 1636-1644

Karaba A, Dixit S, Greco R, Aharoni A, Trijatmiko KR, Marsch-Martinez N, Krishnan A, Nataraja KN, Udayakumar M, Pereira A (2007) Improvement of water use efficiency in rice by expression of HARDY, an Arabidopsis drought and salt tolerance gene. Proc Natl Acad Sci U S A 104: 15270-15275

Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1999) Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nat Biotechnol 17: 287-291

Kasuga M, Miura S, Shinozaki K, Yamaguchi-Shinozaki K (2004) A combination of the Arabidopsis DREB1A gene and stress-inducible rd29A promoter improved drought- and low-temperature stress tolerance in tobacco by gene transfer. Plant Cell Physiol 45: 346-350

Khush GS (1997) Origin, dispersal, cultivation and variation of rice. Plant Mol Biol 35: 25-34 Knight H, Zarka DG, Okamoto H, Thomashow MF, Knight MR (2004) Abscisic acid induces CBF

gene transcription and subsequent induction of cold-regulated genes via the CRT promoter element. Plant Physiol 135: 1710-1717

23

Tiago Lourenço

Konishi S, Izawa T, Lin SY, Ebana K, Fukuta Y, Sasaki T, Yano M (2006) An SNP caused loss of seed shattering during rice domestication. Science 312: 1392-1396

Lacroix B, Tzfira T, Vainstein A, Citovsky V (2006) A case of promiscuity: Agrobacterium's endless hunt for new partners. Trends Genet 22: 29-37

Li C, Zhou A, Sang T (2006) Rice domestication by reducing shattering. Science 311: 1936-1939 Liang YK, Dubos C, Dodd IC, Holroyd GH, Hetherington AM, Campbell MM (2005) AtMYB61, an

R2R3-MYB transcription factor controlling stomatal aperture in Arabidopsis thaliana. Curr Biol 15: 1201-1206

Lin Z, Griffith ME, Li X, Zhu Z, Tan L, Fu Y, Zhang W, Wang X, Xie D, Sun C (2007) Origin of seed shattering in rice (Oryza sativa L.). Planta 226: 11-20

Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1998) Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 10: 1391-1406

Lloyd AM, Barnason AR, Rogers SG, Byrne MC, Fraley RT, Horsch RB (1986) Transformation of Arabidopsis thaliana with Agrobacterium tumefaciens. Science 234: 464-466

McLaren JS (2005) Crop biotechnology provides an opportunity to develop a sustainable future. Trends Biotechnol 23: 339-342

Miura K, Jin JB, Hasegawa PM (2007 b) Sumoylation, a post-translational regulatory process in plants. Curr Opin Plant Biol 10: 495-502

Miura K, Jin JB, Lee J, Yoo CY, Stirm V, Miura T, Ashworth EN, Bressan RA, Yun DJ, Hasegawa PM (2007 a) SIZ1-mediated sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance in Arabidopsis. Plant Cell 19: 1403-1414

Mustilli AC, Merlot S, Vavasseur A, Fenzi F, Giraudat J (2002) Arabidopsis OST1 protein kinase mediates the regulation of stomatal aperture by abscisic acid and acts upstream of reactive oxygen species production. Plant Cell 14: 3089-3099

Mysore KS, Nam J, Gelvin SB (2000) An Arabidopsis histone H2A mutant is deficient in Agrobacterium T-DNA integration. Proc Natl Acad Sci U S A 97: 948-953

Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol 140: 411-432

Nakashima K, Kiyosue T, Yamaguchi-Shinozaki K, Shinozaki K (1997) A nuclear gene, erd1, encoding a chloroplast-targeted Clp protease regulatory subunit homolog is not only induced by water stress but also developmentally up-regulated during senescence in Arabidopsis thaliana. Plant J 12: 851-861

Nakashima K, Yamaguchi-Shinozaki K (2006) Regulons involved in osmotic stress-responsive and cold stress-responsive gene expression in plants. Physiologia Plantarum 126: 62-71

Novillo F, Alonso JM, Ecker JR, Salinas J (2004) CBF2/DREB1C is a negative regulator of CBF1/DREB1B and CBF3/DREB1A expression and plays a central role in stress tolerance in Arabidopsis. Proc Natl Acad Sci U S A 101: 3985-3990

Oh SJ, Kwon CW, Choi DW, Song SI, Kim JK (2007) Expression of barley HvCBF4 enhances tolerance to abiotic stress in transgenic rice. Plant Biotechnol J 5: 646-656

Parkhi V, Rai M, Tan J, Oliva N, Rehana S, Bandyopadhyay A, Torrizo L, Ghole V, Datta K, Datta SK (2005) Molecular characterization of marker-free transgenic lines of indica rice that accumulate carotenoids in seed endosperm. Mol Genet Genomics 274: 325-336

Pellegrineschi A, Reynolds M, Pacheco M, Brito RM, Almeraya R, Yamaguchi-Shinozaki K, Hoisington D (2004) Stress-induced expression in wheat of the Arabidopsis thaliana DREB1A gene delays water stress symptoms under greenhouse conditions. Genome 47: 493-500

Pino MT, Skinner JS, Park EJ, Jeknic Z, Hayes PM, Thomashow MF, Chen TH (2007) Use of a stress inducible promoter to drive ectopic AtCBF expression improves potato freezing tolerance while minimizing negative effects on tuber yield. Plant Biotechnol J 5: 591-604

Potrykus I (1990) Gene transfer to cereals: an assessment. Bio/Technology 8: 535-542 Raineri DM, Bottino P, Gordon MP, Nester EW (1990) Agrobacterium-mediated transformation of

rice (Oryza sativa L.). Bio/Technology 8: 33-38 Rakshit S, Rakshit A, Matsumura H, Takahashi Y, Hasegawa Y, Ito A, Ishii T, Miyashita NT,

Terauchi R (2007) Large-scale DNA polymorphism study of Oryza sativa and O. rufipogon reveals the origin and divergence of Asian rice. Theor Appl Genet 114: 731-743

Sakuma Y, Maruyama K, Osakabe Y, Qin F, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2006) Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in drought-responsive gene expression. Plant Cell 18: 1292-1309

24


Salman H, Abu-Arish A, Oliel S, Loyter A, Klafter J, Granek R, Elbaum M (2005) Nuclear localization signal peptides induce molecular delivery along microtubules. Biophys J 89: 2134-2145

Sang T, Ge S (2007a) Genetics and phylogenetics of rice domestication. Curr Opin Genet Dev 17: 533-538

Sang T, Ge S (2007b) The puzzle of rice domestication. J Integr Plant Biol 49: 760-768 Savitch LV, Allard G, Seki M, Robert LS, Tinker NA, Huner NP, Shinozaki K, Singh J (2005) The

effect of overexpression of two Brassica CBF/DREB1-like transcription factors on photosynthetic capacity and freezing tolerance in Brassica napus. Plant Cell Physiol 46: 1525-1539

Shaked H, Melamed-Bessudo C, Levy AA (2005) High-frequency gene targeting in Arabidopsis plants expressing the yeast RAD54 gene. Proc Natl Acad Sci U S A 102: 12265-12269

Shinozaki K, Yamaguchi-Shinozaki K (2007) Gene networks involved in drought stress response and tolerance. Journal of Experimental Botany 58: 221-227

Smith EF, Townsend CO (1907) A Plant-Tumor of Bacterial Origin. Science 25: 671-673 Sweeney M, McCouch S (2007) The complex history of the domestication of rice. Ann Bot (Lond)

100: 951-957 Terada R, Johzuka-Hisatomi Y, Saitoh M, Asao H, Iida S (2007) Gene targeting by homologous

recombination as a biotechnological tool for rice functional genomics. Plant Physiol 144: 846-856

Tran LS, Nakashima K, Sakuma Y, Osakabe Y, Qin F, Simpson SD, Maruyama K, Fujita Y, Shinozaki K, Yamaguchi-Shinozaki K (2007) Co-expression of the stress-inducible zinc finger homeodomain ZFHD1 and NAC transcription factors enhances expression of the ERD1 gene in Arabidopsis. Plant J 49: 46-63

Tran LS, Nakashima K, Sakuma Y, Simpson SD, Fujita Y, Maruyama K, Fujita M, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2004) Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant Cell 16: 2481-2498

Tzfira T, Citovsky V (2002) Partners-in-infection: host proteins involved in the transformation of plant cells by Agrobacterium. Trends Cell Biol 12: 121-129

Tzfira T, Citovsky V (2006) Agrobacterium-mediated genetic transformation of plants: biology and biotechnology. Curr Opin Biotechnol 17: 147-154

Tzfira T, Vaidya M, Citovsky V (2002) Increasing plant susceptibility to Agrobacterium infection by overexpression of the Arabidopsis nuclear protein VIP1. Proc Natl Acad Sci U S A 99: 10435-10440

Tzfira T, Vaidya M, Citovsky V (2004) Involvement of targeted proteolysis in plant genetic transformation by Agrobacterium. Nature 431: 87-92

Umezawa T, Yoshida R, Maruyama K, Yamaguchi-Shinozaki K, Shinozaki K (2004) SRK2C, a SNF1-related protein kinase 2, improves drought tolerance by controlling stress-responsive gene expression in Arabidopsis thaliana. Proc Natl Acad Sci U S A 101: 17306-17311

Uno Y, Furihata T, Abe H, Yoshida R, Shinozaki K, Yamaguchi-Shinozaki K (2000) Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions. Proc Natl Acad Sci U S A 97: 11632-11637

van Attikum H, Bundock P, Hooykaas PJ (2001) Non-homologous end-joining proteins are required for Agrobacterium T-DNA integration. EMBO J 20: 6550-6558

Van Buskirk HA, Thomashow MF (2006) Arabidopsis transcription factors regulating cold acclimation. Physiologia Plantarum 126: 72-80

Vaughan DA, Morishima H, Kadowaki K (2003) Diversity in the Oryza genus. Curr Opin Plant Biol 6: 139-146

Vogel JT, Zarka DG, Van Buskirk HA, Fowler SG, Thomashow MF (2005) Roles of the CBF2 and ZAT12 transcription factors in configuring the low temperature transcriptome of Arabidopsis. Plant J 41: 195-211

Yamaguchi-Shinozaki K, Shinozaki K (1994) A novel cis-acting element in an Arabidopsis gene is involved in responsiveness to drought, low-temperature, or high-salt stress. Plant Cell 6: 251-264

Yoshida R, Hobo T, Ichimura K, Mizoguchi T, Takahashi F, Aronso J, Ecker JR, Shinozaki K (2002) ABA-activated SnRK2 protein kinase is required for dehydration stress signaling in Arabidopsis. Plant Cell Physiol 43: 1473-1483

Zhu J, Shi H, Lee BH, Damsz B, Cheng S, Stirm V, Zhu JK, Hasegawa PM, Bressan RA (2004) An Arabidopsis homeodomain transcription factor gene, HOS9, mediates cold tolerance through a CBF-independent pathway. Proc Natl Acad Sci U S A 101: 9873-9878

25

Tiago Lourenço

Zhu J, Verslues PE, Zheng X, Lee BH, Zhan X, Manabe Y, Sokolchik I, Zhu Y, Dong CH, Zhu JK, Hasegawa PM, Bressan RA (2005) HOS10 encodes an R2R3-type MYB transcription factor essential for cold acclimation in plants. Proc Natl Acad Sci U S A 102: 9966-9971

26

Chapter 2 Overexpression of HvCBF4 in rice (Oryza sativa L.) causes differential gene expression and stress tolerance Lourenço, T.(1), Saibo, N.(1), Batista, R.(1,2), Pinto Ricardo, C.(1,3) and Oliveira, M. M.(1,4) Overexpression of HvCBF4 in rice (Oryza sativa L.) causes differential gene expression and stress tolerance (submitted) (1) ITQB/IBET, Quinta do Marquês, 2784-505 Oeiras, Portugal (2) Instituto Nacional de Saúde Dr. Ricardo Jorge, Avenida Padre Cruz, 1649-016 Lisboa, Portugal (3) Instituto Superior de Agronomia, UTL, Tapada da Ajuda, 1349-017 Lisboa, Portugal (4) Dep. Biologia Vegetal, Fac. Ciências de Lisboa, 1749-016 Lisboa, Portugal

Tiago Lourenço

Chapter Index Abstract….….….…..….….…..….….….….….….……………….…………………..29 Introduction….….…..…..….…..….….….….…..…..…….….….…….….………...31 Results…….….….….….….…….…..….….…….……..….…….……………………35 Production of HvCBF4 overexpressing rice plants….….….….….….……35 HvCBF4 transgenic plants stress tolerance….…….….….….….….….….38

Chlorophyll fluorescence analysis………….….….….….….….….….…….42 Gene expression analysis using GeneChip®….….….….….…...…..……42 RT-PCR analysis of the transgenic rice lines….….…….…...….….….…43

Discussion….….………….….……..……..….….….….…….…….…….…….…….45 Experimental procedures…….……..….….…..……..….….….….……….….…...50 Genetic construct preparation….….….….….…….……….….….….…......50 DREB1/CBF alignments and phylogenetic analysis…..…..…..…...…..…51 Production of HvCBF4 transgenic rice plants.….…..….……...…….....…51 Analysis of putative transgenic plants….…....…….….....….….…..….…..52

Drought stress treatment for plants grown in soil mixture and growth measurements……...…...….……..…...…...….…..…….…...….….53 Chlorophyll fluorescence analysis.…...…….…..….…….....…….....….….53 Leaf relative water content analysis…..…..…..….…….....…...……..….…54 GeneChip® Rice Genome Array and data analysis……....…..….…...…..54 Total RNA extraction and cDNA synthesis….…...……..….…..……….….55 RT-PCR (reverse-transcriptase-PCR) analysis…….…..……………..…..55

References…….……….….……………..….………....…..…………….….….….….55 Supplementary material……….…….….….….……..…….…….….…….….…….59

28


Abstract

Abiotic stress such as drought, cold or high-salinity are major constrains to crops

productivity worldwide. In the present work, we investigated the effects of

overexpressing a barley transcription factor (HvCBF4) in the abiotic stress

response in rice (Oryza sativa L.). We transformed rice with the HvCBF4 gene

under the control of a constitutive (maize Ubi1) or a stress-inducible promoter

(Arabidopsis RD29A). The transformed plants were analyzed both at molecular

and physiological level. The AtRD29A::HvCBF4 plants were further analyzed

using the GeneChip® Rice Genome Array under control conditions. Only the

plants constitutively expressing HvCBF4 have shown increased survival to

drought stress, but not to cold or high-salinity. These plants have also shown

better photosynthetic capacity, as determined by chlorophyll fluorescence. Plants

expressing AtRD29A::HvCBF4 did not increased survival to any of the stresses

applied. However, in the GeneChip® microarray these plants have shown up-

regulation of many stress-responsive genes (>400) as compared to non-

transformed plants. Interestingly, RT-PCR analysis revealed not only differential

gene expression between roots and shoots, but also between transgenic lines

with different promoters. Our results indicate that different HvCBF4 expression

levels resulted in different transcriptomes. Given that the AtRD29A::HvCBF4

plants did not show increased tolerance to any of the imposed stresses, we may

conclude that this promoter may be unappropriate for rice transformation aiming

for enhanced abiotic stress tolerance.

29

Tiago Lourenço

30


Introduction

Rice (Oryza sativa L.) is one of the most important cereal crops since it is

the staple food of almost 2/3 of the world population. Rice can also be considered

a model plant for studies in crops. It has a relatively small genome (~300Mb),

diploid origin, high degree of synteny with other cereals and it has the genome

fully sequenced (IRGSP, 2005). Due to demographical pressure, especially in

Asia, by 2030 we will need to have an increased rice production using less land,

less water, less labour and less chemicals (Khush, 2005). Thus higher yielding

stress-tolerant rice crop cultivars will be needed.

The impact of abiotic stresses such as drought, cold or high salinity

seriously limits plant productivity worldwide and is responsible for crop losses by

as much as 50% (Boyer, 1982). As sessile organisms, plants are unable to

escape the unfavourable environmental conditions. Thus they have evolved

common mechanisms to respond to abiotic stresses at molecular, cellular, and

physiological level (Thomashow, 1999). A variety of genes are induced upon

abiotic stress, some of which function in gene expression regulation and signal

transduction (Shinozaki et al., 2003; Nakashima and Yamaguchi-Shinozaki,

2006).

With the development of molecular and genomic technologies it has

become important to understand the basis of plant abiotic stress tolerance in

order to produce new tolerant varieties either by genetic engineering or

conventional breeding. However, abiotic stress tolerance is a complex trait and

difficult to achieve. The search and characterization of regulatory genes, such as

the transcription factors, is therefore seen as a possible way to identify key

modulators of the abiotic stress response.

Transcription factors (TFs) are proteins that have a DNA-binding domain

and are involved in the regulation of gene expression. Transcription factors can

recognize and bind specific sequences (cis-motifs) in the promoter region of

target genes activating or inhibiting target gene expression. Transcriptome

analysis has revealed that one of the highest representative classes present in

response to stress treatment are TFs. These results suggest that these stress-

inducible TFs are involved in the further regulation of signal transduction and

31

Tiago Lourenço

regulation of gene expression to stress response revealing an involvement in

complex regulatory gene networks. In 1994, Yamaguchi-Shinozaki and Shinozaki

identified a dehydration-responsive element (DRE/CRT; C-repeat) core motif

(A/GCCGAC) in the promoter of the Arabidopsis RD29a gene (Yamaguchi-

Shinozaki and Shinozaki, 1994). This gene is induced by drought-, salt-, and cold-

stress. Promoter analyses have shown that several other stress-induced genes

had the same DRE/CRT motif upstream the starting codon.

Using the Yeast One-Hybrid screening, transcription factors binding the

DRE core motif have been isolated. These transcription factors were classified in

the AP2 (APETALA 2)/ERF (ethylene responsive factor) superfamily and termed

as DREB (DRE binding) or CBF (CRT binding factor) depending on the team that

isolated them (Stockinger et al., 1997; Gilmour et al., 1998; Liu et al., 1998). The

expression of these genes is quickly and transiently induced by cold-stress but

not by dehydration or salt stress and defines an abscisic acid (ABA) independent

pathway for cold tolerance. Similar transcription factors have been isolated and

named DREB2 genes (Gilmour et al., 1998; Liu et al., 1998). The DREB2 genes

are induced by dehydration and salt-stress but not by cold (Nakashima et al.,

2000) and need a post-translational modification to be in an active form (Sakuma

et al., 2006). The DREB2 genes as the DREB1 also define an ABA-independent

pathway.

Since a transcription factor can alter the expression of several genes, a

transgenic approach with DREB1/CBF transcription factors was planned to

facilitate coping with abiotic stress (Wang et al., 2003; Zhang et al., 2004;

Umezawa et al., 2006). Transgenic Arabidopsis have been generated

overexpressing the DREB1A/CBF3, DREB1B/CBF1 and DREB1C/CBF2, and the

plants have shown an increased tolerance not only to cold, but also to drought

and salt stresses (Jaglo-Ottosen et al., 1998; Liu et al., 1998; Kasuga et al., 1999;

Gilmour et al., 2000). The increased abiotic stress tolerance due to the

overexpression of these transcription factors mimics the biochemical changes

associated with cold acclimation (Gilmour et al., 2000; Gilmour et al., 2004) thus

suggesting the involvement of these TFs in the cold acclimation process. Several

target genes from the CBF regulon have been identified over the past recent

years using different approaches, with either cDNA or GeneChip microarrays in

32


Arabidopsis (Seki et al., 2001; Vogel et al., 2005). The majority of these genes

have at least one DRE/CRT core cis-motif in the promoter region. Some of the

genes regulated by the CBF regulon actively act in stress tolerance (e.g. late

embryogenesis abundant – LEA – proteins and sugar biosynthesis proteins),

while others act in further signal transduction and regulation (e.g. zinc finger

transcription factors and other AP2/ERF transcription factors). The

overexpression of the Arabidopsis DREB1/CBF genes have been used in other

plant systems and the plants generated (either dicots or monocots) have shown

increased abiotic stress tolerance (Hsieh et al., 2002; Pellegrineschi et al., 2004;

Bhatnagar-Mathur et al., 2007). These findings revealed that the induced

expression of orthologous genes from Arabidopsis increased abiotic stress

tolerance in heterologous species. These results also revealed that even cold

sensitive species (e.g. rice) had a functional downstream CBF regulon (Oh et al.,

2005).

However, in several cases, the transgenic plants showed an unwanted

dwarf phenotype with flowering retardation. Exogenous application of gibberellin

(GA) restored the normal growth in tomato (Hsieh et al., 2002). Nevertheless, GA

associated genes did not show any significant expression changes in transgenic

Arabidopsis overexpressing DREB1A/CBF3, DREB1B/CBF1 or DREB1C/CBF2

(Fowler and Thomashow, 2002). The relation between DREB1/CBF genes and

growth retardation is still unknown but the DREB1A/CBF3 downstream target

gene STZ may be involved in growth retardation by negatively regulating the

expression of photosynthesis and carbohydrate metabolism related genes

(Sakamoto et al., 2004). However, rice plants overexpressing the DREB1A/CBF3

gene and not showing stunting growth have already been reported (Oh et al.,

2005). One strategy used to minimize the growth retardation effects is to use the

stress-inducible RD29A gene promoter (Kasuga et al., 2004; Behnam et al., 2007;

Pino et al., 2007) to drive the ectopic expression of the DREB1/CBF genes.

Efforts have also been made to identify DREB1/CBF genes in other

species than Arabidopsis. The CBF regulon genes have been identified and

isolated from Brassica napus, rice, wheat, barley, etc. (Jaglo et al., 2001;

Dubouzet et al., 2003; Skinner et al., 2005). Using a transgenic approach, some

of these genes have been overexpressed in Arabidopsis and the plants have

33

Tiago Lourenço

shown an increased abiotic stress tolerance revealing a similar stress-response

mechanism across-species (Dubouzet et al., 2003; Skinner et al., 2005). Dicots

like Arabidopsis have 6 identified DREB1/CBF genes (Haake et al., 2002) but

monocots like rice or barley have a larger gene family. Barley has at least 20

identified members and rice at least 14 members. Large DREB1/CBF gene

families are typical of cereals irrespectively of the low-temperature tolerance

(Skinner et al., 2005).

In order to understand the molecular mechanisms underlying the abiotic

stress response in a cold-sensitive monocot like rice, we analyzed the expression

of the barley HvCBF4 gene (Choi et al., 2002) using a transgenic approach in rice

(Oryza sativa L., cv. Nipponbare). The HvCBF4 (accession number AF298230) is

a 225 amino acids long transcription factor previously isolated from barley

(Hordeum vulgare cv. Morex) (Choi et al., 2002) and formerly identified as

BCBF1. Barley has a high tolerance to low-temperature and so it would be

interesting to test barley CBF4 expression in a cold sensitive species like rice

(Oryza sativa L., cv. Nipponbare).

The HvCBF4 transcription factor belongs to the AP2/ERF superfamily and

it has the typical signature motif of the DREB1/CBF family flanking each side of

the AP2 (PKK/RPAGRxKFxETRHP and DSAWR) (Fig. 1A). The DREB1/CBF

family has been characterized first in Arabidopsis (Stockinger et al., 1997;

Gilmour et al., 1998; Liu et al., 1998). According to Skinner et al. the DREB1/CBF

monocot transcription factors family can be divided into three subgroups (Skinner

et al., 2005). The HvCBF4 defines a subgroup of monocots DREB1/CBF that has

a typical response different from the other subgroups. The closest phylogenetic

rice CBF member is the OsDREB1B (Fig. 1B). The expression of HvCBF4 was

induced by cold stress but it was unaltered by salt, drought and ABA treatment

(Skinner et al., 2005; Oh et al., 2007) and it binds to DRE/CRT core motif in a

cold-dependent manner (Skinner et al., 2005). Recently, Oh and co-workers (Oh

et al., 2007) have transformed the barley HvCBF4 gene into rice (Oryza sativa L.,

cv. Nakdong). The overexpression of this gene driven by the maize Ubi1 promoter

in rice produced plants with increased abiotic stress tolerance without stunting

growth.

34


In our work, we compared the effects of the ectopic expression of the

HvCBF4 transgene driven by either a constitutive promoter (maize ubiquitin

promoter, Ubi1) or a stress-inducible one (Arabidopsis RD29A gene promoter).

We have performed physiological analyses of the transgenic plants and analyzed

the global gene expression changes using the Affymetrix Rice Whole Genome

GeneChip in one transgenic line. The results comparing the two transgenic and

the non-transformed (NT) lines are discussed.

Results Production of HvCBF4 overexpressing rice plants

To study the effect of the HvCBF4 expression in rice plants, we cloned

the gene in GATEWAY® vectors, in order to have either constitutive or inducible

expression. For this purpose, we used respectively either a constitutive promoter,

maize Ubiquitin 1 promoter including its first intron (maize Ubi1) (Christensen and

Quail, 1996) or a stress-inducible promoter (RD29A promoter from Arabidopsis)

(Fig. 2A). Transgenic rice plants were obtained using the Agrobacterium-

mediated transformation protocol (Hiei et al., 1994) with some modifications

(Rueb et al., 1994). Thirty nine transgenic plants were produced and analysed by

genomic Southern blotting for the transgene integration event. Among those

plants, we retrieved 4 and 5 different transgenic lines from the Ubi::HvCBF4 and

AtRD29A::HvCBF4, respectively. The transgene copy number varied from 1 to at

least 5. Single-copy T1 plant lines were screened for homozygosity, with the help

of a densitometer, to compare band intensities on a genomic Southern blot film.

For this comparison, we could use the band intensities of endogenous

homozygous genes that could also cross-hybridize with HvCBF4 probe. At least

three rice genes share a minimum of 85% homology with the AP2 region of the

HvCBF4 (Oh et al., 2007).

Transgenic homozygous T1 plants from each genetic construct were

allowed to self-pollinate and their progeny was used on subsequent tests. The

expression levels of the transgene were analysed on the T2 plants from each line

using RT-PCR (reverse transcriptase-PCR) (Fig. 2B). Both lines expressed the

transgene, but the AtRD29A::HvCBF4 line only showed increased expression

levels after a few hours of stress imposition (e.g. drought) (Fig. 2B).

35

Tiago Lourenço

+++++++++++++++++++++++++++++

+++++++

36


Figure 1. Phylogenetic analysis between DREB1/CBF AP2-domain amino acids sequences. (A) For the aligment of the DREB1/CBF proteins we used the following amino acids sequences and accession numbers: HvCBF4 (AAK01088), Secale-CBF like (AAL35761), TaCBF1 (AAL37944), BCBF2 (AAM13419), TaCBF2 (AAX28961), OsDREB1b.1 (AAX28958), OsDREB1d (AAX23721), OsDREB1a (AAN02486), Zea mays DREB (AAN76804), HvCBF3 (AAX23692), OsDREB1c (AAP92125), OsCBF4 (BAD29237), HvCBF1 (AAL84170), Lycopersicum esculentum CBF-like 1 (AAS77819), Lycopersicum esculentum CBF1-like (AAS77820), Prunus avium CBF-like (BAD27123), AtDREB1b (NP_567721), AtDREB1c (BAA33436), AtDREB1a (BAA33434), Brassica napus CBF-like (AAL38242), Brassica napus CBF5 (AAM18958), Brassica napus CBF7 (AAM18959), LeCBF-like 2 (AAN77051), OsDREB2a (AAN02487) and Triticum aestivum CBF-like (ABA08424). The alignment of monocot and dicot DREB1/CBF AP2-domain and flanking regions was done using ClustalW. As outliers 3 DREB2 proteins (DREB1/CBF related but without typical signature motifs) were included in the alignment The AP2-domain motif is underlined and the DREB1/CBF AP2-flanking signature motifs are shown with stars. (B) The phylogenetic tree was generated using the Neighbour Joining methodology using the refined alignment produced in (A). The monocot and dicot DREB1/CBF amino acids sequences are phylogenetic separated (vertical bars) and monocot functional subgroups (according to Skinner et al, 2005) are also shown in dashed vertical bars.

However, a small but consistent leaky-expression, of the HvCBF4 from the

AtRD29A promoter in unstressed plants, could be observed when the

amplification program included 35 cycles (data not shown).

Figure 2. Production of transgenic rice (Oryza sativa L., cv. Nipponbare) plants. (A) Two genetic constructs were used for transformation of rice plants with different promoters. RB - right border; LB - left border; pUbi – maize Ubiquitin1 promoter for constitutive expression of the trangene of interest; pRD29A – Arabidopsis stress-inducible promoter from RD29A gene; HvCBF4 – transgene of interest from barley; tN – nopaline synthase gene terminator; pNOS - nopaline synthase gene promoter; Hyg – hptII gene selectable marker for antibiotic resistance to Hygromycin B. (B) Reverse-transcriptase PCR in the T2 homozygous lines expressing the HvCBF4 gene. Total RNA was extracted from two week-old seedlings (according to the experimental procedures) under normal conditions (0h) or after 2 hours of drought stress (2h). The seedlings were also separated in roots and shoots for total RNA extraction. The rice actin gene was used as internal control of the RT-PCR.

The overexpression of CBF/DREB1 transcription factors often results in

stunted growth of the transgenic plants (Ito et al., 2006). We also observed a

stunted growth in the Ubi::HvCBF4 transgenic plants (Fig. 3A, Table 1). The

AtRD29A::HvCBF4 plants also had a small decrease in growth in the seedling

37

http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=protein&val=17148651

Tiago Lourenço

stage probably due to the “leaky-expression” of the promoter. However, during

vegetative growth and seed-setting under glasshouse conditions

AtRD29A::HvCBF4 and NT (non-transformed) plants did not show significant

differences in plant height and number of fertile seeds (Table 1). The reduced

growth observed in the seedling stage of the Ubi::HvCBF4 transgenic line was

also observed during the vegetative growth and seed-setting stage (Fig. 3A,

Table 1).

HvCBF4 transgenic plants stress tolerance In order to understand if the transgenic rice plants expressing the

HvCBF4 gene were more tolerant to abiotic stress, we subjected two week-old

seedlings to drought, high-salinity and cold stress. However, we could not detect

any significant differences in survival rate of both transgenic lines under cold or

high-salinity (data not shown) when compared to non-transgenic (NT) plants.

However, after 12 days of drought stress, the transgenic line Ubi::HvCBF4

revealed increased drought tolerance when compared to the NT line (Fig. 3B,

Table 2). Interestingly, the AtRD29A::HvCBF4 line had a lower tolerance to

drought than the NT line (Fig. 3B, Table 2). This behaviour was corroborated by

the leaf relative water content (RWC) measurements. The AtRD29A::HvCBF4 line

showed higher RWC during the first days of drought stress than NT. On the other

hand, with continuous drought stress, the transgenic plants AtRD29A::HvCBF4

started to lose the ability to retain water in their leaves and ended the stress

period with a RWC lower than the NT plants (Fig. 4B). These results agree with

the visual observations of the leaves. The NT leaves were the first to show signs

of drought stress with wilting and rolling of young leaves. Figure 3. Phenotypic comparison of transgenic and NT rice (Oryza sativa L., cv. Nipponbare) under normal and drought stress conditions. (A) Transgenic rice seeds (AtRD29A::HvCBF4 and Ubi::HvCBF4 line) were germinated according to the protocol described in the experimental procedures and grown under glasshouse conditions to maturity. Adult plants were photographed 50 days after germination for phenotype comparison. (B) 2 week-old transgenic (AtRD29A::HvCBF4 and Ubi::HvCBF4 line) and NT seedlings were used for the drought stress treatment. Seeds from the above mentioned lines were germinated according to what is described in the experimental procedures and transferred to pots with soil mixture 1 week after germination. Drought stress was imposed by withholding water for 12 days and re-watering the plants for 1 week. Plants were screened after this period for survival.

38


39

Tiago Lourenço

However, the AtRD29A::HvCBF4 leaves that started to show drought symptoms

later than NT, had more leaves wilted and rolled by the end of the drought stress

than NT leaves. The Ubi::HvCBF4 plants showed a survival rate 70% higher than

the NT and retained RWC close to 85% difference by the end of the drought

stress test (Table 2, Fig. 4B). The visual observations made to the leaves of this

transgenic line revealed that the leaves started to show drought symptoms much

later than NT and the other transgenic line. In fact, only in the last 3 days of

drought mild stress symptoms were observed. After rehydration, the Ubi::HvCBF4

leaves recovered within hours of the drought stress symptoms and the plants

survived. In contrast, most of the NT and AtRD29A::HvCBF4 plants were unable

to recover and died (Fig. 3B, Table 2).

6**/31† (19%)NT

3**/25† (12%)AtRD29A::HvCBF4

10**/11† (90%)Ubi::HvCBF4

Drought (%)Plant line

61.80±8.472.00±1.4159.80±8.1714.20±0.9167.30±4.18NT

77.40±27.7714.60±12.7660.80±18.1314.80±1.1569.80±6.34AtRD29A::HvCBF4

40.00±3.397.60±4.9332.40±5.5912.56±0.8653.40±2.07Ubi::HvCBF4

Total flowersEmpty grainsFilled grainsPanicle length (cm)

Plant height (cm)Plant line

Table 1. Growth and agronomical measurements of transgenic and NT mature plantsTransgenic and NT seeds were sown in pots filled with soil mixture (see experimental procedures) and were allowed to grow to maturity and self-pollinate. After seed setting, plants were harvested for growth and agronomical measurements. At least 5 plants were analyzed per line.

Table 2. Survival rates of the transgenic and NT plants under drought stressTwo-week old transgenic and NT plant lines (Oryza sativa L., cv. Nipponbare) were subjected to drought stress as described in the experimental procedures.

**Number of plants that survived drought stress.† Total plants analyzed.

40


Figure 4. Transgenic and NT plants physiological analyses. (A) Chlorophyll fluorescence analysis were performed using a pulse modulating fluorometer (Mini-PAM, Walz, Germany) in rice leaves and data were retrieved and analyzed using the Da-Teach software. Each point represents the mean and standard deviation of at least 4 plants per line (n ≥ 4). (B) Leaf relative water content measurements were done according to the protocol described in the experimental procedures. Each time point represents the mean and standard deviation of at least 4 plants per line (n ≥ 4).

41

Tiago Lourenço

Chlorophyll fluorescence analysis

We also evaluated both transgenic lines and NT plants in terms of

integrity of photosystem II (PS II) during drought stress through measuring

changes in chlorophyll fluorescence. Minor differences were observed between

the transgenic lines and the NT plants in terms of the maximum quantum yield of

PSII (Fv/Fm) parameter (data not shown). However, during the drought stress

and especially from the 4th day onward, differences were clearly observed. The

efficiency (quantum yield) of the PSII photochemistry can give an indication of

overall photosynthesis capacity in a given moment. With the accumulation of

stress the Ubi::HvCBF4 transgenic line showed a higher quantum yield of the PSII

than the NT or the transgenic line AtRD29A::HvCBF4 plants (Fig. 4A). In line with

these results are the ETR (electron transfer rate) parameter, the photochemical

quenching (qP) and the non-photochemical quenching (qN) parameters. The qP

parameter relates to the proportion of open PSII reaction centres. With the

accumulation of stress, both NT and AtRD29A::HvCBF4 plants revealed a higher

amount of closed reaction centres (Fig. 4A) and thus lower qP values. The qN is

related to heat dissipation of energy that is not used in photosynthesis. The

Ubi::HvCBF4 plants consistently showed lower heat dissipation as compared to

the other two lines, revealing a better adaptation to drought stress (Fig. 4A). Gene expression analysis using GeneChip®

Changes were analyzed with Rice Whole Genome GeneChip® Array in

the expression profile of the transgenic plants, as compared to NT plants. We

used the AtRD29A::HvCBF4 plants to see if the HvCBF4 gene was able to alter

the expression profile of rice genes under normal plant growth conditions. We

used this transgenic line since the Ubi::HvCBF4 had already been used in a

transcriptomic experiment elsewhere (Oh et al., 2007). In order to identify

differentially expressed genes (with a cut-off p<0.05), we performed a Log2

transformation and selected genes with a 2-fold gene expression change

difference to the controls. More than 500 genes were considered differentially

expressed (2-fold change after Log2 transformation) and most of the genes (over

450), were up-regulated although no stress was imposed. Comparisons were

made against the NT plants. Several genes had their expression altered in

42


response to the presence of HvCBF4 gene or as a reaction to the transformation

event, even in non-stress conditions (Table 3). We also analyzed the promoter

region of the genes with altered expression pattern in search of cis-acting motifs

(Table 3). The majority of the genes had DRE 1 and/or DRE 2 (Xue, 2003) cis-

acting motifs, and also ABA responsive elements (ABRE). The closest cis-motifs

to the ATG starting codon were also analyzed in the same identified genes (Table

S1).

RT-PCR analysis of the transgenic rice lines

In order to validate the results obtained with the GeneChip®, we also

analyzed by RT-PCR the expression level of several genes that have shown up-

regulation. For comparison, we also used genes that showed up-regulation in the

microarray analysis of Ubi::HvCBF4 transgenic rice plants of the work conducted

by Oh and co-workers (Oh et al., 2007). The expression of the selected genes

was compared in the transgenic rice lines and NT plants, under control and

imposed drought conditions (2 hours of drought stress) and in different tissues

(roots and shoots) (Fig. 5). We found that the constitutively expressed (Ubi1

driven) HvCBF4 plants did not activate the same genes as the stress-induced

(AtRD29A driven) counterpart (Fig. 5). However, the Ubi::HvCBF4 did in fact

activate the expression of some genes previously described by Oh et al. (2007)

(Fig. 5, genes marked with an asterisk). The transgenic plants with the stress-

inducible promoter AtRD29A indeed activated the genes that were up-regulated in

the Affymetrix Gene Chip which was especially evident after 2 hours of drought.

These plants also showed differential gene expression patterns. Activation of

gene expression occurred preferentially in roots rather than in shoots (Fig. 5).

43

Tiago Lourenço

Table 3. List of genes retrieved from the GeneChip® array with significantly up-regulated transcripts (Log2 transformation) in transgenic plants (AtRD29A::HvCBF4) under normal growth conditions

0211AK058887Proline-rich proteinOs10g05980Os.11398.1.S1_at

0401AK104310Leucine-rich

repeat protein

Os02g40260Os.4614.1.S1_a_at

0221AK070167CytochromeP450Os02g36190Os.23518.1.A1_at

0,18232AK059150Wsi724/Lip5Os03g45280Os.3411.1.S1_s_at

0622AK064124Alpha-

amylase (RAmy3D)

Os08g36910Os.10908.4.S1_at

0,68116AK070197COR410-Dip1/ Lip9Os02g44870Os.12167.1.S1_at

0102AK101991Jacalin 2Os12g09700Os.18585.1.S1_at

0410AK066682Jacalin 1Os12g14440Os.6863.1.S1_at

19,20040AK070415

SAM dependentcarboxyl

methyltransferase

Os02g48770Os.11812.1.S1_at

95,47000AB040744

Helix-loop-helix DNA-

binding domain

Os04g23550Os.6043.1.S1_at

2,15531AK063517Rab16b-dehydrinOs11g26780Os.51718.1.S1_at

2,9202AK101744Alpha-

amylase precursor

Os02g52710Os.49249.1.S1_at

3,39201BAB86480WRKY-binding domain

Os01g60600OsAffx.9584.1.S1_at

12,04211AK103391Trehalose-6-phosphate

phosphataseOs02g44230Os.6092.1.S1_at

14,59324D76415Cysteine

proteinaseprecursor

Os01g67980Os.4181.1.s1_at

23,27413AY327040Transcription factor CBF1Os06g03670OsAffx.27442.1.s1_at

32,59010AK106041Putative

CRT/DRE factor1

Os02g45450Os.51078.1.S1_at

17,01012NdPutativeNAMOs10g25620OsAffx.20377.1.S1_x_at

34,03236AK107146AP2/ERF domain Os02g52670Os.54944.1.S1_at

9,66713AK121733Putative

cytochromeP450

Os07g44140Os.9067.1.S1_at

58,25210AK064287CytochromeP450Os12g05440Os.51923.1.S1_at

175,86501AK102606Expressed proteinOs03g0115800Os.8823.1.S1_at

Fold change (d)

ABRE(c)DRE 2(b)DRE 1(a)Accession

numberGene nameLocusAffy ID

The promoter region included in cis-region search was 1.500 nucleotides upstream the ATG codon. (a) DRE 1 motif search was G/ACCGAC (b) DRE 2 motif search was G/ATCGAC (c) ABRE motif search was TACGTG and CACGTG/A (d) The fold change is the Log2 conversion of the mean fold change in gene expression (between duplicate GeneChip®

arrays) of the transgenic plants compared to non-transformed plants under normal growth conditions. The genes in italic are genes reported as up-regulated in transgenic plants (Oh et al., 2007; Ito et al., 2005) and were compared with our data set.

44


Figure 5. Gene expression analyses between transgenic and NT plants under normal and drought stress conditions. The changes in gene expression were analyzed using target gene specific primer pairs (Table S2) for PCR using the cDNA prepared. The genes accession numbers used in this analysis were: cytochrome P450 (AK064287), EREF-AP2 gene domain (AK107146), no-apical meristem (NAM) (no full-length cDNA in database, Affymetrix code OsAffx.20377.1.S1_x_at), CBF1-like gene (AY327040), cysteine proteinase precursor (D76415), trehalose-6-phosphate phosphatase gene (AK103391), alpha-amylase precursor gene (AK101744), Rab16b-dehydrin gene (AK063517) Jacalin 1 gene (AK066682), cytochrome P450.1 (AK070167), Leucine-rich repeat protein gene (AK104310) and Proline-rich protein gene (AK058887). The genes marked with an asterisk (*) were described in the work of Oh and colleagues as direct targets of HvCBF4. As control, PCR was performed using specific primers for the rice actin gene.

Discussion In the present work we have generated transgenic rice plants (cv.

Nipponbare) expressing the HvCBF4 gene from barley (Choi et al., 2002). The

gene of interest was expressed under the influence of a constitutive promoter

(maize Ubi1 promoter) (Christensen and Quail, 1996) or a stress inducible one

(Arabidopsis RD29A promoter) and its action was compared with NT plants. The

HvCBF4 is a 225 amino-acids transcription factor phylogenetically related to the

OsDREB1B and has several signature motifs that identifies this transcription

factor as belonging to the sub-family DREB1/CBF from the superfamily AP2/ERF

(Fig. 1). The HvCBF4 gene is intronless (like other DREB1/CBF) and in barley it is

45

Tiago Lourenço

induced by cold, but not by drought, high-salt or ABA (Skinner et al., 2005; Oh et

al., 2007).

We have overexpressed the HvCBF4 gene in rice (cv. Nipponbare) but

could not detect increased tolerance to cold or to high-salt stress. Tolerance

response was only visible under drought stress and only in the Ubi::HvCBF4

plants (Fig. 3B, Table 2). Transgenic AtRD29A::HvCBF4 plants failed to have an

increased tolerance to the abiotic stresses tested (drought, cold or high-salt). This

is opposite to what has been shown in the work of Oh and co-workers (Oh et al.,

2007). In their work, transgenic rice plants (cv. Nakdong) overexpressing the

HvCBF4 gene had a higher tolerance to cold, drought or high-salt than NT plants.

These divergent results may eventually be explained by the different rice cultivar

used, different genomic background and thus different set of genes activated.

Also in contradiction with the results of Oh et al. (2007), the transgenic plants

(Ubi::HvCBF4) generated in our work have shown growth retardation (Table 1,

Fig. 3A). Growth retardation is a common undesired effect observed when plants

are transformed with transcription factors for abiotic stress improvement (Kasuga

et al., 1999; Ito et al., 2006). Again, one possible explanation for these results is

the different cultivar used (Nipponbare vs. Nakdong). The HvCBF4 may activate

different genes in the different cultivars thus resulting in growth retardation in one

cultivar and not in the other. Another possible explanation is somaclonal variation

eventually occurring during the in vitro culture process (Oh et al., 2007). However,

we used T2 single copy homozygous transgenic lines in all our analysis and even

then stunting growth could be observed with Ubi::HvCBF4 plants.

In order to understand how the transgenic plants respond to the drought

stress in physiological terms, we analyzed the transgenic plants using a pulse-

modulated fluorometer. Not many differences were observed between the

transgenic lines and the NT plants in terms of maximum photochemical efficiency

of photossystem II (PSII), the Fv/Fm parameter, during all the drought measuring

period. Expectedly, measures of chlorophyll fluorescence parameters in leaves of

whole plants are more physiologically accurate than those performed on excised

leaves when drought stress is imposed in vitro. However, Oh et al. (2007) have

measured the Fv/Fm parameter in excised leaves and observed differences in this

parameter among transgenic and NT plants. One of the most important

46


parameters in chlorophyll fluorescence is the quantum yield of the PSII which

measures the efficiency of the photochemistry of the PSII (Genty et al., 1989).

This parameter measures the amount of light absorbed by chlorophyll associated

with PSII that is used in photochemistry, giving an overall indication of the

photosynthesis in a given moment (Maxwell and Johnson, 2000). The quantum

yield of PSII also relates to the electron transport rate (ETR) parameter that can

be used as an indication of overall photosynthetic capacity in vivo. The transgenic

Ubi::HvCBF4 plants have shown a higher quantum yield during drought stress

(Fig. 4A) when compared to the AtRD29A::HvCBF4 and NT plants especially at

higher photosynthetic active radiation (PAR). This result reveals that the

photochemistry, and thus photosynthetic efficiency in the Ubi::HvCBF4 plants, is

in better functional conditions than in the AtRD29A::HvCBF4 and NT plants.

Under laboratory conditions there is a strong correlation between the quantum

yield of PSII and the efficiency of carbon fixation (Maxwell and Johnson, 2000).

However a careful interpretation must be made because under certain stress

conditions a discrepancy between these two parameters may occur (Fryer et al.,

1998). When analyzing the qP (photochemical quenching) and the qN (non-

photochemical quenching) the Ubi::HvCBF4 plants showed a higher amount of

open reaction centres than AtRD29A::HvCBF4 and NT plants. These results are

in agreement with the results from the quantum yield and ETR (Fig. 4A). Data

from the Ubi plants revealed that the PSII reaction centres are effectively

transferring electrons (Fig. 4A). The AtRD29A::HvCBF4 and NT plants revealed

an increased proportion of closed PSII reaction centres. This may be due to

photosynthesis saturation by light. Another possible explanation to closed

reaction centres is the closure of stomatal pores. Less CO2 uptake and less

carbon fixation in the Calvin cycle can lead to the closure of the reaction centres

in the PSII site. The results of the non-photochemical quenching (qN) also agree

with this hypothesis. The non-photochemical quenching parameter is related to

heat dissipation. If the PSII reaction centres are closed, the energy that cannot be

used in photosynthesis has to be dissipated in the form of heat. The

AtRD29::HvCBF4 plants and the NT have consistently shown higher heat

dissipation than the Ubi::HvCBF4 plants. Taken together, these results reveal that

the Ubi::HvCBF4 plants are photosynthetically more efficient than the other two

47

Tiago Lourenço

plant lines. This may be due to some kind of thylacoidal protection or to better

stomatal regulation. However, to test these hypotheses further analysis should be

conducted such as carbon fixation rate and stomatal conductance in a gas

exchange chamber (IRGA). Similar results were obtained by Savitch et al. (2005).

The overexpression of two Brassica napus CBF/DREB1-like in B. napus resulted

in increased photosynthetic capacity of the transgenic plants. The non-acclimated

transgenic plants had higher photochemical efficiency of photosynthesis and

increased capacity for linear electron transfer (ETR). The qP and the qN

parameters were also measured in the Savitch and colleagues work. Their results

have shown higher open reaction centres in the transgenic plants than NT plants.

The transgenic plants also had lower heat energy dissipation when compared to

NT plants (Savitch et al., 2005).

The leaf relative water content (RWC) results (Fig. 4B) have shown that

the Ubi::HvCBF4 always had a better water content during all drought stress

period. A possible explanation to this fact may be that these plants have a better

stomatal conductance or better water uptake in the roots. However, it is still not

clear why the AtRD29A::HvCBF4 plants had better water content than NT plants

on day 6 while on day 11, this result was the opposite. A possible explanation is

the fact that the RD29A promoter from Arabidopsis may be only partially effective

on rice. Ito et al. (2006) reported the fact that Arabidopsis RD29A promoter only

functions in rice roots, however we could detect HvCBF4 gene expression in roots

and shoots of the transgenic AtRD29A::HvCBF4 plants after 2h of drought (Fig.

2B). Thus, it is still not clear why AtRD29A::HvCBF4 plants have lower RWC than

NT by the end of the drought stress.

The low-temperature dependent binding to the DRE/CRT motif of

HvCBF4 and the phylogenetically related HvCBF2 (Xue, 2003) have been

previously described in barley (Skinner et al., 2005). In rice, gene activation

occurred even in normal conditions revealing that, at least in this species, there is

no need of low-temperature dependent binding for gene activation.

The analysis of genes up-regulated in the HvCBF4 transgenic plants was

performed using an Affymetrix Rice Whole Genome array with 51.279 probe

transcripts from two rice subspecies (japonica and indica). In a recent work (Oh et

al., 2007), 15 rice genes were identified as HvCBF4 target genes. However, our

48


array results showed that some of the 15 rice genes activated by HvCBF4 in Oh

et al. (2007) work, had little or no expression change. In fact, surprisingly, we

detected more than 500 genes differentially expressed in the AtRD29A::HvCBF4

plants. Some of the activated genes may be related to stress derived from tissue

culture (although we used T2 homozygous plants), but almost all the selected

genes (Table 3) in the top-50 up-regulated genes had a DRE1 (G/ACCGAC) or

DRE2 (G/ATCGAC) (Xue, 2003) cis-motif in the promoter region (Table 3 and

Table S1). The HvCBF4 transcription factor may act as a master-switch, because

several other transcription factors were up-regulated (a NAM, an AP2/ERF

domain TF, a putative CRT/DRE factor1, a transcription factor CBF1, and a

WRKY-binding domain TF). Since other DREB1/CBF genes were activated, it is

difficult to understand which genes are the direct targets of the HvCBF4 protein.

However, stress related genes have been activated like cytochromes P450 and

alpha-amylase which is similar to what has been described in other reports (Ito et

al., 2006; Oh et al., 2007). Genes encoding proteins like a cysteine proteinase

precursor, trehalose-6-phosphate phosphatase (Garg et al., 2002) and a dehydrin

Rab16b (the last two are known to respond to water stress) (Ono et al., 1996)

were also up-regulated in our transgenic rice plants. These genes have been

previously linked to abiotic stress tolerance.

In order to validate our results of the Affymetrix array, we further analyzed

the expression of several genes by RT-PCR including genes detected in other

reports using DREB1/CBF overexpression in rice (Ito et al., 2006; Oh et al.,

2007). Both under control and stress conditions, the Ubi::HvCBF4 did in fact

activate the expression of genes reported in the work of Oh and co-workers

(2007) (Fig. 5). Surprisingly however, this transgenic line did not activate the

expression of the genes up-regulated in our work. In contrast, AtRD29A::HvCBF4

expression activated, in RT-PCR analyses, the expression of the genes we

selected from the microarray study. However, activation only occurred in the roots

(Fig. 5). NAM and Rab16 genes showed up-regulation in shoots, however Rab16

was not up-regulated in the roots. The up-regulation of these genes in shoots

could be because NAM and Rab16b genes are not direct target-genes of HvCBF4

transcription factor. Therefore, their expression change could be related to the

expression of other transcription factors up-regulated eventually by HvCBF4. For

49

Tiago Lourenço

us, it is still not clear why different genes are activated depending on the promoter

used. Apparently, the low expression levels of HvCBF4 gene in the

AtRD29A::HvCBF4 plants (Fig. 2B) were enough to cause an expression change,

even in the absence of stress conditions, due to a leaky-expression of the

promoter (data not shown). The leaky-expression of AtRD29A promoter has been

also reported by other authors (Pino et al., 2007). Nevertheless, despite the fact

that several stress related genes were up-regulated, these plants failed to survive

under drought, cold or salt stress. This effect may be justified by a better function

of the RD29A promoter in roots than in shoots. This hypothesis was also raised in

other reports (Ito et al., 2006). Other stress-inducible promoters that could

function in rice whole plant should be identified in order to develop abiotic-stress

tolerant cultivars without stunting growth and reduced productivity. The

Ubi::HvCBF4 plants were able to survive under drought stress and the plants

showed consistently better chlorophyll fluorescence parameters as compared to

the other transgenic line and NT. However, none of the genes that showed up-

regulation in the Affymetrix rice array could be amplified by RT-PCR for this line

(Fig. 5). The Ubi::HvCBF4 plants could, however, activate the expression of

genes described in the work of Oh et al. (2007) as target genes for HvCBF4 (Fig.

5). One possible hypothesis for this could be the formation of transcription factor

complexes due to the high level of expression in this transgenic line. These

complexes could in turn activate genes different from the ones activated by a

single transcription factor. The genes activated in this transgenic line seem to be

enough to induce drought stress tolerance, and should be further investigated.

The discrepancy of activated gene expression occurring between two different

promoters, as revealed in our work, is a remarkable feature that, to the best of our

knowledge, is being reported for the first time.

Experimental Procedures Genetic construct preparation

The GATEWAY® (Invitrogen, USA) system was used to prepare the genetic

constructs used in this work. We cloned the HvCBF4 cDNA from a plasmid kindly provided

by Dr. Timothy Close (Choi et al., 2002) using GATEWAY® designed primers (GGG GAC

AAG TTT GTA CAA AAA AGC AGG CTT AGA AAT GGA CGT CGC CGA CA and GGG

50


GAC CAC TTT GTA CAA GAA AGC TGG GTC AAA TTA GCA GTC GAA CAA ATA GCT

C, the underlined regions are the attB regions for recombination on destiny GATEWAY®

vector). The amplified HvCBF4 cDNA was then cloned in plasmids derived from the

pH7WG2 (Uni. Ghent, Belgium) having the maize Ubi (Christensen and Quail, 1996) or the

AtRD29A promoters instead of the CaMV 35S promoter (Saibo et al., unpublished results)

on the 5’-end of the GATEWAY® cassette. The Ubi::HvCBF4 or the AtRD29A::HvCBF4

genetic constructs were then introduced in the appropriate Agrobacterium tumefaciens

strain (LBA4404) using a freeze-thaw protocol (Chen et al., 1994).

DREB1/CBF alignments and phylogenetic analysis The protein sequence alignment was made using the ClustalW and refined using

the GeneDoc software (http://www.psc.edu/biomed/genedoc). Phylogenetic analyses on

the refined alignments and phylogenetic trees were done using the MEGA 4 software

(http://www.megasoftware.net) (Tamura et al., 2007). The phylogenetic trees were

generated through the Neighbor Joining methodology on 1000 bootstrap replications.

Production of HvCBF4 transgenic rice plants For the production of transgenic rice plants, we used a protocol based essentially

on Hiei et al. (1994) with modifications (Rueb et al., 1994). We used rice (Oryza sativa L.

cv. Nipponbare) seeds dehusked and treated with a solution of 1 g/L of benlate for 30 min

at 50ºC for elimination of possible fungal contamination. After being washed twice with

sterile water to remove the excess of benlate solution, we surface sterilized the seeds with

a solution of 70% (v/v) ethanol for 1 min with gentle shaking. The seeds were then washed

twice with sterile water and further sterilized with a 2% (v/v) sodium hypochlorite solution

(commercial bleach solution diluted 1:1 in water) with 2-3 drops of Tween® 20 (Sigma,

USA) for 20-25 min with agitation. The seeds were then washed thoroughly for 6-7 times

with sterile water to remove the traces of bleach and placed on callus induction medium for

4 weeks (sub-cultured every 2 weeks). Embryogenic callus tissues were selected and co-

cultivated with Agrobacterium tumefaciens (LBA4404 strain) and incubated for 3 days at

25ºC in the dark on co-cultivation medium. The co-cultivated calluses were transferred to

selection medium supplemented with 50mg/L of Hygromycin B (Duchefa, The Netherlands)

for 4-5 weeks at 28ºC in the darkness (sub-cultured every 10-12 days). Hygromycin B-

resistant callus were then transferred to callus embryogenic improvement medium (with

coconut water, Sigma, USA) supplemented with 100mg/l of Hygromycin B for 4 weeks at

28ºC in the dark (sub-cultured every 2 weeks). After embryogenic improvement,

hygromycin-resistant callus were then transferred to regeneration medium for 2-3 weeks at

51

http://www.psc.edu/biomed/genedoc

Tiago Lourenço

28ºC in the light (12h photoperiod). Regenerating plantlets (with 2-3cm in height) were

transferred to glass tubes (capped with cotton) with plantlet development medium

supplemented with 25mg/L of Hygromycin B for 1 week at 28ºC in the light (12h

photoperiod). Hygromycin-resistant plantlets become evident within a week. The resistant

plantlets were transferred to fresh plantlet development medium without Hygromycin B for

another 2 weeks until a good rooting system developed. Plantlets were then transferred to

pots filled with soil mixture (2:2:1, v/v/v, soil:turf:vermiculite) and placed in the glasshouse.

The plants were grown for further analysis and allowed to self-pollinate to retrieve progeny.

Analysis of putative transgenic plants We collected leaf samples (2-3cm) from putative transgenic rice plants in the

glasshouse and immediately frozen in liquid nitrogen. The samples were stored at -80ºC

until use. For PCR analysis the CTAB protocol (Doyle and Doyle, 1987; Cullings, 1992)

(see Appendix for further notes) was used to extract DNA from the leaf samples. The DNA

was analyzed for its integrity using primers to amplify the rice actin gene. For determining if

the plants had the T-DNA expression cassette integrated in its genome, we used the

HvCBF4 primers (Fw- GAC CAA GTT CCA CGA GAC G and Rv- GCA GTC GAA CAA

ATA GCT CCA) for the gene of interest, the hptII gene primers (Fw- AAT AGC TGC GCC

GAT GGT TTC TAC A and Rv- AAC ATC GCC TCG CTC CAG TCA ATG) for the

selectable marker gene and the maize Ubi1 (Fw- TCT CGA GAG TTC CGC TCC AC and

Rv- ATC TAG AAC GAC CGC CCA AC) or the AtRD29A (Fw- CGT ACG AAG CT TGG

AGG AGC CAT AGA TGC AA and Rv- CGG GAT CCC GCT CTA GAG CCA AAG ATT

TTT TTC TTT CCA ATA G, cloning adaptors are underlined) primers for the promoter

fragment. Only the plants with positive PCR amplification for all the components analyzed

of the T-DNA expression cassette were grown and allowed to self-pollinate to retrieve T1

progeny. The PCR-positive transgenic plants were further analyzed for stable integration of

the transgene by Southern blotting analysis. Leaf samples were collected (1-2 g of tissue),

frozen in liquid nitrogen and stored at -80ºC until use. DNA was extracted using a phenol-

chloroform method (see Appendix) for rice genomic DNA extraction. Fifteen micrograms of

genomic DNA of the PCR-positive plants was digested using the BamHI (Fermentas,

Canada) and EcoRV (Fermentas, Canada) restriction enzymes. The digested genomic

DNA was electrophoretic separated in agarose gel (1.2%) overnight and transferred to a

nylon membrane. The membrane was then hybridized with an Ubi1 probe (Fw- TCT CGA

GAG TTC CGC TCC AC and Rv- ATC TAG AAC GAC CGC CCA AC) using the

Amersham non-radioactive (Gene Images plus CDP-Star detection) chemioluminescent kit

(Amersham, GE Healthcare, UK) following the manufacturer’s instructions.

52


Drought stress treatment for plants grown in soil mixture and growth measurements

Two-week old transgenic and NT plants were used for the stress treatments. The

seeds were surface sterilized and germinated in water for three days in the dark at 28ºC.

After germination the seedlings were grown in Yoshida’s medium (Yoshida et al., 1976) for

1 week (the transgenic seedlings were grown in Yoshida’s medium supplemented with

30mg/L of Hygromicin B) at 28ºC in a 12h photoperiod in a climatic chamber (Aralab,

Portugal). For cold or salt stress treatment the plantlets were further grown for one week in

fresh Yoshida’s medium.

For cold stress treatment, two-week old plantlets were transferred to fresh

Yoshida’s medium and placed in a climatic chamber at 10ºC with a light intensity of approx.

200µmol/m2/s for four days. After cold treatment, the plantlets were transferred back to

28ºC with a light intensity of ~900µmol/m2/s for one week. Plant survival was measured

afterwards.

For salt treatment, two-week old plantlets were transferred to Yoshida’s medium

supplemented with 100mM of NaCl at 28ºC (with a light intensity of ~900µmol/m2/s) for one

week. Plantlets were transferred to Yoshida medium for another week and plant survival

was measured.

For drought stress treatment, one-week old plantlets were transferred to soil

mixture (2:2:1, v/v/v, soil:turf:vermiculite) for another week. The drought stress treatments

were performed in the climatic chamber (Aralab, Portugal) with a light intensity of

~900µmol/m2/s. Water was withheld for 12 days after which plants were re-watered for 1

week.

For the growth measures, transgenic (from both lines) and NT plants (Oryza

sativa cv. Nipponbare) were grown as described above for two weeks and then transferred

to soil mixture and to the glasshouse. The plants were allowed to self-pollinate and growth

measurements were determined afterwards.

Chlorophyll fluorescence analysis The chlorophyll fluorescence analyses were made using the two-week old

transgenic and NT plants grown as for the drought stress treatment. The chlorophyll

fluorescence analyses were made on the youngest fully expanded leaf during the drought-

stress treatment. The selected transgenic and NT plants were measured always in the

same order and a minimum of four plants per transgenic line and NT were used. The

chlorophyll measurements were made using a Mini-PAM (Walz, Germany) and data

retrieved using the Da-Teach software. The selected leaf was dark-adapted for 6 minutes

53

Tiago Lourenço

after which a measuring light was switched on giving the F0 (minimal) fluorescence value

for 1 minute. A pulse of saturating light was then applied allowing the measurement of Fm

(maximum) fluorescence in the dark-adapted state giving also the Fv / Fm ratio (maximum

quantum yield of the PSII). An actinic light is applied at controlled intensities (PAR 120 and

600) for determined intervals of 5 minutes after which a saturating flash of light is applied

allowing the measure of the F’v / F’m ratio (efficiency of the PSII photochemistry). After each

flash of saturating light, a pulse of far-red light is given to empty the PSII reaction centres

of electrons. With this protocol we were able to measure the Fv / Fm ratio, the F’v / F’m ratio

(yield), the ETR (electron transport rate), the qP (photochemical quenching) and qN (non-

photochemical quenching) parameters.

Leaf relative water content analysis The leaf relative water content (RWC) analysis was made using the protocol

described previously elsewhere (Barr and Weatherley, 1962). We used the two-week old

transgenic and NT plants grown as described in the drought stress treatments. We made

the RWC measurements using the youngest fully expanded leaf. A leaf sample was

retrieved from the tested plants and measured the fresh weight (FW). After measuring the

leaf sample FW, the leaf was placed in distilled water for 1 day and the leaf turgid weight

(TW) was measured. For the leaf dry weight (DW) measurement, the leaf sample was

dried at 80ºC in oven for 2 days. The RWC was determined following the formula:

RWC (%) = ((FW-DW) / (TW-DW))x100

A minimum of four plants of each genetic background were used in each time point

analyzed.

GeneChip® Rice Genome Array and data analysis We used for the analysis 2 independent sets of six seedlings each (from the

transgenic line and NT control) and extracted RNA using the RNeasy Plant Mini kit

(Qiagen, USA) following the manufacturer’s instructions. The RNA was processed for

GeneChip® hybridization in the Affymetrix core facility located at the Instituto Gulbenkian

de Ciência (Oeiras, Portugal). The rice array used has to query 51.279 probe transcripts

from 2 rice subspecies (japonica and indica). The GeneChip® hybridization was performed

in duplicate.

The analysis of the data generated by the experiment was performed using the

Partek Genomics Suite software. The Affymetrix CEL files were imported using Robust

Multi-chip Average (RMA) method which includes Log2 transformation of data. For the

54


identification of differentially expressed genes we used the analysis of variance (ANOVA)

and the False Discovery rate (FDR) with a p<0.05 threshold.

Total RNA extraction and cDNA synthesis Transgenic and NT plants were grown as described above for two weeks. The

plantlets were then dried at room temperature on bench top for two hours for drought

stress treatment. A minimum of four plants were used per time point. Shoot and root

samples were collected separately, frozen in liquid nitrogen and kept at -80ºC until use.

Total RNA from roots and shoots was extracted using the TRIZOL® (Invitrogen,

USA) reagent following the manufacturer’s protocol (see Appendix for further notes). For

cDNA synthesis we further treated the total RNA with DNAse (Qiagen, USA) to eliminate

any possible trace of DNA. We preformed the DNAse treatment in the RNA-EZ columns

from Qiagen (USA) and used the manufacturer’s RNA-clean up protocol. For cDNA

synthesis we used 500ng of total RNA using the Invitrogen (USA) cDNA synthesis kit

following the manufacturer’s instructions using oligo-dT (Invitrogen, USA) as primer for

first-strand synthesis.

RT-PCR (reverse transcriptase-PCR) analysis For the detection of selected target gene expression by RT-PCR we used primers

(list of primers available as supplementary material, Table S2) designed using the online

program Primer 3 (http://frodo.wi.mit.edu) at a final PCR reaction concentration of 10 pmol.

As template for the PCR reaction we used 0.5 µL of cDNA (corresponding to 12.5 ng of

total RNA). As PCR control we used the rice actin gene cDNA. PCR was performed using

the following conditions: 95ºC for 5 minutes for denaturing cDNA, 25-28 cycle of 95ºC for 1

minute, 53º-57ºC for 1 minute and 72ºC for 1 minute. A final extension step was made for 5

minutes at 72ºC. The PCR products were resolved on 1% agarose gel stained with

ethidium bromide. Each PCR was repeated twice for validation.

References Barr HD, Weatherley PE (1962) A re-examination of the relative turgidity technique for estimating

water deficit in leaves. Australian Journal of Biological Sciences 15: 413-428 Behnam B, Kikuchi A, Celebi-Toprak F, Kasuga M, Yamaguchi-Shinozaki K, Watanabe KN

(2007) Arabidopsis rd29A::DREB1A enhances freezing tolerance in transgenic potato. Plant Cell Rep 26: 1275-1282

Bhatnagar-Mathur P, Devi MJ, Reddy DS, Lavanya M, Vadez V, Serraj R, Yamaguchi-Shinozaki K, Sharma KK (2007) Stress-inducible expression of At DREB1A in transgenic peanut (Arachis hypogaea L.) increases transpiration efficiency under water-limiting conditions. Plant Cell Rep 26: 2071-2082

Boyer JS (1982) Plant Productivity and Environment. Science 218: 443-448

55

Tiago Lourenço

Chen H, Nelson RS, Sherwood JL (1994) Enhanced recovery of transformants of Agrobacterium tumefaciens after freeze-thaw transformation and drug selection. BioTechniques 16: 664-668

Choi DW, Rodriguez EM, Close TJ (2002) Barley Cbf3 gene identification, expression pattern, and map location. Plant Physiol 129: 1781-1787

Christensen AH, Quail PH (1996) Ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable marker genes in monocotyledonous plants. Transgenic Res 5: 213-218

Cullings KW (1992) Design and testing of a plant-specific PCR primer for ecological and evolutionary studies. Molecular Ecology 1: 233-240

Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry Bulletin 19: 11-15


Fowler S, Thomashow MF (2002) Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell 14: 1675-1690

Fryer MJ, Andrews JR, Oxborough K, Blowers DA, Baker NR (1998) Relationship between CO2 assimilation, photosynthetic electron transport, and active O2 metabolism in leaves of maize in the field during periods of low temperature. Plant Physiol 116: 571-580

Garg AK, Kim JK, Owens TG, Ranwala AP, Choi YD, Kochian LV, Wu RJ (2002) Trehalose accumulation in rice plants confers high tolerance levels to different abiotic stresses. Proc Natl Acad Sci U S A 99: 15898-15903

Genty B, Briantais J-M, Baker NR (1989) The relationship between quantum yield of photosynthetic electron transport and quenching of chlorophyll fluorescence. Biochimica et Biophysica Acta 990: 87-92

Gilmour SJ, Fowler SG, Thomashow MF (2004) Arabidopsis transcriptional activators CBF1, CBF2, and CBF3 have matching functional activities. Plant Mol Biol 54: 767-781

Gilmour SJ, Sebolt AM, Salazar MP, Everard JD, Thomashow MF (2000) Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiol 124: 1854-1865


Haake V, Cook D, Riechmann JL, Pineda O, Thomashow MF, Zhang JZ (2002) Transcription factor CBF4 is a regulator of drought adaptation in Arabidopsis. Plant Physiol 130: 639-648


Hsieh TH, Lee JT, Charng YY, Chan MT (2002) Tomato plants ectopically expressing Arabidopsis CBF1 show enhanced resistance to water deficit stress. Plant Physiol 130: 618-626

IRGSP (2005) The map-based sequence of the rice genome. Nature 436: 793-800 Ito Y, Katsura K, Maruyama K, Taji T, Kobayashi M, Seki M, Shinozaki K, Yamaguchi-Shinozaki

K (2006) Functional analysis of rice DREB1/CBF-type transcription factors involved in cold-responsive gene expression in transgenic rice. Plant Cell Physiol 47: 141-153


Jaglo KR, Kleff S, Amundsen KL, Zhang X, Haake V, Zhang JZ, Deits T, Thomashow MF (2001) Components of the Arabidopsis C-repeat/dehydration-responsive element binding factor cold-response pathway are conserved in Brassica napus and other plant species. Plant Physiol 127: 910-917

Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1999) Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nat Biotechnol 17: 287-291

Kasuga M, Miura S, Shinozaki K, Yamaguchi-Shinozaki K (2004) A combination of the Arabidopsis DREB1A gene and stress-inducible rd29A promoter improved drought- and low-temperature stress tolerance in tobacco by gene transfer. Plant Cell Physiol 45: 346-350

Khush GS (2005) What it will take to feed 5.0 billion rice consumers in 2030. Plant Mol Biol 59: 1-6

56



Maxwell K, Johnson GN (2000) Chlorophyll fluorescence--a practical guide. J Exp Bot 51: 659-668 Nakashima K, Shinwari ZK, Sakuma Y, Seki M, Miura S, Shinozaki K, Yamaguchi-Shinozaki K

(2000) Organization and expression of two Arabidopsis DREB2 genes encoding DRE-binding proteins involved in dehydration- and high-salinity-responsive gene expression. Plant Mol Biol 42: 657-665


Oh SJ, Kwon CW, Choi DW, Song SI, Kim JK (2007) Expression of barley HvCBF4 enhances tolerance to abiotic stress in transgenic rice. Plant Biotechnol J 5: 646-656

Oh SJ, Song SI, Kim YS, Jang HJ, Kim SY, Kim M, Kim YK, Nahm BH, Kim JK (2005) Arabidopsis CBF3/DREB1A and ABF3 in transgenic rice increased tolerance to abiotic stress without stunting growth. Plant Physiol 138: 341-351

Ono A, Izawa T, Chua NH, Shimamoto K (1996) The rab16B promoter of rice contains two distinct abscisic acid-responsive elements. Plant Physiol 112: 483-491

Pellegrineschi A, Reynolds M, Pacheco M, Brito RM, Almeraya R, Yamaguchi-Shinozaki K, Hoisington D (2004) Stress-induced expression in wheat of the Arabidopsis thaliana DREB1A gene delays water stress symptoms under greenhouse conditions. Genome 47: 493-500

Pino MT, Skinner JS, Park EJ, Jeknic Z, Hayes PM, Thomashow MF, Chen TH (2007) Use of a stress inducible promoter to drive ectopic AtCBF expression improves potato freezing tolerance while minimizing negative effects on tuber yield. Plant Biotechnol J 5: 591-604

Rueb S, Leneman M, Schilperoort RA, Hensgens LAM (1994) Efficient plant regeneration through somatic embryogenesis from callus induced on mature rice embryos (Oryza sativa L.). Plant Cell, Tissue and Organ Culture 36: 259-264

Sakamoto H, Maruyama K, Sakuma Y, Meshi T, Iwabuchi M, Shinozaki K, Yamaguchi-Shinozaki K (2004) Arabidopsis Cys2/His2-type zinc-finger proteins function as transcription repressors under drought, cold, and high-salinity stress conditions. Plant Physiol 136: 2734-2746

Sakuma Y, Maruyama K, Osakabe Y, Qin F, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2006) Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in drought-responsive gene expression. Plant Cell 18: 1292-1309

Savitch LV, Allard G, Seki M, Robert LS, Tinker NA, Huner NP, Shinozaki K, Singh J (2005) The effect of overexpression of two Brassica CBF/DREB1-like transcription factors on photosynthetic capacity and freezing tolerance in Brassica napus. Plant Cell Physiol 46: 1525-1539

Seki M, Narusaka M, Abe H, Kasuga M, Yamaguchi-Shinozaki K, Carninci P, Hayashizaki Y, Shinozaki K (2001) Monitoring the expression pattern of 1300 Arabidopsis genes under drought and cold stresses by using a full-length cDNA microarray. Plant Cell 13: 61-72

Shinozaki K, Yamaguchi-Shinozaki K, Seki M (2003) Regulatory network of gene expression in the drought and cold stress responses. Curr Opin Plant Biol 6: 410-417

Skinner JS, von Zitzewitz J, Szucs P, Marquez-Cedillo L, Filichkin T, Amundsen K, Stockinger EJ, Thomashow MF, Chen TH, Hayes PM (2005) Structural, functional, and phylogenetic characterization of a large CBF gene family in barley. Plant Mol Biol 59: 533-551

Stockinger EJ, Gilmour SJ, Thomashow MF (1997) Arabidopsis thaliana CBF1 encodes an AP2 domain-containing transcriptional activator that binds to the C-repeat/DRE, a cis-acting DNA regulatory element that stimulates transcription in response to low temperature and water deficit. Proc Natl Acad Sci U S A 94: 1035-1040

Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596-1599

Thomashow MF (1999) PLANT COLD ACCLIMATION: freezing tolerance genes and regulatory mechanisms. Annu Rev Plant Physiol Plant Mol Biol 50: 571-599

Umezawa T, Fujita M, Fujita Y, Yamaguchi-Shinozaki K, Shinozaki K (2006) Engineering drought tolerance in plants: discovering and tailoring genes to unlock the future. Curr Opin Biotechnol 17: 113-122

Vogel JT, Zarka DG, Van Buskirk HA, Fowler SG, Thomashow MF (2005) Roles of the CBF2 and ZAT12 transcription factors in configuring the low temperature transcriptome of Arabidopsis. Plant J 41: 195-211

57

Tiago Lourenço

Wang W, Vinocur B, Altman A (2003) Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance. Planta 218: 1-14

Xue GP (2003) The DNA-binding activity of an AP2 transcriptional activator HvCBF2 involved in regulation of low-temperature responsive genes in barley is modulated by temperature. Plant J 33: 373-383


Yoshida S, Forno DA, Cock JH, Gomez KA (1976) Laboratory manual for physiological studies of rice. International Rice Research Institute, Manila (The Philippines)

Zhang JZ, Creelman RA, Zhu JK (2004) From laboratory to field. Using information from Arabidopsis to engineer salt, cold, and drought tolerance in crops. Plant Physiol 135: 615-621

58


Supplementary material Table S1. Analysis of the closest cis-motifs to the ATG start codon The closest 3 cis-motifs (only selected motifs) in the promoters are assigned to proximity of the start codon (ATG). The number 1 represents the closest motif to the ATG codon of the 3 cis-motifs in the promoter. Motifs in capital letters are in sense orientation and in small letters in reverse orientation. The genes in italic are genes that were up-regulated in transgenic plants in other papers (Oh et al., 2007; Ito et al., 2005) and compared with our data set.

0ABRE (TACGTG)DRE 1 (gccgac)DRE 2

(ATCGAC)Proline-rich

proteinOs10g05980Os.11398.1.S1_at

0ABRE (tacgtg)ABRE (cacgta)ABRE (tacgtg)Leucine-rich repeat proteinOs02g40260Os.4614.1.S1_a_at

0DRE 1 (ACCGAC)

DRE 2 (GTCGAC)

DRE 2 (ATCGAC)Cytochrome P450Os02g36190Os.23518.1.A1_at

0,18DRE 2 (gtcgac)ABRE (cacgtg)DRE 2 (atcgac)Wsi724/Lip5Os03g45280Os.3411.1.S1_s_at

0ABRE (CACGTA)

ABRE (CACGTA)ABRE (tacgtg)Alpha-amylase

(RAmy3D)Os08g36910Os.10908.4.S1_at

0,68DRE 1 (GCCGAC)DRE 1 (gccgac)DRE 1

(GCCGAC)COR410-Dip1/

Lip9Os02g44870Os.12167.1.S1_at

0ABRE (tacgtg)DRE 1 (accgac)DRE 1 (accgac)Jacalin 2Os12g09700Os.18585.1.S1_at

0ABRE (CACGTG)

ABRE (CACGTG)

DRE 2(atcgac)Jacalin 1Os12g14440Os.6863.1.S1_at

19,20DRE 2 (GTCGAC)DRE 2 (gtcgac)DRE 2 (atcgac)

SAM dependent carboxyl

methyltransferaseOs02g48770Os.11812.1.S1_at

95,47---Helix-loop-helix

DNA-binding domain

Os04g23550Os.6043.1.S1_at

2,15ABRE (CACGTA)DRE 2 (gtcgac)DRE 2

(ATCGAC)Rab16b-dehydrinOs11g26780Os.51718.1.S1_at

2,9ABRE (tacgtg)DRE 1 (accgac)DRE 1 (accgac)Alpha-amylase precursorOs02g52710Os.49249.1.S1_at

3,39DRE 1 (accgac)ABRE (CACGTA)ABRE (cacgtg)WRKY-binding

domainOs01g60600OsAffx.9584.1.S1_at

12,04ABRE (cacgta)DRE 2 (ATCGAC)ABRE (cacgtg)

Trehalose-6-phosphate

phosphataseOs02g44230Os.6092.1.S1_at

14,59DRE 1 (gccgac)DRE 2 (atcgac)DRE 2 (atcgac)Cysteine

proteinaseprecursor

Os01g67980Os.4181.1.s1_at

23,27ABRE (CACGTG)DRE 1 (accgac)ABRE

(CACGTG)Transcription factor CBF1Os06g03670OsAffx.27442.1.s1_at

32,59--DRE 2 (gtcgac)Putative CRT/DRE factor1Os02g45450Os.51078.1.S1_at

17,01DRE 2 (gtcgac)DRE 1 (gccgac)DRE 1 (GCCGAC)Putative NAMOs10g25620OsAffx.20377.1.S1_x_at

34,03DRE 1 (accgac)DRE 1 (accgac)DRE 1 (ACCGAC)AP2/ERF domain Os02g52670Os.54944.1.S1_at

9,66ABRE (CACGTG)DRE 1 (accgac)DRE 1 (gccgac)Putative

cytochrome P450Os07g44140Os.9067.1.S1_at

58,25ABRE (CACGTG)

ABRE (CACGTG)

DRE 2 (ATCGAC)Cytochrome P450Os12g05440Os.51923.1.S1_at

175,86ABRE (CACGTG)ABRE (cacgtg)ABRE (cacgta)Expressed

proteinOs03g0115800Os.8823.1.S1_at

Fold change(d)321Gene nameLocusAffy ID

59

Tiago Lourenço

Table S2. Target gene specific primer pairs for PCR Primer pairs were designed using the Primer 3 software using the longest gene cDNA available in the public database. “Fw” designates the left-forward primer and “Rv” the right-reverse primer.

Fw – CTAGTTCTCCTCGGCGTTTG Rv – ACGATCTTGGATGGCTCTTGProline-rich proteinOs10g05980Os.11398.1.S1_at

Fw- ATTCTAAGGCGCTCCTCCTCRv- GCAGTTGTTCCTGACGTTGALeucine-rich repeat proteinOs02g40260Os.4614.1.S1_a_at

Fw - TCCCAGTTACCGACGAAATC Rv - GCCAAATGGAAGGAATTCAACytochrome P450Os02g36190Os.23518.1.A1_at

Fw - CTTGTTCAGGGCAACCAGAT Rv- TGCCATAGCAAACTGTCCTGJacalin 1Os12g14440Os.6863.1.S1_at

Fw - AAGCTCCAGCTCGTCGTCTRv - ACAAAGCTTGCAATGGCATC

Rab16b-dehydrinOs11g26780Os.51718.1.S1_at

Fw – CACCACCAAGGGCATCCTRv - TCGTGGACAATTGCATCCAlpha-amylase precursorOs02g52710Os.49249.1.S1_at

Fw – CTGAACATTTGAAGTGCAACGRv - AGGACATTTTGCCATCCAAG

Trehalose-6-phosphate phosphataseOs02g44230Os.6092.1.S1_at

Fw - GCGTTCGAGTACATCAAGCARv - ATCGATCGACCTCACCTCAC

Cysteine proteinaseprecursorOs01g67980Os.4181.1.s1_at

Fw - CCATGATGATGCAGTACCAGRv - AAAATCTCCATTAATTTCTCCTACAGTranscription factor CBF1Os06g03670OsAffx.27442.1.s1_at

Fw – CAACGTCGTACATGCTGGAARv – CGTCTCCATCACCTCCATCTPutative NAMOs10g25620OsAffx.20377.1.S1_x_at

Fw – CGAGGGGAGCAGGTACAGRv – GCGGGGAACAGTAGTAAAGGAP2/ERF domainOs02g52670Os.54944.1.S1_at

Fw - TCAGCTACGAGCACCTGAAGCRv - AACGCGTCTGATCTTCACTGG

Cytochrome P450Os12g05440Os.51923.1.S1_at

Primer pairGene nameLocusAffy ID

60

Chapter 3 Isolation and characterization of the rice (Oryza sativa L.) OsHOS1 gene Lourenço, T.(1), Saibo, N.(1), Pinto Ricardo, C.(1,2) and Oliveira, M. M.(1,3) Isolation and characterization of the rice (Oryza sativa L.) OsHOS1 gene (in preparation) (1) ITQB/IBET, Quinta do Marquês, 2784-505 Oeiras, Portugal (2) Instituto Superior de Agronomia, UTL, Tapada da Ajuda, 1349-017 Lisboa, Portugal (3) Dep. Biologia Vegetal, Fac. Ciências de Lisboa, 1749-016 Lisboa, Portugal

Tiago Lourenço

Chapter Index Abstract…………………………………………………….…………………………..63 Introduction………………………………………………….…………………………65 Results………………………………………………………….………………………67 Identification of OsHOS1….….....….…..…..…..….….….…..…….….……67 RNA interference (RNAi) silencing of OsHOS1……..….….…...…...…..67 Effect of OsHOS1 silencing in gene expression….....….…..…..….….….70 Detection of OsICE1 protein….……..….….…….….…...….…………..…..71 Cold acclimation and cold survival tests….…….….….….….….….……71

Discussion……………………………………………………….…………………….71 Experimental procedures……………………………………….…………………...73 Identification and cloning of the OsHOS1 gene…..…..…..….…...….……73 Preparation of the RNA interference (RNAi) genetic construct..…..…….73 Production of transgenic RNAi::OsHOS1 rice plants.…..…..…...….….…73 Analysis of putative transgenic plants…....…....…….….…….….….….….74 Stress treatment and total RNA extraction…..….….….….….….….…….75 Gene expression analysis….…...……….….….….….……….….….….…..75 Detection of small interference RNA (siRNA) in transgenic RNAi plants.76 Protein extraction and analysis of OsICE1 protein.….……..….…..…..….77 Electrolyte leakage test….….….….….….….….….…….….….….…….….77

References………………………………………………………….………………….77 Supplementary material…………………………………………….……………...79

62


Abstract Rice (Oryza sativa L.) production is mainly limited to warmer temperatures, which

may indicate that rice does not cold acclimate very efficiently. However, the

mechanisms underlying cold-stress tolerance in rice are still not fully understood.

In this work, we isolated the rice orthologue of the HOS1 gene which is involved

in the cold signal transduction in Arabidopsis. The isolated rice gene was named

OsHOS1 and its function studied through a RNA interference (RNAi) transgenic

approach. The RNAi::OsHOS1 plants showed, under cold stress, a higher

expression of the OsDREB1A gene and of other stress-responsive genes.

However, these plants did not shown enhanced cold tolerance either in survival or

cold acclimation tests. Although, we could not prove a specific interaction

between the OsHOS1 and OsICE1, the rice HOS1 encodes a protein with a

function apparently similar to the one observed in Arabidopsis. Further analysis

must be performed to fully understand if/how the OsHOS1 regulates the cold

transduction pathway in rice.

63

Tiago Lourenço

64


Introduction

Abiotic stresses (cold, drought and salt stress) are major constrains to

agronomical productivity worldwide. Low temperature is a major constrain to the

geographical distribution of plants (Guy, 1990). Plants have evolved mechanisms

to respond and adapt to low temperature through processes involving membrane

stabilization, synthesis and accumulation of specific solutes and changes in

enzyme activity in a process known as cold acclimation (Thomashow, 1999).

However, the molecular mechanisms underlying this process are not fully

understood and have been under focus in the past years in order to develop more

cold-tolerant crops. The promoter of several cold-stress responsive genes

contains the DRE/CRT (dehydration-responsive element/C-repeat binding)

(CCGAC) cis-motif (Yamaguchi-Shinozaki and Shinozaki, 1994) which is

essential for the stress-inducible genes expression. A group of specific

transcription factors (TFs) with unique characteristics, belonging to the AP2/ERF

superfamily, was found to bind and control the expression of the stress-inducible

genes with the CRT/DRE cis-motif. This group of TFs was named DREB1/CBF

regulon (Stockinger et al., 1997; Gilmour et al., 1998; Liu et al., 1998). The names

DREB1 (A, B or C)/CBF (3, 1 or 2 respectively) are due to the two different teams

who isolated and published about these TFs, at the same time. DREB1/CBF

genes are rapidly and transiently up-regulated upon cold-stress, to which they

were found to respond in an ABA-independent manner.

The HOS1 (high expression of osmotically responsive gene 1) was first

identified in Arabidopsis through a mutation approach. The hos1 mutant plants

showed an increased expression of cold-stress associated genes (Ishitani et al.,

1998) like the DREB1/CBF regulon but, however, did not show increased cold-

tolerance when compared to non-transformed (NT) plants. Nevertheless, the

mutant plants regain the same degree of freezing tolerance after a few days of

cold acclimation. With reduced freezing tolerance, albeit the enhanced expression

of cold-stress responsive genes, these mutant plants also showed early flowering

when compared to NT plants. This is correlated with lower levels of expression of

the Flowering Locus C (FLC) gene (Lee et al., 2001). Recently, the HOS1 protein

as been described as a RING E3 ubiquitin ligase that mediates the degradation of

65

Tiago Lourenço

the ICE1 (Inducer of CBF expression 1) protein (Chinnusamy et al., 2003) during

cold-stress (Dong et al., 2006). This was the first time that the

ubiquitin/proteasome pathway was described as involved in the control of the

cold-stress response. The ICE1 is a MYC-like bHLH (basic Helix-Loop-Helix)

transcription factor and it is thought to be the major responsible for the activation

of DREB1A/CBF3 gene expression (Chinnusamy et al., 2003). The higher

expression of cold stress responsive genes, like the CBF3/DREB1A, in the hos1

mutant plants is achieved through the stabilization of the ICE1 protein. However,

it is still not clear why the plants with higher expression of the DREB1/CBF

regulon show lower cold-stress tolerance.

The ICE1 TF is detected at normal growth temperatures but the

DREB1A/CBF3 expression is only transiently detected after periods of cold

treatment. This suggested that there might be some post-translational

modifications to ICE1. Recently, the sumoylation pathway has also been

implicated in the post-translational modification of ICE1 through the action of

SIZ1, an E3 SUMO (small ubiquitin-related modifier) ligase (Miura et al., 2007).

The SUMO proteins are transferred in a reversible way to other proteins and can

be involved in several cellular mechanisms like transcriptional regulation,

apoptosis, protein stability (competing with the ubiquitination pathway) and

response to stress. Transcription factors, like the ICE1, can be direct targets of

SUMO conjugation which is mediated by SIZ-like proteins (Gill, 2005) conferring

enhanced protein stability to degradation by the ubiquitin pathway.

In our study, we have isolated the rice HOS1 orthologue which was

named OsHOS1. Through a transgenic approach, we generated RNA

interference (RNAi) plants to silence the OsHOS1 expression and analyze its

function. As part of the mechanism of gene silencing through RNAi, we were able

detect in the transgenic plants the characteristic small interference RNAs

(siRNAs) specific for OsHOS1. The function of the isolated OsHOS1 gene, and

the protein predicted as part of the cold stress response in rice will be discussed.

66


Results

Identification of OsHOS1 We used the HOS1 (NP 181511) amino acids sequence from Arabidopsis

to blast the rice genome in search of homologies (Altschul et al., 1997) with a

putative OsHOS1. Two BACs (OSJNBa0084L17 and OSJNBb0016H12) were

identified with a genomic sequence encoding proteins with high homology to the

HOS1. However, these two BACs had different gene prediction for the same

genomic region. Therefore, we decided to design primers for each of the

predicted rice genes in the two BAC clones (S-Fw; F-Fw; F-Rv; L-Rv) available in

public databases. The primers were used in different combinations (S-Fw/F-Rv;

F-Fw/F-Rv; S-Fw/L-Rv and F-Fw/L-Rv) for RT-PCR (reverse transcriptase-PCR)

(Fig. 1A). Only the combinations S-Fw/F-Rv and S-Fw/L-Rv were able to produce

amplifications (Fig.1A) revealing that the F-Fw primer, that was only able to

produce amplifications on genomic DNA (data not shown), was located at an

intron region. To identify the full sequence of the putative OsHOS1, other primers

were designed and the PCR products were cloned and sequenced. The

sequencing revealed a coding sequence of 2842bp and a predicted protein of 942

amino acids (Fig. 1B). The protein sequence had a 48.7% homology with the

HOS1 protein of Arabidopsis and the E3 ubiquitin ligase features such as the

RING domain (Fig. 1B). RNA interference (RNAi) silencing of OsHOS1

We decided to study the function of OsHOS1 in rice. To accomplish this,

we prepared a genetic construct to silence the expression of OsHOS1 using a

RNAi vector (pANDA) (Miki and Shimamoto, 2004) with GATEWAY© technology.

The vector was introduced in Agrobacterium tumefaciens (LBA4404 strain) and

rice mature seeds (Oryza sativa L., cv. Nipponbare) were transformed using a

protocol from Hiei et al. (1994) with some modifications (Rueb et al., 1994). The

rice transgenic line was analyzed for the presence of OsHOS1 transcripts (Fig. 2)

and compared to non-transformed plants (NT). The RNAi::OsHOS1 line showed

lower expression of the OsHOS1 gene in all the time points analyzed under cold

stress conditions.

67

Tiago Lourenço

Figure 1. Isolation of OsHOS1 gene. (A) RT-PCR products using different primer combination according to the genes predicted in the BACs OSJNBa0084L17 and OSJNBb0016H12. Only the SF and SL primers combinations were able to produce amplifications (~2700bp and ~2800bp respectively) for the OsHOS1 gene isolation. On the right the GeneRuler (Fermentas, Canada) was used as molecular marker (arrows show band sizes of 4000bp, 3000bp, 2000bp and 1500bp from top to bottom). (B) Sequence alignment of the OsHOS1 and Arabidopsis HOS1 (accession nº NP_181511) proteins. The RING finger motif is underlined and a putative nuclear localization signal (NLS) is signalized with asterisks.

68


Because RNAi is mediated through small interference RNA (siRNAs) we decided to purify the small fraction RNA and analyze it by Northern blot hybridizing with

the RNAi OsHOS1 fragment. A hybridization signal for siRNAs was only detected

in the RNAi::OsHOS1 line (Fig. 3). We could detect 2 hybridization signals below

the 25nt band probably corresponding to the typical 21-24nt siRNAs mediating

gene silencing (Hamilton et al., 2002).

RNAi::OsHOS1 NT

Figure 2. Gene expression analysis. The changes in gene expression were analyzed using target gene specific primer pairs (Table S1) for RT-PCR. The genes accession numbers used in this analysis were: OsHOS1, OsICE1 (AK109915), OsSIZ1 (AK105290), P5CS (AY574031) and actin as an internal control. In the lower panel, the OsDREB1a (AF300970) gene expression was analyzed by Northern blot under normal and cold stress (10ºC) conditions. The ethidium bromide staining was used as loading control.

69

Tiago Lourenço

Figure 3. Northern blot analysis of small interference RNA (siRNA). Total RNA from two-week old plants was used to isolate low molecular weight (LMW) RNAs. The two black arrows on the right side indicate the two hybridization signals below the 25 bp molecular ruler band present only in the RNAi::OsHOS1 plants. These hybridization signals correspond to the typical siRNA bands. As loading control, the membrane was probed for 5S rRNA. Effect of OsHOS1 silencing in gene expression

We analyzed the gene expression in the RNAi::OsHOS1 plants and

compared it to NT plants under normal and cold-stress conditions. We selected

to analyze the expression of genes that may be related to OsHOS1 (Fig. 2) like

OsSIZ1, OsICE1 and OsDREB1A (Dubouzet et al., 2003). The expression

changes of OsSIZ1 and OsICE1 were analyzed by RT-PCR. The expression of

these genes was unaltered in both RNAi::OsHOS1 and NT plants under the

tested conditions (Fig. 2).

The expression of OsDREB1A was analyzed by Northern blot. The

RNAi::OsHOS1 plants showed a higher accumulation of OsDREB1A transcripts

than the NT plants after 2 hours of cold stress conditions (Fig. 2, lower panel)

even with a lower amount of total RNA loading (Fig. 2, EtBr panel). In addition, we

analyzed the expression of an OsDREB1A downstream target gene in order to

validate the differences observed in the OsDREB1A gene expression in

RNAi::OsHOS1 plants. The P5CS gene encodes a ∆-pyrroline 5-carboxylase

synthetase which is involved in proline biosynthesis (osmotic adjustment under

cold acclimation) and contains DRE elements in its promoter region (Gilmour et

al., 2000). The expression pattern of this gene can be used to evaluate the

OsDREB1/CBF genetic circuit (de los Reyes et al., 2003), and to distinguish

between cold tolerant and intolerant rice lines (Morsy et al., 2005). Our results

show that the P5CS gene expression is higher in the RNAi::OsHOS1 than in NT

after cold stress (Fig. 2). The increment of expression is also correlated with the

expression peak of OsDREB1a after 2 hours of cold stress (Fig. 2, lower panel).

70


Detection of OsICE1 protein We attempted to detect the OsICE1 protein in the RNAi::OsHOS1 and

NT plants under normal and cold stress conditions by Western blot. We used

polyclonal antibodies raised against a specific oligopeptide of the OsICE1

protein. However, there was not enough time to optimize the Western blot

protocol to detect this protein still within this PhD work.

Cold acclimation and cold survival tests

In order to understand if the higher gene expression of cold-stress

tolerance related genes (e.g. OsDREB1A; Fig. 2, lower panel) in the

RNAi::OsHOS1 plants as compared to NT plants, resulted in higher tolerance to

cold stress, we performed an electrolyte leakage test to asses the integrity of the

cell membrane after cold stress. However, with the used methodology, we were

not able to distinguish differences (if any) between the RNAi::OsHOS1 and NT

plants subjected to cold acclimation (see experimental procedures) for the 12

days and 2 days period of cold stress (6ºC). The cold survival tests also did not

show any significant difference between the two lines (data not shown).

Discussion

In Arabidopsis a genetic locus was identified that negatively regulates the

cold response affecting mainly the DREB1A/CBF3 expression (Ishitani et al.,

1998; Lee et al., 2001). The identified gene was named HOS1 and the

corresponding protein has a RING finger motif. The mechanism by which HOS1

(an E3 ubiquitin ligase) negatively controls the DREB1/CBF expression is related

to the control of ICE1 (Chinnusamy et al., 2003) protein level through the

ubiquitin/proteasome pathway (Dong et al., 2006).

The present work identified the rice (Oryza sativa L.) orthologue of HOS1,

which was named OsHOS1. This protein also had the RING finger motif (Fig. 1 B)

characteristic of other E3 ubiquitin ligases and similar to the HOS1 (Lee et al.,

2001). We analyzed the functional characteristics of the OsHOS1 generating a

transgenic line silencing the expression of the OsHOS1 through RNA interference

(RNAi). The silencing of the OsHOS1 expression resulted in a higher expression

of the OsDREB1A/CBF3 gene and its downstream target stress-responsive

71

Tiago Lourenço

genes such as P5CS. These results were similar to what was shown in the hos1

mutant in Arabidopsis (Lee et al., 2001).

In Arabidopsis, since ICE1 is negatively regulated by HOS1 through the

ubiquitin/proteasome pathway, it would be expected that the silencing of OsHOS1

would not interfere with either the expression of OsICE1 or the expression of

OsSIZ1. In fact, the RNAi::OsHOS1 plants have not shown gene expression

changes of either OsICE1 or OsSIZ1 as compared to NT plants (Fig. 2).

Therefore, and since there was a higher gene expression of OsDREB1A (Fig. 2,

lower panel) in the RNAi::OsHOS1 plants under cold stress, it may be possible

that this is due to a less efficient ubiquitin-mediated degradation of OsICE1

protein after cold treatment. These results suggest that, in rice, there may be a

mechanism of post-translational regulation of the OsICE1 similar to what

observed in Arabidopsis (Miura et al., 2007). Nevertheless, this hypothesis has

not been confirmed in our results because we were still not able to establish an

efficient Western blot protocol using the anti-OsICE1 antibody.

In Arabidopsis, the hos1 mutation caused early flowering (Ishitani et al.,

1998). However, our RNAi::OsHOS1 plants showed flowering retardation when

compared to NT plants (data not shown). We did not analyze the expression level

of flowering related genes in rice such as Hd3a and RFT1, but rice has probably a

different mechanism of OsHOS1 involvement in flowering as compared to

Arabidopsis.

Cold acclimation tests revealed no significant differences in electrolyte

leakage between the silenced line and the NT plants. Additionally, we could not

detect any significant differences in cold survival tests in the same plants either.

The latter result differs from the results observed in the Arabidopsis mutant hos1

(Ishitani et al., 1998) where the mutant plants were less tolerant to chilling stress.

This result may suggest that, despite being a negative regulator of the

DREB1/CBF regulon through the ubiquitin-mediated degradation of OsICE1,

OsHOS1 is somehow necessary for cold acclimation.

Taken together, our results show that rice has also a functional HOS1

protein similar to the one found in Arabidopsis but apparently with some functional

modifications. Further analyses are required to show the interaction of the

72


OsHOS1 with the OsICE1, as well as its putative role in flowering retardation in

rice.

Experimental procedures Identification and cloning of the OsHOS1 gene

In order to identify the rice orthologue of the HOS1 from Arabidopsis (Lee et al.,

2001), we have used the BLASTN tool (Altschul et al., 1997) to scan the rice genome. The

homology search retrieved two BAC clones from the same genome region

(OSJNBa0084L17 and OSJNBb0016H12) with different gene prediction. We have

designed primers (Table S1) with the Primer 3 software (http://frodo.wi.mit.edu) for the

identification of the OsHOS1 gene using as template rice cDNA for PCR. The PCR

products were extracted from the gel and purified using the Wizard SV Gel and PCR

Clean-up system (Promega, USA). The purified bands were then cloned in the pCR2.1

vector (TA Cloning kit, Invitrogen, USA) and sequenced (StabVida, Portugal). The retrieved

sequences were hand-trimmed to remove the pCR2.1 sequence and the longest ORF was

identified as the OsHOS1 gene.

Preparation of the RNA interference (RNAi) genetic construct We used the GATEWAY®-based (Invitrogen, USA) pANDA vector (Miki and

Shimamoto, 2004) to prepare the RNA interference construct used in this work. A 371bp

region from the identified OsHOS1 sequence (including 3’-end and 3’-UTR) was then used

to prepare the RNAi genetic construct. We have designed GATEWAY® primers (GGG GAC

AAG TTT GTA CAA AAA AGC AGG CTTG GTC AAA ATG GTC ACT CAA AGA and GGG

GAC CAC TTT GTA CAA GAA AGC TGG GTT CCT CAA ACA AAT CGC AGT TAC A,

underlined region are the attB regions for recombination with the donor GATEWAY®

vector) with the Primer 3 software to generate the RNAi OsHOS1 fragment. The RNAi

fragment of the OsHOS1 was then cloned in the pANDA vector and introduced in the

appropriate Agrobacterium tumefaciens strain (LBA4404) through a freeze-thaw protocol

(Chen et al., 1994).

Production of transgenic RNAi::OsHOS1 rice plants For the production of transgenic rice plants, we used a protocol based essentially

on Hiei et al. (1994) with modifications (Rueb et al., 1994). We used rice (Oryza sativa L.

cv. Nipponbare) mature seeds dehusked and treated with a solution of 1 g/L of benlate for

30 min at 50ºC for elimination of possible fungal contamination. After being washed twice

with sterile water to remove the excess of benlate solution, we surface sterilized the seeds

73

Tiago Lourenço

with a solution of 70% (v/v) ethanol for 1 min with gentle agitation. The seeds were then

washed twice with sterile water and further sterilized with a 2% (v/v) sodium hypochlorite

solution (commercial bleach solution dilute 1:1 in water) with 2-3 drops of Tween® 20

(Sigma, USA) for 20-25 min with agitation. The seeds were then washed thoroughly for 6-7

times with sterile water to remove the traces of bleach and placed on callus induction

medium for 4 weeks (sub-cultured every 2 weeks). Embryogenic callus tissues were

selected and co-cultivated with Agrobacterium LBA4404 strain and incubated for 3 days at

25ºC in the dark on co-cultivation medium. The co-cultivated calluses were transferred to

selection medium supplemented with 50mg/L of Hygromycin B (Duchefa, The Netherlands)

for 4-5 weeks at 28ºC in darkness (sub-cultured every 10-12 days). Hygromycin B-resistant

callus were then transferred to callus embryogenic improvement medium (with coconut

water, Sigma, USA) supplemented with 100mg/l of Hygromycin B for 4 weeks at 28ºC in

the dark (sub-cultured every 2 weeks). After embryogenic improvement, hygromycin-

resistant callus were then transferred to regeneration medium for 2-3 weeks at 28ºC in the

light (12h photoperiod). The regenerating plantlets (with 2-3cm in height) were transferred

to glass tubes (capped with cotton) with plantlet development medium supplemented with

25mg/L of Hygromycin B for 1 week at 28ºC under photoperiod conditions (12h).

Hygromycin-resistant plantlets become evident within a week. The resistant plantlets were

transferred to fresh plantlet development medium without Hygromycin B for another 2

weeks until a good rooting system developed. Plantlets were then transferred to pots filled

with soil mixture (2:2:1, v/v/v, soil:turf:vermiculite) and placed in the glasshouse. The plants

were grown for further analysis and allowed to self-pollinate to retrieve progeny.

Analysis of putative transgenic plants Leaf samples (2-3cm) from putative transgenic rice plants were sampled and

immediately frozen in liquid nitrogen. The samples were stored at -80ºC until use. For PCR

analysis we used the CTAB protocol (Doyle and Doyle, 1987; Cullings, 1992) to extract

DNA from the leaf samples. The DNA was analyzed for its integrity using primers to amplify

the rice actin gene. To analyze if the plants had the T-DNA expression cassette integrated

in its genome, we used the OsHOS1 primers (Fw- GGC ACA CTA ACT TAG CAT CTT GG

and Rv- GAG AGG GCT TGA CTT CTT CTG AG) for the fragment of interest (the genomic

sequence harbours an intron), the hptII gene primers (Fw- AAT AGC TGC GCC GAT GGT

TTC TAC A and Rv- AAC ATC GCC TCG CTC CAG TCA ATG) for the selectable marker

gene and the Ubi (Fw- TCT CGA GAG TTC CGC TCC AC and Rv- ATC TAG AAC GAC

CGC CCA AC) primers for the promoter fragment. Only the plants with positive PCR

amplification for all the components analyzed of the T-DNA expression cassette were

allowed to grow and self-pollinate to retrieve T1 progeny. The PCR-positive transgenic

74


plants were further analyzed for stable integration of the transgene by Southern blotting

analysis. 15µg of genomic DNA of the PCR-positive plants was digested using the BamHI

(Fermentas, Canada) and PstI (Fermentas, Canada) restriction enzymes. The digested

genomic DNA was electrophoretic separated in 1.2% agarose gel overnight and

transferred to a Hybond-N+ membrane (Amersham Pharmacia, UK). The membrane was

then hybridized with a Ubi1 probe (Fw- TCT CGA GAG TTC CGC TCC AC and Rv- ATC

TAG AAC GAC CGC CCA AC) using the Amersham non-radioactive Gene Images plus

CDP-Star chemioluminescent kit (GE Healthcare, UK) following the manufacturer’s

instructions.

Stress treatment and total RNA extraction Transgenic and NT plants were grown for 2 weeks in Yoshida’s medium (Yoshida

et al., 1976), however for transgenic plants the medium was supplemented with 30mg/L of

Hygromicin B. Cultures were maintained for two weeks at 28ºC with a 12h photoperiod and

150-200µmol/m2/s light intensity, and then transferred to a 10ºC growth chamber with the

same photoperiod and light intensity for cold treatment. Whole plant samples were

collected at 0h (28ºC), 2h (10ºC), 5h (10ºC) and 24h (10ºC) time points, frozen in liquid

nitrogen and stored at -80ºC until use. A minimum of 4 plants were used per time point of

each transgenic and NT line. Total RNA from whole plants was extracted using the

TRIZOL® (Invitrogen, USA) reagent following the manufacturer’s protocol.

Gene expression analysis For cDNA synthesis we further treated the total RNA with DNAse (Qiagen, USA)

to eliminate any possible trace of DNA. We preformed the DNAse treatment in the RNA-EZ

columns from Qiagen (USA) and used the manufacturer’s RNA-clean up protocol. For

cDNA synthesis we used 1µg of total RNA using the Invitrogen (USA) cDNA synthesis kit

following the manufacturer’s instructions using oligo-dT (Invitrogen, USA) as primer for

first-strand synthesis. For the detection of selected target gene expression by RT-PCR

(reverse transcriptase-PCR) we used primers (list available as supplementary material,

Table S1) designed using the online program Primer 3 at a final PCR reaction

concentration of 10pmol. As template for the PCR reaction we used 0.5µL of cDNA

(corresponding to 25ng of total RNA). The rice actin gene was used as internal control.

PCR was performed using the following conditions: 95ºC for 5 minutes for denaturing

cDNA, 25-28 cycles of 95ºC for 1 minute, 53º-57ºC for 45 seconds and 72ºC for 1 minute.

A final extension period was made at 72ºC for 5 minutes. The PCR products were resolved

75

Tiago Lourenço

in 1% agarose gel stained with ethidium bromide. Each PCR was repeated twice for

validation.

For the Northern blot analysis, 15µg of total RNA was electrophoretic separated in

a denaturant RNA gel (1x MOPS buffer, 2% formaldehyde, 1.2% agarose) and then

transferred to Hybond-N+ membrane (Amersham Pharmacia – GE Healthcare, UK) by

capillary blotting. RNA was fixed to the membrane by baking the membrane for 2 hours at

80ºC. The membrane was then probed with the OsDREB1A (Table S1) fragment using the

Amersham non-radioactive Gene Images plus CDP-Star chemioluminescent kit (GE-

Healthcare, UK) according to manufacturer’s instructions. As loading control for the

Northern blot we used the ethidium bromide staining of the total RNA/lane.

Detection of small interference RNA (siRNA) in transgenic RNAi plants We used a protocol described by Goto et al. (2003) to separate low molecular

weight (LMW) RNAs from total RNA (Goto et al., 2003) with some modifications. A total of

100µg RNA was used from transgenic RNAi and NT plants. An equal volume of a 20%

PEG (MW=8000) 2M NaCl solution was added to each of the total RNA solutions. This

step is to precipitate RNA and (eventual) DNA of high molecular weight. The mixture is

then incubated on ice for at least 30 minutes and centrifuged at 4ºC at 10500g for 30

minutes. The supernatant was collected to a new tube. An equal volume of isopropanol

was added and the mixture was precipitated for 15 minutes on ice. The mixture was

centrifuged at 4ºC at 10500g for 25 minutes and the supernatant discarded. The pellet was

then washed with 70% ethanol and centrifuged at 4ºC at 10500g for 5 minutes. After

discarding the supernatant, the pellet was dried for 10-15 minutes in a flow chamber.

Formamide (15 µL) of was then added and the tube was heated at 65ºC for 15 minutes.

The tube was snap-cooled on ice for 2 minutes and 5µL of loading buffer was added. The

LMW RNAs were separated in a 15% poliacrylamide gel (15% poliacrylamide, 7M urea, 0.5

TBE, 0.1% APS, 1:2000 dilution TEMED) at 200V for 2.5 hours. After electrophoretic

separation, the LMW RNAs were transferred to Hybond-N+ membrane (Amersham

Pharmacia) by capillary blotting. The membrane was washed in 5x SSC for 5 minutes at

RT and air-dried. The RNAs were fixed to the membrane by UV cross-linking (2 minutes at

1200U plus 2 cycles of 1200U) and baked at 80ºC for 2 hours. The membrane was

hybridized using the chemiluminescent kit (GE-Healthcare) using the GW-OsHOS1

fragment as probe following the manufacturer’s instructions. As loading control, we

hybridized the membrane with a 5S RNA probe (Table S1).

76


Protein extraction and analysis of OsICE1 protein Total protein extraction (see Appendix) was performed on RNAi::OsHOS1 and NT

plants in normal conditions and with 24 hours of cold treatment (10ºC). Whole plant

samples were collected after treatment, frozen in liquid nitrogen and stored at -80ºC until

use. The samples were grinded on liquid nitrogen to a fine powder and mixed with 2x SB

(50mM Tris pH 6.8, 100mM DTT, 0.06% bromophenol blue, 15% glycerol, 2% SDS) (3mL

per gram of plant fresh weight). The mixture was boiled for 5 minutes and cooled down on

ice for another 5 minutes. The tubes were centrifuged at 8000g at 4ºC for 5 minutes and

the supernatant was collected to a new tube. Proteins were quantified by the Lowry

method.

We used 30µg of total protein in a SDS-PAGE (see Appendix). Proteins were

fractioned by electrophoresis and transferred to a nitrocellulose membrane (Amersham

Pharmacia) by electrical transfer. The membrane was stained with Ponceu solution for

protein loading control and hybridized (Western blot, see Appendix) with anti-OsICE1

(raised against the oligopeptide - CRRNAGEDDDDKKRK, Thermo, Germany) using a

chemioluminescent kit according to the manufacturer’s instructions (Tropix, USA).

Electrolyte leakage test Two-week old transgenic RNAi::OsHOS1 and NT were cold acclimated during 14

days from 28ºC to a 12 hour period of 6ºC. After cold acclimation, 15 leaf segments of 1

cm each were collected and washed in bi-distilled water to remove wound-released

electrolytes. The leaf segments were placed in 15mL of bi-distilled water and electrolyte

leakage occurred through 24 hours after which it was measured using a conductivimeter

(Crison, Spain). Total electrolyte was measured after boiling the tubes for 15 minutes, and

leakage was determined using the following formula: EL (electrical leakage) % = (Sample

Electrolyte leakage / Total electrolyte leakage)x100

References Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped

BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389-3402

Chen H, Nelson RS, Sherwood JL (1994) Enhanced recovery of transformants of Agrobacterium tumefaciens after freeze-thaw transformation and drug selection. BioTechniques 16: 664-668



77

Tiago Lourenço

de los Reyes BG, Morsy M, Gibbons J, Varma TS, Antoine W, McGrath JM, Halgren R, Redus M (2003) A snapshot of the low temperature stress transcriptome of developing rice seedlings (Oryza sativa L.) via ESTs from subtracted cDNA library. Theor Appl Genet 107: 1071-1082




Gill G (2005) Something about SUMO inhibits transcription. Curr Opin Genet Dev 15: 536-541 Gilmour SJ, Sebolt AM, Salazar MP, Everard JD, Thomashow MF (2000) Overexpression of the

Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiol 124: 1854-1865


Goto K, Kanazawa A, Kusaba M, Masuta C (2003) A simple and rapid method to detect plant siRNAs using nonradioactive probes. Plant molecular biology reporter 21: 51-58

Guy CL (1990) Cold acclimation and freezing stress tolerance: Role of protein metabolism. Annual Reviews of Plant Physiology and Plant Molecular Biology 41: 187-223

Hamilton A, Voinnet O, Chappell L, Baulcombe D (2002) Two classes of short interfering RNA in RNA silencing. Embo J 21: 4671-4679


Ishitani M, Xiong L, Lee H, Stevenson B, Zhu JK (1998) HOS1, a genetic locus involved in cold-responsive gene expression in arabidopsis. Plant Cell 10: 1151-1161

Lee H, Xiong L, Gong Z, Ishitani M, Stevenson B, Zhu JK (2001) The Arabidopsis HOS1 gene negatively regulates cold signal transduction and encodes a RING finger protein that displays cold-regulated nucleo--cytoplasmic partitioning. Genes Dev 15: 912-924


Miki D, Shimamoto K (2004) Simple RNAi vectors for stable and transient suppression of gene function in rice. Plant Cell Physiol 45: 490-495

Miura K, Jin JB, Lee J, Yoo CY, Stirm V, Miura T, Ashworth EN, Bressan RA, Yun DJ, Hasegawa PM (2007) SIZ1-mediated sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance in Arabidopsis. Plant Cell 19: 1403-1414

Morsy MR, Almutairi AM, Gibbons J, Yun SJ, de Los Reyes BG (2005) The OsLti6 genes encoding low-molecular-weight membrane proteins are differentially expressed in rice cultivars with contrasting sensitivity to low temperature. Gene 344: 171-180

Rueb S, Leneman M, Schilperoort RA, Hensgens LAM (1994) Efficient plant regeneration through somatic embryogenesis from callus induced on mature rice embryos (Oryza sativa L.). Plant Cell, Tissue and Organ Culture 36: 259-264


Thomashow MF (1999) PLANT COLD ACCLIMATION: Freezing tolerance genes and regulatory mechanisms. Annu Rev Plant Physiol Plant Mol Biol 50: 571-599


Yoshida S, Forno DA, Cock JH, Gomez KA (1976) Laboratory manual for physiological studies of rice. International Rice Research Institute, Manila (The Philippines)

78


Supplementary material

ATC TAG AAC GAC CGC CCA ACPrimer Rv-mUbi

TCT CGA GAG TTC CGC TCC ACPrimer Fw-mUbi

AAC ATC GCC TCG CTC CAG TCA ATGPrimer Rv-hptII

AAT AGC TGC GCC GAT GGT TTC TAC APrimer Fw-hptII

ACA CAA GGA CTT CCC AGG AGPrimer Rv-5S rRNA

GGA TGC GAT CAT ACC AGC ACPrimer Fw-5S rRNA

TCA TGC CTC CTC TAC CTA CAC GAG APrimer Rv-P5CS

AAG ATG GAA GAT TGG CTT TGG GCA GPrimer Fw-P5CS

TGG AAG AAA AAT TTG CAA GGAPrimer Rv-OsSIZ1

TGG AAA TGA ACA AAT GAT GGAPrimer Fw-OsSIZ1

TAG CTC CAG AGT GGG ACG TCPrimer Rv-OsDREB1a

CTC CTA CCG CAC CCT CGCPrimer Fw-OsDREB1a

GAG AGG GCT TGA CTT CTT CTG AGPrimer Rv-OsHOS1-L4

GGC ACA CTA ACT TAG CAT CTT GGPrimer Fw-OsHOS1-L3

GTG TGC CTT GAG GGT ATG TCCPrimer Rv-OsHOS1-L2

GGA GGT CGA CGG AGC AACPrimer Fw-OsHOS1-S2

TCT TCT AGA AAA TCT GGC TCG TCPrimer Rv-OsHOS1-L

CAG CTG GCA TCC ATT GAT CTPrimer Fw-OsHOS1-S

CCT GAG AAC ATT CTC TTT AGG AGG TPrimer Rv-OsHOS1-F

GCA TCT TTA GAG AAA TCC AAT CGPrimer Fw-OsHOS1-F

Table S1. List of primers used in this work

79

Tiago Lourenço

80

Chapter 4 Isolation and preliminary characterization of two ERF transcription factors binding to the OsHOS1 promoter Lourenço, T.(1), Saibo, N.(1), Negrão, S.(1), Ouwerkerk, P. B. F.(3), Pinto Ricardo, C.(1,2) and Oliveira, M. M.(1,3) Isolation and preliminary characterization of two ERF transcription factors binding to the OsHOS1 promoter (in preparation) (1) ITQB/IBET, Quinta do Marquês, 2784-505 Oeiras, Portugal (2) Instituto Superior de Agronomia, UTL, Tapada da Ajuda, 1349-017 Lisboa, Portugal (3) Institute of Biology, Leiden University, Leiden, The Netherlands (4) Dep. Biologia Vegetal, Fac. Ciências de Lisboa, 1749-016 Lisboa, Portugal

Tiago Lourenço

Chapter Index Abstract………………….………….……….…………………………………………83 Introduction….….….…………….…….….…..….…….…….……………………….85 Results……….…….….………………………….….…….………….…….….….…..88

Isolation of putative transcription factors using the Yeast One-Hybrid screening.….…...……...…...…..…..…….…..…..….…88 Alignment and phylogeny analysis of the isolated AP2/ERF transcription factors..…….…....…..…..…...….….…..…....…....89

In-vitro DNA binding activity of the isolated TF proteins….….....……..….92 Expression analysis of the Y1H6 and Y1H20 genes under cold stress...92 Nuclear localization of the isolated TF proteins…..…..….….….….……...93 Y1H6 gene mutant plant analysis.….....…...…..….….….....….…........….94

Discussion….…….…...…………….….…………….…….……..….…….…….…...94 Experimental procedures……………………………….………………………….98 Construction of the bait strain.….…...…..….….….….….....….….….…….98

Yeast One-Hybrid screening with a cDNA expression library of rice seedlings..….….…..…..….…..….….….….…..….….….…..….……99 Identification of true positive interactions in the Yeast One-Hybrid screening.…..……...….….....…..…..….…..….….…..100 Particle bombardment of onion epidermal cells with a GFP-fusion vector…..…...….….....……..………..………..….…....101 AP2/ERF alignments and phylogenetic analysis……....…...….........…..102 Stress treatment and total RNA extraction..….....…...…....….......…...102 cDNA synthesis and RT-PCR (reverse-transcriptase-PCR) analysis….102 Genotyping Y1H6 T-DNA tagged line..….….…..….…..…......….…...….103

References……….…….….………..……..…………….…….…….….….………...103 Supplementary material………………………………..……..…….……..….…...106

82


Abstract

Abiotic stress such as cold, drought and high-salinity, often cause deleterious

effects in crop productivity. Transcription factors (TFs) play an important role in

the abiotic stress signal transduction pathway regulating the function of stress-

responsive genes that will ultimately confer tolerance to the plants. In this work,

we have isolated two TFs putatively binding to the OsHOS1 promoter. We used a

rice seedling (cv. Taipei 309) cDNA expression library to isolate TFs in an Yeast

One-Hybrid screening. The isolated TFs, which were named Y1H6 and Y1H20,

had their amino acids sequence and gene expression changes analyzed in order

to determine their putative function. The Y1H20 was previously reported in

another study and identified as OsBIERF4. The two TFs isolated have an AP2

DNA-binding domain and belong to the ERF transcription factor family. These TFs

can putatively bind to the GCC-box cis-motif present in the analyzed promoter

and have a characteristic N-terminal motif (MCGGAII/L) which defines a specific

group in the ERF family. Interestingly, Y1H6 expression was negatively regulated

by cold but Y1H20 was constitutively expressed. Although, the isolated TFs may

bind to the OsHOS1 promoter, further analysis must be conducted to fully

understand their function in the abiotic stress signal transduction pathway through

the regulation of OsHOS1 gene expression.

83

Tiago Lourenço

84


Introduction

Plants are frequently exposed to environmental changes of either abiotic

or biotic nature. These changes are perceived by the plant that responds

activating signal transduction pathways, altering gene expression thus allowing

the function of specific stress-responsive genes in order to tolerate the stress

conditions.

The main abiotic stresses that affect plant development and are

responsible for crop losses are drought, high-salt, and cold. Rice culture is

sensitive to low temperatures, which restricts growth at high latitudes. The

process of response and adaptation to cold is known as cold acclimation

(Thomashow, 1999). Rice, however, does not cold acclimate very efficiently.

Under low temperature, plants suffer certain biochemical changes (e.g. alteration

of the membrane lipid composition) that allow them to survive the stress. These

changes are induced by cold treatment through gene expression regulation by

transcription regulators (transcription factors, TFs). An important group of TFs

includes the DREB1/CBF (Dehydration responsive element binding protein 1/C-

repeat binding factor) that were extensively studied in recent years and their

importance in cold stress response thoroughly documented (Stockinger et al.,

1997; Gilmour et al., 1998; Jaglo-Ottosen et al., 1998; Liu et al., 1998). However,

little is still known regarding how the cold signal transduction pathway activates

the expression of DREB1/CBF genes and in particular the DREB1A/CBF3, a

gene strongly induced upon cold stress. In Arabidopsis, a MYC-like transcription

factor named ICE1 (Inducer of CBF expression 1) is known to bind to a MYC-

recognition site in the promoter of the CBF3 gene (Chinnusamy et al., 2003).

ICE1 gene is constitutively expressed but, and despite the presence of the ICE1

TF, no cold-stress associated gene expression is observed at room temperature

(Chinnusamy et al., 2003). This suggests that there is a post-translational

regulation for the activation of this protein. Recently, two proteins were identified

as interacting with the ICE1 protein in Arabidopsis. The two proteins were

identified as SIZ1 (Miura et al., 2007) (a SUMO E3 ligase) and HOS1 (Dong et al.,

2006) (an E3 ubiquitin ligase). The SIZ1 protein was shown to act in the post-

translational activation of ICE1 allowing the transcription factor to bind the CBF3

85

Tiago Lourenço

promoter. HOS1 is implicated in the negative control of the cold stress response

by degradation of the ICE1 protein through the ubiquitin-proteasome pathway.

HOS1 protein shows a cytoplasm to nucleus re-localization upon cold stress (Lee

et al., 2001) which also suggests a post-translational modification regulating this

movement, although, how it is determined is still unknown. Despite its constitutive

expression, HOS1 gene expression in Arabidopsis declines shortly after cold

treatment recovering within the following hours (Lee et al., 2001). How HOS1

gene expression is regulated is so far still unknown.

The signal transduction pathway of stress response is, in several cases,

mediated by plant hormones like ethylene, ABA (abscisic acid), and jasmonic or

salicylic acid, that act as secondary messengers in the stress response.

Ultimately, TFs will have the transcriptional level altered by the action of these

hormones. Several transcription factors from different families were already

implicated in the abiotic stress response of plants (Nakashima and Yamaguchi-

Shinozaki, 2006).

The AP2/ERF (APETALA2/Ethylene Responsive Factor) transcription

factor superfamily is characterized by the presence of a highly conserved DNA

binding domain of ~60-70 amino acids and it is composed of the AP2, RAV

(Related to ABI3/VP1) (Kagaya et al., 1999) and ERF families. In Arabidopsis,

147 members of the AP2/ERF superfamily were recently identified through a

computational study (Nakano et al., 2006). Several transcription factors of this

superfamily have been implicated in plant developmental processes and

responses to environmental stimuli. The AP2 family is characterized by the

presence of two AP2/ERF DNA binding domains and is related to the regulation

of, for instance, flower development (Elliott et al., 1996). The RAV family is

characterized by the presence of one AP2/ERF DNA binding domain and one B3

domain and its members have been related to the response to ethylene, ABA and

brassinosteroids (Zhao et al., 2008). The ERF family contains only one AP2/ERF

DNA binding domain and, in Arabidopsis, it includes more than 80% of all

AP2/ERF superfamily members (Nakano et al., 2006). In the study of Nakano et

al. (2006) in rice, 139 ERF proteins were assigned to this family, suggesting that

the differentiation of the three families (AP2, RAV and ERF families) occurred

before the separation between monocots and dicots. The ERF family can be

86


further divided in two major sub-families known as the ERF and the DREB/CBF

subgroups, and their members have been implicated in diverse processes such

as responses to biotic (Park et al., 2001; Gu et al., 2002) and abiotic stresses

(Stockinger et al., 1997; Dubouzet et al., 2003). It was found that the conserved

cis-motif (GCCGCC, GCC-box) in the promoter of pathogen related (PR) genes

(Ohme-Takagi and Shinshi, 1995) is essential for ERF TF binding to DNA

(Fujimoto et al., 2000). A similar cis-motif (A/GCCGAC, DRE motif) was also

found in the promoter sequence of abiotic stress responsive genes (Yamaguchi-

Shinozaki and Shinozaki, 1994) as being crucial for the binding of DREB1/CBF

TFs to DNA (Stockinger et al., 1997; Liu et al., 1998).

In the ERF subgroup, the DNA binding domain (ERF) structure is

composed by two β-sheets and an α-helix (Allen et al., 1998). The conservation of

the β-sheets is required for the GCC-box binding (Tournier et al., 2003). Still in

the ERF subgroup four different functional classes have been identified according

to ERF amino acid structure (Fujimoto et al., 2000; Tournier et al., 2003). These

ERF classes define different functional activities due to different motifs and motif

organization. However, only few members of these classes have been

characterized (Berrocal-Lobo et al., 2002; Fischer and Droge-Laser, 2004; Huang

et al., 2004; Zhang et al., 2004; Zhang et al., 2005) and so their function is largely

unknown. In rice, the function of ERF proteins is largely uncharacterized and so

far only few members of the predicted 139 (Nakano et al., 2006) have been

described (Yang et al., 2002; Cao et al., 2005; Cao et al., 2006; Hu et al., 2008).

In the present work, we used the Yeast One-Hybrid screening to identify

transcription factors that could be involved in the transcription regulation of the

OsHOS1 gene, previously identified in our laboratory. From the screening, two

putative ERF transcription factors were isolated as binding to the OsHOS1 gene

promoter fragment closest to the ATG starting codon. This promoter fragment had

the characteristic cis-motif GCC-box where ERF proteins bind. Both TFs belong

to the class IV of ERF proteins (Fujimoto et al., 2000; Tournier et al., 2003). The

protein sequence motifs and gene expression in response to cold of the two

isolated genes will be discussed.

87

Tiago Lourenço

Results Isolation of putative transcription factors using the Yeast One-Hybrid screening

Using the Yeast One-Hybrid screening to identify TFs that bind to the

OsHOS1 gene promoter, we isolated 25 putative positive colonies for the PROM

1 (the closest fragment to ATG start codon; Fig. 1A) fragment bait strain. No

putative positive colonies were isolated from either PROM 2 or PROM 3 fragment

bait strains. All isolated colonies harboured plasmids with cDNA sizes ranging

from 800-1300 bp and most of the putative positive colonies had the same PCR

amplification band size (Fig. 1B). After yeast plasmid extraction and amplification

in E. coli, the plasmids were sequenced and four different sequences were

identified. Using the BLAST tool (Altschul et al., 1997), two sequences were

identified as putative transcription factors belonging to the AP2/ERF superfamily

(Y1H6 and Y1H20) (ERF subfamily, GCC-box binding) and the other two were a root-specific protein (Y1H27) and a NADPH-cytochrome P450 protein (Y1H28).

After re-transformation of the PROM 1 bait strain with the isolated plasmids, only

the two AP2/ERF putative transcription factors revealed positive interaction with

the OsHOS1 promoter fragment (Fig. 1C, only Y1H6 and Y1H27 are shown). As

control, the pACTII empty vector was also transformed in the PROM 1 yeast bait

strain. In this case, no colony growth was observed with the pACTII empty vector

(Fig. 1C with asterisk). Another control performed was the transformation of an

unrelated bait strain without GCC-box binding cis-motifs (PROM 3). None of the

AP2/ERF putative transcription factors gave positive interaction with this bait

strain (data not shown).

Figure 1. Yeast One-Hybrid screening of the OsHOS1 promoter. (A) Each line represents the promoter fragments in which the promoter of the OsHOS1 gene was divided (PROM 1, PROM 2 (P2) and PROM 3 (P3)). The start and end of the promoter fragments are indicated in base pairs. The A base of the ATG start codon is considered as 0. (B) Colony-PCR products of the yeast one-hybrid screen using PROM 1 bait strain in an agarose gel. pACTII – amplification of the product of the pACTII empty vector. 1-10 – different PCR product sizes amplified from putative positive colonies. Kb - GeneRuler (Fermentas, Canada) with band sizes in base pairs on the left. (C.) PROM 1 bait strain re-transformation plates with isolated plasmids (Y1H6 and Y1H27). The asterisk represents bait strain transformation with pACTII empty vector.

88


Alignment and phylogeny analysis of the isolated AP2/ERF transcription factors

The two TFs isolated in the Yeast One-Hybrid screening were similar in

amino acid sequence having both the AP2/ERF DNA binding domain of 57 amino

acids (Fig. 2C) and a putative nuclear localization signal (pNLS) preceding the

AP2/ERF binding region (Fig. 2B). The Y1H20 ERF protein had another pNLS

already inside the ERF binding domain (Fig. 2B). The two TFs have a 33% amino

acids sequence homology which is especially high in the AP2/ERF DNA-binding

region. Both TFs share a similar N-terminal motif (MCGGAII/L) characteristic of

class IV ERF proteins (Tournier et al., 2003), although in the Y1H6 the conserved

Ile-6 is substituted by a leucine (Fig. 2B). The Y1H6 gene (full length cDNA

accession number AK106057) is translated into a 250 amino acid TF with a

89

Tiago Lourenço

genomic region harbouring one intron in the C-terminal region and is located in

chromosome 9 (Os09g11480). This TF also has a putative acidic domain in the

N-terminal and a putative phosphorylation site at the C-terminal (EPRSVL) (Fig.

2B). The Y1H20 gene (full length cDNA accession number AK105922) is

translated into a 329 amino acid TF with an intronless genomic sequence and is

located in chromosome 3 (Os03g08500). This TF has a LWSF motif which is

similar to a motif found in DREB1 proteins (Fig. 2B). The Y1H6 and the Y1H20

proteins have a predicted 27 kDa and 35.3 kDa protein size and a pI of 4.57 and

4.31 respectively. The Y1H6 TF has not yet been functionally described and it is

annotated as a callus-expressing factor. The Y1H20 was previously reported in a

paper by Cao et al. (2006) as OsBIERF4 (Oryza sativa benzothiadiazole induced

ethylene responsive factor 4).

The amino acid sequences of both TFs were used to build a phylogenetic

tree with other ERF proteins (Fig. 2A) and also other members from the AP2/ERF

superfamily (from the other two families, AP2 and RAV) as outliers. The ERF

proteins group into different functional classes according to their amino acid

sequence (Fujimoto et al., 2000; Tournier et al., 2003).

Figure 2. Phylogenetic analysis of the isolated ERF transcription factors. (A.) Phylogenetic tree comparison between published ERF, RAV and AP2 proteins. For the aligment of the AP2/ERF proteins the following amino acids sequence and accession numbers were used: Y1H6 (BAD29670), Y1H20 (ABF94333), Oryza sativa OsBIERF1 (AAV98700), Oryza sativa OsBIERF2 (AAV98701), Oryza sativa OsBIERF3 (AAV98702), Oryza sativa OsBIERF4 (AAV98703), Oryza sativa OsEREBP1 (AAF23899), Oryza sativa OsEBP-89 (CAC83122), Oryza sativa ERF1 (ABK34954) Triticum aestivum TaERF1 (AAX13280), Capsicum annuum CaPF1 (AAP72289), Arabidopsis APETALA2 (AAC13770), Arabidopsis AINTEGUMENTA (AAA91040), Arabidopsis RAV1 (AAG09554), Arabidopsis RAV2 (AAG52035), Arabidopsis ERF1 (BAA32418), Arabidopsis ERF2 (BAA32419), Arabidopsis ERF3 (BAA32420), Arabidopsis ERF4 (BAA32421), Arabidopsis ERF5 (BAA32422), Lycopersicum esculentum TERF1 (AAK95688), Lycopersicum esculentum LeERF4 (AAO34706), Lycopersicum esculentum JERF1 (AAK95687), Nicotiana sylvestris NsERF2 (BAA97122), Nicotiana tabacum NtERF4 (BAA07323), Nicotiana tabacum NtERF5 (AAU81956). The alignment of the proteins was made using the ClustalW with default parameters in the MEGA 4 software. The phylogenetic tree was generated using the same software as above with the Neighbour Joining methodology with 1000 bootstrap replications. The accession numbers of the proteins used are described in the experimental procedures. (B) Alignment of the Y1H6 and Y1H20 proteins. The black bars indicate: N-tm, N-terminal motif (both Y1H6 and Y1H20); AD, putative acidic activation domain; pNLS, putative nuclear localization signal; pPS, putative phosphorylation site (only in Y1H6); L-motif, LWSF motif present also in CBF/DREB proteins (only in the Y1H20). The ERF domain in both proteins is also shown. (C) Alignment of the ERF domain of selected proteins. The protein structure is represented above the amino acids. The asterisk represents the differences in the residue-6 among the selected sequences .

90


91

Tiago Lourenço

In-vitro DNA binding activity of the isolated TF proteins In order to examine the DNA binding activity of the isolated TFs, we

overexpressed them in E. coli using a GATEWAY vector (pDEST 17). The

overexpressed proteins were in both cases mainly in the insoluble fraction,

reason why it was not yet possible to purify the HIS-tagged fusion proteins for in

vitro protein-DNA binding assays.

Expression analysis of the Y1H6 and Y1H20 genes under cold stress We analyzed the gene expression of the two putative TFs that interact

with the OsHOS1-PROM 1 yeast bait strain in cold treated plants. No expression

differences could be detected in the Y1H20 gene under cold stress (data not

shown) which could eventually be due to a very high amplification level that could

mask minor differences in gene expression. We also consistently detected the

presence of three bands (Fig. 3A). The band of highest size (1050bp)

corresponded to the full length sequence, while the smallest band (400bp)

corresponded in size to the cloned fragment in the bait strain. The sequence

present in the Y1H20 colony was internally deleted, however no intron typical

borders were detected in the retrieved genomic sequence. In addtition, no introns

are predicted in this TF. Still, it is not known if the bands other than the full-length

are only PCR artifacts or if they have any physiological significance.

The Y1H6 transcriptional level was very low when compared to the

expression of the Y1H20 (Fig. 3A; same number of cycles). Interestingly, Y1H6

gene showed a cold-repressed expression, as the gene was expressing at room

temperature and rapidly silenced upon cold stress, maintaining the repression

throughout the whole cold treatment (Fig. 3A). Further analyses of gene

expression for both TFs in response to other abiotic stresses (drought, salt and

also ABA and ethylene treatment) are needed.

Figure 3. Y1H6 and Y1H20 expression and protein sub-cellular localization. (A) Expression analysis of the Y1H6 gene on rice plants (Oryza sativa L., cv. Nipponbare) under normal and cold stress (10ºC) conditions. The different cold stress time points are indicated. On the right, Y1H20 gene expression under normal growth conditions. Different PCR products were obtained and their sizes are indicated on the side. (B) Y1H6 GFP-fusion protein sub-cellular localization on onion epidermal cells. The sub-cellular localization of the Y1H6 GFP-fusion protein and the GFP protein alone were visualized 21 hours after particle bombardment. Bright-field and epifluorescence images (Y1H6 on the left and GFP-control on the right) are shown. White arrows on control images panel indicate the particle bombarded cell. White arrows on the Y1H6 images panel indicate the onion cell nucleus and the localization of the Y1H6 protein on the nucleus of the particle bombarded cell.

92


Nuclear localization of the isolated TF proteins

An in-frame N-terminal GFP-fusion (in GATEWAY vector) was used to

study the sub-cellular localization of both isolated TFs. The GFP-fusion vector for

both proteins was delivered by particle bombardment into onion epidermal cells.

As control, a GFP empty vector was also delivered into onion epidermal cells. In

the control, the GFP signal did not localize in any specific cellular compartment

being detected spread through the whole cytoplasm and nucleus (Fig. 3B).

Instead, both GFP-fusion constructs carrying either Y1H6 (Fig. 3B) or Y1H20

(data not shown), gave strong GFP signal only in the nucleus revealing that the

GFP-fusion protein was translocated to the nucleus probably due to the pNLS

present near the N-terminal of the AP2/ERF domain.

93

Tiago Lourenço

Y1H6 gene mutant plant analysis We have blasted the Y1H6 and the Y1H20 gene sequences in the

RiceGE (Rice Functional Genomic Express database; http://signal.salk.edu/cgi-

bin/RiceGE) to search for rice lines mutated in our target genes. A rice (cv.

Dongjin) line was identified with a T-DNA tag in the Y1H6 gene region, however

no T-DNA tag line was found for the Y1H20 gene. A T-DNA tag line (Jeon et al.,

2000; Jeong et al., 2002) for Y1H6 gene was ordered from POSTECH (Korea).

The available set of seeds (15) was a T1 mixture (NT, hetero- and homozygous

seeds) and had to be screened for T-DNA insertion (hptII gene as selectable

marker for hygromicin resistance). The seeds were amplified for seed stock. The

Hyg-positive plants were selected and genotyped for T-DNA position on the

genome, using a left-border T-DNA primer and a gene primer. Until now, it was

not possible to determine the position of the T-DNA insertion in the selected

plants. Also, we still do not know if the T-DNA is truly inserted in the Y1H6 gene,

disrupting its function. Further analyses have to be performed in order to

determine the usefulness of this T-DNA tagged line.

Discussion

By computational study 139 ERF proteins were predicted in the rice

genome (Nakano et al., 2006). However, the large majority of these rice genes

was not studied in depth especially in the ERF subgroup (CBF/DREB1 subgroup

genes have been studied in the past years) (Dubouzet et al., 2003; Ito et al.,

2006).

Using the Yeast One-Hybrid screening we have identified two rice ERF

transcription factors (Y1H6 and Y1H20) that could bind to the promoter of the

OsHOS1 gene. Nevertheless, we were not able to prove the true binding to the

promoter fragment in vitro due to being unable to overexpress soluble

recombinant ERF proteins. The presence of GCC-boxes (Ohme-Takagi and

Shinshi, 1995) in the promoter fragment from which these two proteins were

isolated, supports the true binding of these ERFs to the OsHOS1 promoter. The

GCC-box is essential for the ERF transcription factors binding to DNA(Fujimoto et

al., 2000).

94

http://signal.salk.edu/cgi-bin/RiceGE

http://signal.salk.edu/cgi-bin/RiceGE


Both ERF proteins had a characteristic N-terminal motif (MCGGAII/L)

(Fig. 2B) which is typical of the ERF proteins from class IV (Fujimoto et al., 2000;

Tournier et al., 2003). The phylogenetic tree (Fig. 2A) revealed that the ERF

proteins are clustered according to the ERF classes but some of the nodes had

weak bootstrap branches, revealing that the relative position of the ERF proteins

may be different.

The function of this N-terminal motif (MCGGAII/L) is still not clear.

Nevertheless, recently, Xu and colleagues (2007) identified a TaERF1 gene in

wheat that also belongs to class IV ERFs (Xu et al., 2007). This protein has a C-

terminal putative phosphorylation site that could interact with a protein kinase.

The deletion of the N-terminal motif enhanced the interaction with the putative

protein kinase in yeast cells. This was the first time that a putative function for this

N-terminal motif was described. The Y1H6 ERF protein had a small modification

in the N-terminal motif. The Ile-6 amino acid of the conserved motif was

substituted in the N-terminal motif of this protein by a leucine. However, the

physiological meaning of this substitution, if any, is still unknown.

The protein structure of the isolated ERF proteins revealed a conserved

57 amino acids ERF domain (Fig. 2C). The Y1H6 protein has a Gln-6 (Q,

uncharged amino acid) in the ERF domain while the Y1H20 has a basic highly

charged Arg-6 (R) in the same position (Fig. 2C). This shift in amino acids may

account for differences in binding activity (Tournier et al., 2003). The 3D spatial

alignment of ERF proteins showed that the spatial orientation of the residue-6

side chain is important for binding affinity (Tournier et al., 2003). These findings

may indicate a higher affinity to the GCC-box of the Y1H20 than the Y1H6.

The two ERF protein sequences had putative nuclear localization signals

(pNLS) (Fig. 2B). Both proteins had pNLS preceding the ERF domain. The Y1H6

has one putative NLS and the Y1H20 has two putative NLS (Fig. 2B), which were

sufficient to target the GFP fusion-ERF proteins to the nucleus in onion epidermal

cells (Fig. 3B). In the Y1H20 protein, only one of the pNLS will probably be

enough to target the protein to the nucleus. In support of this Xu et al. (2007),

demonstrated by deletion of a pNLS located at the N-terminal, that a single pNLS

located inside the ERF domain is able to target the protein to the nucleus (Xu et

al., 2007).

95

Tiago Lourenço

We also detected the presence of acidic domains in the N-terminal side of

the TF proteins. These acidic domains are a common feature in several ERF

proteins (Nakano et al., 2006) and may act as transcriptional activation domains

(AD). Deletion constructs for the acidic AD of the JERF1 protein were prepared

and transferred to yeast cells using the LacZ reporter gene (Wang et al., 2004).

The AD deletion constructs were unable to activate the LacZ expression thus

revealing that the AD was important for the transcriptional activation function of

the JERF1 protein (Wang et al., 2004). In vivo studies using tobacco seedlings

transformed with a reporter gene and co-transformed with the TaERF1 gene and

several deletion constructs also confirmed the transcriptional activation function of

the acidic domain. The deletion construct that removed the acidic AD was unable

to activate the expression of the reporter gene in the transgenic tobacco

seedlings (Xu et al., 2007).

Another motif was found in the Y1H6 and the Y1H20 in the study by

Nakano and colleagues (2006). The two proteins Y1H6 and Y1H20 (identified as

OsERF#63 and OsERF#64, respectively, in Nakano’s paper) have a C-terminal

conserved motif of unknown function (CMVII-8) however, the putative conserved

region has a weak consensus among the subgroup members.

Most of the ERF sub-family members (including the DREB/CBF and ERF

subgroups) were considered intronless (Sakuma et al., 2002). The identified

Arabidopsis genes belonging to the class IV of ERF had a single intron at the N-

terminal coding region (Nakano et al., 2006) which seemed to be a conserved

feature. In wheat, the TaERF1 gene which encodes a class IV ERF also revealed

a single intron at the N-terminal coding region. It was thus suggested that the

ancestor of the class had an intron before the divergence between monocots and

dicots (Xu et al., 2007). However, the two proteins we isolated, which belong to

the same ERF class IV, had a different gene structure. The Y1H6 also had a

single intron, however, its position was on the 3’-end corresponding to the C-

terminal of the protein. In turn, the Y1H20 gene is intronless (Cao et al., 2006).

This may suggest that either not all the ERF class IV genes evolved from the

same common ancestor or, most likely, that the different intron position or the

intronless feature have evolved after divergence of monocots and dicots.

96


Another motif present only in the Y1H6 ERF protein is a putative

phosphorylation site (EPRSVL, pPS) at the C-terminal (Nakano et al., 2006).

Other proteins from the same ERF class IV also have putative phosphorylation

sites. The OsEREBP1 and the TaERF1 (Cheong et al., 2003; Xu et al., 2007)

have phosphorylation sites (TPDITS) at the C-terminal and two MAPK (mitogen

activated protein kinase) were identified as interacting with the ERF transcription

factors. The phosphorylation sites are important to enhance binding of the ERF

proteins to the GCC-box. Binding enhancement was reported in vivo using the

GUS reporter gene. GUS expression was largely induced when GUS reporter

plants were transformed with both the ERF protein and the MAPK (Cheong et al.,

2003; Xu et al., 2007). These results may indicate that there could be a MAP

kinase or a casein kinase involved in phosphorylation of the Y1H6 protein.

ERF proteins are able to bind to the GCC-box cis-motif (Ohme-Takagi

and Shinshi, 1995) present in the promoters of pathogen-related (PR) genes

(Fujimoto et al., 2000; Gu et al., 2002; Zhou et al., 2008). However, it was also

shown that some ERF transcription factors besides the DREB/CBF, could also

bind the DRE cis-motif (Park et al., 2001; Wang et al., 2004) and also enhance

abiotic stress tolerance. This suggests that some ERF proteins can act in a cross-

talk between biotic and abiotic stress. Some of the class IV ERF proteins have

already been studied in more depth. The studied genes revealed their expression

induced by biotic and abiotic stress. When overexpressed in Arabidopsis and/or

tobacco, the transgenic plants showed increased tolerance to both biotic and

abiotic stress (Wang et al., 2004; Yi et al., 2004; Xu et al., 2007). The Y1H6 gene,

however, had its expression downregulated by cold stress (Fig. 3A). This result

alone, distinguishes this gene from the other members of the ERF class IV

studied so far. The Y1H20 gene showed a constitutive expression under cold

stress (data not shown). We also detected other smaller PCR amplification bands

from rice cDNA other than the full-length Y1H20 gene. These bands could be

PCR artifacts, but the sequence retrieved from the Y1H20 colony in the Yeast

One-Hybrid screening, interestingly also had an internal deletion and

corresponded to one of the PCR bands (Fig. 3A). This internal deletion did not

correspond to the typical intron borders and the Y1H20 gene is thought to be

intronless. The significance of this internal deletion, if any, is still unknown. This is

97

Tiago Lourenço

different from what has been shown for this gene in the work of Cao and co-

workers (Cao et al., 2006). In their work, the OsBIERF4 gene (corresponding to

the Y1H20) was strongly induced by abiotic stress, but not by wounding. The

different results obtained for the Y1H20/OsBIERF4 gene expression may be due

to the different rice cultivar used (cv. Nipponbare vs. cv. Yuanfengzao).

Nevertheless, the results we obtained for the gene expression are very preliminar.

Further analyses are required to understand how Y1H6 and Y1H20 genes

respond to other stresses like drought, salt, wounding, and ABA and ethylene

treatment.

To complete these results we will need to purify Y1H6 and Y1H20

proteins and prove the in vitro binding of these proteins to the GCC-box (present

in the promoter fragment of the OsHOS1 gene from where these two proteins

were isolated) and also to the DRE cis-motif. The trans-activation activity of these

proteins should also be investigated both in vitro using yeast cells and in vivo in

transgenic reporter plants. Since there is also a putative phosphorylation site in

the Y1H6 protein, a Yeast Two-Hybrid approach could reveal the MAP or the

casein kinase that could interact with the Y1H6 protein. It will also be interesting

to overexpress these proteins in Arabidopsis and/or tobacco to see if the

transgenic plants have an enhanced tolerance to abiotic and biotic stresses.

Experimental procedures Construction of the bait strain

We selected 1500 bp upstream the ATG starting codon of the OsHOS1 gene to

unveil transcription factors that bind to the specific promoter. The OsHOS1 gene promoter

region was divided in 3 fragments of ~525 bp overlapping in 30-40 bp to cover all possible

binding sites, and PCR primers were designed (Table S1) using the Primer 3

(http://frodo.wi.mit.edu) software to clone the promoter fragments. These primers have 5’-

end NotI and a 3’-end NheI adaptors (cohesive end compatible with SpeI restriction

enzyme). The PCR generated fragments were cloned into pCR2.1 (TA cloning vector kit,

Invitrogen, USA) and sequenced (StabVida, Portugal). The pCR2.1 plasmid was digested

using NotI (Fermentas, Canada) and NheI (Fermentas, Canada) restriction enzymes. The

digestion mixture was separated by electrophoresis and the promoter fragments were

extracted from the gel and purified using the Wizard SV Gel and PCR Clean-up system kit

(Promega, USA). The purified fragments were cloned into the pINT-HIS3NB (Meijer et al.,

98

http://frodo.wi.mit.edu/


1998) sites NotI and SpeI (Fermentas, Canada) generating the pINT-HIS3NB/PROM 1-3

(PROM 1 is the closest to the ATG starting). The pINT-HIS3NB/PROM was digested with

NcoI and AscI and the generated integrative fragment was gel-purified (Qiaquick Gel

Extraction kit, Qiagen, USA). This fragment contains the PDC6 locus, HIS3 reporter gene,

promoter fragment for analysis and APT1 gene conferring resistance to G418 in yeast.

Yeast competent cells (Y187 genotype: leu-, trp-, his-, Ura+, ade-, met-, Lys+) were prepared

using Lithium-Acetate protocol (Ouwerkerk and Meijer, 2001) (for further notes on Yeast

One-hybrid see Appendix) and transformed with the pINT-HIS3/PROM1-3 purified

fragment. The transformation of the yeast competent cells was carried out using

PEG/TE/Lithium-Acetate protocol (Ouwerkerk and Meijer, 2001) with the transfer of the

fragment being helped by the YEASTMAKER carrier DNA (Clontech, USA). The

transformed cells were allowed to grow at 30ºC for at least 4 hours to allow the expression

of APT1 gene (G418 resistance). The cells were plated on YAPD-G418 plates and allowed

to grow at 30ºC for 3 days. Colonies G418-resistant grown on plates were re-streaked on

fresh YAPD-G418 plates. Single colonies were then analyzed by PCR for the presence of

the PROM fragment. Single positive G418-resistant colonies were grown on liquid YAPD

medium and glycerol stocks (30%) prepared.

The bait strains were titrated for 3-AT concentration (3-amino-1,2,4-triazole) prior

to Yeast One-Hybrid screening. This titration is needed to avoid false positives due to leaky

expression of the HIS3 reporter gene.

Yeast One-Hybrid screening with a cDNA expression library of rice seedlings

In order to identify transcription factors that bind to the target promoter region, we

performed an Yeast One-Hybrid screening using a rice (Oryza sativa L., cv. Taipei 309)

seedling cDNA expression library (kindly provided by P.B.F. Ouwerkerk, University of

Leiden, The Netherlands). The cDNA expression library was constructed by transforming

the rice seedlings cDNA into a lambda vector containing an E. coli–yeast shuttle vector

(λACTII/pACTII’) (Memelink, 1997). This shuttle vector has a Gal4p activation domain and

the Leu2 selectable marker gene (complementing the leucine deficiency in the Y187 yeast

bait strain). The rice seedlings cDNA was cloned between the arms of the lambda phage.

The phage library was amplified by infecting E. coli and retrieving the phage plaques. For

yeast One-Hybrid, the phage library was transformed in a plasmid library using an E. coli

Cre-protein producing strain via the Cre-lox system. The plasmid is extracted from E. coli

and used to transform the bait strains in the subsequent screenings (Ouwerkerk and

Meijer, 2001).

99

Tiago Lourenço

Over 50 individual transformations were made for each bait strain of the OsHOS1

selected promoter region in order to saturate the library. The transformation efficiency

ranged from 5.000-20.000 transformations per plate and a total ~1x106 individual

transformed colonies were obtained per promoter fragment. The transformation plates

were incubated at 30ºC for 14 days. Putative positive colonies were identified as fast

growing colonies over the background. Putative positive colonies were re-streaked in fresh

medium for false positive discovery. Growing colonies after re-streaking were considered

putative positive colonies.

Yeast colony PCR was performed on the putative positive colonies with the

pACTII primers (Table S1). The colonies were picked with a disposable tip and placed

inside a PCR tube. The colonies were burst during 30 seconds in the microwave maximum

power. The PCR conditions used were: 96ºC for 5 minutes, 20 cycles of 96ºC for 45

seconds, 53ºC for 45 seconds, 72ºC for 2 minutes, plus 15 additional cycles of 96ºC for 45

seconds, 53ºC for 45 seconds, 72ºC for 2 minutes plus 5 seconds per cycle, and a final

extension period of 10 minutes at 72ºC. The PCR products were separated by

electrophoresis in 1% agarose gel. The remaining PCR mixture volume was purified

(Wizard SV Gel and PCR Clean-up system; Promega, USA) and sequenced using the

pACTII primers (StabVida, Portugal). The retrieved sequences were hand-trimmed for the

pACTII primers sequences and translated. The longest ORF was considered for further

analysis. Translated protein sequences that were retrieved from incomplete cDNA were

analyzed in the possible ORFs and blasted in the rice genome for high sequence

homology. The highest homology sequence was considered for further analysis.

Identification of true positive interactions in the Yeast One-Hybrid screening To assess true positive interaction between the transcription factor and the

OsHOS1 promoter, we isolated the plasmid (see Appendix) from the putative positive yeast

colonies. These colonies were grown overnight at 30ºC with agitation (170 rpm). A 1.5-3mL

of the dense culture was pelleted in a bench top centrifuge at maximum speed for 5

minutes at RT. The supernatant was discarded and pelleted cells were ressuspended in

200µL breaking buffer (2% Triton X-100, SDS 1%, 100mM NaCl, 10mM Tris-HCl, 1mM

EDTA). For further mechanical release of the plasmid, 0.3g of glass beads (Ø 425-600µm)

were added to the ressuspended pellet and also 200µL phenol:chloroform:isoamyl-alcohol

(1:1:0.02). The mixture was vortexed at RT for 2 minutes and centrifuged at 10000xg for 3

minutes at RT. The aqueous phase was recovered and mixed (1:1) with a chloroform:

isoamyl-alcohol (24:1) solution. The tube was mixed by inversion and centrifuged at

10000xg for 3 minutes at RT. We used 5µL of the recovered aqueous phase to transform

100


the appropriate E. coli strain (e.g. DH5α) for plasmid amplification. The transformation of E.

coli with the plasmid extracted from yeast was done following 30 minutes of incubation on

ice (E. coli competent cells and 5µL of the plasmid), heat-shock at 45ºC for 45 seconds

(snap-cool on ice for 1 minute) and 3 hours of growth in the appropriate liquid medium.

After plasmid amplification on E. coli, the plasmid was extracted and re-transformed in the

initial yeast bait strain (Y187::pINT-HIS3NB/PROM1-3) according to the yeast

transformation protocol described above.

We have also designed GATEWAY primers to clone the gene in an expression

vector (Table S1) using the Primer 3 software. The cDNA sequences of the putative

positive colonies were PCR amplified (using 5% of DMSO in the PCR mixture) with the

following conditions: 95ºC for 5 minutes for initial denaturation step, 20 cycles of 95ºC for 1

minute, 53ºC for 1 minute (61ºC annealing temperature for the Y1H20 colony), 72ºC for 70

seconds of extension step, and 15 additional cycles of 95ºC for 1 minute, 53ºC for 1 minute

(61ºC annealing temperature for the Y1H20 colony), 72ºC for 70 seconds plus 5 seconds

per cycle, and an additional final extension period of 5 minutes at 72ºC. The amplified

sequences were cloned by homologous recombination in the GATEWAY pDONR 221

vector and sequenced for validation. After sequence validation, the sequence was

transferred to the GATEWAY destination vector pDEST 17. This vector was developed for

high-level expression on E. coli, and it has an N-terminal poly-histidine tag for rapid

purification with a nickel chelating resin. After recombination, pDEST 17 carrying the

sequences of interest were transformed into E. coli DE3 (BL21) strain competent cells. The

protein of interest was induced with 1mM of IPTG for 4 hours. Induced culture samples

were collected at regular time points, the cells were centrifuged and the pellet was stored

at -20ºC until use.

Particle bombardment of onion epidermal cells with a GFP-fusion vector We used the GATEWAY pENTR_Y1H6 and Y1H20 generated as described

above to transfer the sequences of interest to an N-terminal GFP-fusion GATEWAY

destiny vector (pH7WGF2.0). The GFP-Y1H6 or Y1H20 fusion vectors were particle

bombarded into onion epidermal cells following a protocol described by Scott and

colleagues (1999). The inner epidermal onion peels were collected and placed on 1x MS

(Murashige and Skoog medium supplemented with 30g/L of sucrose and 2% agar; pH 5.7)

(Murashige and Skoog, 1962) plates 1 hour prior to bombardment. We used 0.5mg of 1µm

Ø gold particles per particle discharge, mixed with 2µg of vector DNA. The gold/DNA

mixture was delivered to the onion epidermal peels through a Biolistic PDS-1000/He

system (BioRad, USA) using a 1100psi rupture disk. After particle discharge, the plates

101

Tiago Lourenço

were incubated at 22ºC under continuous light. The plates were screened for GFP signal

between 18-22 hours after bombardment using an inverted light microscope with

fluorescence light and differential interference contrast (Nomarski imaging) (Nikon Eclipse

TE300).

AP2/ERF alignments and phylogenetic analysis For the AP2/ERF alignments and phylogenetic analysis, we used amino acids

sequences from all (I-IV) ERF classes and also sequences from the AP2 and RAV families

as outliers.

The protein sequence alignment was made using the ClustalW and refined using

the GeneDoc software (http://www.psc.edu/biomed/genedoc). Phylogenetic analyses on

the refined alignments and phylogenetic trees were done using the MEGA 4 software

(http://www.megasoftware.net) (Tamura et al., 2007). The phylogenetic trees were

generated through the Neighbor Joining methodology on 1000 bootstrap replications.

Stress treatment and total RNA extraction Rice seedlings (cv. Nipponbare) grown for 2 weeks in Yoshida’s medium (Yoshida

et al., 1976) at 28ºC (12h light /12h dark photoperiod) were transferred to a 10ºC growth

chamber (Aralab, Portugal) (12h light/12h dark) with 150-200µmol/m2/s light intensity for

cold treatment. Whole plant samples were collected at 0h (28ºC), 15 minutes (10ºC), 30

minutes (10ºC), 1 hour (10ºC), 2 hours (10ºC), 3 hours (10ºC) and 5 hours (10ºC) time

points, frozen in liquid nitrogen, and then kept at -80ºC until use. A minimum of 4 plants

were used per time point. Total RNA from whole plants was extracted using the TRIZOL®

(Invitrogen, USA) reagent following the manufacturer instructions.

cDNA synthesis and RT-PCR (reverse transcriptase-PCR) analysis For cDNA synthesis we treated the total RNA with DNAse (Qiagen, USA) to

eliminate any possible trace of DNA. The DNAse treatment was performed in the RNA-EZ

columns from Qiagen (USA) following the manufacturers RNA-clean up protocol. For cDNA

synthesis we used 1µg of total RNA using the Invitrogen (USA) cDNA synthesis kit

following the manufacturer instructions using oligo-dT (Invitrogen, USA) as primer for first-

strand synthesis.

For the detection of selected target gene (Y1H6 and Y1H20) expression by RT-

PCR we used primers designed using the online program Primer 3 at a final PCR reaction

concentration of 10pmol. As template for the PCR reaction we used 0.5µL of cDNA

(equivalent to 50ng of total RNA), and the control was made with the actin rice gene. PCR

102

http://www.psc.edu/biomed/genedoc


was performed using the conditions described above. The PCR products were resolved in

1% agarose gel stained with ethidium bromide. Each PCR was repeated at least twice for

validation.

Genotyping Y1H6 T-DNA tagged line The seed mixtures (non-transformed, heterozygous and homozygous) from the T-

DNA tagged line were germinated in water and in the dark for three days. The seedlings

were then transferred to Yoshida’s medium supplemented with 30mg/L of hygromicin B

and grown for 2 weeks at 28ºC (12h light /12h dark photoperiod) to screen the non-

transformed seeds. Rice non-transformed seeds (cv. Dongjin) were germinated and grown

as previously described but without the Yoshida’s medium supplemented with hygromicin

B. The surviving seeds were transferred to soil mixture (2:2:1, v/v/v, soil:turf:vermiculite)

and allowed to grow in the glasshouse. The DNA was collected and frozen in liquid

nitrogen, and then kept at -80ºC until use. The CTAB protocol (Doyle and Doyle, 1987;

Cullings, 1992) was used to extract DNA from the rice plants and the DNA was used in the

genotyping of the different lines with specific primers (Table S1).

References Allen MD, Yamasaki K, Ohme-Takagi M, Tateno M, Suzuki M (1998) A novel mode of DNA

recognition by a beta-sheet revealed by the solution structure of the GCC-box binding domain in complex with DNA. Embo J 17: 5484-5496

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389-3402

Berrocal-Lobo M, Molina A, Solano R (2002) Constitutive expression of ETHYLENE-RESPONSE-FACTOR1 in Arabidopsis confers resistance to several necrotrophic fungi. Plant J 29: 23-32

Cao Y, Song F, Goodman RM, Zheng Z (2006) Molecular characterization of four rice genes encoding ethylene-responsive transcriptional factors and their expressions in response to biotic and abiotic stress. J Plant Physiol 163: 1167-1178

Cao Y, Wu Y, Zheng Z, Song F (2005) Overexpression of the rice EREBP-like gene OsBIERF3 enhances disease resistance and salt tolerance in transgenic tobacco. Physiological and Molecular Plant Pathology 67: 202-211

Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, Kim IH, Park CY, Kim JC, Park BO, Koo SC, Yoon HW, Chung WS, Lim CO, Lee SY, Cho MJ (2003) BWMK1, a rice mitogen-activated protein kinase, locates in the nucleus and mediates pathogenesis-related gene expression by activation of a transcription factor. Plant Physiol 132: 1961-1972





Dubouzet JG, Sakuma Y, Ito Y, Kasuga M, Dubouzet EG, Miura S, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) OsDREB genes in rice, Oryza sativa L., encode

103

Tiago Lourenço

transcription activators that function in drought-, high-salt- and cold-responsive gene expression. Plant J 33: 751-763

Elliott RC, Betzner AS, Huttner E, Oakes MP, Tucker WQ, Gerentes D, Perez P, Smyth DR (1996) AINTEGUMENTA, an APETALA2-like gene of Arabidopsis with pleiotropic roles in ovule development and floral organ growth. Plant Cell 8: 155-168

Fischer U, Droge-Laser W (2004) Overexpression of NtERF5, a new member of the tobacco ethylene response transcription factor family enhances resistance to tobacco mosaic virus. Mol Plant Microbe Interact 17: 1162-1171

Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M (2000) Arabidopsis ethylene-responsive element binding factors act as transcriptional activators or repressors of GCC box-mediated gene expression. Plant Cell 12: 393-404


Gu YQ, Wildermuth MC, Chakravarthy S, Loh YT, Yang C, He X, Han Y, Martin GB (2002) Tomato transcription factors pti4, pti5, and pti6 activate defense responses when expressed in Arabidopsis. Plant Cell 14: 817-831

Hu Y, Zhao L, Chong K, Wang T (2008) Overexpression of OsERF1, a novel rice ERF gene, up-regulates ethylene-responsive genes expression besides affects growth and development in Arabidopsis. J Plant Physiol

Huang Z, Zhang Z, Zhang X, Zhang H, Huang D, Huang R (2004) Tomato TERF1 modulates ethylene response and enhances osmotic stress tolerance by activating expression of downstream genes. FEBS Lett 573: 110-116

Ito Y, Katsura K, Maruyama K, Taji T, Kobayashi M, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2006) Functional analysis of rice DREB1/CBF-type transcription factors involved in cold-responsive gene expression in transgenic rice. Plant Cell Physiol 47: 141-153


Jeon JS, Lee S, Jung KH, Jun SH, Jeong DH, Lee J, Kim C, Jang S, Yang K, Nam J, An K, Han MJ, Sung RJ, Choi HS, Yu JH, Choi JH, Cho SY, Cha SS, Kim SI, An G (2000) T-DNA insertional mutagenesis for functional genomics in rice. Plant J 22: 561-570

Jeong DH, An S, Kang HG, Moon S, Han JJ, Park S, Lee HS, An K, An G (2002) T-DNA insertional mutagenesis for activation tagging in rice. Plant Physiol 130: 1636-1644

Kagaya Y, Ohmiya K, Hattori T (1999) RAV1, a novel DNA-binding protein, binds to bipartite recognition sequence through two distinct DNA-binding domains uniquely found in higher plants. Nucleic Acids Res 27: 470-478

Lee H, Xiong L, Gong Z, Ishitani M, Stevenson B, Zhu JK (2001) The Arabidopsis HOS1 gene negatively regulates cold signal transduction and encodes a RING finger protein that displays cold-regulated nucleo--cytoplasmic partitioning. Genes Dev 15: 912-924


Meijer AH, Ouwerkerk PB, Hoge JH (1998) Vectors for transcription factor cloning and target site identification by means of genetic selection in yeast. Yeast 14: 1407-1415

Memelink J (1997) Two yeast/Escherichia coli lambda/plasmid vectors designed for yeast one- and two- hybrid screens that allow directional cDNA cloning. Trends Genetics 13: 376

Miura K, Jin JB, Lee J, Yoo CY, Stirm V, Miura T, Ashworth EN, Bressan RA, Yun DJ, Hasegawa PM (2007) SIZ1-mediated sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance in Arabidopsis. Plant Cell 19: 1403-1414

Murashige T, Skoog F (1962) A revised mediumfor rapid growth and bioassays tobacco tissue cultures. Phisiolgia Plantarum 15: 473-497

Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol 140: 411-432


Ohme-Takagi M, Shinshi H (1995) Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element. Plant Cell 7: 173-182

Ouwerkerk PB, Meijer AH (2001) Yeast one-hybrid screening for DNA-protein interactions. Curr Protoc Mol Biol Chapter 12: Unit 12 12

104


Park JM, Park CJ, Lee SB, Ham BK, Shin R, Paek KH (2001) Overexpression of the tobacco Tsi1 gene encoding an EREBP/AP2-type transcription factor enhances resistance against pathogen attack and osmotic stress in tobacco. Plant Cell 13: 1035-1046

Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki K (2002) DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochem Biophys Res Commun 290: 998-1009

Scott A, Wyatt S, Tsou PL, Robertson D, Allen NS (1999) Model system for plant cell biology: GFP imaging in living onion epidermal cells. Biotechniques 26: 1125, 1128-1132


Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596-1599

Thomashow MF (1999) PLANT COLD ACCLIMATION: Freezing Tolerance Genes and Regulatory Mechanisms. Annu Rev Plant Physiol Plant Mol Biol 50: 571-599

Tournier B, Sanchez-Ballesta MT, Jones B, Pesquet E, Regad F, Latche A, Pech JC, Bouzayen M (2003) New members of the tomato ERF family show specific expression pattern and diverse DNA-binding capacity to the GCC box element. FEBS Lett 550: 149-154

Wang H, Huang Z, Chen Q, Zhang Z, Zhang H, Wu Y, Huang D, Huang R (2004) Ectopic overexpression of tomato JERF3 in tobacco activates downstream gene expression and enhances salt tolerance. Plant Mol Biol 55: 183-192

Xu ZS, Xia LQ, Chen M, Cheng XG, Zhang RY, Li LC, Zhao YX, Lu Y, Ni ZY, Liu L, Qiu ZG, Ma YZ (2007) Isolation and molecular characterization of the Triticum aestivum L. ethylene-responsive factor 1 (TaERF1) that increases multiple stress tolerance. Plant Mol Biol 65: 719-732


Yang HJ, Shen H, Chen L, Xing YY, Wang ZY, Zhang JL, Hong MM (2002) The OsEBP-89 gene of rice encodes a putative EREBP transcription factor and is temporally expressed in developing endosperm and intercalary meristem. Plant Mol Biol 50: 379-391

Yi SY, Kim JH, Joung YH, Lee S, Kim WT, Yu SH, Choi D (2004) The pepper transcription factor CaPF1 confers pathogen and freezing tolerance in Arabidopsis. Plant Physiol 136: 2862-2874

Yoshida S, Forno DA, Cock JH, Gomez KA (1976) Laboratory manual for physiological studies of Rice. International Rice Research Institute, Manila (The Philippines)

Zhang H, Zhang D, Chen J, Yang Y, Huang Z, Huang D, Wang XC, Huang R (2004) Tomato stress-responsive factor TSRF1 interacts with ethylene responsive element GCC box and regulates pathogen resistance to Ralstonia solanacearum. Plant Mol Biol 55: 825-834

Zhang X, Zhang Z, Chen J, Chen Q, Wang XC, Huang R (2005) Expressing TERF1 in tobacco enhances drought tolerance and abscisic acid sensitivity during seedling development. Planta 222: 494-501

Zhao L, Luo Q, Yang C, Han Y, Li W (2008) A RAV-like transcription factor controls photosynthesis and senescence in soybean. Planta

Zhou J, Zhang H, Yang Y, Zhang Z, Zhang H, Hu X, Chen J, Wang XC, Huang R (2008) Abscisic acid regulates TSRF1-mediated resistance to Ralstonia solanacearum by modifying the expression of GCC box-containing genes in tobacco. J Exp Bot 59: 645-652

105

Tiago Lourenço

Supplementary Material Table S1. List of primers used in this work. The primer used to isolate the OsHOS1 gene promoter fragments used to construct the yeast bait strains (PROM 1-3) had adaptors on their 5’-end to help in cloning process. The Fw (Forward) PROM primers had a NotI adaptor and the Rv (Reverse) PROM 1-3 primers had a NheI adaptor. The adaptor sequence in both cases is underlined. For the Y1H6 and Y1H20 protein expression (Fw and Rv primers) we used GATEWAY (Invitrogen, USA) primers. The recombinant GATEWAY sequence in the primers is underlined and bold. The Rv His3 primer was used in combination with the Fw PROM primers for controlling the cloning process in the pINTHIS3NB vector and sequencing.

tag tag ggc ttt ctg ctc tgPrimer Rv His3

ggg gac cac ttt gta caa gaa agc tgggtc cta gaa gga caa gtc ggc ctc

Primer Rv GW Y1H20

ggg gac aag ttt gta caa aaa agc aggctc aaa gat gtg cgg cgg agc gat c

Primer Fw GW Y1H20

ggg gac cac ttt gta caa gaa agc tgggtg cta att aac cat tcc caa aac ac

Primer Rv GW Y1H6

ggg gac aag ttt gta caa aaa agc aggctc gat gtg tgg aggagc act gat

Primer Fw GW Y1H6

gtt gaa gtg aac ttg cgPrimer Rv pACTII

ccc cac caa acc caa aaa aagPrimer Fw pACTII

cta gct agc ttc ctt gtt tgt cga tca gtt cPrimer Rv PROM 3

ata aga atg cgg ccg ctg aag caa atagag ctt ctc

Primer Fw PROM 3

cta gct agc aat tct aga ttt gaa tgt acc tga at

Primer Rv PROM 2

ata aga atg cgg ccg ctt aac ggc tag aactga tcg

Primer Fw PROM 2

cta gct agc tct ggg cga cct cgc cgt tgPrimer Rv PROM 1

ata aga atg cgg ccg cgg cac aca tgt attcag gta ca

Primer Fw PROM 1

106

Chapter 5 General Conclusions and Future Perspectives

Tiago Lourenço

108


General Conclusions and Future Perspectives

The analysis of a rice line transformed with the HvCBF4 gene was our

main goal, in order to study the abiotic stress pathway in rice (Oryza sativa).

However, in the first two years of PhD scholarship, the strategy used to transform

rice with the HvCBF4 gene failed. We had prepared genetic constructs to use in

particle bombardment of rice immature embryos in a work conducted at IRRI

(International Rice Research Institute, Los Baños, The Philippines) in the Tissue

Culture Laboratory under the supervision of Dr. Swapan Datta. Unfortunately, the

time spent to achieve rice transformation through particle bombardment, despite

the invested effort, was not enough to retrieve a single transformed line.

Nevertheless, all the rice tissue culture expertise gathered at IRRI, proved to be

very useful during the remaining PhD research.

Aiming for new and more efficient strategies we decided to transform rice

using an Agrobacterium-mediated protocol targeting mature seeds. We prepared

constructs using a constitutive (maize Ubi1) or a stress-inducible (Arabidopsis

RD29A) promoter to drive the expression of HvCBF4. This strategy proved to be

efficient since we were able to generate, for both promoters, several transgenic

lines expressing the transgene of interest. Additionally, new objectives were

persued to study the rice abiotic stress pathway. We decided to identify the rice

orthologue of the Arabidopsis HOS1 gene and to identify, by a Yeast One-Hybrid

approach, how this gene is regulated in rice.

We studied the expression of the HvCBF4 gene driven by a constitutive or

a stress-inducible promoter in rice. Only the Ubi::HvCBF4 plants have shown

tolerance to drought stress, but not to cold or high-salt. The AtRD29A::HvCBF4

plants had, however, a higher number stress-responsive gene up-regulated in

GeneChip expression studies when compared to other studies with Ubi::HvCBF4

plants. Nevertheless, the AtRD29A::HvCBF4 plants did not shown an improved

stress tolerance. This may be because the RD29A promoter from Arabidopsis is

less efficient in rice than in other plants. Furthermore, the stress-responsive

genes had the expression altered especially in the roots. Most of the research

papers use whole-plants to extract total RNA, however, we showed that there is a

tissue specific gene expression pattern in response to the action of the HvCBF4.

109

Tiago Lourenço

Still, a set of genes up-regulated in recent work from another group was also up-

regulated in our Ubi::HvCBF4 plants. The reason why the different promoters

cause different gene expression is still unknown.

We also analyzed, by fluorometry, physiological data from the transgenic

lines. Not surprisingly, the Ubi::HvCBF4 showed a better efficiency of the

photosystem II (PSII) than the other lines, which agrees with the higher survival

rate observed. However, further analyses like stomatal conductance and gas

exchange data, must be preformed to understand if the mechanism by which

these plants (Ubi::HvCBF4) survive drought stress is indeed through tolerance or

avoidance.

We also identified the rice orthologue of the Arabidopsis HOS1 gene,

which was named OsHOS1. In Arabidopsis, the HOS1 negatively regulates the

ICE1 function by targeting this TF to degradation in the ubiquitin-proteasome

complex. We decided to study the function of the OsHOS1 by silencing its

expression by RNA interference (RNAi). In the RNAi::OsHOS1 plants, the

expression of the OsICE1 was unaltered, however, the expression of OsDREB1A

gene, a target of the OsICE1 TF, showed up-regulation when compared to the NT

plants under cold stress. Furthermore, a downstream target gene of the

OsDREB1A TF, the P5CS gene, also showed up-regulated expression in the

RNAi::OsHOS1 plants under cold stress. Nevertheless, we could not establish the

link between the low level of the OsHOS1 gene expression and the OsICE1 TF

stability. This was due to the fact that, in preliminary Western blot analysis, the

primary antibody used against the OsICE1 protein reacted unspecifically. In terms

of cold-stress tolerance, we could not detect, by an electrolyte leakage assay,

major differences between the RNAi line and the NT after a cold acclimation

process, although there were cold-stress tolerance associated genes (e.g.

OsDREB1A) up-regulated. This suggests that there may be other mechanisms

affecting cold-stress tolerance in rice. Nonetheless, we can not rule out the

hypothesis that the absence of differences in cold-stress tolerance could be due

to low cold-stress strength. This RNAi line holds other promising aspects to study.

In Arabidopsis, for instance, the interference of the HOS1 in flowering was

described, and we have also observed differences in flowering in the

110


RNAi::OsHOS1 line which may be further characterized at both transcriptomic

and proteomic levels.

During the PhD research work, we have also identified two TFs in the

Yeast One-Hybrid screening, which may be involved in the gene expression

regulation of the OsHOS1. In Arabidopsis, the HOS1 expression is silenced in the

first 30 minutes of cold stress, but it is recovered to normal levels after another 30

minutes. Interestingly, the expression of one of the TFs isolated as putatively

binding the OsHOS1 promoter is silenced after 30 minutes of cold stress. The

silencing of this TF is maintained throughout the whole stress treatment which

may indicate that other TFs can regulate the OsHOS1 expression during cold

stress. However, this part of the research is still in a very preliminary state.

Protein-DNA in vitro binding assays have to be preformed to evaluate to true

binding of the isolated TFs to the OsHOS1 promoter. Furthermore, it is also

important to investigate how these TFs may affect gene expression when

overexpressed in Arabidopsis or tobacco in order to determine their importance in

abiotic stress.

From a personal perspective, this PhD research work gave me the

opportunity of learning several techniques and working in different lab

environments, which resulted in a personal growth both as researcher and as

human being. Regarding this work, there are still several questions that I would

like to address in the future especially regarding the functional characterization of

both TFs isolated in the Yeast One-Hybrid screening. In addition, it will be

interesting to use the transgenic lines already raised in further studies regarding

abiotic stress in rice which will be part of my future work as post-doc.

111

Tiago Lourenço

112

Appendix Protocols

Tiago Lourenço

Chapter Index CTAB extraction protocol………….….…….……….….…..….…….….………115 Rice genomic DNA isolation (SOUTHERN BLOTTING)…...….…..….…..…….….116 TRIzol® RNA extraction protocol….…..….…..…..…...……..….….…....….….117 Rice seed surface sterilization for physiological tests.…....…....…....….….118 Protein extraction method……..……..…......…….…....……....…….…….….…119 Protein quantification (Lowry method)..…..……….….….…....…...….….…...120 SDS-PAGE……….….….…..….…...….….…..……..…..…….….….……..….…...121 Western blotting………………………….……………...….……........…..….…...122 Isolation of specific antibody from mixture a of multiple antibodies.…......123 Yeast One-Hybrid.…...…..….….…..…..….…….…..........…….....…..….……….124

Yeast competent cells preparation protocol (1)…..….…....…...….….….124 Transformation protocol of yeast competent cells with pINT-HIS3 reporter (2)…..…...….….…..……..…….…...…....…..………125 3-AT (3-amino-1, 2, 4-triazole) titration protocol (3)….….…..…...….…..126 LIBRARY SCREENING - transformation protocol of yeast reporter strain competent cells with the cDNA library (4).........127

Rapid yeast-plasmid extraction protocol…………………………….…………129

114


CTAB extraction protocol CTAB Buffer: 10mL 100mM Tris pH8.0 1000uL (1M stock) 25mM EDTA pH8.0 500uL (0.5M stock) 700mM NaCl 1400uL (5M stock) 1%CTAB 1000uL (10% stock) H2Odd 6100uL

• Harvest 1-2g of green leaf. • Grind the leaf with 1mL of CTAB buffer. • Collect the higher amount of buffer and transfer it to a 2mL tube. • Incubate for 10min at 60ºC. • Add 1 volume of chloroform:isoamyl alcohol (24:1). • Centrifuge for 3 min at 6000g (4ºC). • Remove the supernatant to a new 2mL tube. • Add 0.1 volume of 3M sodium acetate (pH5.8). • Add 2 volumes of cold 100% ethanol. • Mix gently and precipitate for 2 hours at -20ºC. • Centrifuge for 5 min at 100g (4ºC). • Pour off the supernatant and wash the pellet with 400uL of washing

buffer. • Centrifuge for 3 min at 800g. • Pour off the supernatant and dry the pellet o/n at room temperature or at

37ºC for 30 min. • Ressuspend the pellet in 100uL of TE buffer.

115

Tiago Lourenço

Rice genomic DNA isolation (SOUTHERN BLOTTING) 2x Pre-Isolation Buffer (PIB): 100mL 0.6M NaCl 12mL (5M stock) 100mM Tris pH 7.5 10mL (1M stock) 40mM EDTA 1.49g 4% N-Lauroyl sarcosine 4g 1% SDS (Sodium Dodecyl Sulfate) 10mL (10% stock) Sterilize in autoclave 1x Isolation Buffer (IB): 10mL 1 volume 2x PIB 5mL 1 volume 10M Urea*** 5mL 5% Phenol pH 8.0 (0.1% 8-hydroxychinolin) 500µL 1% Isoamylalcohol 100µL ***- Do not sterilize in autoclave!!! When crystallized warm in microwave.

• Harvest 0.5-1g of leaf material and freeze immediately in liquid nitrogen until DNA isolation. Store at -80ºC.

• Grind the leaf material in liquid nitrogen into a fine powder and transfer it to a 2mL tube.

• Add 600µL of IB and 600µL of phenol:chloroform:isoamylalcohol (1:1:0.02). Gently mix the leaf material with the buffer until it is homogenized.

• Centrifuge for 20 minutes at 6000g. • Remove the supernatant into a new 2mL tube and add 0.8 volume of

isopropanol. Gently mix it for a maximum of 5 minutes at room temperature.

• Centrifuge for 20 minutes at 6000g. • Pour off the supernatant and dry the remaining drop blotting the tube on a

paper towel. • Wash the pellet with 200µL of 70% ethanol. Do not mix or shake!!! • Centrifuge for 5 minutes at 6000g. • Pour off the 70% ethanol and dry the pellet at 37ºC for 45 minutes to 1

hour or at room temperature overnight. Add 50µL of modified TE buffer (TE+10µg/mL RNAse A), spin down and store at -20ºC.

116


TRIzol® RNA extraction protocol Material:

• Disposable plasticware RNAse-free. • Disposable gloves. • RNA reserved pipettes. • Mortar and pestle. • Liquid nitrogen. • Chloroform. • Isopropanol. • 75% ethanol in DEPC-treated water (RNAse-free). • RNAse-free water (treated with DEPC)

WARNING: TRIzol reagent can be harmful. Always wear gloves and avoid breathing vapor by working in the fume hood.

• This protocol is set to isolate RNA from 50-100mg of tissue. The sample volume should not exceed 10% of the volume of TRIzol used for homogenization.

• Grind the frozen tissue in liquid nitrogen to a fine powder. Transfer the powder to a 2mL tube with a spatula (pre-cooled in liquid nitrogen). Keep the sample tube frozen in liquid nitrogen until all samples are done.

• Add 1mL of TRIzol (per 50-100mg of tissue) to the sample and immediately vortex to allow the tissue to thaw in the TRIzol reagent.

• Centrifuge the cleared homogenate 5min at 12000x g at room temperature (RT). Transfer the liquid solution to a new 2mL tube.

• Centrifuge again for 5min at 12000x g at RT. • Incubate the solution for 5min at RT for complete dissociation of

nucleoprotein complexes. • Add 0.2mL of chloroform (per 1mL of TRIzol) to the solution and

vigorously shake for 15secs and incubate 2-3min at RT. • Centrifuge the tubes for 10min at full speed at RT. • After centrifugation the solution is separated in different phases. The RNA

is exclusively in the clear upper-phase. Transfer the RNA phase to a new 2mL tube (approx. 60% of the initial volume of TRIzol).

• Add 0.5mL (per 1mL of TRIzol) of isopropanol to the tube. Incubate for 10min at RT.

• Centrifuge the tube for 10min at 12000x g at RT. RNA precipitate forms a gel-like pellet in the bottom of the tube.

• Discard the supernatant and wash the RNA-pellet with 1mL (per 1mL of TRIzol) of 75% EtOH. Mix by vortexing and centrifuge for 5min at 7500x g at RT.

• Discard the supernatant and dry the pellet (can be used a short speed vac centrifugation but do not let the pellet dry completely!) for 5-10min.

• Ressuspend the pellet in RNAse-free water (e.g. 100uL). Store at -20ºC until use.

117

Tiago Lourenço

Rice seed surface sterilization for physiological tests

• Pre-treat seeds (seeds grown in the field do not need) at 50ºC for 3 days to break of dormancy.

• Wash mature seeds with 1g/L of benlate (fungicide) solution for 30min at 50ºC (removes fungal contamination and to break dormancy).

• Wash the seeds twice (2x) in sterile water. • Wash the seeds with 70%EtOh for 1min at room temperature (RT). • Wash the seeds twice (2x) in sterile water. • Wash the seeds with a solution of 2% sodium hypochlorite (commercial

bleach diluted 1:1 with water) with 2-3 drops of Tween 20 for 20min at RT with agitation.

• Wash the seeds in sterile water for at least six times (6x) to remove all the traces of the bleach solution!!!

• Place the seeds to germinate in sterile water (~10mL in tubes). Let the seeds germinate for 3-4 days in the dark at 28ºC.

• Transfer the germinated seeds to Yoshida’s medium + 30mg/L Hygromicin B (only for transgenic seeds) (use 10mL per tube). NT seeds are transferred to Yoshida’s medium (10mL per tube). The seeds are placed in a growth chamber at 28ºC with a 12h/12h photoperiod (light/dark) for 5 days.

• Transfer the seeds to fresh Yoshida’s medium and let the plantlets grow for another 9 days.

• Apply the stress treatments for the time needed.

118


Protein extraction method

Material: • • • •

•

Liquid nitrogen Ice Mortar and pestle 2x SB (50mM Tris pH 6.8, 100mM DTT, 0.06% bromophenol blue, 15% glycerol, 2% SDS) Water bath

Method: • Collect the sample material and immediately froze it in liquid nitrogen. • Grind the material to a fine powder (weight the material before start grinding). • Add 3mL of 2x SB per g of FW. Mix it well and boil at 99ºC for 5min. • Cool down on ice for 5min. • Centrifuge the tubes for 5min at ~8000g at 4ºC (to avoid proteases). • Collect supernatant (working on ice). • Quantify protein (see Protein Quantification Method) • Apply ~30ug on a SDS-PAGE.

119

Tiago Lourenço

Protein quantification (Lowry method)

Material: • Reagent A (20g Na2CO3; 4g NaOH; 1.6g sodium tartarate; 10g SDS)/ 1 liter

(keep in dark bottles) • Reagent B (2g CuSO4.5H2O)/ 50mL • Reagent C (1 Reagent B: 100 Reagent A) – prepared in the dark • Sodium dexosicolate 1% • TCA 10% • Folin reagent (1:1 H2O) • Eppendorf’s Method: •

• •

• • •

•

Dilute 5uL of your sample in 245uL of water. Add 50uL of sodium dexosicolate 1% and 1mL of TCA 10%. Incubate for 10min. Centrifuge for 5min at 10000rpm (~8000g). Discard the supernatant. Add 1mL of reagent C to the pellet. Incubate for 10min. Add 100uL of Folin reagent (1:1 H2O) and incubate for 30min. Apply 200uL of your sample to a microplate well. Read the absorption at 620nm (if in a microplate, if not at 750nm).

As standard use BSA (5mg/mL) and use a serial dilutions in H2O:

uL of BSA uL of H2O 0 250 5 245 10 240 30 220 50 200 70 180

Apply 200uL to the microplate well.

120


SDS-PAGE Materials: • • • • • •

30% Acrylamide mixture (29:1) 1.5M Tris-HCl (pH 8.8) 10% SDS 10% APS (freshly prepared) TEMED 10x Tris-Glycine (pH 8.3)

Method: 12% Resolution Gel: Final Concentration 30% Acrylamide mixture (29:1) 12% (v/v) 1.5M Tris-HCl (pH 8.8) 0.375M 10% (w/v) SDS 0.1% (v/v) 10% (w/v) APS (freshly prepared) 0.1% (v/v) TEMED 0.04% (v/v) Note: Apply 100-200µL iso-buthanol to top the resolution gel to level. Allow the gel to polymerize at least for 30min. 5% Stacking Gel: Final Concentration 30% Acrylamide mixture (29:1) 5% (v/v) 1M Tris-HCl (pH 6.8) 0.126M 10% (w/v) SDS 0.1% (v/v) 10% (w/v) APS (freshly prepared) 0.1% (v/v) TEMED 0.1% (v/v) 1x TGS gel electrophoresis buffer: Final Concentration 10x TG (pH 8.3) 1x 10% (w/v) SDS 0.1% (v/v) • Apply 30µg of sample protein to the gel. • Separate the proteins by electrophoresis • Wash the anti-body with a solution of 1x PBS, 0.1% Tween 20 (for lower

stringencies use 0.05%) in H2Odd. Wash the membrane 1x for 15min at RT with agitation and 4x for 5min at RT with agitation.

• Incubate the membrane with the secondary antibody-alkaline phosphatase (goat anti-rabbit; Tropix, Applied Biosystems, USA) in the 1:5000 dilution (according to manufactures instructions) in the same solution of the step 1 (1xPBS, 5% (w/v) low-fat powder milk, 0.1% Tween 20 (for lower stringencies use 0.05%) in H2Odd). Allow the incubation to occur for 1h at RT with agitation.

• Wash the antibody with a solution of 1x PBS, 0.1% Tween 20 (for lower stringencies use 0.05%) in H2Odd. Wash the membrane 3x for 5min at RT with agitation. Further wash the membrane with 1x Assay buffer (10x supplied with the Western-StarTM kit) for 2x 2min at RT with agitation. Drain the membrane by touching its corners on a paper towel.

• Pipette 3mL of CDP-Star® on top (per 100cm2) of the membrane. Incubate for 5min at RT. Drain the excess of substrate and place the membrane on a plastic bag and expose to standard X-ray film.

NOTES: If using a PVDF membrane do not use CDP-Star® with Nitro-BlockTM enhancer. Nitro-BlockTM can only be used in nitrocellulose membranes (150µL per 3mL of CDP-Star® per 100cm2 of membrane).

121

Tiago Lourenço

Western blotting

Material: •

• • • •

10x PBS (0.68M NaCl, 0.58M Na2HPO4, 0.17M NaH2PO4. Adjust pH to 7.4 and add water to 1L) Low-fat powder milk Tween 20 H2Odd Western-StarTM kit (Tropix, Applied Biosystems, USA) – Chemiluminescent Immunoblot Detection System

Method: Previous NOTES: If the membrane is dry, pre-wet the membrane on methanol for 10secs (!!!) and wash it twice (2x) with H2Odd. If the membrane has been stained with Ponceu’s reagent, change the blocking solution during the blocking step (1x). • Block the membrane with a solution (adjust volumes to membrane size)

1xPBS, 5% (w/v) low-fat powder milk, 0.1% Tween 20 (for lower stringencies use 0.05%) in H2Odd. Incubate for 1h-1.30h at room-temperature (RT) with agitation.

• Incubate the membrane with the primary antibody (e.g. antibody against OsICE1) in the tested dilution (e.g. 1:500 or 1:2000) in the same solution of the above step (1xPBS, 5% (w/v) low-fat powder milk, 0.1% Tween 20 (for lower stringencies use 0.05%) in H2Odd). Allow the incubation to occur for 1h at RT with agitation.

• Wash the anti-body with a solution of 1x PBS, 0.1% Tween 20 (for lower stringencies use 0.05%) in H2Odd. Wash the membrane 1x for 15min at RT with agitation and 4x for 5min at RT with agitation.

• Incubate the membrane with the secondary antibody-alkaline phosphatase (goat anti-rabbit; Tropix, Applied Biosystems, USA) in the 1:5000 dilution (according to manufactures instructions) in the same solution of the step 1 (1xPBS, 5% (w/v) low-fat powder milk, 0.1% Tween 20 (for lower stringencies use 0.05%) in H2Odd). Allow the incubation to occur for 1h at RT with agitation.

• Wash the antibody with a solution of 1x PBS, 0.1% Tween 20 (for lower stringencies use 0.05%) in H2Odd. Wash the membrane 3x for 5min at RT with agitation. Further wash the membrane with 1x Assay buffer (10x supplied with the Western-StarTM kit) for 2x 2min at RT with agitation. Drain the membrane by touching its corners on a paper towel.

• Pipette 3mL of CDP-Star® on top (per 100cm2) of the membrane. Incubate for 5min at RT. Drain the excess of substrate and place the membrane on a plastic bag and expose to standard X-ray film.

NOTES: If using a PVDF membrane do not use CDP-Star® with Nitro-BlockTM enhancer. Nitro-BlockTM can only be used in nitrocellulose membranes (150µL per 3mL of CDP-Star® per 100cm2 of membrane).

122


Isolation of specific antibody from mixture a of multiple antibodies

Material: • 4

• • • • •

•

•

•

•

•

•

10x PBS (0.68M NaCl, 0.58M Na2HPO , 0.17M NaH2PO4. Adjust pH to 7.4 and add water to 1L) Low-fat powder milk Tween 20 H2Odd 1M Tris-HCl buffer (pH 7.4) 0.1M Glycine-HCl buffer (pH 2.8)

Method: Previous NOTES: If the membrane is dry, pre-wet the membrane on methanol for 10secs (!!!) and wash it twice (2x) with H2Odd. If the membrane has been stained with Ponceu’s reagent, change the blocking solution during the blocking step (1x). In step 5 always work on ice!!!

Dot-blot the peptide (≈100µg/µL) in the membrane (several dot-blots can be made in a row). Allow the dot-blot to dry on the membrane in a non-absorbent background (3MM paper moisturized with 1xPBS). The membrane can be washed briefly in PBS-T (1x PBS, 0.05% Tween 20) Block the membrane in PBS-T with 5% (w/v) low-fat powder milk. Allow the incubation to occur for 1h at RT with agitation or over-night (o/n) at 4ºC with agitation. Incubate the membrane with a minimal volume of a 1:15 dilution of the antiserum (mixture of antibodies) in PBS-T with 5% (w/v) low-fat powder milk for 3h at 4ºC with agitation. Wash the membrane with PBS-T for 3x10min at room temperature (RT) and another wash 1x10min in PBS at RT. Both washes with agitation. Elute the specific antibody bound to the peptide in the membrane (the membrane can be cut into small pieces and placed in a 1.5mL tube) the antibody with a solution of 0.1M Glycine-HCl (pH 2.8) for 30secs!!! Transfer the elution immediately to a tube with 1M Tris-HCl buffer (pH 7.4) (for 500µL of 0.1M Glycine use 60µL of 1M Tris buffer). Repeat this operation twice. Add (optional) 0.5mg/mL of BSA to the solution. Transfer the neutralized antibody solution to a dialysis cassette (e.g. from Pierce) and allow the dialysis to occur over-night against 2L 1xPBS (pre-cooled) at 4ºC with agitation (magnetic stirrer). Recover the dialyzed solution. Store the antibody solution at 4ºC. Alternatively 1/10 volume of 10xPBS can be added to the tube with the neutralized antibody solution and stored at 4ºC.

123

Tiago Lourenço

Yeast One-Hybrid

Yeast competent cells preparation protocol (1) Solutions and Material: • YPD medium (10g/L yeast extract, 20g/L peptone, 20g/L glucose). Sterilize by

autoclaving. • YAPD medium (YPD medium with 20mg/L of adenide hemisulfate). The

adenine is added only after the YPD medium has been autoclaved. • 50mL centrifuge tubes (Falcon type – without skirt). • 300 incubator with shaking. • 10x TE buffer (100mM Tris-HCl, pH7.5; 10mM EDTA, pH7.5. Sterilize by

autoclaving and store at room temperature.). • 10x lithium acetate (1M lithium acetate, pH7.5, adjust with acetic acid,

sterilize by autoclaving and store at room temperature). NOTE: This protocol is adjusted to yeast strain Y187, therefore incubation times maybe have to be adjusted to other yeast strains.

Note that ALL STEPS must be carried OUT OF ICE. • Grow an overnight culture (for every 10 planned transformations) of the

appropriate strain of yeast (e.g. Y187) on 50mL YAPD medium at 300C/170rpm.

• This step is needed only if is to be used in library screening transformation. Otherwise, proceed to step 3. Dilute the overnight culture to an OD600 of around 0.25 in YAPD medium prewarmed to 300C and grow the culture for an additional 3hours. The cells will be harvested at the exponential phase (OD600 around 0.4 to 0.8).

• Harvest the cells of the overnight culture in one 50mL tube by centrifuging for 2minutes at 2400 x g at room temperature in a swing-out tabletop centrifuge.

• Discard the supernatant and resuspend the cells in 50mL of sterile water (use initially 25mL to resuspend the cells and then add the other 25mL). Repeat centrifugation of step 3. This step is repeated twice.

• Discard the supernatant and resuspend the cells in 1mL of 1x TE/1x lithium acetate (prepared from the 10x stocks). Transfer the cells to an 1.5mL eppendorf tube.

• Centrifuge the cells for 30secs at maximum speed. Discard the supernatant and resuspend the cells in 250uL 1x TE/1x lithium acetate.

• The cells are ready to be transformed at this step. The cells can be stored at 40C for a week, although their competency will gradually decrease.

124


Transformation protocol of yeast competent cells with pINT-HIS3 reporter (2)

Solutions and Material: • YPD medium (10g/L yeast extract, 20g/L peptone, 20g/L glucose). Sterilize by

autoclaving. • YAPD-G418 plates (YPD medium with 20mg/L of adenine hemisulfate and

15g/L of bacto-agar (or microagar)) supplemented with 150mg/L of G418. The G418 is added only after the YAPD medium as cooled to 600C.

• 300 incubator with and without shaking. • 10x TE buffer (100mM Tris-HCl, pH7.5; 10mM EDTA, pH7.5. Sterilize by


sterilize by autoclaving and store at room temperature). • 50% (w/v) PEG 4000 (sterilize by autoclaving and store at room temperature

on well-closed bottles). The transformation efficiencies are very dependent on the PEG concentration.

• 10mg/mL YEASTMAKER carrier DNA (Clontech). Method: • Immediately prior to transformation, denature the required amount of

YEASTMAKER carrier DNA (25ug/reaction – 2.5uL) to be used in all yeast transformations in a boiling bath for 10min and snap cool on ice.

• Prepare 40% PEG/ 1x TE /1x lithium acetate from the stocks (add 8 parts of 50% PEG, 1 part of 10x TE buffer and 1 part of 10x lithium acetate) in sufficient amount to be used in step 3. This solution should always be made fresh.

• Mix 100-500ng (per transformation) of the isolated fragment of pINT-HIS3-Promoter with the 25ug carrier DNA to a total volume of 10uL in a 1.5mL eppendorf tube. Add 50uL of the competent yeast cells and 300uL of the freshly prepared 40% PEG/ 1x TE /1x lithium acetate solution. Vortex to mix.

• Incubate for 30min at 300C at 170rpm. • Heat-shock the cells at 420C for 15min. • Harvest the cells by centrifuging at maximum speed for 30secs. • The transformed yeast cells need to recuperate to express the APT1 marker

gene that confers resistance to G418. Resuspend the pelleted cells in 1mL of YAPD medium and transfer them to 10-15mL tubes (1.5mL tubes are not suitable due to the excess of CO2 pressure). Incubate the cells for 3-6hours at 300C at 170rpm.

• After the recuperation step, transfer the cells to 1.5mL eppendorf tubes and harvest the cells by centrifuging for 30secs at maximum speed. Discard supernatant and resuspend the cells in 100uL of 1x TE.

• Plate the resuspend cells in YAPD-G418 plates and incubate them for 2-3 days at 300C.

• After the growth of G418 resistant colonies, pick and restreak them on fresh YAPD-G418 plates. As negative control, also streak the yeast strain used in transformation (e.g. Y187) in the same plate. Incubate for 2-3 days at 300C. NOTE: Do not pick very small colonies, which may carry a mutation and grow slower. These colonies are not useful in library screening.

• Proceed to 3-AT titration.

125

Tiago Lourenço

3-AT (3-amino-1, 2, 4-triazole) titration protocol (3) Y187 strain genotype: Leu -, Trp -, His -, Ura +, Ade -, Met -, Lys + Solutions and Material: • CM medium (2% glucose, 5 g/L (NH4)2So4, 1,7 g/L YNB (Yeast nitrogen

base)). Doesn’t require pH adjustment. Sterilize by autoclaving at 1100C (pressure 0.8bar).

• Standard size petri-dishes • CM solid (CM medium + 2% microagar – sterilize by autoclaving). • CM His – plates (CM medium + 2% microagar – sterilize by autoclaving) with

Leu, Met, Ade and Trp. • CM His – plates (CM medium + 2% microagar – sterilize by autoclaving) with

Leu, Met, Ade, Trp and 5mM 3-AT. • CM His – plates (CM medium + 2% microagar – sterilize by autoclaving) with

Leu, Met, Ade, Trp and 10mM 3-AT. • CM His – plates (CM medium + 2% microagar – sterilize by autoclaving) with

Leu, Met, Ade, Trp and 25mM 3-AT. • CM His + plates (CM medium + 2% microagar – sterilize by autoclaving) with

Leu, Met, Ade, Trp and His. • 3-AT 2M stock (filter sterilize and add to CM solid medium only after

autoclaving). • Appropriate amino acids in a 100x stock (Leu 3g/L, Met 2g/L, His 4g/L, Ade

2g/L, Trp 2g/L). Sterilize by autoclaving. Trp is sensitive to light and should be protected with foil. Add the appropriate amino acids after CM solid medium has been autoclaved and cooled to 600C.

126


LIBRARY SCREENING - transformation protocol of yeast reporter strain competent cells with the cDNA library (4)

Solutions and Material: • YPD medium (10g/L yeast extract, 20g/L peptone, 20g/L glucose). Sterilize by

autoclaving. • YAPD medium (YPD medium with 20mg/L of adenine hemisulfate). • CM Leu- standard plates (MATH plates; CM medium - 0.17% YNB (yeast

nitrogen base without amino-acids or ammonium sulfate), 2% glucose, 5g/L Ammonium sulfate ((NH4)2SO4) solified with 2% microagar (Duchefa), supplemented with 20mg/L Methionine, 20mg/L Adenine, 20mg/L Tryptophan, 40mg/L Histidine.

• CM Leu- His- large (15cm) plates (MAT plates; CM medium solified with 2% microagar and supplemented with 20mg/L Methionine, 20mg/L Adenine, 20mg/L Tryptophan and the appropriate amount of 3-AT (3-amino-1, 2, 4-triazole) determined by the 3-AT titration protocol.

• CM Leu- His- standard plates (MAT plates; CM medium solified with 2% microagar and supplemented with 20mg/L Methionine, 20mg/L Adenine, 20mg/L Tryptophan and the appropriate amount of 3-AT (3-amino-1, 2, 4-triazole) determined by the 3-AT titration protocol. NOTE: The amino acids should be added only after CM medium is autoclaved and cooled to 600C.The CM medium should be autoclaved at 1100C instead at the normal 1210C. The pressure will also be slightly inferior to 1 bar. All the plates have to be well dried before plating to avoid moisture during the incubation.

• 300 incubator with and without shaking. • 10x TE buffer (100mM Tris-HCl, pH7.5; 10mM EDTA, pH7.5. Sterilize by


sterilize by autoclaving and store at room temperature). • 50% (w/v) PEG 4000 (sterilize by autoclaving and store at room temperature

on well-closed bottles). The transformation efficiencies are very dependent on the PEG concentration.

• 10mg/mL YEASTMAKER carrier DNA (Clontech). • 2M 3-AT (3-amino-1, 2, 4-triazole) stock (filter sterilized). • 2g/L Methionine (100x stock). • 2g/L Adenine (100x stock). • 2g/L Tryptophan (100x stock). • 4g/L Histidine (100x stock) Method: • Immediately prior to transformation, denature the required amount of

YEASTMAKER carrier DNA (25ug/reaction – 2.5uL) to be used in all yeast transformations in a boiling bath for 10min and snap cool on ice.

• Prepare 40% PEG/ 1x TE /1x lithium acetate from the stocks (add 8 parts of 50% PEG, 1 part of 10x TE buffer and 1 part of 10x lithium acetate) in sufficient amount to be used in step 3. This solution should always be made fresh.

• Mix 1ug of the cDNA library (per individual transformation) with the 25ug carrier DNA to a total volume of 10uL in a 1.5mL eppendorf tube. Add 50uL of

127

Tiago Lourenço

the competent yeast cells (reporter strain) and 300uL of the freshly prepared 40% PEG/ 1x TE /1x lithium acetate solution. Vortex to mix. NOTE: As a transformation control, empty pACTII vector can also be used in transformation of yeast reporter strain cells. It will help to assess the percentage of true HIS+ colonies are emerging from the plates.

• Incubate for 30min at 300C at 170rpm. • Heat-shock the cells at 420C for 15min. • Harvest the cells by centrifuging at maximum speed for 30secs. • The transformed yeast reporter strain cells don’t need a recuperation step

because the auxotrophic marker genes don’t need it. Discard supernatant and resuspend the cells in 200uL of 1x TE.

• Plate 1-2 of the independent transformations (with dilutions of 100- and 1000-fold) on CM Leu- plates (MATH plates) and incubate them for 3 days at 300C. This will assess the transformation efficiency. Calculate the total number of transformants to determine if the screening was saturating (it should be around 106 colonies). Good transformation efficiency varies from around 5x104 to 1x105 colonies. This will also determine how many MAT plates (screening plates) are needed to saturate the library.

• Plate the transformation reaction on the large MAT plates (screening plates). Grow the plates for 10-14 days at 300C. Putative His+ positive colonies will appear as fast growing colonies among the background. Pick these colonies and restreak them in standard MAT plates and grow them for 3-10 days.

• Proceed to the identification and assessment of true positives studies.

128


129

Rapid yeast-plasmid extraction protocol

Material: • Breaking buffer: 2% Triton X-100, SDS 1%, 100mM NaCl, 10mM Tris-HCl,

1mM EDTA. • Phenol:chloroform:isoamilic alcohol (1:1:0.02) • Chloroform:isoamilic alcohol (24:1) • Glass beads • Table-top centrifuge • 1.5mL eppendorf tubes Method: • Grow the yeast strain in the appropriate medium over-night at 30ºC and

170rpm. • Use 1.5mL to 3 mL of the dense culture grown over-night and pellet the cells

for 5min at room temperature (RT) in a table-top centrifuge at maximum speed (13000 rpm).

• Discard the supernatant and ressuspend the pellet in 200µL of breaking buffer. Transfer the ressuspended cells to a 1.5mL eppendorf tube.

• Add 0.3g of glass beads (425-600µm) to the tube and 200µL phenol:chloroform:isoamilic alcohol.

• Vortex for 2min at RT and centrifuge 3min at RT at 10000 rpm. • Transfer the aqueous layer to a new 1.5mL eppendorf tube and perform a

chloroform:isoamilic alcohol extraction. Mix by inversion of the tube and centrifuge for 3min at RT at 10000 rpm.

• Use 5µL of the aqueous layer to transform bacteria.

Documents

ADDRESSING ABIOTIC STRESS TOLERANCE IN ICE ORYZA … › ~saibo › projectos2011 › TeseTiago2008.pdf · Addressing Abiotic Stress Tolerance in Rice (Oryza sativa L.) Through a