Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
1
Acetylation of the Response Regulator RcsB 1
Controls Transcription from a Small RNA Promoter 2
3
Linda I. Hu1, Bui Khanh Chi2, Misty L. Kuhn3, Ekaterina V. Filippova3, Arti J. Walker-4
Peddakotla1, Katrin Bäsell2, Dörte Becher2, Wayne F. Anderson3, Haike Antelmann2, and 5
Alan J. Wolfe1# 6
7
1Department of Microbiology and Immunology 8
Loyola University Chicago 9
Stritch School of Medicine 10
2160 S. First Ave. Bldg. 105 11
Maywood, IL 60153, USA 12
2Institute for Microbiology, 13
Ernst-Moritz-Arndt-University of Greifswald, 14
F.-L.-Jahn-Str. 15, D-17487 Greifswald, Germany 15
3Center for Structural Genomics of Infectious Diseases, Northwestern University, Feinberg School of 16
Medicine, Department of Molecular Pharmacology and Biological Chemistry, Chicago, IL 60611, USA 17
18
*Running title: Acetylation regulates transcription 19
20
To whom correspondence should be addressed: Alan J. Wolfe, Department of Microbiology and 21
Immunology, Loyola University Chicago, Stritch School of Medicine, 2160 S. First Ave. Bldg. 105, 22
Maywood, IL 60153, Tel: (708) 216-5814; Fax: (708) 216-9574; E-mail: [email protected] 23
Copyright © 2013, American Society for Microbiology. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.00383-13 JB Accepts, published online ahead of print on 12 July 2013
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
2
Abstract 24
Nε-lysine acetylation was recently discovered on many bacterial proteins that function in diverse 25
cellular processes. Thus, many questions remain unanswered. For example, what mechanisms 26
regulate lysine acetylation? Does acetylation affect physiology? To help answer these questions, 27
we studied the Escherichia coli response regulator and transcription factor RcsB, which is 28
reported to be acetylated in vitro. To characterize RcsB acetylation, we monitored transcription 29
from the rprA promoter, which requires RcsB. The conventional view is that RcsB is activated by 30
phosphorylation through either the Rcs phosphorelay or acetyl phosphate. We affirmed that rprA 31
transcription requires phosphorylated RcsB and showed that AcP is a phosphoryl group donor to 32
RcsB. However, a mutant that accumulates AcP (ackA) exhibited reduced rprA transcription 33
instead of the predicted increase. rprA transcription also diminished in the cobB mutant, which 34
lacks the only known E. coli protein deacetylase. This suggests the existence of an inhibitory 35
mechanism that involves lysine acetylation, a supposition supported by the observation that RcsB 36
isolated from the ackA or cobB mutants was hyperacetylated. Finally, we used a genetic approach 37
to identify an AckA- and CobB-sensitive lysine (Lys-154) that controls RcsB activity. We 38
propose that acetylation inhibits RcsB activity and that some of this inhibition acts through the 39
acetylation of Lys-154. 40
41
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
3
Introduction 42
More than 300 post-translational modifications (PTMs) have been identified (1,2). By 43
decorating proteins in various combinations, PTMs can alter charge, size, hydrophobicity or 44
conformation, and thus a protein’s activity, stability, cellular location, and/or affinity for its 45
binding partners (3). Phosphorylation is one of the most common PTMs. In bacteria and lower 46
eukaryotes, phosphorylation of histidinyl and aspartyl residues allows two-component signal 47
transduction systems to sense environmental change and, in response, to appropriately alter 48
cellular behavior. The Rcs phosphorelay is a complex two-component signal transduction 49
pathway composed of three proteins: the hybrid sensor RcsC, the histidine phosphotransferase 50
RcsD and the response regulator (RR) RcsB (Figure 1A). In response to certain extracellular 51
stimuli, the hybrid sensor RcsC autophosphorylates its conserved histidinyl residue and donates 52
that phosphoryl group to a conserved aspartyl residue within its receiver (REC) domain. Next, the 53
phosphoryl group transfers to a conserved histidinyl residue on RcsD, which passes the 54
phosphoryl group to aspartyl residue 56 (Asp-56) within the REC domain of the RR RcsB. Once 55
phosphorylated, RcsB is reported to either form an RcsB homodimer or form heterodimers with 56
its co-activator RcsA (4) or the LuxR-type transcription factors BglJ (5) and GadE (6). The result 57
is regulated transcription of more than 150 genes in Escherichia coli (7), including the small non-58
encoding RNA rprA, which activates translation of the stationary phase sigma factor RpoS (8). 59
In the absence of an extracytoplasmic stimulus, the Rcs phosphorelay works in reverse 60
with RcsD and RcsC functioning as a net phosphatase, dephosphorylating phosphorylated RcsB 61
(Figure 1B). Under such conditions, it is proposed that the phosphoryl group donor for RcsB is 62
acetyl-phosphate (AcP), the intermediate of the Pta-AckA pathway (9). Disruptions of this central 63
metabolic pathway alter intracellular AcP concentrations (10) and result in correlative changes to 64
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
4
in vivo RcsB activities (11). While AcP has been shown to function as the phosphoryl donor to 65
various response regulators in vitro (12,13), its ability to act in this capacity for RcsB has not been 66
demonstrated. 67
Another PTM is Nε-lysine acetylation, which is thought to use acetyl-CoA (AcCoA) as 68
the acetyl donor (3). It was recently reported that RcsB is one of several E. coli transcription 69
factors acetylated in vitro by Pat, a Salmonella enterica Gcn5-like acetyltransferase (GNAT) (14). 70
Both Pat and its E. coli homolog YfiQ (15,16) (also called Pka (17) or PatZ (18)) acetylated RcsB 71
lysine residue 180 (Lys-180) (14). Deacetylation of Lys-180Ac was catalyzed by CobB (14), a 72
member of the sirtuin family of NAD+-dependent deacetylases (19). Since Lys-180 is located in 73
the DNA binding helix-turn-helix motif of RcsB, Lys-180 acetylation reduced RcsB’s affinity for 74
its DNA site at the flhDC promoter (14). Whether RcsB is acetylated in vivo and whether 75
acetylated RcsB has physiological relevance remained unknown (14,20). 76
Here, we provide evidence that the RcsB-dependent rprA promoter is regulated by both 77
phosphorylation and acetylation of RcsB. First, we identify a novel RcsB-dependent behavior and 78
demonstrate that it depends on RcsB phosphorylation. We then show that this behavior is 79
inhibited by loss of CobB’s deacetylase activity or by deletion of ackA, which causes AcP to 80
accumulate. The relevant target of CobB and AckA appears to be RcsB, as mass spectrometry 81
detected several acetylated RcsB lysines, some of which were sensitive to both CobB and AckA. 82
One of those acetylated lysines (Lys-154) appears to play an essential role in RcsB’s ability to 83
activate rprA transcription, but not in its ability to inhibit migration through semi-solid agar. To 84
the best of our knowledge, this is the first report that acetylation of a bacterial transcription factor 85
could have an effect in vivo. 86
87
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
5
Materials and Methods 88
Bacterial strains, plasmids, and bacteriophage. All bacterial strains used in this study are listed in 89
Table 1. Derivatives were constructed by generalized transduction with P1kc, as described 90
previously (21). The transcriptional fusion φ(PrprA-lacZ), carried by λPrprA as described 91
previously (8), was a generous gift from Susan Gottesman (National Institutes of Health, 92
Bethesda, MD). Construction of monolysogens was performed and verified as described 93
previously (22,23). 94
95
Culture conditions. For strain construction, cells were grown in LB containing 1% (w/v) tryptone, 96
0.5% (w/v) yeast extract, and 0.5% (w/v) sodium chloride; LB plates also contained 1.5% agar. 97
For promoter activity assays, cells were grown in TB7, which contains 1% (w/v) tryptone 98
buffered at pH 7.0 with potassium phosphate (100 mM). Transformations were performed by 99
electroporation, or through the use of either transformation buffers 1 and 2 (24) or transformation 100
and storage solution (25). Cell growth was monitored spectrophotometrically (DU640; Beckman 101
Instruments, Fullerton, CA) by determining the absorbance at 600 nm (A600). Spectinomycin (100 102
µg/ml), ampicillin (100 µg/ml), and chloramphenicol (25 µg/ml for experiments using pCA24n-103
yfiQ or 17.5 µg/ml for experiments with pCC1-derived plasmids) were added to growth media 104
when needed. To induce expression of genes carried from various plasmids, β-D-1 105
thiogalactopyranoside (IPTG) was added at the indicated concentrations. 106
107
Promoter activity assays. To monitor promoter activity from φ(PrprA-lacZ), cells were grown 108
aerobically at 37°C in TB7 overnight. The overnight cultures were diluted into fresh TB7 and 109
grown aerobically at 37°C until early stationary phase. At regular intervals, 50 µl aliquots were 110
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
6
harvested and added to 50 µl of All-in-One β-galactosidase reagent (Pierce Biochemical). β-111
galactosidase activity was determined quantitatively using a microtiter format, as described 112
previously (26). As a blank, 50 µl of sterile TB7 was used. Promoter activity was always 113
determined across the entire growth curve and was plotted versus either time or A600; for some 114
experiments, however, only peak activity during exponential phase is shown. Each experiment 115
included three biological replicates unless otherwise mentioned. The values represent the means 116
with standard deviations. All experiments were performed at least twice. 117
118
RcsB cloning into a single copy vector. To construct a single copy plasmid that permits 119
expression of moderate amounts of WT RcsB, we cloned the WT rcsB allele into a derivative of 120
CopyControlTM pCC1TM (EpiCentreR). We began with pVEC, a derivative of pCC1TM, in which 121
the plasmid-encoded lacZα is disrupted by a kanamycin resistance cassette (Table 1, (27)). To 122
replace the kanamycin resistance cassette with the WT rcsB allele, we first constructed a 123
derivative of pVEC that lacked the kanamycin cassette. pVEC was BamHI-digested, ligated, 124
transformed into TransforMaxTM EPI300TM-T1R Chemically Competent E. coli (EpiCentreR), and 125
plated onto an LB plate containing chloramphenicol (17 µg/ml) and 5-bromo-4-chloro-indolyl-β-126
D-galactopyranoside (X-gal). A blue transformant was isolated and grown overnight at 37°C in 127
LB supplemented with chloramphenicol (17 µg/ml) to maintain the plasmid and with 128
CopyControlTM BAC Autoinduction Solution (EpiCentreR) to amplify the plasmid. The plasmid 129
DNA was purified and this pCC1 derivative was designated pLIH001 (Table 1). We then 130
amplified the WT rcsB allele from the chromosome of strain AJW3759 (Table 1), using primers 131
rcsBFBamHI and rcsBRBamHI (Table 1). The resulting amplicon was purified using the 132
CloneJETTM PCR Purification Kit (Thermo Scientific) and cloned into pJET1.2 using the 133
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
7
CloneJETTM PCR Cloning Kit (Thermo Scientific). The ligated product was transformed into 134
competent DH5α and plated onto LB ampicillin plates. The WT rcsB allele was excised from 135
pJET1.2 with BamHI, gel-extracted, subcloned into BamHI-digested pLIH001, transformed into 136
EPI300 cells, and plated onto LB plates containing chloramphenicol and X-gal. White colonies 137
were used to inoculate LB supplemented with chloramphenicol and CopyControlTM BAC 138
Autoinduction Solution (EpiCentreR) and shaken overnight at 37°C. Plasmid DNA was purified 139
and sequenced using primer pCC1RBZ (Table 1). The resulting plasmid was named pLIH002 140
(Table 1). For experiments that involved pLIH002 or derivatives, pVEC functioned as the 141
negative control. 142
143
Site-directed mutagenesis. Site-directed mutagenesis of RcsB in pLIH002 was conducted using 144
QuikChangeR Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies) in 145
accordance with the manufacturer’s instructions using the mutagenic primers listed in Table 1. 146
147
Cloning, Recombinant Expression, and Purification. To purify proteins used for in vitro studies, 148
we transformed the chloramphenicol resistant ASKA plasmids that encode YfiQ or RcsB with a 149
noncleavable N-terminal polyhistidine (His6) tag (28) into kanamycin resistant BL21 Magic cells 150
(29). The ASKA-encoded, His6-tagged protein was expressed in the presence of 34 μg/ml 151
chloramphenicol and 35 μg/ml kanamycin, and purified with IMAC followed by size exclusion 152
chromatography as described (Kuhn et al., submitted, (30)). 153
154
Dynamic light scattering. For characterization of molecular size in solution, dynamic light 155
scattering (DLS) provides a measure of the translational diffusion coefficient of protein in 156
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
8
solution. All DLS measurements were performed on a Zetasizer Nano-S Zen 1600 DLS 157
instrument with a 633 nm wavelength laser. The fluctuations in light intensity, due to the 158
Brownian motion of the molecules, were measured by a photodiode at a 90° angle. Photons were 159
counted and the time dependence of the light intensity fluctuations was analyzed by 160
autocorrelation. Assumptions include a solution viscosity equal to 1.019 and that the proteins are 161
spherical in nature. The proteins were centrifuged for 5 min with 14,000 x g prior to collecting 162
scattering data. Experiments were run at 25°C and at least 6 measurements were taken at each 163
condition. Regularization histogram analyses of samples were carried out using the Zetasizer 164
Nano software. 165
166
LTQ-Orbitrap Velos-LC-MS/MS analysis. For identification of in vivo acetylation sites, cells 167
transformed with pHis6rcsB (which expresses His6-tagged RcsB, (31)) were grown aerobically at 168
37°C at 250 rpm in TB7 supplemented with 50 µM IPTG and spectinomycin until entry into 169
stationary phase and cell lysates were prepared. For the identification of in vivo acetylation of 170
cells inhibited for sirtuin activity, 20 mM nicotinamide was added to the growth medium. For 171
identification of in vitro acetylation sites, His6-tagged RcsB and His6-tagged YfiQ proteins were 172
purified from E. coli cells (see below). The proteins in the in vivo and in vitro samples were 173
separated by SDS-polyacrylamide gel electrophoresis. To normalize the number of cells to lyse 174
per milliliter, the inverse of the culture A600 was used (32). To avoid cross-contamination, we 175
electrophoresed the samples from each strain and/or condition on separate SDS-polyacrylamide 176
gels with bioreplicates separated by an empty lane(s). Electrophoresis was terminated before 177
proteins could run off the bottom of the gel. The gel was cut down the middle of the empty lane to 178
separate the bioreplicates. Each half of the gel was stained with SimplyBlueTM SafeStain 179
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
9
(Invitrogen) and destained with water. The bands were then excised and subjected to tryptic 180
digestion, as described previously (33). Peptides eluted from tryptic digests of gel pieces were 181
subjected to reversed phase column chromatography (self-packed C18 column, 100 μm diameter 182
x 200 mm length) operated on an Easy-nLC II (Thermo Fisher Scientific, Waltham, MA). Elution 183
was performed using a binary gradient of buffer A (0.1% (v/v) acetic acid) and buffer B (99.9 % 184
(v/v) acetonitrile; 0.1% (v/v) acetic acid) over a period of 100 min with a flow rate of 300 nl/min. 185
MS and MS/MS data were acquired with the LTQ-Orbitrap-Velos mass spectrometer (Thermo 186
Fisher Scientific) equipped with a nanoelectrospray ion source. The Orbitrap Velos was operated 187
in data-dependent MS/MS mode using the lock-mass option for real time recalibration. After a 188
survey scan in the Orbitrap (r = 30,000), MS/MS data were recorded for the 20 most intensive 189
precursor ions in the linear ion trap. For MS/MS analysis, singly charged ions were not taken into 190
account. 191
192
Identification of lysine acetylation sites. Post-translational lysine acetylation sites on proteins 193
were identified by searching all MS/MS spectra in .dta format against an E. coli database 194
(extracted from the Uniprot-KB database: 195
http://www.uniprot.org/uniprot/?query=Escherichia+coli+K12&sort=score), using Sorcerer™-196
SEQUEST® (Sequest v. 2.7 rev. 11, Thermo Electron including Scaffold_3_00_05, Proteome 197
Software Inc., Portland, OR). The Sequest search was carried out considering the following 198
parameters: a parent ion mass tolerance - 10 ppm, fragment ion mass tolerance of 1.00 Da. Up to 199
two tryptic mis-cleavages were allowed. Methionine oxidation (+15.99492 Da), cysteine 200
carbamidomethylation (+57.021465 Da) and lysine acetylation (+42.010571 Da) were set as 201
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
10
variable modifications. Proteins were identified by at least two peptides applying a stringent 202
SEQUEST filter. Sequest identifications required deltaCn scores of greater than 0.10 and XCorr 203
scores of greater than 2.2, 3.3 and 3.8 for doubly, triply and quadruply charged peptides. 204
Acetylated peptides that passed these filter criteria were examined manually and accepted only 205
when b- or y- ions confirmed the acetylation site. 206
207
Quantification of acetylated peptides. To compare the abundance of acetylated peptides in 208
different biological samples, we used Scaffold (Sequest v. 2.7 rev. 11, Thermo Electron including 209
Scaffold_3_00_05, Proteome Software Inc., Portland, OR) to perform spectral counting analysis. 210
After fragmentation of a specific peptide, Scaffold can quantify protein amounts from different 211
samples according to the number of MS/MS fragment ion spectra. If a peptide was abundant in 212
the overview MS scan, then many MS/MS fragment ion spectra were generated for this peptide. 213
The number of these spectra is considered to the spectral count for that peptide. To compare the 214
abundance of any given acetylated peptide between samples, we calculated the ratio of spectral 215
counts of one sample versus the other. In-gel tryptic digests for the MS analysis are not suited to 216
added peptide standards; therefore, we applied a semi-quantitative approach. We processed and 217
measured all samples to be compared with the same methods, at the same time, in parallel, and 218
loaded equal amounts of tryptic digest to the LC column. Each comparison was performed on 219
multiple replicates. 220
221
In vitro acetylation reactions. Two different methods were used to detect in vitro acetylated 222
proteins using AcCoA as the acetyl group donor: detection by anti-acetylated lysine Western 223
immunoblot and detection of AcCoA hydrolysis. 224
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
11
225
In vitro acetylation followed by anti-acetyllysine Western immunoblot analysis. Combinations of 226
20 µM RcsB, 0.4 mM AcCoA, and 2 µM YfiQ were incubated at 37°C for 1 hour in 50 mM Tris 227
HCl (pH 8), 10% glycerol, 1 mM DTT, 10 mM sodium butyrate, and 0.1 mM EDTA, as described 228
previously (34). (For the Western immunoblot analysis, see below) 229
230
In vitro acetylation followed by measurement of AcCoA hydrolysis. This biochemical in vitro 231
assay detects acetylation by measuring the hydrolysis of AcCoA. Biochemical assays were 232
performed as described previously (35) with some modifications. First, reactions were performed 233
in the presence of 150 mM NaCl at 25°C for 1 hr to prevent protein precipitation during the 234
reaction. Additionally, after stopping the reactions with guanidine HCl, samples were transferred 235
to Nanosep 10K MWCO centrifugation devices (Pall Life Sciences, VWR) and centrifuged at 236
17,000 x g for 10 minutes to separate CoA and the protein. The Ellman’s reagent was then added 237
to the flow-through and monitored as described (35). This biochemical in vitro acetylation assay 238
was performed in the absence of DTT because this reducing agent generates false positive signals. 239
Reactions reached completion within one hour, and a saturating concentration of RcsB was 240
determined to be 0.15 mM. High concentrations of YfiQ (100 μg) were necessary to detect 241
activity, possibly due to competition for binding between AcCoA and the His6 tag (35). 242
243
In vitro phosphorylation reactions. In vitro phosphorylation was carried out by incubating lithium 244
potassium AcP (Sigma) with purified His-tagged RcsB at 30°C for 30 min in buffer (40 mM Tris-245
HCl pH 8.0, 10 mM MgCl2, 40 mM KCl and 1 mM DTT), as described previously (36). 246
247
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
12
Detection of phosphorylated RcsB. Similar to a previously reported procedure (36), 248
phosphorylated RcsB from in vitro phosphorylation was separated from non-phosphorylated 249
RcsB using zinc(II) Phos-TagTM SDS-PAGE (10% acrylamide (37.5:1), 350 mM Tris, pH 6.8, 250
0.1% SDS, 75 μM Phos-Tag (NARD Institute LTD), and 150 μM Zn(NO3)2). Purified protein 251
was detected by staining the gel with SimplyBlueTM (Invitrogen). 252
253
Western immunoblot analysis. Purified proteins were separated by SDS-PAGE. Proteins were 254
transferred onto a methanol-treated PVDF membrane at 25-30 V at 4°C for 16 hours. The blot 255
was blocked with 5% (w/v) milk prepared in PBS for 1 hour at room temperature. The blot was 256
washed with PBST for 5 minutes. A rabbit polyclonal antibody raised against an acetylated 257
lysine-containing peptide (Cell Signaling 9441) was used at a 1:500 dilution in 5% milk in PBS at 258
4°C overnight. The blot was washed 3 times for 5 minutes each with PBST and then incubated 259
with HRP-conjugated goat anti-rabbit secondary antibody (Cell Signaling 7074S) at a 1:1000 260
dilution in 5% milk in PBS for 1 hour at room temperature. The blot was washed 3 times for 5 261
minutes each with PBST and exposed using 20X LumiGLOR Reagent and Peroxide (Cell 262
Signaling 7003). 263
264
Motility assays. Three independent colonies representing three biological replicates were used to 265
inoculate 5 mL of TB and grown aerobically with agitation at room temperature. These overnight 266
cultures were diluted to a final OD600 of 0.1 in TB. 5 μl were inoculated onto the surface of 267
tryptone motility plates [TB supplemented with 0.25% (w/v) agar] and incubated at 28°C and the 268
diameter measured over time. The values represent the means with standard deviations. The 269
experiment included at least three replicates and was repeated at least once. 270
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
13
271
Results 272
A novel RcsB-dependent behavior requires the phosphoryl acceptor site Asp-56 273
To determine how acetylation might regulate RcsB, we monitored RcsB activity using the 274
canonical RcsB-dependent promoter rprA (PrprA) fused transcriptionally to lacZ. This PrprA-275
lacZ fusion was carried on prophage λ (8), which we inserted into its attachment site in the E. coli 276
K-12 BW25113 chromosome. We grew the resultant λPrprA-lacZ lysogen (strain AJW3759, 277
Table 1) at 37°C in buffered tryptone broth (TB7), monitored β-galactosidase activity over time, 278
and observed that rprA transcription peaked during exponential phase (Figure 2A-B), a behavior 279
that required the RR RcsB (Figure 2B). 280
To further characterize this novel RcsB-dependent behavior, we asked whether PrprA 281
activity, like other RcsB-regulated behaviors, depended on the phosphoryl acceptor residue (Asp-282
56) in the REC domain of RcsB. From a single copy plasmid, we expressed WT rcsB (pLIH002, 283
Table 1) or the mutant rcsB-D56A (pLIH003, Table 1) in an rcsB null mutant of the λPrprA-lacZ 284
lysogen (strain AJW4884) and found that WT rcsB complemented exponential phase PrprA 285
activity, while the rcsB-D56A allele did not (Figure 2C). Since the rcsB-D56A allele carried by 286
the pLIH003 inhibited the activity of endogenous WT RcsB (Figure 2D), we conclude that RcsB-287
D56A is expressed and that exponential phase rprA transcription requires Asp-56 of RcsB and 288
thus active, phosphorylated RcsB. Since both the Rcs phosphorelay and AcP are reported to 289
activate RcsB (11,37,38), we tested if these phosphoryl sources could activate PrprA activity. 290
Because the sensor protein RcsC has been reported to function as either a net kinase or a net 291
phosphatase (11,37,38), we assessed the influence of RcsC on rprA promoter activity. First, we 292
deleted rcsC and found that PrprA activity diminished relative to the WT parent (Figure 2E), 293
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
14
indicating that RcsC activates PrprA transcription. We then overexpressed RcsC, which is 294
reported to decrease phospho-RcsB-dependent mucoidy (11, Figure S1), and observed inhibition. 295
In contrast, RcsF overexpression, reported to increase mucoidy (11, Figure S1), activated rprA 296
transcription (Figure 2F). We conclude that endogenous RcsC functions as a net kinase in this 297
genetic background grown under these conditions. We further propose that the equilibrium 298
between RcsC kinase and phosphatase activities is sensitive to RcsC concentration. 299
300
AckA influences exponential phase rprA transcription. 301
AcP has been shown genetically to activate the Asp-56-dependent RcsB activity required 302
for mucoidy and for inhibition of flagellar biogenesis (11). AcP also has been shown both 303
biochemically and genetically to donate phosphoryl groups to RRs (38). We therefore assessed 304
the role of AcP in activating RcsB at the rprA promoter. To test whether AcP can act as a 305
phosphoryl group donor for RcsB, we used Phos-TagTM, a dinuclear metal complex (i.e. 1,3-306
bis[bis(pyridin-2-ylmethyl)amino]propan-2-olato dizinc(II)) that has affinity for 307
phosphomonoester dianions, such as the one found in a phosphorylated RR. When included in an 308
SDS-PAGE, Phos-TagTM slows the migration of the phosphorylated protein, allowing it to be 309
distinguished from the non-phosphorylated protein by mobility shift. When purified RcsB was 310
incubated with AcP, we observed a shifted band that was sensitive to heat (Figure 3), indicative 311
of a heat-labile aspartyl phosphate. We conclude that this shifted band is composed of 312
phosphorylated RcsB and that RcsB can catalyze its own phosphorylation using AcP as the 313
phosphodonor. 314
Since AcP can donate its phosphoryl group to RcsB in vitro, we asked whether AcP 315
activates rprA transcription in vivo. The enzyme phosphotransacetylase (Pta) converts AcCoA to 316
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
15
AcP, while acetate kinase (AckA) converts AcP to acetate (Figure 4A). Deletion of both ackA 317
and pta results in the lack of AcP (10). In contrast, deletion of ackA alone causes accumulation of 318
AcP (10). If AcP activated the observed Asp-56-dependent rprA transcription, then PrprA activity 319
would be expected to decrease in the ackA pta double mutant and increase in the ackA null 320
mutant. As predicted, the ackA pta double mutant displayed a small but reproducible reduction in 321
rprA transcription whether or not rcsC was intact (Figure 2E). These results support the 322
hypothesis that both AcP and RcsC contribute to RcsB phosphorylation. Contrary to expectations, 323
however, rprA transcription was reduced in the ackA mutant rather than increased (Figure 2E 324
and 4B). This latter result suggests that the accumulation of some metabolic intermediate in the 325
ackA mutant inhibits RcsB activity. We reasoned that this inhibitory mechanism might involve 326
protein acetylation because we have observed that a deletion of ackA changes the acetylation 327
profile of RNA polymerase (36) and enhances global E. coli protein acetylation (B. Zemaitaitis 328
and A. J. Wolfe, unpublished results). We thus considered the possibility that protein acetylation 329
was involved in the reduced rprA transcription exhibited by the ackA mutant. 330
331
The deacetylase CobB activates PrprA activity and regulates RcsB acetylation in vivo 332
Consistent with the hypothesis that acetylation may regulate rprA transcription, others 333
have reported that RcsB could be acetylated in vitro, that this acetylation reduces RcsB DNA 334
binding affinity, and that this acetylation can be reversed by CobB (14). We therefore tested if 335
protein acetylation inhibited rprA transcription. In the absence of cobB, which encodes the only 336
known E. coli deacetylase, there was a strong reduction in rprA transcription compared to that of 337
its WT parent, similar to that of the ackA mutant (Figure 4B). Similar results were obtained when 338
WT cells were grown in the presence of nicotinamide, an inhibitor of CobB (39) (Figure 4C). We 339
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
16
conclude that CobB enhances rprA transcription, likely by deacetylating some protein that inhibits 340
rprA transcription in its acetylated form. 341
Because deletion or inhibition of CobB reduced PrprA activity (Figure 4B and C) and 342
since CobB deacetylates Lys-180Ac of RcsB in vitro (14), we asked whether RcsB was acetylated 343
in vivo and whether CobB regulated RcsB deacetylation in vivo. We first attempted to detect 344
acetylated endogenous RcsB, but failed because the concentration of RcsB was too low. We 345
therefore used pHis6rcsB (31) to overexpress RcsB in WT cells and in its isogenic cobB mutant 346
and grew the resultant transformants in TB7 supplemented with and without NAM. These results 347
have been corroborated by quantitative mass spectrometric analysis of cell-free lysates prepared 348
from WT cells and cobB mutants that do not overexpress RcsB (B. Schilling, B. Gibson, and A. J. 349
Wolfe, unpublished data). For each strain/condition, we performed four biological replicates in 350
parallel and prepared cell lysates. We excised RcsB protein from each SDS polyacrylamide gel 351
and evaluated the acetylation status using Orbitrap Velos LC-MS/MS analysis. To ensure 352
comparable protein abundances for tryptic digestion and MS analysis, RcsB protein obtained from 353
all strains were processed in parallel and similar protein concentrations were loaded onto each 354
SDS-polyacrylamide gel. This allowed us to use the Scaffold software to perform a semi-355
quantitative comparison of abundances (given as spectral counts, SC; (40)) for each detected 356
peptide that contained an acetylated lysine (Table 2, Tables S1-S3). 357
RcsB is acetylated in vivo. In four parallel bioreplicates of the untreated WT strain, 358
Orbitrap Velos mass spectrometry reproducibly detected acetylation of four lysine residues: Lys-359
72, Lys-125, Lys-128 and Lys-154. Each acetylated lysine was identified by at least 1 SC in at 360
least 2 replicates, with an average of 4.0 total SC over all four replicates (Table 2, Table S1A-D). 361
CobB affects RcsB acetylation in vivo. In the cobB mutant, mass spectrometry 362
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
17
reproducibly detected acetylation of 8 lysine residues: the four listed above plus Lys-118, Lys-363
140, Lys-149, and Lys-180 (Table 2, Tables S2A-D). In the parent strain treated with NAM, 364
mass spectrometry also reproducibly detected acetylation of 8 lysine residues: the first seven 365
identified in the cobB mutant and Lys-173 instead of Lys-180 (Table 2, Tables S3A-D). 366
Furthermore, the acetylated peptides were more abundant in the cobB mutant (average total SC of 367
12.5) and in the NAM-treated parent strain (average total SC of 10.5) than in the parent control 368
(average total 4.0 SC). However, these increases in SC were not distributed evenly over all 369
acetylated lysines, suggesting that CobB does not regulate all acetylated RcsB lysines similarly. 370
For example, the average SC for peptides containing acetylated Lys-72 or Lys-125 did not differ 371
significantly between strains/conditions; in contrast, we reproducibly detected acetylation of 3 372
residues (Lys-118, Lys-140, and Lys-149) in the cobB mutant and the NAM-treated parent that 373
were not detected in the untreated parent (Table 2). We conclude that RcsB is acetylated in vivo 374
and that CobB may promote deacetylation of certain RcsB lysines in vivo. 375
376
AckA impacts the acetylation status of RcsB in vivo 377
If RcsB acetylation is responsible for the weak rprA transcription in the ackA mutant, then 378
the RcsB acetylation pattern in the ackA mutant should differ from RcsB from WT cells and, 379
perhaps, resemble that of the cobB mutant. We therefore overexpressed RcsB in the WT strain 380
and its isogenic ackA and cobB mutants, separated the proteins by SDS-PAGE, and subjected the 381
tryptic digests to mass spectrometry as described above. Once again, we performed replicate 382
experiments in parallel, and processed the same amount of protein from all samples so that we 383
could compare the spectral counts for each acetylated peptide in each mutant relative to WT. 384
When comparing the results of this experiment (Table 3) to those of the previously described 385
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
18
experiment (Table 2), we noticed a general increase in the numbers of detected acetylated lysine 386
residues and their spectral counts. We attribute this difference primarily to the larger amounts of 387
RcsB analyzed in the second experiment, which was performed a year later, and to the use of a 388
different liquid chromatography (LC) column prior to Orbitrap Velos MS. 389
The general pattern however, was reproducible: acetylated peptides were more abundant 390
in the cobB mutant (average total SC of 14.5) than in the parent control (average total 8.5 SC) 391
(Table 3), supporting the conclusion that CobB may deacetylate RcsB in vivo. For the parent, we 392
reproducibly detected acetylation of 5 lysine residues, each identified by 1-2 SC per replicate 393
(Table 3, Tables S4A-B). For the cobB mutant, we observed reproducible acetylation of 7 394
lysines, each identified by 1-4 SC per replicate (Table 3, Tables S5A-B). Moreover, some 395
acetylated peptides were reproducibly more abundant than the same peptides from the parent, 396
suggesting that CobB deacetylates these sites in vivo. 397
As predicted, the acetylation profile of RcsB isolated from the ackA mutant (Table 3, 398
Tables S6A-B) generally resembled that of the cobB mutant (Table 3, Tables S5A-B). Of the 7 399
acetylated RcsB lysines from the cobB mutant, 6 lysines were reproducibly acetylated in the ackA 400
mutant. Several acetylated lysines (Lys-118, Lys-128, and Lys-154) were detected more often in 401
both mutants than in their WT parent. Like RcsB from the cobB mutant (average total 14.5 SC), 402
acetylated peptides from the ackA mutant were two-fold more abundant (average total 17 SC) 403
than the same peptides from WT cells (average total 8.5 SC). We conclude that disruption of ackA 404
promotes acetylation of some RcsB lysines in vivo. We further propose that the reduction in rprA 405
transcription in the ackA and cobB mutants results from the same mechanism, an increase in RcsB 406
acetylation. 407
408
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
19
YfiQ regulates PrprA activity independently of RcsB acetylation 409
Because S. enterica Pat and its E. coli homolog YfiQ were reported to acetylate E. coli 410
RcsB in vitro and inhibit its ability to bind DNA (14), we asked if the acetyltransferase YfiQ 411
affects PrprA activity and found that it does: deletion of yfiQ inhibited rprA transcription (Figure 412
5). We therefore asked whether YfiQ affects RcsB acetylation in vivo. However, the acetylation 413
profile of RcsB isolated from the yfiQ mutant did not differ much from that of its parent (Table 3, 414
Tables S7A-B). While not identical, the lysine acetylation sites were quite similar. Most notably, 415
the overall SC for the yfiQ mutant and its parent were identical (average total 8.5 SC) and there 416
was no substantial change in the SC for individual acetylated lysines. Thus, the acetyltransferase 417
YfiQ appears to have no effect on the acetylation status of RcsB in vivo in this growth condition. 418
We conclude that YfiQ enhances rprA transcription by acetylating a protein other than RcsB. 419
420
In vitro acetylation of RcsB 421
Since our in vivo observations argue that YfiQ does not regulate the acetylation status of 422
RcsB (Table 3, Tables S7A-B), but the published in vitro results show that YfiQ can acetylate 423
RcsB (14), we investigated the effect of purified YfiQ on the acetylation status of purified RcsB. 424
We first purified RcsB using gel filtration chromatography, finding that the 23.7 kDa RcsB 425
purified from WT E. coli cells resolved into two peaks with estimated molecular mass values of 426
100 kDa (high molecular weight or peak 1 (RcsB-1)) and 60 kDa (low molecular weight or peak 2 427
(RcsB-2)) (Figure S2A). Dynamic light scattering revealed that monodisperse solutions of RcsB-428
1 and RcsB-2 have globular species with exclusion radii of 8.9 nm and 7.2 nm, respectively 429
(Figures S2B and S2C). Taken together, these results are consistent with the formation in 430
solution of both tetramers (RcsB-1) and dimers (RcsB-2). 431
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
20
Anti-acetyllysine immunoblot analysis detected acetylation of purified YfiQ (Figure 6A). 432
It also detected acetylation of RcsB-1 and RcsB-2, but this acetylation was only visible after a 433
long exposure (Figure S3). This suggests that YfiQ and a small fraction of both RcsB oligomers 434
were acetylated under the conditions used for purification. Indeed, Orbitrap Velos mass 435
spectrometric analysis (33,41) detected 10 acetylated lysines in RcsB-1 (Table 4, Table S8A), 9 436
acetylated lysines in RcsB-2 (Table 4, Table S8D), and 8 acetylated lysines in YfiQ (Tables 437
S9A-C). The average total SC of acetylated peptides for both RcsB-1 (22 SC) and RcsB-2 (20 438
SC) were similar. The distribution of acetylated RcsB peptides also was similar, but not identical. 439
For both RcsB oligomers, incubation with AcCoA dramatically increased acetylation 440
(Figure 6A, compare lanes 5 and 6 to lanes 3 and 4) and increased the abundance of acetylated 441
RcsB peptides by about two-fold (Table 4, Tables S8B and E). The distribution of acetylated 442
lysines differed somewhat between the two oligomers. This difference suggests the possibility 443
that the oligomeric structure could influence the acetylation pattern. For YfiQ, incubation with 444
AcCoA also detected increased acetylation of YfiQ (Figure 6A, compare lane 2 to lane 1, Tables 445
S9D and E), suggesting that YfiQ might autoacetylate. 446
To determine whether RcsB can be a substrate of YfiQ, we used a biochemical assay that 447
detects AcCoA hydrolysis (35). When RcsB and AcCoA were present at saturating 448
concentrations, the activity of YfiQ towards either RcsB-1 or RcsB-2 was nearly identical 449
(Figure 6B). For both oligomers, AcCoA hydrolysis increased as the concentration of RcsB was 450
increased; incubation of 0.02 mM YfiQ with 15 times the concentration of RcsB (0.30 mM) 451
hydrolyzed more AcCoA than in the presence of equimolar amounts of RcsB (0.02 mM). This 452
behavior indicates that RcsB acts as a substrate of YfiQ. We also found that YfiQ hydrolyzed 453
AcCoA (Figure S4), adding support to the supposition that YfiQ might autoacetylate. 454
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
21
To identify the RcsB lysines acetylated in the presence of YfiQ, we used mass 455
spectrometric analysis (33,41). Following incubation of either RcsB oligomer with YfiQ and 456
AcCoA, we observed acetylation of Lys-180, consistent with the previous report that YfiQ 457
acetylates Lys-180 in vitro (14), but we also observed YfiQ-dependent acetylation of several 458
other RcsB lysines: Lys-125, Lys-127, Lys-149 and Lys-186 (Table 4, Tables S8C and F). 459
Surprisingly, incubation with both AcCoA and YfiQ did not dramatically change the abundance 460
of acetylated lysines relative to incubation with AcCoA alone (Table 4, Tables S8B and E). 461
Anti-acetyl-lysine immunoblot analysis yielded a similar result (Figure 6A, compare lanes 9 and 462
10 to lanes 5 and 6). Instead, the pattern of acetylation changed. For some residues, the level of 463
acetylation increased relative to their status after incubation with AcCoA alone. For other 464
residues, the acetylation decreased (Table 4). For example, both RcsB-1 and RcsB-2 exhibited 465
increased SC for acetylated Lys-125, Lys-180, and Lys-186. In contrast, the SC for acetylated 466
Lys-140 of RcsB-1 decreased by more than five-fold (Table 4). While these in vitro results show 467
that YfiQ can affect the acetylation status of multiple RcsB lysines, our in vivo results showing 468
that YfiQ does not affect RcsB acetylation (Table 3, Tables S7A-B) argue against a direct role 469
for YfiQ in RcsB acetylation, at least under the tested conditions. 470
471
Analysing the function of acetylated RcsB lysines in rprA transcription 472
In the absence of ackA or cobB, rprA transcription was inhibited and RcsB acetylation 473
increased. One RcsB lysine (Lys-154) that was reproducibly more acetylated in the mutants 474
relative to the WT parent (Tables 2 and 3) was found to be critical for RcsB activity. To assess 475
the effect of acetylation on RcsB function, we applied an approach commonly used in studies of 476
acetylation in eukaryotes (42), converting this AckA- and/or CobB-sensitive lysine to a glutamine 477
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
22
(which mimics a neutral, acetylated lysine) or to an arginine (which mimics a positive, non-478
acetylatable lysine). We introduced this rcsB variant (carried by pVEC) into the rcsB null strain 479
(AJW4884) and monitored PrprA activity. The acetylated and non-acetylated mimics of Lys-154 480
exhibited opposite behaviors. The mimic of acetylated Lys-154 (RcsB-K154Q) exhibited a strong 481
reduction in PrprA activity, a behavior that was indistinguishable from that of the vector control 482
(Figure 7A), the non-phosphorylatable mutant RcsB-D56A, and the RcsB-K154A mutant (data 483
not shown). This contrasted with the behavior of the non-acetylated mimic (RcsB-K154R), which 484
more closely resembled that of the WT protein (Figure 7A). We next tested whether the inability 485
of RcsB-K154Q to support PrprA activity was due to a lack of expression or a loss of function. To 486
do so, we took advantage of the report that RcsB inhibits migration through semi-solid agar by 487
repressing transcription of flhDC, which encodes the master regulator of flagella biosynthesis 488
(11,43). We asked if expression of the rcsB mutants could inhibit migration of the highly motile 489
strain AJW3331. Indeed, each mutant rcsB allele (D56A, K154A, K154Q, and K154R) inhibited 490
migration to a level similar to that of the WT allele (Figure 7B). We conclude that the mutants 491
are expressed and that they retain function. We therefore propose that the positive charge of Lys-492
154 is critical to RcsB-dependent activation of rprA transcription and that acetylation of Lys-154 493
may regulate RcsB activity. 494
495
Discussion 496
Given the diversity of the bacterial proteins that have been detected as acetylated (44-46), 497
there is great potential for this post-translational modification to impact many facets of bacterial 498
physiology. However, the study of bacterial protein acetylation is young and many fundamental 499
questions remain unanswered. In this report, we described genetic and biochemical analyses of 500
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
23
RcsB acetylation that have led to four key findings. First, we provided the first evidence that in 501
vivo acetylation of a bacterial transcription factor could regulate its activity. Second, we verified 502
that RcsB is a substrate of CobB (14) and showed that it regulates the acetylation status of RcsB 503
in vivo. Third, we showed that rprA transcription is activated by YfiQ, but likely not by direct 504
acetylation of RcsB. Since YfiQ is the only known protein acetyltransferase in E. coli, this result 505
suggests that other mechanisms of acetylation might exist in E. coli. Fourth, we showed that the 506
Pta-AckA pathway influences protein acetylation. 507
508
Both phosphorylation and acetylation regulate rprA transcription. 509
Majdalani et al. reported that PrprA activity and rprA RNA levels depend on RcsB. As 510
cultures transition into stationary phase, rprA RNA levels increase 8-fold, while PrprA activity 511
increases only 2.5-fold. Thus, these authors proposed that RprA is stabilized during the transition, 512
allowing for accumulation in stationary phase. The net result is increased expression of the 513
alternative sigma factor σS (8,47). We have extended this model, showing that PrprA activity, and 514
thus RprA synthesis, can peak during exponential growth in buffered tryptone broth (Figure 2A-515
B). While the physiological impact of this novel behavior remains obscure, it has given us a 516
unique opportunity to investigate the effect that Nε-lysine acetylation exerts on the function of a 517
phosphorylated transcription factor. 518
Like other reported RcsB-activated behaviors, this exponential burst of rprA transcription 519
requires the phospho-acceptor site (Asp-56) of RcsB (Figure 2C). Like many of these behaviors, 520
this novel exponential phase rprA transcription required the kinase activity of the bifunctional 521
RcsC (Figure 2E). It also involved AcP as reported previously for two other RcsB-regulated 522
promoters: cps and flhD (11). In this study, we showed that purified RcsB can become 523
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
24
phosphorylated when incubated with AcP (Figure 3). 524
If AcP donates its phosphoryl group to RcsB, then why is phospho-RcsB-dependent rprA 525
transcription inhibited in the ackA mutant? The answer appears to be acetylation. Escalante-526
Semerena and colleagues previously reported that RcsB could become acetylated on Lys-180 in 527
vitro by YfiQ or Pat, the S. enterica YfiQ homolog, and deacetylated by CobB (14). We have 528
confirmed this report and extended its significance. We confirmed that YfiQ acetylates RcsB in 529
vitro (Table 4 and Figure 6). We further showed that RcsB acetylation occurs in vivo on multiple 530
lysines (Tables 2 and 3) and that both CobB and AckA affect RcsB acetylation in vivo (Figure 531
4). We also provided genetic evidence that acetylation of a specific lysine may exert an effect on 532
RcsB activity (Figure 7). 533
534
What is the effect of acetylation on RcsB? 535
We propose that the positive charge at position 154 is required for RcsB-dependent rprA 536
transcription and that acetylation of Lys-154 would inhibit RcsB activity, possibly by interfering 537
with the binding of RcsB to its DNA site. In the absence of ackA or cobB, rprA transcription 538
diminished (Figure 4B) and acetylation of Lys-154 increased substantially (Table 3). 539
Furthermore, a genetic mimic of acetylated Lys-154 (RcsB-K154Q) appeared inactive at the rprA 540
promoter, while a genetic mimic of non-acetylated Lys-154 (RcsB-K154R) remained active 541
(Figure 7A). Our proposal is supported by a previous report on the structural analysis of Erwinia 542
amylovora RcsB DNA-binding domain (48). The authors reported that Lys-153 of E. amylovora 543
RcsB (homologous to Lys-154 in E. coli RcsB), positioned in the supporting helix a7 of the 544
DNA-binding HTH motif, is capable of interacting with DNA. Because the RcsB-K154Q and 545
RcsB-K154R mutants retained the ability to inhibit migration on semi-solid agar plates (Figure 546
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
25
7B), which requires the binding of RcsB to the flhDC promoter, acetylation could impact some 547
later event in the initiation of rprA transcription, such as the recruitment of RNA polymerase. 548
However, while the inhibition of migration provides evidence that the mutant proteins are 549
functional and that RcsB does not require Lys-154 to bind at the flhDC promoter, it does not 550
directly address the role of Lys-154 at the rprA promoter. This is because the flhDC promoter is 551
quite complex and the binding of the mutant RcsB proteins could be aided by one of the many 552
proteins that also regulate flhDC. 553
554
CobB regulates RcsB acetylation. 555
CobB enhanced PrprA activity (Figure 4B and 4C), suggesting that CobB activates by 556
deacetylating some acetylated protein. Given that we found that RcsB is hyperacetylated in the 557
cobB mutant (Tables 2 and 3), we propose that acetylation of RcsB is responsible for reducing 558
PrprA activity and that CobB regulates the deacetylation of certain RcsB lysines in vivo. While 559
certain RcsB lysines (e.g. Lys-118 and Lys-154) appeared to be sensitive to CobB (i.e., they 560
exhibited increased acetylation in the absence of CobB activity (Tables 2 and 3), others (e.g., 561
Lys-72 and Lys-125) appeared to be insensitive to CobB, suggesting that some acetylated lysines 562
are not deacetylated or that some presently unknown deacetylase or other deacetylation 563
mechanism exists. 564
565
Does AckA influence protein acetylation? 566
We hypothesize that AckA is a regulator of protein acetylation. We base this hypothesis 567
on the following observations. First, we showed that RcsB is hyperacetylated when isolated from 568
the ackA mutant and that its acetylation profile was similar to that of RcsB isolated from the cobB 569
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
26
mutant (Table 3). Second, we previously reported that the acetylation pattern of RNA polymerase 570
isolated from an ackA mutant grown in the presence of glucose is substantially different from the 571
pattern obtained with the WT parent (36). Indeed, preliminary analyses show that ackA mutants 572
exhibit a dramatic increase in global protein acetylation that is eliminated when pta is also deleted 573
(B. Zemaitaitis and A. J. Wolfe, unpublished results). Efforts to understand the underlying 574
mechanism are underway. 575
576
Does a lysine acetyltransferase regulate RcsB? 577
The mechanism by which RcsB becomes acetylated in vivo remains unknown. Deletion of 578
yfiQ diminished rprA transcription (Figure 5), suggesting that YfiQ is an activator of rprA 579
transcription. However, YfiQ is unlikely to act directly upon RcsB, as deletion of yfiQ did not 580
exert a major effect on the acetylation status of RcsB (Table 3). Further support for the 581
proposition that YfiQ is not the physiological acetyltransferase for RcsB acetylation comes from 582
the observation that deletion of yfiQ enhances migration in semi-solid agar rather than the 583
inhibition predicted if the main role of YfiQ were to acetylate Lys-180 and thus inhibit binding of 584
RcsB to its DNA site (J. Escalante-Semerena, personal communication). 585
If YfiQ does not acetylate RcsB in vivo, two scenarios are possible: (1) the existence of 586
another protein acetyltransferease or (2) a mechanism that does not involve an acetyltransferase. 587
The ability of purified RcsB to become acetylated when incubated with AcCoA alone is 588
suggestive of an alternative mechanism of acetylation (Figure 6 and Table 4). It is unlikely that 589
purified RcsB was contaminated by an acetyltransferase, as in-solution mass spectrometric 590
analysis did not detect a contaminating acetyltransferase (data not shown). An alternative is that 591
RcsB autoacetylates in vivo with AcCoA as the acetyl donor. This mechanism is not 592
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
27
unprecedented, as others have reported the autoacetylation of several other proteins (49-52), 593
including proteins in the mitochondrion, where little is known about potential mitochondrial 594
lysine acetyltransferase(s) and the conditions are favorable for AcCoA-dependent lysine 595
acetylation, i.e., alkaline pH (~8.0) and high AcCoA concentration (~5 mM) (53-55). 596
597
Why is RcsB regulated by both aspartyl phosphorylation and Nε-lysine acetylation? 598
Since RcsB regulates over 100 different genes, involved in many aspects of bacterial 599
physiology, it is likely that acetylation affects other RcsB-regulated promoters. Regulating RcsB 600
with a simple phosphorylation-dependent “on-off” switch may not provide enough sophisticated 601
control of gene expression. Indeed, this study shows that RcsB can be post-translationally 602
modified in vivo on eight different residues (i.e., phosphorylated on Asp-56 and acetylated on at 603
least 7 lysines), raising the opportunity for 256 different isoforms. The existence of multiple RcsB 604
isoforms could increase functional diversity, which could dictate promoter specificity or affinity 605
for the diverse RcsB interacting proteins (5). Furthermore, multiple and different modifications 606
could interact (56). In bacteria, such an interaction is not unprecedented. In Mycoplasma 607
pneumoniae, serine/threonine/tyrosine phosphorylation and Nε-lysine acetylation are common co-608
modifiers of the same proteins, and phosphorylation and acetylation are proposed to regulate each 609
other (57). Like RcsB, CheY is a RR that can be co-regulated by phosphorylation and acetylation 610
and these modifications of CheY inhibit each other (58-65). Additionally, we show that RcsB can 611
form dimers or tetramers (Figure S2), a behavior that has been described for some other RRs (66-612
68). 613
614
Concluding Remarks 615
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
28
In summary, we propose that RcsB can become acetylated on multiple lysines in vivo. We 616
further propose that one of these acetylations (Lys-154) inhibits the ability of RcsB to activate 617
rprA transcription in vivo. Much remains to be learned, including the mechanism(s) by which 618
RcsB becomes acetylated, how acetylation inhibits RcsB function and whether acetylation 619
interacts with phosphorylation, and how the Pta-AckA pathway regulates protein acetylation. 620
621
Acknowledgments 622
We thank Sandy Thao and Jorge Escalante-Semerena for allowing us access to unpublished data. 623
We thank Susan Gottesman, Robert Blumenthal, Kaymeuang Cam, and Jorge Escalante-624
Semerena for their generous donations of phage, plasmids or strains. We thank Dhaval Nanavati 625
for his mass spectrometric identification of acetylated RplB. We thank all members of both the 626
Wolfe and Visick labs for critical and open discussions. We specifically thank Sylvia A. Reimann 627
for her help and support, Bruno P. Lima for his help with Phos-Tag, Bozena Zemaitaitis for her 628
analyses of global acetylation in E. coli, and Richard M. Schultz for his modeling of RcsB 629
structure. This work was supported by NIH grant GM066130 and Loyola University Chicago 630
Potts Foundation award LU11200 awarded to A.J.W and by Deutsche Forschungsgemeinschaft 631
project AN746/2-1 awarded to H.A. It also was supported with Federal funds from the National 632
Institute of Allergy and Infectious Diseases, National Institutes of Health, Department of Health 633
and Human Services, under Contracts No. HHSN272200700058C and HHSN272201200026C to 634
W.F.A. 635
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
29
References 636
1. Witze, E. S., Old, W. M., Resing, K. A., and Ahn, N. G. (2007) Nat Methods 4, 798-806 637 2. Gupta, N., Tanner, S., Jaitly, N., Adkins, J. N., Lipton, M., Edwards, R., Romine, M., 638
Osterman, A., Bafna, V., Smith, R. D., and Pevzner, P. A. (2007) Genome research 17, 639 1362-1377 640
3. Hu, L. I., Lima, B. P., and Wolfe, A. J. (2010) Molecular microbiology 77, 15-21 641 4. Majdalani, N., and Gottesman, S. (2005) Annual review of microbiology 59, 379-405 642 5. Venkatesh, G. R., Kembou Koungni, F. C., Paukner, A., Stratmann, T., Blissenbach, B., 643
and Schnetz, K. (2010) Journal of bacteriology 192, 6456-6464 644 6. Castanie-Cornet, M. P., Cam, K., Bastiat, B., Cros, A., Bordes, P., and Gutierrez, C. 645
(2010) Nucleic acids research 38, 3546-3554 646 7. Ferrieres, L., and Clarke, D. J. (2003) Molecular microbiology 50, 1665-1682 647 8. Majdalani, N., Hernandez, D., and Gottesman, S. (2002) Molecular microbiology 46, 813-648
826 649 9. Wolfe, A. J. (2005) Microbiology and molecular biology reviews : MMBR 69, 12-50 650 10. Klein, A. H., Shulla, A., Reimann, S. A., Keating, D. H., and Wolfe, A. J. (2007) Journal 651
of bacteriology 189, 5574-5581 652 11. Fredericks, C. E., Shibata, S., Aizawa, S., Reimann, S. A., and Wolfe, A. J. (2006) 653
Molecular microbiology 61, 734-747 654 12. Lukat, G. S., McCleary, W. R., Stock, A. M., and Stock, J. B. (1992) Proc Natl Acad Sci 655
U S A 89, 718-722 656 13. Feng, J., Atkinson, M. R., McCleary, W., Stock, J. B., Wanner, B. L., and Ninfa, A. J. 657
(1992) J Bacteriol 174, 6061-6070 658 14. Thao, S., Chen, C. S., Zhu, H., and Escalante-Semerena, J. C. (2010) PloS one 5, e15123 659 15. Lima, B. P., Antelmann, H., Gronau, K., Chi, B. K., Becher, D., Brinsmade, S. R., and 660
Wolfe, A. J. (2011) Molecular microbiology 81, 1190-1204 661 16. Ma, Q., and Wood, T. K. (2011) Biochemical and biophysical research communications 662
410, 846-851 663 17. Liang, W., and Deutscher, M. P. (2012) RNA 18, 37-41 664 18. Castano-Cerezo, S., Bernal, V., Blanco-Catala, J., Iborra, J. L., and Canovas, M. (2011) 665
Mol Microbiol 82, 1110-1128 666 19. Blander, G., and Guarente, L. (2004) Annu Rev Biochem 73, 417-435 667 20. Thao, S., and Escalante-Semerena, J. C. (2011) Curr Opin Microbiol 14, 200-204 668 21. Silhavy, T. J., Berman, M. L., and Enquist, L. W. (1984) Experiments with gene fusions. 669
in Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 670 22. Powell, B. S., Rivas, M. P., Court, D. L., Nakamura, Y., and Turnbough, C. L., Jr. (1994) 671
Nucleic acids research 22, 5765-5766 672 23. Simons, R. W., Houman, F., and Kleckner, N. (1987) Gene 53, 85-96 673 24. Hanahan, D. (1983) Journal of molecular biology 166, 557-580 674 25. Chung, C. T., Niemela, S. L., and Miller, R. H. (1989) Proceedings of the National 675
Academy of Sciences of the United States of America 86, 2172-2175 676 26. Beatty, C. M., Browning, D. F., Busby, S. J., and Wolfe, A. J. (2003) Journal of 677
bacteriology 185, 5148-5157 678
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
30
27. Lintner, R. E., Mishra, P. K., Srivastava, P., Martinez-Vaz, B. M., Khodursky, A. B., and 679 Blumenthal, R. M. (2008) BMC microbiology 8, 60 680
28. Kitagawa, M., Ara, T., Arifuzzaman, M., Ioka-Nakamichi, T., Inamoto, E., Toyonaga, H., 681 and Mori, H. (2005) DNA research : an international journal for rapid publication of 682 reports on genes and genomes 12, 291-299 683
29. Dieckman, L., Gu, M., Stols, L., Donnelly, M. I., and Collart, F. R. (2002) Protein 684 expression and purification 25, 1-7 685
30. Millard, C. S., Stols, L., Quartey, P., Kim, Y., Dementieva, I., and Donnelly, M. I. (2003) 686 Protein expression and purification 29, 311-320 687
31. Carballes, F., Bertrand, C., Bouche, J. P., and Cam, K. (1999) Molecular microbiology 34, 688 442-450 689
32. DiGiuseppe, P. A., and Silhavy, T. J. (2003) Journal of bacteriology 185, 2432-2440 690 33. Chi, B. K., Gronau, K., Mader, U., Hessling, B., Becher, D., and Antelmann, H. (2011) 691
Molecular & cellular proteomics : MCP 10, M111 009506 692 34. Wang, Q., Zhang, Y., Yang, C., Xiong, H., Lin, Y., Yao, J., Li, H., Xie, L., Zhao, W., 693
Yao, Y., Ning, Z. B., Zeng, R., Xiong, Y., Guan, K. L., Zhao, S., and Zhao, G. P. (2010) 694 Science 327, 1004-1007 695
35. Kuhn, M. L., Majorek, K. A., Minor, W., and Anderson, W. F. (2013) Protein science : a 696 publication of the Protein Society 22, 222-230 697
36. Lima, B. P., Huyen, T. T., Bäsell, K., Becher, D., Antelmann, H., and Wolfe, A. J. (2012) 698 The Journal of biological chemistry 287, 32147-32160 699
37. Majdalani, N., Heck, M., Stout, V., and Gottesman, S. (2005) Journal of bacteriology 187, 700 6770-6778 701
38. Wolfe, A. J. (2010) Current opinion in microbiology 13, 204-209 702 39. Denu, J. M. (2005) Trends in biochemical sciences 30, 479-483 703 40. Lundgren, D. H., Hwang, S. I., Wu, L., and Han, D. K. (2010) Expert review of 704
proteomics 7, 39-53 705 41. Chi, B. K., Gronau, K., Mäder, U., Hessling, B., Becher, D., and Antelmann, H. (2011) 706
Molecular & cellular proteomics : MCP 10, M111 009506 707 42. Dang, W., Steffen, K. K., Perry, R., Dorsey, J. A., Johnson, F. B., Shilatifard, A., 708
Kaeberlein, M., Kennedy, B. K., and Berger, S. L. (2009) Nature 459, 802-807 709 43. Francez-Charlot, A., Laugel, B., Van Gemert, A., Dubarry, N., Wiorowski, F., Castanie-710
Cornet, M. P., Gutierrez, C., and Cam, K. (2003) Molecular microbiology 49, 823-832 711 44. Yu, B. J., Kim, J. A., Moon, J. H., Ryu, S. E., and Pan, J. G. (2008) Journal of 712
microbiology and biotechnology 18, 1529-1536 713 45. Zhang, J., Sprung, R., Pei, J., Tan, X., Kim, S., Zhu, H., Liu, C. F., Grishin, N. V., and 714
Zhao, Y. (2009) Molecular & cellular proteomics : MCP 8, 215-225 715 46. Zhao, S., Xu, W., Jiang, W., Yu, W., Lin, Y., Zhang, T., Yao, J., Zhou, L., Zeng, Y., Li, 716
H., Li, Y., Shi, J., An, W., Hancock, S. M., He, F., Qin, L., Chin, J., Yang, P., Chen, X., 717 Lei, Q., Xiong, Y., and Guan, K. L. (2010) Science 327, 1000-1004 718
47. Majdalani, N., Chen, S., Murrow, J., St John, K., and Gottesman, S. (2001) Molecular 719 microbiology 39, 1382-1394 720
48. Pristovsek, P., Sengupta, K., Lohr, F., Schafer, B., von Trebra, M. W., Ruterjans, H., and 721 Bernhard, F. (2003) The Journal of biological chemistry 278, 17752-17759 722
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
31
49. Barak, R., Yan, J., Shainskaya, A., and Eisenbach, M. (2006) Journal of molecular 723 biology 359, 251-265 724
50. Karanam, B., Jiang, L., Wang, L., Kelleher, N. L., and Cole, P. A. (2006) The Journal of 725 biological chemistry 281, 40292-40301 726
51. Santos-Rosa, H., Valls, E., Kouzarides, T., and Martinez-Balbas, M. (2003) Nucleic acids 727 research 31, 4285-4292 728
52. Yang, C., Wu, J., and Zheng, Y. G. (2012) PloS one 7, e32886 729 53. Rardin, M. J., Newman, J. C., Held, J. M., Cusack, M. P., Sorensen, D. J., Li, B., 730
Schilling, B., Mooney, S. D., Kahn, C. R., Verdin, E., and Gibson, B. W. (2013) 731 Proceedings of the National Academy of Sciences of the United States of America 110, 732 6601-6606 733
54. Wagner, G. R., and Payne, R. M. (2011) Journal of aging research 2011, 234875 734 55. Scott, I., Webster, B. R., Li, J. H., and Sack, M. N. (2012) The Biochemical journal 443, 735
655-661 736 56. Yang, X. J., and Seto, E. (2008) Molecular cell 31, 449-461 737 57. van Noort, V., Seebacher, J., Bader, S., Mohammed, S., Vonkova, I., Betts, M. J., Kuhner, 738
S., Kumar, R., Maier, T., O'Flaherty, M., Rybin, V., Schmeisky, A., Yus, E., Stulke, J., 739 Serrano, L., Russell, R. B., Heck, A. J., Bork, P., and Gavin, A. C. (2012) Molecular 740 systems biology 8, 571 741
58. Barak, R., Welch, M., Yanovsky, A., Oosawa, K., and Eisenbach, M. (1992) Biochemistry 742 31, 10099-10107 743
59. Barak, R., Abouhamad, W. N., and Eisenbach, M. (1998) J Bacteriol 180, 985-988 744 60. Ramakrishnan, R., Schuster, M., and Bourret, R. B. (1998) Proc Natl Acad Sci U S A 95, 745
4918-4923 746 61. Barak, R., and Eisenbach, M. (1992) Biochemistry 31, 1821-1826 747 62. Yan, J., Barak, R., Liarzi, O., Shainskaya, A., and Eisenbach, M. (2008) Journal of 748
molecular biology 376, 1260-1271 749 63. Barak, R., and Eisenbach, M. (2004) Journal of molecular biology 342, 375-381 750 64. Barak, R., Prasad, K., Shainskaya, A., Wolfe, A. J., and Eisenbach, M. (2004) Journal of 751
molecular biology 342, 383-401 752 65. Liarzi, O., Barak, R., Bronner, V., Dines, M., Sagi, Y., Shainskaya, A., and Eisenbach, M. 753
(2010) Molecular microbiology 76, 932-943 754 66. Chen, M. W., Kotaka, M., Vonrhein, C., Bricogne, G., Rao, F., Chuah, M. L., Svergun, 755
D., Schneider, G., Liang, Z. X., and Lescar, J. (2012) Journal of bacteriology 194, 4837-756 4846 757
67. De, N., Pirruccello, M., Krasteva, P. V., Bae, N., Raghavan, R. V., and Sondermann, H. 758 (2008) PLoS biology 6, e67 759
68. Najle, S. R., Inda, M. E., de Mendoza, D., and Cybulski, L. E. (2009) Biochimica et 760 biophysica acta 1790, 1238-1243 761
69. Datsenko, K. A., and Wanner, B. L. (2000) Proceedings of the National Academy of 762 Sciences of the United States of America 97, 6640-6645 763
70. Kumari, S., Beatty, C. M., Browning, D. F., Busby, S. J., Simel, E. J., Hovel-Miner, G., 764 and Wolfe, A. J. (2000) Journal of bacteriology 182, 4173-4179 765
71. Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K. A., 766
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
32
Tomita, M., Wanner, B. L., and Mori, H. (2006) Molecular systems biology 2, 2006 0008 767 72. Zuber, M., Hoover, T. A., and Court, D. L. (1995) Journal of bacteriology 177, 4238-4244 768 73. Amann, E., Ochs, B., and Abel, K. J. (1988) Gene 69, 301-315 769 74. Clarke, D. J., Joyce, S. A., Toutain, C. M., Jacq, A., and Holland, I. B. (2002) Journal of 770
bacteriology 184, 1204-1208 771 772 773
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
33
Table 1. Bacterial strains, bacteriophage, plasmids, and primers used in this study. 774
Strain, phage, plasmid, or primer
Relevant Characteristic Source/Reference
Strains
BW25113 F- λ- Δ(araD-araB)567 Δ(rhaD-rhaB)568 ΔlacZ4787 rrnB3 rph-1 hsdR514
(69)
AJW678 thi-1 thr-1(Am) leuB6 metF159(Am) rpsL136 ΔlacX74 (70) AJW3759 BW25113 λΦ(PrprA142-lacZ) λ: λrprA142 BW25113 AJW3331 AJW678 λΦ(PrprA142-lacZ) λ: λrprA142 AJW678
AJW4884 AJW3759 ΔrcsB::FRT P1: JW2205 (71) AJW3759, then removed antibiotic marker
AJW3976 AJW3759 ΔrcsC::tet P1: MZ63 (72) AJW3759 AJW3981 AJW3759 ΔackA::FRT-kan-FRT P1: JW2293 (71) AJW3759
JE8659 ΔcobB::cat Escalante-Semerena (U. of Georgia)
AJW5011 AJW3759 ΔcobB::cat P1: JE8659 AJW3759 AJW3797 AJW3759 ΔyfiQ:: FRT-kan-FRT P1: JW2568 (71) AJW3759
EPI300TM-T1R F− mcrA Δ(mrr-hsdRMS-mcrBC) φ80dlacZΔM15lacX74 recA1 endA1 araD139 (ara-leu)7697 galU galK rpsL nupG trfA tonA dhfr
EpicentreR Biotechnologies
BL21 (DE3) Magic a derivative of BL21 cells carrying a plasmid encoding rare tRNAs (29) Phage
λrprA142 rprA142-lacZ (8) Plasmids
pVEC Single-copy, lacZ null derivative of pCC1 (EpicentreR), control for pLIH002 and pLIH003 CmR
(27)
pLIH001 pVEC derivative with kanamycin cassette removed This study pLIH002 pLIH001 carrying rcsB(WT) CmR This study pLIH003 pLIH001 carrying rcsBD56A allele CmR This study pLIH004 pLIH001 carrying rcsBK154Q allele CmR This study
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
34
pLIH005 pLIH001 carrying rcsBK154R allele CmR This study pLIH006 pLIH001 carrying rcsBK154A allele CmR This study pTrc99a Vector control for pPSG980 ApR (73) pPSG980 pTrc99a carrying Φ(PlacUV5–rcsC) ApR (7,74) pMH300 pTrc99a carrying Φ(PlacUV5–rcsF) ApR (37) pCA24n Control plasmid CmR (28) pCA24n-rcsB pCA24n expressing 6xHis-RcsB from an IPTG-inducible promoter CmR (28)
pHis6rcsB pIM10 vector expressing 6xHis-RcsB from an IPTG-inducible promoter, KnR SpR
(31)
Primers (5’-3’) rcsBFBamHI GGATCCAGGAAGGTAGCCTATTACATGAAC This study rcsBRBamHI GGATCCTTAGTCTTTATCTGCCGGACTTAAGG This study pCC1RBZ GTAAAACGACGGCCAGTGAATTG This study
rcsBK154Q ACAAGCGTCTCTCGCCACAGGAGAGTGAAGTTCTGCG, AAACAG
This study
rcsBK154A TGACAAGCGTCTCTCGCCAGCAGAGAGTGAAGTTCTGC, AAAGCA
This study
rcsBK154R ACAAGCGTCTCTCGCCAAGAGAGAGTGAAGTTCTG, AAAAGA
This study
rcsBD56A CATGTGTTGATTACCGCTCTCTCCATGCCTGGC, GATGCT This study
775
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
35
Table 2. Spectral counts of lysine acetylated RcsB peptides isolated from WT cells, cobB mutants, and WT cells exposed to 776
nicotinamide (NAM) 1,4 777
778 Average SC2 SC Ratio2
Acetylated lysine
WT cobB WT + NAM
cobB/WT NAM/WT
72 1.0 0.8 1.0 0.8 1.0 118 0.0 3.0 2.3 >3.03 >2.3 125 1.5 2.0 1.5 1.3 1.0 128 0.5 0.8 1.0 1.5 2.0 140 0.0 2.0 0.8 >2.0 >0.8 149 0.0 1.5 1.5 >1.5 >1.5 154 1.0 2.0 2.0 2.0 2.0 173 0.0 0.0 0.5 NA >0.5 180 0.0 0.5 0.0 >0.5 NA
Total SC 4.0 12.5 10.5 3.1 2.6
779 1Average spectral counts (SC) of detected lysine acetylation sites in the wild type (WT), its isogenic cobB mutant (cobB) and in the 780
WT treated with NAM (WT+NAM). 781
2Using data obtained from Scaffold 3 proteome software, the spectral counts of four biological replicates for each strain/condition 782
were counted manually, were averaged over the four replicates, and were compared as ratios of the mutant or the treated WT relative 783
to the untreated WT. 784
3When the SC of a peptide with an acetylated lysine in the cobB mutant or in the NAM-treated WT is greater than the SC of the same 785
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
36
peptide in the untreated WT control, the ratio is underlined. A ratio of >n refers to any acetylated peptide that was not detected in WT 786
(SC=0), but detected in the cobB mutant or the NAM-treated WT (SC=n). 787
4The spectral counts of the detected lysine acetylation sites in each replicate and the peptide scores and mass deviations as well as the 788
complete MS/MS spectra and fragment ion series can be found in Tables S1A-D, S2A-D, and S3A-D, where A-D denote the four 789
bioreplicates. 790
791
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
37
Table 3. Spectral counts of lysine acetylated RcsB peptides isolated from WT cells or yfiQ, cobB, or ackA mutant cells 1,4 792
793 Average SC2 SC Ratio2
Acetylated lysine
WT cobB ackA yfiQ cobB/WT ackA/WT yfiQ/WT
63 1.0 1.0 1.5 0.0 1.0 1.5 0.0 72 2.0 0.5 4.5 2.0 0.33 2.33 1.0
118 1.5 3.5 4.5 2.5 2.4 3.0 1.7 125 1.5 1.5 2.0 1.5 1.0 1.4 1.0 128 0.5 2.0 1.0 0.0 4.0 2.0 0.0 140 0.0 1.5 0.5 0.0 >1.5 >0.5 0.0 149 0.0 0.5 0.0 0.0 >0.5 0.0 0.0 154 0.5 3.0 2.0 1.0 6.0 4.0 2.0 173 1.5 0.0 0.0 1.5 0.0 0.0 1.0 180 0.0 1.0 1.0 0.0 >1.0 >1.0 0.0
Total SC 8.5 14.5 17.0 8.5 1.7 2.0 1.0 794 1Average spectral counts (SC) of detected lysine acetylation sites in the wild type (WT), and its isogenic cobB, ackA and yfiQ mutants. 795
2Using data obtained from Scaffold 3 proteome software, the spectral counts of two biological replicates for each strain were counted 796
manually, were averaged over the two replicates, and were compared as ratios of the mutants relative to the untreated WT. 797
3When the SC of a peptide with an acetylated lysine in a mutant is less than the SC of the same peptide in the WT control, the ratio is 798
italicized. When the SC of a peptide with an acetylated lysine in a mutant is greater than the SC of the same peptide in the WT control, 799
the ratio is underlined. A ratio of >n refers to any acetylated peptide that was not detected in WT (SC=0), but detected in a mutant 800
(SC=n). 801
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
38
4The spectral counts of the detected lysine acetylation sites in each replicate and the peptide scores and mass deviations as well as the 802
complete MS/MS spectra and fragment ion series can be found in Tables S4A-B, S5A-B, S6A-B and S7A-B, where A-B denote the 803
two bioreplicates. 804
805
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
39
Table 4. Spectral counts of acetylated peptides of RcsB1,4 806
807
Acetylated
lysine
RcsB-1 RcsB-2 Average SC2 SC Ratio2 Average SC SC Ratio
Control AcCoA AcCoA+
YfiQ AcCoA /control
AcCoA+YfiQ /AcCoA
control AcCoA AcCoA+
YfiQ AcCoA /control
AcCoA+YfiQ /AcCoA
63 2.0 1.0 0.0 0.53 0.0 0.0 0.0 0.0 NA NA 72 2.0 2.0 1.5 1.0 0.8 0.5 2.5 1.5 5.0 0.6 118 5.5 7.0 10.0 1.3 1.4 6.0 8.5 10.5 1.4 1.2 125 2.0 4.0 13.5 2.03 3.4 3.0 4.0 9.0 1.3 2.3 127 0.0 1.0 2.0 >1.0 2.0 0.0 1.0 2.0 >1.0 2.0 128 3.0 4.0 6.0 1.3 1.5 1.5 4.5 7.0 3.0 1.6 140 0.5 19.0 3.0 38.0 0.2 0.0 3.0 3.5 >3.0 1.2 149 1.0 2.0 5.0 2.0 2.5 2.5 5.0 5.0 2.0 1.0 154 3.5 8.0 4.5 2.3 0.6 3.0 6.5 5.0 2.2 0.9 173 2.0 2.0 2.5 1.0 1.3 1.0 2.5 2.0 2.5 0.8 180 0.5 1.0 6.0 2.0 6.0 1.5 2.5 6.5 1.6 2.3 186 0.0 1.0 3.0 >1.0 3.0 1.0 0.5 2.5 0.5 5.0
Total SC 22 52 57 2.4 1.1 20 40.5 54.5 2.0 1.3 808 1Average spectral counts (SC) of detected lysine acetylation sites in purified RcsB (control), and purified RcsB incubated with AcCoA 809
(AcCoA) or purified RcsB incubated with AcCoA plus YfiQ (AcCoA+YfiQ). 810
2Using data obtained from Scaffold 3 proteome software, the spectral counts of two replicates for each condition were counted 811
manually, were averaged over the two replicates, and were compared as the ratio of SC detected for RcsB incubated with AcCoA or 812
with AcCoA and YfiQ relative to SC detected with purified RcsB alone. 813
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
40
3When the SC of a peptide with an acetylated lysine following AcCoA incubation is substantially more than the SC of the same 814
peptide in the absence of AcCoA or if the SC of a peptide with an acetylated lysine following incubation with both AcCoA and YfiQ 815
is substantially more than the SC of the same peptide in the presence of AcCoA alone, the ratio is underlined. If the ratio is 816
substantially less, then the ratio is italicized. A ratio of >n refers to any acetylated peptide that was not detected in the absence of 817
AcCoA (SC=0), but detected in the presence of AcCoA (SC=n). 818
4The spectral counts of the detected lysine acetylation sites in each replicate and the peptide scores and mass deviations as well as the 819
complete MS/MS spectra and fragment ion series can be found in Tables S10A-F, where A-C respectively denote RcsB-1 alone, 820
RcsB-1 incubated with AcCoA, and RcsB-1 incubated with both AcCoA and YfiQ, and D-F respectively denote RcsB-2 alone, RcsB-821
2 incubated with AcCoA, and RcsB-2 incubated with both AcCoA and YfiQ. 822
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
41
823
824
Figure 1. Schematic diagrams of the Rcs phosphorelay. 825
A) Model for Rcs kinase signaling. In the presence of an activating environmental stimulus, 826
RcsC acts as a net kinase, using ATP as a phosphoryl group donor, this phosphoryl group is 827
transferred from RcsC to the Hpt RcsD, which donates the phosphoryl group and activates RcsB. 828
B) Model for Rcs phosphatase signaling. Under conditions that stimulate RcsC net phosphatase 829
activity, acetyl-phosphate (AcP) is an alternative phosphoryl group donor for RcsB. The RcsCD 830
pathway can remove phosphoryl groups from phosphorylated RcsB to generate inorganic 831
phosphate. 832
833 834
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
2
Prp
rA A
ctiv
ity (M
iller
units
)
A B
0
2000
4000
6000
0 1 2 3 4 5 6 7 8 9 10
lag exponential stationary
Time (hours)
Prp
rA A
ctiv
ity (M
iller
units
)
A600
C
05000
100001500020000
0.03 0.3 3
WT/pVEC
WT/prcsBD56A WT/prcsBWT
A600
Prp
rA A
ctiv
ity (M
iller
units
)
Prp
rA A
ctiv
ity (M
iller
units
)
D rcsB/pVEC
rcsB/prcsBD56A rcsB/prcsBWT
F
Prp
rA A
ctiv
ity (M
iller
units
)
05000
100001500020000
0.03 0.3 3A600
WT/pTrc99a WT/prcsC WT/prcsF
02000400060008000
10000
0.03 0.3 3
Prp
rA A
ctiv
ity (M
iller
units
)
A600
E
05000
100001500020000
0.03 0.3 3A600
WT rcsB
WT
ackA pta ackA rcsC ackA pta rcsC
05000
100001500020000
0.03 0.3 3
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
43
838
Figure 2. rprA transcription in exponential phase requires the conserved aspartyl residue 839
56 of RcsB and is regulated by RcsC and AcP. 840
A) PrprA activity of WT BW25113 cells lysogenized with a λPrprA-lacZ transcriptional fusion 841
(strain AJW3759) and aerated at 37°C in TB7. Cells were harvested at multiple points 842
throughout growth to measure A600 and β-galactosidase activity. The values represent the means 843
of triplicate independent cultures with standard deviations. 844
B) PrprA activity of WT cells (AJW3759) and the isogenic rcsB (AJW4884) mutant. The values 845
represent the means of triplicate independent cultures with standard deviations. 846
C) PrprA activity of an rcsB null mutant (AJW4884) transformed with a lacZ null derivative of 847
the single-copy expression plasmid pVEC or with a variant of that vector that encodes the WT 848
rcsB allele (pLIH002) or the rcsBD56A (pLIH003) mutant allele aerated at 37°C in TB7 849
supplemented with 50 µM IPTG. The values represent the means of triplicate independent 850
cultures with standard deviations. 851
D) PrprA activity of WT cells (AJW3759) transformed with pVEC or pVEC encoding WT rcsB 852
(pLIH002) or the rcsBD56A allele (pLIH003) aerated at 37°C in TB7 supplemented with 50 µM 853
IPTG. The values represent the means of triplicate independent cultures with standard deviations. 854
E) PrprA activity of WT cells (AJW3759), ackA (AJW3981), ackA pta (AJW4030), rcsC 855
(AJW3976), and ackA pta rcsC (AJW5187) aerated at 37°C in TB7. The values represent the 856
means of triplicate independent cultures with standard deviations. 857
F) PrprA activity of WT cells transformed with the RcsC expression plasmid prcsC (pPSG980), 858
the RcsF expression plasmid (pMH300), or the vector control (pTrc99a) and aerated at 37°C in 859
TB7 supplemented with 50 µM IPTG to induce rcsC or rcsF expression. The values represent 860
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
44
the means of triplicate independent cultures with standard deviations. 861
862
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
45
863
864 865 866 867 868 869 870
871 872 Figure 3. AcP can act as a phosphoryl group donor to RcsB. 873
Purified His6-RcsB peak 2 was incubated in the absence (lane 1) or presence of 5 mM AcP (lanes 874
2, 3, 4) for 30 minutes at 30°C. A fraction of the reaction was heated at 95°C for 15 minutes to 875
hydrolyze the phosphoryl group (lane 4). The reactions were separated in a Phos-TagTM SDS-PA 876
gel and the gel was stained with coomassie brilliant blue. 877
878 879
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
46
880 881
Figure 4. AckA and CobB activate rprA transcription in BW25113 882
A) The Pta-AckA pathway. AcCoA, acetyl coenzyme A; Pta, phosphotransacetylase; Pi, 883
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
47
inorganic phosphate; AckA, acetate kinase. Glucose is metabolized to AcCoA. Pta reversibly 884
converts Pi and AcCoA to generate AcP and CoASH. AckA reversibly converts AcP and ADP to 885
ATP and excreted acetate. 886
B) WT cells lysogenized with λPrprA-lacZ (AJW3759) and the isogenic ackA (AJW3981) and 887
cobB (AJW5011) mutants were aerated at 37°C in TB7. Cells were harvested at multiple points 888
throughout growth to measure A600 and β-galactosidase activity. The values represent the means 889
of triplicate independent cultures with standard deviations. 890
C) Peak β-galactosidase activity between A600 0.6 – 0.8 of WT (AJW3759) cells aerated at 37°C 891
in TB7 in the presence or absence of increasing concentrations of nicotinamide (NAM). The 892
values indicate the average of triplicate independent cultures with standard deviations. 893
894
895
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
48
896 897
Figure 5. Analysing the effect of YfiQ at the rprA promoter. 898
λrprA of WT cells (AJW3759) and the isogenic yfiQ null mutant (AJW3797) were grown at 899
37°C in TB7 with shaking. Samples were harvested for A600 and β-galactosidase activity 900
measurements. The values represent the average of triplicate independent cultures and error bars 901
indicate standard deviations. 902
903
904
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
49
905 906 Figure 6. In vitro acetylation of RcsB 907
A) In vitro acetylation reactions with RcsB, YfiQ, and AcCoA. 50 µl reactions of 21 µM RcsB-1 908
or -2, 2 µM YfiQ, and 0.4 mM AcCoA were incubated at 37°C for 2 hours. The reactions were 909
quenched with 50 µl 2X SDS-PAGE loading buffer and heated at 95°C for 5 minutes. 15 µl was 910
resolved by 13% SDS-PAGE, proteins were transferred, and acetylated proteins detected by 911
Western immunoblot with anti-acetyl-lysine antibody. Lane 1: YfiQ alone, lane 2: YfiQ + 912
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
50
AcCoA, lane 3: RcsB-1 alone, lane 4: RcsB-2 alone, lane 5: RcsB-1 + AcCoA, lane 6: RcsB-2 + 913
AcCoA, lane 7: YfiQ + RcsB-1, lane 8: YfiQ + RcsB-2, lane 9: YfiQ + RcsB-1 + AcCoA, lane 914
10: YfiQ + RcsB-2 + AcCoA. These results are representative of three independent experiments. 915
The high molecular weight signal in lanes 1, 2, 9 and 10 corresponds to acetylated YfiQ. The 916
acetylated sites were determined using semi-quantitative mass spectrometry (Tables S9A-E). 917
Mass spectrometry also identified the signal visible between the 37-50 kDa markers in lanes 2, 9 918
and 10 as the 43.3 kDa EF-Tu protein and determined the acetylated sites (Table S10). Mass 919
spectrometry identified the signal between the 25-37 kDa markers in lanes 9 and 10 as the 29.9 920
kDa RplB protein and determined its acetylated sites (Table S11). 921
B) Activity of YfiQ using different concentrations of RcsB1 and RcsB2. Reactions were 922
performed using 0.02 mM YfiQ at 25°C for one hour in a 50 μl reaction volume. To initiate the 923
reaction, 0.5 mM AcCoA was used. Activity (nmol/min/mg) is shown as the average of three 924
separate trials. Black bars correspond to 0.02 mM RcsB and red bars to 0.3 mM RcsB. 925
926 927
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
51
928 929 930
931
Figure 7. Analyzing the role of Lys-154 on rprA transcription and migration. 932
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
52
A) PrprA activity of rcsB mutant (AJW4884) transformed with the single copy plasmid pVEC or 933
pVEC carrying WT and mutant rcsB-K154 alleles. Cells were aerated at 37°C in TB7 934
supplemented with 50 µM IPTG. 935
B) Migration analysis of the highly motile WT strain (AJW3331) transformed with pVEC or 936
pVEC carrying WT and mutant rcsB alleles. The histogram shows the last measurement of an 937
8.5 hour time course experiment. These results are representative of the whole experiment. 938
939 940
on June 4, 2020 by guesthttp://jb.asm
.org/D
ownloaded from