As

Ma

b

a

ARRA

KFNRI

1

Rspnhmahpf

hlttbmt

P

(

0d

Journal of Biotechnology 143 (2009) 79–84

Contents lists available at ScienceDirect

Journal of Biotechnology

journa l homepage: www.e lsev ier .com/ locate / jb io tec

recombinase-based palindrome generator capable of producing randomizedhRNA libraries

ark Nichols a, Richard A. Steinman a,b,∗

Department of Pharmacology, 2.26 Hillman Cancer Center, 5117 Centre Avenue, Pittsburgh, PA 15213, United StatesDepartment of Medicine, University of Pittsburgh School of Medicine and University of Pittsburgh Cancer Institute, Pittsburgh, PA, United States

r t i c l e i n f o

rticle history:eceived 8 January 2009eceived in revised form 4 June 2009ccepted 9 June 2009

eywords:

a b s t r a c t

Short hairpin RNA (shRNA)-expressing vectors have been shown stably to knock-down directed targetsthrough RNA interference (RNAi). RNAi has emerged as a powerful tool for reverse genetic screens byassaying cellular phenotypes after exposure to libraries of pooled shRNAs directed against all or a subsetof cellular mRNAs. Recently, noncoding RNAs have been recognized as major arbiters of cellular pheno-types. The scope and diversity of noncoding RNAs greatly enlarge the target pool for reversible genetic

LP recombinaseoncoding RNAandomized libraries

nterfering RNA

screens and underscore the desirability as screening tools of complex RNAi libraries, such as randomizedRNAi libraries. We describe a novel approach to generate randomized shRNAs that takes advantage of astable plasmid intermediate that arises in a FLP recombinase system. The ability of this system to generaterandomized palindromes represents a new technology for shRNA generation including random shRNAsthat cannot be produced synthetically. We describe this plasmid system and its use in generating ran-

put 2own e

domized shRNAs from inthis approach to knock-d

. Introduction

RNA interference disrupts gene expression via targeting of theISC endonuclease complex to mRNAs that are homologous to onetrand of a short double-stranded RNA that is loaded into that com-lex. Exogenous short interfering RNAs (siRNAs) consisting of 19–29ucleotide double-stranded RNAs with 2-nucleotide 3′ overhangsave been extensively used to downregulate the activity of specificRNA targets in mammalian cells (Caplen et al., 2001; Elbashir et

l., 2001). In addition, plasmid vectors encoding hairpin loops (shortairpin RNAs, or shRNAs) whose stems are processed by the cyto-lasmic endonuclease dicer into functional siRNAs have been used

or gene knockdown (Brummelkamp et al., 2002).The genetic components active in diverse physiologic pathways

ave been identified through the use of systematic screens usingibraries of siRNA or shRNA-encoding plasmids. The promise ofhis approach was first highlighted in studies interrogating 90% of

he C. elegans gene pool for involvement in metabolic phenotypesy using a bacterial library encoding long double-stranded (ds)RNAs (Fraser et al., 2000). Because such long ds-mRNAs trigger

he interferon response in mammalian cells, the systemic iden-

∗ Corresponding author at: Suite 2.18 Hillman Cancer Center, 5117 Centre Avenue,ittsburgh, PA 15213, United States. Tel.: +1 412 6233237; fax: +1 412 6237768.

E-mail addresses: mnichols@pitt.edu (M. Nichols), steinman@pitt.eduR.A. Steinman).

168-1656/$ – see front matter © 2009 Elsevier B.V. All rights reserved.oi:10.1016/j.jbiotec.2009.06.010

0-bp oligomers, and validate the functionality of a shRNA produced usingstrogen receptor alpha expression.

© 2009 Elsevier B.V. All rights reserved.

tification of genes involved in mammalian pathways has insteadused pooled libraries of thousands of individually synthesized ∼21nucleotide siRNAs or shRNAs directed against specific genes (Bernset al., 2004; Paddison et al., 2004; Zheng et al., 2003). Such largescale approaches identified novel functional components of thep53 and NF-�B pathways and generated useful resources for func-tional analysis of human and murine genomes via interfering RNAexpressing libraries (Berns et al., 2004; Cleary et al., 2004; Paddisonet al., 2004).

As an alternative to synthesizing thousands of oligomers to gen-erate siRNA libraries, four groups have used enzymatic tools togenerate plasmids expressing interfering RNA from cDNA libraries.This approach derives siRNA libraries from double-stranded cDNAlibraries by ligating a hairpin linker containing a restriction site forthe enzyme Mme1 to fragmented cDNAs. This enzyme cuts DNA18-20 bp from the restriction site and yields ∼20 bp DNA stemsthat could be converted into palindromic shRNA-encoding loopsby ligation of a second adapter followed by PCR, Phi29-DNA poly-merase or Bst DNA polymerase extension (cloning strategies knownas EPRIL, REGS and SPEED respectively) (Luo et al., 2004; Sen et al.,2004; Shirane et al., 2004). Subsequently, Dinh and Mo (2005) mod-ified this procedure by using a nicking enzyme, N. AlwI, to open a

loop-bounded MmeI-generated stem into a single strand, followedby a filling-in reaction to generate palindromic shRNA fragments.A drawback to cDNA-based libraries is that they generally containsubstantial overrepresentation of shRNAs directed against commonmessages. Xu et al. (2007) have recently published a subtractive

8 al of B

ho

ktRlteaertmesitoTNptcRu

miobwrstbgbpsasssRaihshl

Difmlt

2

2

e3

0 M. Nichols, R.A. Steinman / Journ

ybridization-based equalization step that can limit the problemf overrepresentation.

The availability of siRNA libraries whose targets extend beyondnown mRNAs could be useful in phenotypic screens. Recentlyhere has been growing recognition that endogenous noncodingNAs play a major role in the control of development and cellu-

ar phenotypes through mechanisms including mRNA turnover orranslational control, formation of ribonucleoprotein complexes, orpigenetics (for review (Carninci and Hayashizaki, 2007; Yazgannd Krebs, 2007; Zaratiegui et al., 2007)). Highly regulated (Cawleyt al., 2004) noncoding RNAs are transcribed in response to envi-onmental cues and are functional in many cases. At least 7% ofranscripts are noncoding (Numata et al., 2003); it has been esti-

ated that 20% of genes have associated antisense transcripts (Yelint al., 2003) and that these may activate rather than suppress theense transcript (Cawley et al., 2004). Comparative genomic stud-es indicate that roughly half of the human genome is transcribed,hat one-third of these sequences are highly conserved, and thatnly 2% are protein-coding (Mattick, 2001; Semon and Duret, 2004).hese findings support the view that many critical functional ncR-As remain to be discovered and that they may constitute a newool of valid drug targets. Large noncoding RNAs constitute putativeargets for siRNA downmodulation; in addition siRNAs have suc-essfully targeted precursors or loop structures in small noncodingNAs (e.g. microRNAs). Libraries of randomized siRNAs could beseful in screens that capture noncoding RNA function.

Randomized siRNA libraries cannot be generated by syntheticethods because of scale limitations and the complexity of sto-

chiometrically annealing all randomized sense and antisenseligomers. Random hairpins cannot be synthetically generatedecause of the impossibility of matching each random sequenceith its random complement after the loop. Two laboratories have

eported success in generating small libraries of randomized siRNAequences. Kaykas and Moon (2004) have reported the genera-ion of functional siRNAs by positioning ∼21-bp DNA sequencesetween opposing RNA polymerase III promoters. Such constructsenerate both sense and antisense strands of siRNAs and cane cloned with appropriate 3′-overhangs encoded between theromoters. Kaykas randomized 3-bp within a luciferase-targetedequence and recovered functional siRNAs, suggesting possibledaptation of this system to the generation of larger randomizediRNA libraries. Chen et al. subsequently developed a library ofiRNAs driven by opposing promoters that they used to screen tran-cripts involved in NIH3T3 cell proliferation (Chen et al., 2005).ecently, the DNA nicking procedure of Dinh and Mo (2005) wasdapted to generate a small shRNA library from input random-zed oligonucleotides and it was shown that 18-bp oligonucleotidesomologous to p53 mRNA could be developed into functionalhRNA sequences using their approach (Wu et al., 2007). Wang et al.as recently used a 10-step cloning procedure to generate a shRNA

ibrary from randomized 29-mers (Wang et al., 2008).We describe a novel approach to the generation of randomized

NA hairpins and demonstrate the utility of this strategy in produc-ng a shRNA library and a functional shRNA. This approach differsrom those above by utilizing a FLP recombinase and a unique plas-

id intermediate to generate random shRNAs without the need toigate small terminal hairpin adapters or to use complex amplifica-ion procedures.

. Materials and methods

.1. Plasmid construction

pFRT is a 6480 bp kanamycin resistant plasmid that drives FLPxpression in bacteria. It contains FRT sites at positions 540 and226 that are oriented towards each other and flank a 423 aa FLP

iotechnology 143 (2009) 79–84

coding sequence extending from bp 727 to 1996. It was created byBgl2 digestion of (7380 bp) plasmid 313 FRT FLP cI IR and substi-tution of a Bgl2-linkered Kanamycin resistance gene for ampicillinresistance in the parental plasmid.

2.2. Preparation of Insert for hairpin library and generation ofpFRT-N20

Random 20-mers of DNA were synthesized, flanked on the 5′

side by a sequence containing a (bolded) Bgl2 site (CTTGAGATCT)and on the 3′ side by a (bolded) PstI site and priming template(CTGCAGCACTCGTGCC). This pool of single stranded DNAs wasannealed to a priming oligomer comprised of the sequence 5′-GGCACGAGTGCTGCAG and filled in with Klenow DNA polymerase,followed by phenol/chloroform extraction and ethanol precipita-tion. Following digestion with Bgl2 and PstI and another round ofpurification, 6 pmol of insert was ligated with 4 �g of Bgl2–PstI-digested pFRT vector, and transformed in batches into XL-1 Bluebacteria via electroporation in 1 mm cuvettes using settings of1.7 kV, 200 �, 25 �F. Bacteria from 5 cuvettes were pooled into a sin-gle flask for bulk culture under kanamycin selection of the resultantpFRTN20 plasmid pool and subsequent plasmid library purifica-tion. In some cases the random 20-mer was flanked by Bgl2 andBstEII linkers and cloned into a Bgl2/BstEII site in pFRT. In thesecases shRNAs bearing inverted repeats were separated by a BstEIIrecognition sequence loop (GGTAACC).

2.3. Generation of pFRTN20 palindromic plasmids and isolation ofshRNA hairpins

Expression of the FLP recombinase encoded within pFRTN20caused the expression of three forms of pFRTN20-derived plasmidswithin transformed XL-1 bacteria (Fig. 1). These arose from recom-binase action on FRTs within the plasmid, flipping the FRT-boundedsequence, or between plasmids, generating a palindromic dimer.Plasmids were digested with PstI, linearizing monomeric plasmidforms and generating two fragments from dimeric forms becauseof asymmetric placement of PstI relative to the two FRT sites inpFRT. Linearized plasmid fragments were fractionated on a 0.7%agarose gel and the shortest fragment isolated by elution (Fig. 1).This plasmid was autoligated to juxtapose sense and antisense ran-dom sequence at the PstI site. Autoligation was performed at lowdensity (e.g. 400 �l reaction at 10 ng/�l). Random hairpins wereexcised by Bgl2 digestion.

A modified pMig retroviral vector was constructed to expressrandom hairpin constructs generated from pFRT-N20. pMig(generous gift from Luc Van Parijs, Massachusetts Institute ofTechnology) a retroviral vector carrying an IRES and green fluo-rescent protein was digested with HpaI and a ccdB cloning cassette(Gateway Conversion system, Invitrogen, Inc.) was inserted, gen-erating pMigCCD. The inserted ccdB cassette contains ccdB anda chloramphenicol resistance gene for selection of recombi-nant plasmids, and also attR1 and attR2 sites to prepare therecipient vector for attL-attR lambda integrase-based recombina-tion cloning. A U6 promoter fragment containing a disposablesequence lacking siRNA functionality between its BamHI andHindIII sites was amplified from pSilencer 2.0 (Ambion, Inc.)using primers 5′-CACCGAGGAGAAGCATGAATTCC-3′ (sense) and 5′-CGTTGTAAAACGACGGCCAG-3′ (antisense). This PCR fragment wascloned into the shuttle vector pTopoEntr (Invitrogen) and recom-bined using the Clonase reaction with pMigCCD. This resulted in

the insertion of a U6 promoter followed by a BamHI site and thena TTTT termination signal 5′ of the IRES-GFP in pMig (plasmidpMU6TTTTiG). In addition to using pMU6TTTTiG as a retroviralshRNA-expression plasmid, a red fluorescent protein encoding vec-tor was generated to facilitate isolation of shRNAs from transduced

M. Nichols, R.A. Steinman / Journal of B

Fig. 1. Library-generation approach. Mechanism for generation of hairpin library isoutlined. The construction scheme takes advantage of the FLP recombinase. (A) Ran-domized 20-mer (red) bounded by Bgl2 and Pst1 restriction sites (blue and green,respectively). (B) Fragment shown in (A) was filled in and cloned so that it wassituated between two recognition sequences (FRTs, blue triangles) for the FLP recom-binase (orange starburst). (C) Transformation distributes plasmids singly amongbacteria on average. FLP recombinase is constitutively expressed from the input con-struct. (D) Intra-plasmid recombination by FLP flips the FRT bounded-sequence (“A”and “B”). Inter-plasmid recombination leads to generation of an intermediate formbearing large inverted (“C”) or direct (“D”) repeats. (E). Pst1 restriction digestion ofpooled plasmids yields linear monomeric plasmid from “A”, “B”, “D” and asymmetricdigestion products from “C”. (F and G) Isolation of the intermediate is followed byautoligation, restriction digestion with Bgl2 and cloning to yield randomized shorthairpins in an expression plasmid. (For interpretation of the references to color inthis figure legend, the reader is referred to the web version of the article.)

iotechnology 143 (2009) 79–84 81

cells containing GFP or exhibiting green autofluorescence. In orderto eliminate GFP and to create a cloning vector for random hairpinsthat encoded red fluorescent protein, a BamH1-linkered dsRed gene(Clontech, Inc.) was cloned into the Bgl2 site of pMU6TTTiG). Thisplasmid was then digested with BamH1 and Cla1 to remove the IRESand GFP, replacing the fragment with a BamHI-TTTT-HindIII–ClaIlinker. The resultant plasmid, pdsredMigU6BTHC was used as athe recipient for Bgl2-linkered randomized hairpin sequences.These retroviral vectors were grown under ampicillin selection,minimizing potential outgrowth from any (kanamycin resistant,ampicillin-sensitive) pFRT plasmid that conceivably had contam-inated preparation of the hairpin fragments.

2.4. Western blotting

CV-1 cells were co-transfected using lipofectamine with an ERalpha expression plasmid and either the shRNA control plasmidpdsredMigU6BTHC or pMigdsRedNotU6 or with shRNA plasmids#1, 4, 7, or 11 containing shRNAs directed against the ER transcriptthat were generated using the pFRT intermediate plasmid as above.Cells were harvested for determination of ER expression 48 h aftershRNA transfection. Anti ER alpha antibody HC-20 (sc-543, SantaCruz Biotechnology, Inc.) was used in immunoblotting at a 1:1000dilution.

3. Results

3.1. Construction of shRNA palindromes

Our strategy for generating shRNA palindromes exploits a stableintermediate form that is generated by a plasmid encoding the FLPrecombinase (Sadowski, 1995) and that contains two recognitionsites (FRT) for that recombinase to act upon.

FRT recognition sites consist of palindromic 13 bp sequences,separated by an 8 bp spacer that is not palindromic. If the two FRTsare in the same relative orientation in a DNA molecule, a dimer ofFLP recombinase will bind at each FRT and, through a tetramericprotein intermediate, result in a deletion of all of the DNA betweenthe FRTs, which ends up as a circular DNA containing one FRT. If thespacers are in opposite orientations relative to each other, the DNAbetween the FRTs is inverted by FLP recombinase. Both reactionsare reversible. We make use of a target cloning plasmid where theFRTs are cloned in opposite orientations 2.7 kb apart. As a result,after transfection and expression in bacteria, the recombinase actsupon the FRT bounded sequence to reverse the orientation of the2.7 kb. Through the action of the FLP-FRT system, a mixture of singleplasmids results, containing original (A) or inverted (B) sequencebetween the recombination sites. As well, the FLP recombinase cangenerate double sized plasmids through inter-plasmid recombina-tion that is comprised of two A-forms, two B-forms, or one A andone B hybrid forms (forms C and D, Fig. 1). In the hybrid A and Bplasmid (“C”), the FRT-bounded 2.7 kb sequences have opposite ori-entations within the plasmid. We have found that this intermediateform can represent up to 55% of the plasmid pool (see below, andFig. 2).

The schematic in Fig. 1 demonstrates how the dynamic rear-rangements of the pFRT plasmid can be exploited to generate apalindrome of a randomized sequence, positioned between theFRT recognition sites to generate pFRT20-mer. Single stranded ran-domized 20-mers were synthesized, bounded by Bgl2 and PstI

recognition sequences and a 3′ tail for priming filling-in to a double-stranded insert (see Section 2. In a parallel approach BstEII was usedinstead of Pst1 for cloning). Following digestion with Bgl2 and PstI,the double-stranded randomized inserts were cloned into uniqueBgl2 and PstI sites in pFRT. These sites were arranged so that the

82 M. Nichols, R.A. Steinman / Journal of Biotechnology 143 (2009) 79–84

Fig. 2. Formation of palindromic dimer plasmid. (A) Two isolates of plasmid pFRTare shown, grown with different amounts of induced FLP activity. Isolate 1 has moresupercoiled (sc) monomer form than isolate 2, and likewise isolate 2 shows moredimer and higher multimer forms than isolate 1. The higher order forms are gener-ated when monomers insert into each other via FLP activity at the FRT sites. Wheneach of the isolates is digested by the enzyme PstI, several products were formed.The monomer band includes linear “A” and “B” form plasmids (see Fig. 1A–C). Inaddition, a monomer results when the dimer plasmid “D” (that is a direct repeatof constituent plasmids) is cut with PstI. The “C” plasmid, resulting from an A andB combination plasmid, yielded a large and small piece when cut by PstI, as dia-grammed in Fig. 1. Isolate 2 had a higher percentage of dimers and therefore resultsidnt

rsptIcft1i(tcf(“12r2t

osbrs

Table 1Sequences of palindromes. This table shows examples of shRNA sequences that weregenerated from random 20-mers cloned into pFRT, processed as above and isolatedfrom bacterial clones. The generation of inverted repeats separated by CTGCAG loopsis evident.

5′–3′

AGGCGTAACCCCATTAGTTT CTGCAG AAACTAATGGGGTTACGCCTTCAGGGTTTTACGTATTGTG CTGCAG CACAATACGTAAAACCCTGATGACCGGCAGCAATAGGAGG CTGCAG CCTCCTATTGCTGCCGGTCATGTTTGGGGGGGTGGCTACG CTGCAG CGTAGCCACCCCCCCAAACAAAGTGCGACTAAGGCCGTAA CTGCAG TTACGGCCTTAGTCGCACTTAGCTAGGTGGGGGTCGCTGG CTGCAG CCAGCGACCCCCACCTAGCT

generated by a plasmid expressing FLP recombinase and contain-ing two oppositely oriented FRT sequences. We have demonstratedthat randomized input oligomers can be efficiently converted intohairpins and that the stem loop structures generated can func-

n a higher proportion of C-large and C-small than isolate 1. (B) Isolates 1 and 2 wereigested with Xba1, an enzyme whose sequence abuts the FRTs of pFRT and doesot flip. All of the supercoiled multimer forms shown in the previous (A) digestedo yield two bands at 3.8 kb and 2.7 kb, as expected for the 6.5 kb plasmid.

andom oligomer was positioned asymmetrically between the FRTites, abutting one of the two sites. When plasmids prepared fromFRT20-mer were digested with PstI, a 6.5 kb band representinghe linearized monomer plasmid forms A and B was generated.n addition, the intermediate form double plasmid (denoted “D”)ontaining direct repeats of plasmid A or of plasmid B large canorm. When any of these three plasmids were digested with Pst1,hey generated linear monomeric plasmid 6.5 kb in length (Figs.E and 2). An asymmetric double plasmid intermediate form aris-

ng from recombination of A and B (denoted “C”) was also formedFig. 1D). When cleaved by Pst1, this intermediate form generatedwo asymmetric fragments; a 9.1 kb fragment containing dupli-ated FLP sequences and most plasmid sequences, and a 3.9 kb smallragment bordered by 20-mer sequences in opposite orientationFigs. 1E and 2). As shown in Fig. 2A, the prevalence of this hybridC” plasmid varied in different preparations, ranging from a low of6% of the total plasmid yield (lane 1) to 55% of the total yield (lane). As expected, all of the FRT-bounded components of the plasmidsetain their integrity. This is manifested by the generation of 3.8 and.7 bands when any of the plasmids are digested at the Xba1 sitehat abuts FRT sites and is not recombined.

Autoligation of the small fragment arising from Pst1 digestionf plasmid C generates a 20-mer palindrome in which a PstI site

eparates sense and antisense repeats (Fig. 1F). The loop sequenceetween repeats could be changed simply by substituting anotherestriction site for PstI, as we verified in a construct using a BstEIIite instead of the PstI site. The palindromic inverted repeat cas-

GAGGGGAGGCCCTCGCTGGG CTGCAG CCCAGCGAGGGCCTCCCCTCAACAGTCGGTGCTCAGGCGG CTGCAG CCGCCTGAGCACCGACTGTTGGATAGAGGGAGGTCGCGAA CTGCAG TTCGCGACCTCCCTCTATCC

sette could be excised with Bgl2 digestion and cloned next to a RNApolymerase III promoter to generate shRNA expression plasmids(Fig. 1G).

Table 1 lists sequences of nine clones randomly selected fromplates of bacteria transfected with putative palindromic constructs.It was evident that random input sequences were converted intoinverted repeats separated by PstI restriction site, as expected.

3.2. Validation of shRNA function

In order to demonstrate that stem-loop palindromes created inthe shRNA library could be functional, we cloned 21-mers corre-sponding to validated siRNA targets (our unpublished data) withinthe estrogen receptor alpha coding sequence into pFRT. Fig. 3demonstrates biological activity of shRNAs generated using thissystem. Input DNAs matching 21-bp of estrogen receptor alphasequence were accordingly cloned into Bgl2–BstEII sites of pFRT andtransformed into double-stranded RNA hairpins with a BstEII loop.These input sequences (AAGGCCTTCTTCAAGAGAAGT and AAGAT-CACAGACACTTTGATC) had previously been shown to suppressestrogen receptor alpha expression when delivered as syntheticds siRNAs (our unpublished data). In order to determine whethershRNA constructs could suppress ER alpha, either of two isolatedretroviral plasmids containing the “A” hairpin sequence (siR1 andsiR4) or either of two plasmid isolates containing the “B” hairpinsequence (siR7 and siR11) were co-transfected into CV-1 cells alongwith an ER alpha expression plasmid. As shown in the Westernblot in Fig. 3, these shRNA plasmids dramatically reduced ER alphaexpression whereas vector control plasmids (C1 and C2) did not.

4. Discussion

This project generated randomized DNA palindromes by exploit-ing a highly prevalent dimeric plasmid intermediate that was stably

Fig. 3. Effectiveness of shRNAs formed using hairpin-generating mechanism. Top:Western blot demonstrates that shRNAs against estrogen receptor alpha sequencesgenerated by the library methodology were able to suppress the protein level of ERalpha.

al of B

tdsatse

Rtputhrpabcomgg

pcgmlpawgtoititrcgtspi

fwabbbt1iwcats

cssH

M. Nichols, R.A. Steinman / Journ

ion as shRNAs to knock-down gene expression. The technologyescribed could be useful in generating libraries of randomizedhRNAs for reverse genetic screens. Such libraries could exceed thebility of cDNA-directed shRNA libraries to uncover functions of theranscriptome, because antisense and noncoding RNAs comprise aubstantial portion of cellular transcripts (Claverie, 2005; Numatat al., 2003; Yelin et al., 2003).

ShRNA libraries are an efficient delivery system for interferingNA because they tether sense and antisense RNAs together, ratherhan relying on homologous RNA strands transcribed from distinctromoters. Prior approaches to generate shRNA palindromes havetilized extended protocols that begin with ligation of stem struc-ures containing the MmeI endonuclease to DNA and or filling-inalf-hairpins. The strategy that we described is straightforward andelies on cloning of random oligomers into a functionally uniquelasmid rather than relying on ligation of targets to degeneratedaptors along with extracellular strand amplification as requiredy other shRNA strategies. While the plasmid intermediate that isentral to our approach is ranges from a minor to substantial portionf the total plasmid pool, the procedure can readily be scaled to yieldany micrograms of this product. As demonstrated for the estro-

en receptor alpha mRNA target in this paper, FLP/FRT palindromeeneration can also produce functional directed shRNAs.

Randomized libraries of siRNA molecules are tools with greatotential to test the entire breadth and depth of coding and non-oding eukaryotic gene expression. However, it is not practical toenerate and screen all (420) possible sequences of randomized 20-ers. Nonetheless, empirical evidence indicates that screens of as

ittle as one million cells are likely to be informative. For exam-le, Kawasaki and Taira (2002) utilized 20 random nucleotides inrandom ribozyme library in HeLa cells and identified 25 targetshich were necessary for Fas-mediated apoptosis. Suyama et al.

enerated a library of one billion random ribozymes, out of whichhey grew 5 million plasmids. When used to screen a populationf 1 million transfected cells this generated 8 sequences important

n cellular invasion (Suyama et al., 2003). Chen et al. (2005) stablyransfected roughly 1–3 million MC3T3-E1 cells with a random-zed siRNA library based on convergent promoters and obtainedhree clones that augmented cell proliferation. A similar study wasecently reported in which 2 million random shRNA-transducedells generated 9 subclones in which shRNAs decreased death fromrowth factor deprivation (Wang et al., 2008). These findings illus-rate the likelihood of informative high-throughput screening usingubsets of a random library that capture only a portion of its com-lexity. Results of the studies suggest that roughly 1–5 million

ndependent shRNAs would suffice for most functional screens.A key advantage of the shRNA randomized library arises in

unctional screens. While initial screens by phenotype will beeak, stringency arises from reiterative selection and expansion of

ffected cells. The random nature of shRNAs increases the proba-ility that library sequences will have microRNA-like affects. Targetinding by ∼22-bp miRNAs is determined primarily by a homologyetween a 7-bp “seed” region at the 5′ of the miRNA and the mRNAarget. All possible seed sequences comprise a random space of only6,384 members. A 1-million sequence randomized library wouldnclude the seed region of the majority of possible miRNAs along

ith variable 3′ miRNA tails that contribute to differences in effi-acy (Grimson et al., 2007) or subcellular localization (Hwang etl., 2007) of microRNAs. Because microRNAs affect cellular pheno-ypes by modulating multiple transcripts at once, the likelihood ofuccessful phenotypic screens using the library is bolstered.

Randomized shRNA libraries cannot compete with directed,DNA-based libraries in the efficient knockdown of mRNA tran-cripts that match sequences in the library. The larger pool ofequences makes randomized libraries inefficient in this process.owever, because randomized shRNAs may reiterate microRNA

iotechnology 143 (2009) 79–84 83

sequences the library pool will contain shRNAs that can regulatemultiple transcripts at once. Insofar as novel microRNA sequencesare transduced from the library, novel combinations of targetsbearing similar seed sequences may be coordinately regulated.Randomized sequences are likely to be particularly useful in mod-els of development and differentiation, because tissues tend tounderexpress potential microRNA targets at times when thosemicroRNAs are expressed (Farh et al., 2005). Randomized shRNAscould undercut this process of “selective avoidance” by targeting3′-utr sequences that have escaped regulation by the endogenouspool of microRNAs.

Like gene-directed shRNAs, randomized shRNAs will have “off-target” effects. In general, it will be difficult to identify the directtargets of functional shRNAs isolated from library screening. Someof the functional shRNAs may act as microRNAs, embodyingimperfect matches to targets, or may target noncoding RNAs. Can-didate targets or their downstream pathways may be illuminatedby microarray-denoted changes in mRNA and miRNA expressionlinked to shRNAs. Detailed secondary screens of informative ran-domized shRNAs will be needed to ensure that hits do not have“off-target” phenotypes after screening strategies directed at iden-tifying shRNAs that have a specific phenotypic function.

Randomized palindrome libraries could have usage beyondhigh-throughput RNA interference screens by serving as a tool forbiological investigations of inverted DNA or RNA repeats. It has beenshown that short inverted repeats in the genome trigger the forma-tion of large DNA palindromes associated with double strand breaksand gene amplification (Neiman et al., 2008; Narayanan et al.,2006; Tanaka et al., 2005, 2006, 2002). The sequence-dependenceof inverted repeats in triggering large palindromes and chromo-somal breaks is not completely understood. We have described amethod for generating short randomized inverted repeats of 20 bpin this paper for use in RNAi, although it is worth noting our bacte-rial plasmid intermediates actually contained 2.7-kb long invertedsequences. Longer randomized DNA palindromes produced fromour plasmid could be useful in the analysis of palindromic-drivengene amplification or in elucidating sequence-dependent func-tionality of hairpin unwinding and cleaving complexes (Paull andGellert, 1999).

In summary, these studies demonstrated that a stable plasmidintermediate arising from FLP recombinase-expressing plasmidsbearing convergent FRT sites generates inverted repeats from inputsequences. These can be converted into shRNA-encoding hairpinrepeats allowing the generation of randomized shRNA librariesfrom randomized input oligomers. This technology can be adaptedfor screening of coding and noncoding RNAs by RNA interference.

Acknowledgements

We thank Peng Cheng and Christine Stehle for technical assis-tance. This work was supported by a grant from the HillmanFoundation; and the Pittsburgh Life Science Greenhouse subcon-tracted through Cellumen, Inc. The funding agencies were notinvolved in the design, collection, analysis, interpretation of data,nor in manuscript review.

Authors’ contributions: MN and RAS conceived and co-designedthe scientific strategy, planned and conducted experiments, ana-lyzed results and obtained funding. RAS drafted and MN edited andreviewed the manuscript. The authors declare intellectual propertyinterests.

References

Berns, K., Hijmans, E.M., Mullenders, J., Brummelkamp, T.R., Velds, A., Heimerikx,M., Kerkhoven, R.M., Madiredjo, M., Nijkamp, W., Weigelt, B., Agami, R., Ge, W.,Cavet, G., Linsley, P.S., Beijersbergen, R.L., Bernards, R., 2004. A large-scale RNAi

8 al of B

B

C

C

C

C

CC

D

E

F

F

G

H

K

K

L

M

N

4 M. Nichols, R.A. Steinman / Journ

screen in human cells identifies new components of the p53 pathway. Nature428, 431–437.

rummelkamp, T.R., Bernards, R., Agami, R., 2002. A system for stable expression ofshort interfering RNAs in mammalian cells. Science 296, 550–553.

aplen, N.J., Parrish, S., Imani, F., Fire, A., Morgan, R.A., 2001. Specific inhibition ofgene expression by small double-stranded RNAs in invertebrate and vertebratesystems. Proc. Natl. Acad. Sci. U.S.A. 98, 9742–9747.

arninci, P., Hayashizaki, Y., 2007. Noncoding RNA transcription beyond annotatedgenes. Curr. Opin. Genet. Dev. 17, 139–144.

awley, S., Bekiranov, S., Ng, H.H., Kapranov, P., Sekinger, E.A., Kampa, D., Piccolboni,A., Sementchenko, V., Cheng, J., Williams, A.J., Wheeler, R., Wong, B., Drenkow, J.,Yamanaka, M., Patel, S., Brubaker, S., Tammana, H., Helt, G., Struhl, K., Gingeras,T.R., 2004. Unbiased mapping of transcription factor binding sites along humanchromosomes 21 and 22 points to widespread regulation of noncoding RNAs.Cell 116, 499–509.

hen, M., Zhang, L., Zhang, H.Y., Xiong, X., Wang, B., Du, Q., Lu, B., Wahlestedt, C.,Liang, Z., 2005. A universal plasmid library encoding all permutations of smallinterfering RNA. Proc. Natl. Acad. Sci. U.S.A. 102, 2356–2361.

laverie, J.M., 2005. Fewer genes, more noncoding RNA. Science 309, 1529–1530.leary, M.A., Kilian, K., Wang, Y., Bradshaw, J., Cavet, G., Ge, W., Kulkarni, A., Paddison,

P.J., Chang, K., Sheth, N., Leproust, E., Coffey, E.M., Burchard, J., McCombie, W.R.,Linsley, P., Hannon, G.J., 2004. Production of complex nucleic acid libraries usinghighly parallel in situ oligonucleotide synthesis. Nat. Methods 1, 241–248.

inh, A., Mo, Y.Y., 2005. Alternative approach to generate shRNA from cDNA. Biotech-niques 38, 629–632.

lbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., Tuschl, T., 2001.Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mam-malian cells. Nature 411, 494–498.

arh, K.K., Grimson, A., Jan, C., Lewis, B.P., Johnston, W.K., Lim, L.P., Burge, C.B., Bartel,D.P., 2005. The widespread impact of mammalian MicroRNAs on mRNA repres-sion and evolution. Science 310, 1817–1821.

raser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M.,Ahringer, J., 2000. Functional genomic analysis of C. elegans chromosome I bysystematic RNA interference. Nature 408, 325–330.

rimson, A., Farh, K.K., Johnston, W.K., Garrett-Engele, P., Lim, L.P., Bartel, D.P., 2007.MicroRNA targeting specificity in mammals: determinants beyond seed pairing.Mol Cell 27, 91–105.

wang, H.W., Wentzel, E.A., Mendell, J.T., 2007. A hexanucleotide element directsmicroRNA nuclear import. Science 315, 97–100.

awasaki, H., Taira, K., 2002. A functional gene discovery in the Fas-mediatedpathway to apoptosis by analysis of transiently expressed randomized hybrid-ribozyme libraries. Nucleic Acids Res. 30, 3609–3614.

aykas, A., Moon, R.T., 2004. A plasmid-based system for expressing small interferingRNA libraries in mammalian cells. BMC Cell Biol. 5, 16.

uo, B., Heard, A.D., Lodish, H.F., 2004. Small interfering RNA production by enzy-

matic engineering of DNA (SPEED). Proc. Natl. Acad. Sci. U.S.A. 101, 5494–5499.

attick, J.S., 2001. Non-coding RNAs: the architects of eukaryotic complexity. EMBORep. 2, 986–991.

arayanan, V., Mieczkowski, P.A., Kim, H.M., Petes, T.D., Lobachev, K.S., 2006. Thepattern of gene amplification is determined by the chromosomal location ofhairpin-capped breaks. Cell 125, 1283–1296.

iotechnology 143 (2009) 79–84

Neiman, P.E., Elsaesser, K., Loring, G., Kimmel, R., 2008. Myc oncogene-inducedgenomic instability: DNA palindromes in bursal lymphomagenesis. PLoS Genet.4, e1000132.

Numata, K., Kanai, A., Saito, R., Kondo, S., Adachi, J., Wilming, L.G., Hume,D.A., Hayashizaki, Y., Tomita, M., 2003. Identification of putative noncodingRNAs among the RIKEN mouse full-length cDNA collection. Genome Res. 13,1301–1306.

Paddison, P.J., Silva, J.M., Conklin, D.S., Schlabach, M., Li, M., Aruleba, S., Balija, V.,O’Shaughnessy, A., Gnoj, L., Scobie, K., Chang, K., Westbrook, T., Cleary, M., Sachi-danandam, R., McCombie, W.R., Elledge, S.J., Hannon, G.J., 2004. A resourcefor large-scale RNA-interference-based screens in mammals. Nature 428,427–431.

Paull, T.T., Gellert, M., 1999. Nbs1 potentiates ATP-driven DNA unwinding andendonuclease cleavage by the Mre11/Rad50 complex. Genes Dev. 13, 1276–1288.

Sadowski, P.D., 1995. The Flp recombinase of the 2-microns plasmid of Saccharomycescerevisiae. Prog. Nucleic Acid Res. Mol. Biol. 51, 53–91.

Semon, M., Duret, L., 2004. Evidence that functional transcription units cover at leasthalf of the human genome. Trends Genet. 20, 229–232.

Sen, G., Wehrman, T.S., Myers, J.W., Blau, H.M., 2004. Restriction enzyme-generatedsiRNA (REGS) vectors and libraries. Nat. Genet..

Shirane, D., Sugao, K., Namiki, S., Tanabe, M., Iino, M., Hirose, K., 2004. Enzymaticproduction of RNAi libraries from cDNAs. Nat. Genet..

Suyama, E., Kawasaki, H., Nakajima, M., Taira, K., 2003. Identification of genesinvolved in cell invasion by using a library of randomized hybrid ribozymes.Proc. Natl. Acad. Sci. U.S.A. 100, 5616–5621.

Tanaka, H., Tapscott, S.J., Trask, B.J., Yao, M.C., 2002. Short inverted repeats initi-ate gene amplification through the formation of a large DNA palindrome inmammalian cells. Proc. Natl. Acad. Sci. U.S.A. 99, 8772–8777.

Tanaka, H., Bergstrom, D.A., Yao, M.C., Tapscott, S.J., 2005. Widespread and non-random distribution of DNA palindromes in cancer cells provides a structuralplatform for subsequent gene amplification. Nat. Genet. 37, 320–327.

Tanaka, H., Bergstrom, D.A., Yao, M.C., Tapscott, S.J., 2006. Large DNA palindromes asa common form of structural chromosome aberrations in human cancers. Hum.Cell 19, 17–23.

Wang, Y., Wang, Y.E., Cotticelli, M.G., Wilson, R.B., 2008. A random shRNA-encodinglibrary for phenotypic selection and hit-optimization. PLoS ONE 3, e3171.

Wu, H., Dinh, A., Mo, Y.Y., 2007. Generation of shRNAs from randomized oligonu-cleotides. Biol. Proc. Online 9, 9–17.

Xu, L., Li, J., Liu, L., Lu, L., Gao, J., Li, X., 2007. Construction of equalized short hairpinRNA library from human brain cDNA. J. Biotechnol. 128, 477–485.

Yazgan, O., Krebs, J.E., 2007. Noncoding but nonexpendable: transcriptional regula-tion by large noncoding RNA in eukaryotes. Biochem. Cell Biol. 85, 484–496.

Yelin, R., Dahary, D., Sorek, R., Levanon, E.Y., Goldstein, O., Shoshan, A., Diber, A., Biton,S., Tamir, Y., Khosravi, R., Nemzer, S., Pinner, E., Walach, S., Bernstein, J., Savitsky,K., Rotman, G., 2003. Widespread occurrence of antisense transcription in the

human genome. Nat. Biotechnol. 21, 379–386.

Zaratiegui, M., Irvine, D.V., Martienssen, R.A., 2007. Noncoding RNAs and gene silenc-ing. Cell 128, 763–776.

Zheng, L., Liu, J., Batalov, S., Zhou, D., Orth, A., Ding, S., Schultz, P.G., 2003. An approachto genomewide screens of expressed small interfering RNAs in mammalian cells.Proc. Natl. Acad. Sci. U.S.A..