at SciVerse ScienceDirect

Plant Physiology and Biochemistry 62 (2013) 23e32

Contents lists available

Plant Physiology and Biochemistry

journal homepage: www.elsevier .com/locate/plaphy

Research article

A PR-4 gene identified from Malus domestica is involved in the defense responsesagainst Botryosphaeria dothidea

Suhua Bai a,b, Chaohua Dong a, Baohua Li c, Hongyi Dai b,*aCollege of Life Science, Qingdao Agricultural University, Qingdao 266109, ChinabCollege of Horticulture, Qingdao Agricultural University, 700 Changcheng Road, Qingdao 266109, ChinacCollege of Agriculture and Plant Protection, Qingdao Agricultural University, Qingdao 266109, China

a r t i c l e i n f o

Article history:Received 4 September 2012Accepted 27 October 2012Available online 7 November 2012

Keywords:Antifungal activityBotryosphaeria dothideaDefense responseMalus domesticaPathogen-related protein-4Ribonuclease activity

* Corresponding author. Tel.: þ86 532 86080008; fE-mail address: hydai@qau.edu.cn (H. Dai).

0981-9428/$ e see front matter � 2012 Elsevier Mashttp://dx.doi.org/10.1016/j.plaphy.2012.10.016

a b s t r a c t

Pathogenesis-related protein-4 (PR-4) family is a group of proteins with a Barwin domain in C-terminusand generally thought to be involved in plant defense responses. However, their detailed roles are poorlyunderstood in defense of apple plant against pathogenic infection. In the present study, a new PR-4 gene(designated as MdPR-4) was identified from Malus domestica, and its roles in defense responses of applewere investigated. The open reading frame of MdPR-4 gene is of 447 bp encoding a protein of 148 aminoacids with a Barwin domain in C-terminus and a signal peptide of 26 amino acids in N-terminus.Sequence and structural analysis indicated that MdPR-4 protein belongs to class II of PR-4 family. Thehigh-level expression ofMdPR-4 was observed in flowers and leaves as revealed by quantitative real timePCR. The temporal expression analysis demonstrated that MdPR-4 expression could be up-regulated byBotryosphaeria dothidea infection and salicylic acid (SA) or methyl jasmonate (MeJA) treatment, butsuppressed by diethyldithiocarbamic acid (DIECA). In vitro assays, recombinant MdPR-4 protein exhibitedribonuclease activity specific for single strand RNA and significant inhibition to hyphal growth of threeapple pathogenic fungi B. dothidea, Valsa ceratosperma and Glomerella cingulata. Moreover, the inhibitionwas reduced by the presence of 50-ADP. Taken all together, the results indicate that MdPR-4 protein isinvolved in the defense responses of apple against pathogenic attack by directly inhibiting hyphalgrowth, and the inhibition is correlated with its ribonuclease activity, where as MdPR-4 expression isregulated by both SA and JA signaling pathway.

� 2012 Elsevier Masson SAS. All rights reserved.

1. Introduction

Ring rot is a highly devastating disease of apple in China andother East Asia countries including Japan and South Korea. Thedisease is caused by fungal pathogen Botryosphaeria dothideawhichinfects branches, trunk or fruits, forming warts around lenticels inbranches and trunk or resulting in sunken lesions with alternatingtan and brown rings in ripened fruits [1]. As the disease progressed,it will cause the infected trunk and branches to die or fruit to rot,which has resulted in tremendous economic loss. Due to limitedknowledge on hostepathogen interactions of ring rot, it is difficultto eradicate this disease or slow down its incidence. Understandingthe defense responses of host against B. dothidea is the base tomanage effectively the disease and develop disease-resistantcultivar.

ax: þ86 532 86080221.

son SAS. All rights reserved.

To avoid attack of phytopathogenic organisms, plants haveevolved various innate defense response mechanisms, includingthe limitation of pathogen spread by a physical barrier, the inhi-bition of pathogen growth and colonization by production ofantimicrobial compounds [2,3], and the induction of pathogenesis-related protein (PR) synthesis which, in turn, lead to systemicacquired resistance (SAR) [4e6]. Among these defense mecha-nisms, SAR is long-lasting and broad-spectrum disease resistancewhich involves three signaling pathways, i.e, salicylic acid (SA),jasmonic acid (JA), and ethylene (ETH) signaling pathways [5,6]. Ingenerally, SA signaling pathway regulates host immune responsesagainst biotrophic pathogens, where as JA and ETH signalingpathways regulate the defense responses which impede necrotro-phic pathogens. These signaling pathways also interact with eachother to modulate plant defense responses [5,6]. It has beendemonstrated that SA or its derivatives are strong antagonists ofthe JA signaling pathway, and JA and ETH signaling can act syner-gistically [5,6]. It has yet to be known which signaling pathway isinvolved in the defense responses of apple plant against theinfection of B. dothidea.

Table 1Primers used in the present study.

Primers Primers sequence (50e30) for quantitativereal time PCR

MdPR-4 Primers for amplification of initial cDNA fragmentP1 F: 54 50-TGGCCGGGAAGATCACAG-30

P2 R: 497 50- AGTCGCCGCAGTCGACAA-30

MdPR-4 Primers for 30 RACEP3 F: 131þ 50-CAAAGTGCGACGAATGTGAG-30

P4 F: 312þ 50-GCGGAAGGTGCCTCTTGGTG-30

Adaptor-oligo dT GGCCACGCGTCGACTAGTACT17Adaptor GGCCACGCGTCGACTAGTACMdPR-4 Primers for 50 RACEP5 R: 340� 50-AGTGTTTGTCACCAAGAGGC-30

P6 R: 246� 50-TCGAGGGATTTATCGGCATC-30

Adaptor-oligo dG GGCCACGCGTCGACTAGTACG13

MdPR-4 Primers for verification of the full-length cDNAP7 F: 8þ 50-TTGTAGATTATTGCCTGCTT-30

P8 R: 560� 50-CCCTACCAATACTGGAAGTA-30

MdPR-4 Primers for quantitative real time PCRP9 F: 157þ 50-ATACCACCTCTACAATCCACA-30

P10 R: 406� 50-GTCCAAGTCCAATCCTCC-30

b-actin Primers for quantitative real time PCRP11 F: 50-CTGAACCCAAAGGCTAATCG-30

P12 R: 50-ACTGGCGTAGAGGGAAAGAA-30

Primers for preparation of recombinant protein MdPR-4P13 F: 63þ 50-CCATGGCCGGGAAGATCACAGC-30

P14 R: 717� 50-CTCGAGTTAGTCGCCGCAGTCGACAA-30

Primer for generation of Double strand RNA specific for GFP geneP15 F: 50-TAATACGACTCACTATAGGGCGA

CGTAAACGGCCACAAGT-30

P16 R: 50-TAATACGACTCACTATAGGGCTTGTACAGCTCGTCCATGC-30

Primer for generation of single strand RNA specific for GFP geneP17 R: 50-CTTGTACAGCTCGTCCATGC-30

S. Bai et al. / Plant Physiology and Biochemistry 62 (2013) 23e3224

Pathogen infection stimulates plant to synthesize SA, JA or ETHwhich in turn regulate the expression of pathogenesis-relatedproteins (PRs) and lead to the accumulation of PR proteins. Thesynthesis and accumulation of pathogenesis-related proteins (PR)have been confirmed to play important role in defense againstpathogenic infection [7]. PR proteins are defined as the plantprotein which can be induced by plant pathogen [7,8], and some ofthem can directly kill pathogen or inhibit the pathogen growthwith their antimicrobial activity [7,8]. At present, a large number ofPR proteins have been identified in various plant species andclassified into 17 groups according to their biochemical and phys-iological properties [7]. Some of them with direct antimicrobialactivity have been used as indicator to assess the defence status ofmodel plants [9]. However, nowell-studied PR genes were reportedin Malus domestica. It has been found that some PR proteins accu-mulated in M. domestica in response to pathogen inoculation suchas fungal pathogen Venturia inaequalis and bacterial pathogenErwinia amylovora. For example, the accumulation of b-1,3-glucanase (PR-2), chitinase (PR-3), and thaumatin-like protein(PR-5)was observed in M. domestica leaves infected by V. inaequalis[10]. In another example, PR-1, PR-5, PR-8 genes were reported tobe induced in M. domestica by inoculation with the bacterialpathogen, E. amylovora [9]. Up to date, little has known about PRproteins responding to the infection of B. dothidea in M. domestica.

In order to identify responsive genes related to B. dothideainfection, we examined the mRNA expression of some defence-related genes using quantitative real time PCR technique. A geneencoding PR-4 proteinwas found among the highly expressed onesin the bark of apple trees infected with B. dothidea. PR-4 protein hasbeen reported to have the antifungal activity and resistance-relatedproperty in other plant species. The protein was first identifiedfrom Solanum tuberosum [11] and subsequently, isolated frommanyother plants [12e19]. All PR-4 proteins share a common Barwindomain in C-terminus and can be divided into two classesaccording the presence N-terminal cysteine-rich domain [20]. Oneclass with the N-terminal cysteine-rich domain was referred asclass I (also known as hevein-like protein) and the second one wasdesignated as class II which lacks the N-terminal cysteine-richdomain. The former possesses binding ability to chitin andthereby have strong antifungal activities which were extensivelyresearched [21]. However, class II proteins are less extensivelystudied and their functions are divergent. In different species, classII proteins exhibit different biological activities [20,22], and evendifferent proteins of class II identified from the same species alsohave different biological activities [22]. They are involved indevelopment regulation [23] and defense responses against variousbiotic or abiotic stresses [23,24]. At present, roles of PR-4 protein indefense of apple against fungal pathogen remain to be elucidated.

In the present work, the biological activity of an apple PR-4 gene(MdPR-4) and its temporal expression changes after inoculation ofB. dothidea were examined in order to understand the role of PR-4protein in defense responses against B. dothidea. Its involvement inthe signaling pathway was also investigated with biochemicalapproach.

2. Results

2.1. Cloning of MdPR-4 gene

To examine gene expression change as a consequence ofB. dothidea infection, a predictive DNA sequence encoding a PR-4protein was identified from genome sequence of M. domestica bysearching the Genbank database using TBLASTN algorithm. Basedon the genomic DNA sequence, primers P1 and P2 were designed toamplify the partial cDNA fragment encoding PR-4 protein.

A 444 bp of cDNA fragment was obtained via PCR amplificationwith primers P1 and P2. According to the cDNA fragment, genespecific primers (P3eP6, Table 1) were designed to amplify the 30

and 50 end of cDNA by nested PCR. Nested PCR produced a 300 bpof 30 end cDNA fragment and a 246 bp of 50 end cDNA fragment,respectively. A 611 bp of full-length cDNA sequence was obtainedby assembling the three obtained cDNA fragments and confirmedby PCR amplification with P7 and P8. The full-length cDNA wasnamed as MdPR-4 and deposited in GenBank under accession No.JQ342967 (Fig. 1).

2.2. Sequence and homology analysis of MdPR-4 gene

The full-length cDNA sequence contains a 447 bp of openreading frame (ORF), 52 bp of 50-UTR and 112 bp of 30-UTR withployA tail. The putative protein is composed of 148 amino acidswith a predicted molecular weight of 15.85 kDa and theoreticalisoelectric point of 5.05. There is a typical signal peptide consistingof the first 26 amino acid residues in the N-terminus as predictedwith signialP program. SMART analysis revealed that the putativeMdPR-4 protein contains a Barwin domain which is shared by PR-4proteins of other plant species. Two conservative His residuesrequired for ribonuclease activity of PR-4 (class II) protein [22,25]also exist in the deduced amino acid sequence. However, thisprotein lacks N-terminal cysteine-rich domain necessary for chitinbinding activity in class I of PR-4 family (Fig. 2).

The homology analysis revealed significant sequence similarityof the Barwin domain betweenMdPR-4 and other PR-4 proteins(Fig. 2). According to the sequence alignment data, all the invariantresidues featuring the domain are well conserved in MdPR-4. Thededuced amino acid sequence exhibited high identity with PR-4protein identified from Nicotiana tabacum (P29063) (82%), Vitis

Fig. 1. Nucleotide and putative amino acid sequences of MdPR-4 gene from M.domestica. Nucleotides (lower) and amino acids (upper) are numbered on the left. Thepredicted signal peptide is underlined. The asterisks (*) indicates stop codon andamino acids with gray background represent Barwin domain.

S. Bai et al. / Plant Physiology and Biochemistry 62 (2013) 23e32 25

vinifera (XP_002264720.1) (75%), Dioscorea bulbifera (AAB94514.1)(73%) and Solanum lycopersicum (NP_001234083) (70%), hevein-like protein of Arabidopsis thaliana (NP_187123) (79%), as well asWheatwin1 (O64392.1) from Triticum aestivum (68%).

2.3. The tissue distribution of MdPR-4 mRNA and its temporalexpression in response to B. dothidea infection

The tissue distribution of MdPR-4 mRNAwas investigated usingquantitative real time PCR technique. MdPR-4 mRNA was detectedin six different tissues including roots, barks, young fruits, leaves,buds and flowers (Fig. 3A). Higher expression was found in flowersand leaves, whereas a relatively low expression level was observedin other tissues including roots, barks, young fruits and buds. Therewas no significant difference observed among the latter four tissues(P > 0.05).

To determine the response of MdPR-4 gene to the infection ofB. dothidea, the new branches of two-year-old apple trees wereinoculated with conidia of B. dothidea. The warts which character-ized the symptom of ring rot were commonly visible on theinfected branches 26e34 days after inoculation. The temporalexpression of MdPR-4 in the barks was analyzed usingquantitative real time PCR. There was no significant expressionchange of MdPR-4 until 20 days after challenge with B. dothidea.The significantly up-regulated expression of MdPR-4 gene wasobserved 20 to 40 days after inoculation. The highest expressionlevel was observed on the 30th day (8.58 folds, P< 0.001), and thenthe expressionwasmaintained at a relatively high level. No obviousexpression change was detected in the control group throughoutthe whole experiment process (Fig. 3B).

2.4. Effect of phytohormone on MdPR-4 expression

To determine the effect of phytohormone on MdPR-4 geneexpression, we applied SA and MeJA to apple seedling of ‘gala’,respectively. SA and MeJA application significantly induced theaccumulation of MdPR-4 transcripts in leaves. The highestexpression of MdPR-4 appeared at 12 h after SA and MeJA treat-ment, and then, the expression was kept at a relatively high level(Fig. 4A, B). At 12 h after treatment, the relative mRNA expression

was increased to 5.25 folds and 4.74 folds in SA and MeJA treat-ment group, respectively, as compared with that of the control.Further,MdPR-4 expressionwas significantly reduced by treatmentwith diethyldithiocarbamic acid (DIECA), an inhibitor of JAsynthesis. The expression was significantly decreased from 6 hafter DIECA treatment as compared with that of the control andreached the lowest point at 24 h after treatment (Fig. 4D). Andthen, the relatively low expression level was maintained until 48 h.However, no effect on MdPR-4 expression was observed afterapplication of paclobutrazol (PAC), an inhibitor of SA synthesis(Fig. 4C).

2.5. Antifungal activity of recombinant MdPR-4 protein

To test the biological activity of MdPR-4 protein, the recombi-nant protein was prepared using prokaryotic expression system.The recombinant protein analyzed by SDS-PAGE showed a distinctband with a molecular mass of about 20.0 kDawhich correspondedwith the predicted molecular mass of fusion protein (Fig. 5). Afterpurification and removal of the upstream tag sequence, the ob-tained recombinant protein (referred as rMdPR-4) showed a singleband in SDS-PAGE gel.

The rMdPR-4was examined for its antifungal activity with applepathogenic fungi. It demonstrated a dose-dependent inhibitoryeffect on hyphal growth of B. dothidea. With the concentrationincreased, inhibition percentage of hyphal growth was enhancedand the IC50 was 22.6 mg ml�1 (Fig. 6A). The inhibitory effect on twoother apple pathogenic fungi, Valsa ceratosperma and Glomerellacingulata, was also tested to determine whether the antifungalactivity is broad-spectrum or specific for B. dothidea. The resultsshowed that the hyphal growth of the two fungi was also signifi-cantly inhibited by rMdPR-4. The IC50 to V. ceratosperma and G.cingulata were 28.8 mg ml�1 and 40.8 mg ml�1, respectively(Fig. 6B, C).

2.6. Ribonuclease activity of recombinant MdPR-4

To examine the nuclease activity of MdPR-4 protein, rMdPR-4protein was tested for its ability to digest DNA and RNA. Obviouscleavage of single strand RNAwas visible in gel after incubatedwithrMdPR-4. However, no degradation was observed in double RNAand lDNA incubated with different concentration of rMdPR-4.Reduced RNA degradation was observed in the presence of 50-ADP, a powerful inhibitor of ribonuclease activity (Fig. 7).

To further investigate the correlation between antifungalactivity of MdPR-4 and its ribonuclease activity, pathogenic fungiV. ceratosperma, B. dothidea and G. cingulata were cultured in thepresence of rMdPR-4 and 50-ADP. The presence of 50-ADP signifi-cantly improved the hyphal growth (Figs. 8 and 9). The hyphalgrowth inhibition percentage caused by 40 mg ml�1 rMdPR-4decreased to 0.28, 0.23, and 0.15 folds, respectively, in the pres-ence of 50-ADP as compared with that of control fungi culturedwithout 50-ADP.

3. Discussion

In the present study, a new apple gene responding to B. dothideainfection was identified from the bark of two-year-old applebranches. The putative amino acid sequence exhibited high simi-larity to PR-4 proteins identified from other plant species. More-over, the protein contains a Barwin domain which was a highlyconserved structural feature of PR-4 protein [20,22,26]. Thesequence alignment and structural analysis collectively indicatedthat MdPR-4 is a new member of PR-4 family. For lack of cysteine-rich sequence, MdPR-4 protein have no fungi binding activity

StWIN1 - - M V K L I S N S T I L L S L F L F S I A A I A N A Q Q C G R Q K G G A L C S G N L C C S Q F G W C G S T P E F C S P S - 59HbHEVEIN - - - - - - - - - - M N I F I V V L L C L T G V A I A E Q C G R Q A G G K L C P N N L C C S Q W G W C G S T D E Y C S P D - 51WHEATWIN1 - - - - - - M A A R P M L V V A L L C A A A A A A T A Q Q - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 23

VvPR-4 - - - - - - M E R R G I C K V V V L L S L V A C A A A Q S - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 23SLPR-4 - - M E R V N - - K L C V A F F V I N M M M A V A A A Q S - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 25NtPR-4A - - M E R V N N Y K L C V A L L I I S M V M A M A A A Q S - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 27MdPR-4 - M A G K I T A S S V L F V S I M I C G L V G S A L G Q S - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 28

StWIN1 - Q G C Q S R C T G T G G S T P T P S G S A Q N V R A T Y H I Y N P Q N V G W D L N - - A V S A Y C S T W D A N K P L S W - 117HbHEVEIN - H N C Q S N C K D S G - - E G V G G G S A S N V L A T Y H L Y N S Q D H G W D L N - - A A S A Y C S T W D A N K P Y S W - 107WHEATWIN1 - - - - - - - - - - - - - - - - - - - - - A T N V R A T Y H Y Y R P A Q N N W D L G A P A V S A Y C A T W D A S K P L S W - 63

VvPR-4 - - - - - - - - - - - - - - - - - - - - - A S N V R A T Y H Y Y N P E Q N G W D L N - - A V S A Y C S T W D A S Q P L A W - 61SLPR-4 - - - - - - - - - - - - - - - - - - - - - A T N V R A T Y H L Y N P Q N I N W D L R - - T A S V Y C A T W D A D K P L E W - 63NtPR-4A - - - - - - - - - - - - - - - - - - - - - A T N V R S T Y H L Y N P Q N I N W D L R - - A A S A F C A T W D A D K P L A W - 65MdPR-4 - - - - - - - - - - - - - - - - - - - - - A T N V R A T Y H L Y N P Q Q N N Y D L R - - A V S A Y C A T W D A D K S L E W - 66

∗ ΔStWIN1 - R K K Y G W T A F C G P V G P R G R D S C G K C L R V T N T R T G A Q T T V R I V D Q C S N G G L D L D V N - V F R Q I - 176

HbHEVEIN - R S K Y G W T A F C G P V G A H G Q P S C G K C L S V T N T G T G A K T T V R I V D Q C S N G G L D L D V N - V F R Q L - 166WHEATWIN1 - R S K Y G W T A F C G P A G A H G Q A S C G K C L Q V T N P A T G A Q I T A R I V D Q C A N G G L D L D W D T V F T K I - 123

VvPR-4 - R S K Y G W T A F C G P S G P T G Q A A C G K C L S V T N T A T G T Q A T V R I V D Q C S N G G L D L D S G - V F N K L - 120SLPR-4 - R R R Y G W T A F C G P A G P T G Q A S C G R C L R V T N T G T G T Q E T V R I V D Q C R N G G L D L D V N - V F N R L - 122NtPR-4A - R Q K Y G W T A F C G P A G P R G Q V S C G R C L R V T N T G T G T Q T T V R I V D Q C S N G G L D L D V N - V F N Q L - 124MdPR-4 - R S K Y G W T A F C G P A G P T G Q A A C G R C L L V T N T R T G A Q A T V R I V D Q C S N G G L D L D V N - V F N Q I - 125

ΔΔΔΔStWIN1 - D T D G N G N H Q G H L I V N Y Q F V D C G D N - - - - - - - - - - - - - - 200

HbHEVEIN - D T D G K G Y E R G H L T V N Y Q F V D C G D S F N P L F S V M K S S V I N 204WHEATWIN1 - D T N G I G Y Q Q G H L N V N Y Q F V D C R D - - - - - - - - - - - - - - - 146

VvPR-4 - D T N G A G Y N Q G H L I V N Y E F V D C G D - - - - - - - - - - - - - - - 143SLPR-4 - D T N G L G Y Q R G N L N V N Y E F V N C - - - - - - - - - - - - - - - - - 143NtPR-4A - D T N G V G Y Q Q G H L T V N Y E F V N C N D - - - - - - - - - - - - - - - 147MdPR-4 - D T D G S G Y Q Q G H L M V N Y D F V D C G D - - - - - - - - - - - - - - - 148

∗ Δ

Fig. 2. Amino acid sequence alignment of MdPR-4 protein with other PR-4 proteins. Identical amino acids are in white letters with black background, and gray background indicates high levels of amino acid similarity. The black lineindicates N terminus cysteine-rich domain, the triangles (D) indicate conserved cysteine residues required for forming intra-disulfide linkages and asterisks (*) indicate conserved histidine residues required for nuclease activity. Gapsare indicated by dashes to improve the alignment. MdPR-4 represents for PR-4 protein of M. domestica, StWIN1 (P09761.1) for WIN1 protein of S. tuberosum, HbHEVEIN (AAO63574.1) for hevein protein of Hevea brasiliensis, Wheatwin1(O64392.1) for PR-4 protein of T. aestivum, VvPR-4 (AAC33732.1) for PR-4 protein of V. vinifera, SLPR-4 (NP_001234083) for PR-4 protein of S. lycopersicum and NtPR-4A (CAA41437.1) for PR-4 protein of N. tabacum.

S.Baiet

al./Plant

Physiologyand

Biochemistry

62(2013)

23e32

26

0

0.5

1

1.5

2

2.5

3

3.5

4

4.5

Leaves Flower Young fruit Root Young bark Bud

Tissues

Ral

tive

expr

essi

on o

f M

dPR

-4 m

RN

A

*

*

0

1

2

3

4

5

6

7

8

9

10

0 5 10 15 20 25 30 32 34 36 38 40

Time post inoculation (days)

Rel

ativ

e ex

pres

sion

of

MdP

R-4

mR

NA

*

*

* *

**

*

*

A

B

Fig. 3. mRNA expression of MdPR-4 gene revealed by quantitative real time PCR. A, therelative expression of MdPR-4 gene in different tissues; B, temporal expression profileof MdPR-4 transcript in young bark after challenge with B. dothidea. b-actin gene wasused as an internal control. Error bars represent the standard deviation from fivereplicated experiments and asterisks indicate significantly different expression(P < 0.05) compared with that of calibrator samples.

6.5

14.3

20.1

29.0

44.3

66.4

116200

6.5

14.3

20.1

29.0

44.3

66.4

116200

97.2 97.2

M P1 C I1 I2 M P2

Fig. 5. SDS-PAGE analysis of recombinant MdPR-4 protein. Protein samples wereresolved with 15% polyacrylamide gel and each well was loaded with about 8 mg ofprotein sample. Lane M: protein molecular weight standards (kDa); Lane C: negativecontrol for recombinant MdPR-4 (without induction); Lane I1 and I2: IPTG inducedrecombinant MdPR-4 fusion protein; Lane P1: purified recombinant MdPR-4 fusionprotein; Lane P2: purified recombinant MdPR-4 cleaved off the upstream 43 amino acidresidues of fusion protein with enterokinase. The arrows indicate the recombinantMdPR-4 protein band.

S. Bai et al. / Plant Physiology and Biochemistry 62 (2013) 23e32 27

mediated by N-terminal cysteine-rich domain as the case in theclass I protein of PR-4 family.

Examining the expression of MdPR-4 gene is helpful in under-standing its physiological function. Quantitative real time PCR

0

1

2

3

4

5

6

7

8

0 3 6 12 24 36 48

Time of the treatment (h)

Rel

ativ

e ex

pres

sion

of

MdP

R-4

mR

NA c

cd

bd bdb

a a

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

0 3 6 12 24 36 48

Time of the treatment (h)

Rel

ativ

e ex

pres

sion

of

MdP

R-4

mR

NA

A

C

Fig. 4. The relative expression of MdPR-4 mRNA in leaves of apple plantlets after different c48 h after treatment with (A) 1 mM SA; (B) 0.1 mM MeJA; (C) 0.1 mM PAC; (D) 1 mM DIECdifferent letters indicated significant difference (P < 0.05).

revealed that MdPR-4 mRNA was found to be expressed in allexamined tissues of M. domestica. The widespread expressionpattern suggested that MdPR-4 may play multiple physiologicalfunctions as other reported PR-4 genes [23,24,27]. The higher

0

1

2

3

4

5

6

7

0 3 6 12 24 36 48

Time of the treatment (h)

Rel

ativ

e ex

pres

sion

of

MdP

R-4

mR

NA

c

bb

bb

aa

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

0 3 6 12 24 36 48

Time of the treatment (h)

Rel

ativ

e ex

pres

sion

of

MdP

R-4

mR

NA

b bb b

b

a a

B

D

hemical treatment. The leaves were collected from apple plantlets at 0, 3, 6, 12, 24, 36,A. Error bars represent the standard deviation from three replicated experiments and

-5

5

15

25

35

45

55

65

75

85

95

105

115

0 5 10 15 20 25 30 35 40 45 50 55

Protein concentration (µg/ml)

Gro

wth

inhi

bito

ry p

erce

ntag

e (%

)

rMdPR-4

BSA

-10

0

10

20

30

40

50

60

70

80

90

100

110

0 5 10 15 20 25 30 35 40 45 50 55

Protein concentration (µg/ml)

Gro

wth

inhi

bito

ry p

erce

ntag

e (%

)

rMdPR-4

BSA

-10

0

10

20

30

40

50

60

70

80

0 5 10 15 20 25 30 35 40 45 50 55

Protein concentration (µg/ml)

Gro

wth

inhi

bito

ry p

erce

ntag

e (%

)

rMdPR-4

BSA

A B

C

Fig. 6. Antifungal activity analysis of recombinant MdPR-4 protein with BSA as control. Dose-response curves were determined at 8 h after incubation of pathogenic fungi spores inhalf strength PDB supplemented with different concentration of rMdPR-4 or BSA and show the inhibition of rMdPR-4 to (A) B. dothidea; (B) V. ceratosperma; (C) G. cingulata. Growthinhibition percentage was expressed as (OD value of control � OD value of sample)/OD value of control � 100%.

Fig. 7. Ribonuclease activity of rMdPR-4 revealed by agarose gel electrophoresis. 1 mgsynthesized single strand RNA specific for GFP gene was incubated with 1 mg rMdPR-4(1), 2 mg rMdPR-4 (2), 0 mg rMdPR-4 (3), 1 mg rMdPR-4 and 5 mM 50-ADP (4), 1 mgrMdPR-4 and 10 mM 50-ADP (5) and 10 mM TriseHCl, pH 7.5 in a 20 ml reactionmixture at 37 �C for 30 min.

S. Bai et al. / Plant Physiology and Biochemistry 62 (2013) 23e3228

expression level inflower suggested thatMdPR-4mayalso playa rolein thedevelopmentoffloral organ,which is similar to someother PRssuchas PR-10, PR-1 andPR-2whichhave also been found tobehighlyexpressed in floral organ and PR-2 has been reported to be necessaryfor normal pollen development [7]. Although a relative lower levelexpressionwas observed in bark, the infection site of B. dothidea, theexpression in bark could be induced by B. dothidea infection. Asprevious reports thatPR-4 genes could be induced in different plantspecies by fungal infection or other stimuli [19,24], the expression ofMdPR-4 gene could also be up-regulated by B. dothidea. The highmRNA accumulation in the tissues infected by B. dothidea suggestedthat this gene is involved in the defense responses of apple plantagainst B. dothidea infection. As revealed by quantitative RT-PCR,there were two distinct phases observed in the expression ofMdPR-4 in response toB. dothidea infection. In thefirst phase, rangingfrom 0 to 20 days, no significant changewas observed in the relativeexpression of MdPR-4 gene. This period was consistent with latentperiod of ring rot disease, suggesting that tissues damage had notoccurred at this phase. As time progressed, at about 20e30 days afterchallenge, drastic increase ofMdPR-4 transcript was detected. It wasspeculated that during this period, live fungi grew quickly and theinfection signalwas transported into cell to activate the transcriptionof MdPR-4. Subsequently, the expressed MdPR-4 protein wasinvolved in the defence against fungal infection.

Fig. 8. Inhibition effect of rMdPR-4 on B. dothidea growth revealed by optical microscopy (20� objective). B. dothidea spores were incubated in half strength PDB (A); in half strengthPDB containing 40 mg ml�1 rMdPR-4 (B); or in half strength PDB containing 40 mg ml�1 rMdPR-4 and 10 mM 50-ADP (C) at 25 �C for 8 h.

S. Bai et al. / Plant Physiology and Biochemistry 62 (2013) 23e32 29

It is generally assumed that the recognition of the pathogeninitiates the host response which, in turn, leads to up-regulation ofPR gene expression [28,29]. This process is regulated by phyto-hormones via SA or JA signaling pathway [30e32]. The data pre-sented in this paper demonstrated that MdPR-4 gene expressioncould be strongly induced by MeJA and SA treatment. Similarresults have been already reported in wheat [27], tomato [33] ortobacco plant [34] where PR-4 genes are induced by both exoge-nous MeJA and SA treatments. The results suggested that theexpression of MdPR-4 may utilize both SA and JA signal trans-duction pathways. This point of view is supported by the fact thatthe SA and JA signaling pathways share some common components[35]. Different effect of PAC and DIECA on MdPR-4 gene expression

0

20

40

60

80

100

120

V. ceratosperma B. dothidea G. cingulata

Gro

wth

inhi

bito

n pe

rcen

tage

(%

)

40 µg/ml rMdPR-4; 40 µg/ml rMdPR-4+10mM 5'-ADP; 10mM 5'-ADP

aa

b

c

b

c

a

bc

Fig. 9. Effect of 50-ADP on the antifungal activity of rMdPR-4. V. ceratosperma,B. dothidea and G. cingulata were cultured in half-strength PDB containing 40 mg ml�1

rMdPR-4 with or without the presence of 10 mM 50-ADP at 25 �C for 8 h. Pathogenicfungi cultured in half-strength PDB containing 10 mM 50-ADP were used as control.The fungal growth inhibition was evaluated by measuring the absorbance at 595 nm.Different lowercase letters indicated significant difference (P < 0.05).

suggested that MdPR-4 expression may depend on JA signaltransduction pathway more than SA signal pathway.

The biological activities of PRs are the base of their functions inplant defense responses. In vitro assays, recombinant MdPR-4exhibited strong antifungal activity. The antifungal activity wassimilar to that of wheatwin1 which inhibited hyphal growth ina dose-dependant way [26], suggesting that MdPR-4 defense hostagainst B. dothidea infection by directly inhibiting the pathogengrowth. Moreover, MdPR-4 protein is a broad-spectrum antifungalprotein rather than specific for B. dothidea. Two other apple path-ogenic fungi were also significantly inhibited by rMdPR-4. Theantifungal activity was also reported previously in other PR-4proteins from either class II [18,26] or class I of PR-4 family[21,36e39], but the antifungal mechanism of class II proteins stillremains unclear. For lack of N-terminal cysteine-rich domain, theantifungal activities of class II proteins are different from that ofclass I proteinswhich need the presence of cysteine-rich domain fortheir antifungal activity [38,39]. Caruso et al. [26] reported that theantifungal activity ofwheatwin1 andwheatwin2 are related to theirribonuclease activity. MdPR-4 is structurally similar to wheatwin1,and the data present here indicated that MdPR-4 protein also hasribonuclease activity related with its antifungal activity.

Recombinant MdPR-4 exhibited obvious ribonuclease activityfor single strand RNA, but not for double strand RNA. Different fromthat of PR-4 from Capsicum chinense reported previously [20], noDNase activity was observed in MdPR-4. The ribonuclease activitycould be inhibited by 50-ADP and its antifungal activity could bereduced by 50-ADP, indicating that the antifungal activity of MdPR-4is associated with its ribonuclease activity. The result is comparablewith that observed in wheatwin1 [26].

In conclusion, the new apple defense gene MdPR-4 was identi-fied in the present study which could be induced to accumulate inbark of apple tree by B. dothidea infection. Its recombinant proteinhas ribonuclease activity specific for single strand RNA and exhibits

S. Bai et al. / Plant Physiology and Biochemistry 62 (2013) 23e3230

significant inhibition to the growth of pathogenic fungi. Moreover,the antifungal activity of MdPR-4 is related to its ribonucleaseactivity. The data presented here indicate that MdPR-4 is involvedin the defense responses of M. domestica against B. dothideainfection by directly inhibiting the hyphal growth.

4. Materials and methods

4.1. Pathogenic fungi and plant materials

4.1.1. Pathogenic fungiThree apple pathogenic fungi used in the present study were

B. dothidea, V. ceratosperma and G. cingulatawhich were isolated bythe Laboratory of Phytopathology in Qingdao Agricultural Univer-sity. B. dothidea, the pathogenic fungus causing ring rot [1] byinfecting the bark of apple tree and fruits in a compatible interac-tion, were used for inoculation in the present study. V. ceratospermaand G. cingulata, the pathogens of apple canker [40] and Glomerellaleaf spot of apple [41], respectively, were used in the present studyto test antifungal activity of MdPR-4 protein.

For preparation of inocula, an isolate of B. dothidea, strain No.040301 was grown on potato dextrose agar (PDA) at 25 �C underalternating 12 h near ultraviolet light and 12 h white light to inducesporulation. Mature pycnidia were collected and crushed in sterile-distilled water. The resultant suspension was then filtered succes-sively through three layers of glass wool to remove debris andcentrifuged at 13,000� g for 2 min afterward, the pellet wasresuspended in sterile-distilled water and conidia were quantified.

4.1.2. Plant materials and treatmentTwo-year-old apple trees of ‘Jinguan’ grafted on Malus robusta

rootstock were grown in a greenhouse under natural daylightconditions. A set of 40 trees with equal vigor were divided into 2groups and used for the inoculation experiments. One group wasinoculated with B. dothidea by spraying with conidia suspensionand another group was used as control which was mock-infectedwith equal volume of sterile distilled water.

Before inoculation, the inoculation sites (10 cm long segment ofnew branches) were disinfected with 75% ethanol and woundedwith pins. Afterward, the 10-cm-long segments of new brancheswere inoculated by a spray of 5 ml suspension containing 1 � 106

conidia in water and wrapped with plastic bags to maintainhumidity for at least 24 h. The branches used as control weretreated with sterile distilled water using the same procedure.Young barks of inoculated branches were collected for RNA isola-tion at 0, 5, 10, 15, 20, 25, 30, 32, 34, 36, 38, 40 day after inoculation,respectively.

For chemical treatment, in vitro shoot cultures of apple ‘Gala’were grown on MS medium containing 1.0 mg L�1 6-BA, 0.1 mg L�1

NAA, 30 g L�1 sucrose and 8 g L�1 agar at 25 �C with a 16 hphotoperiod, and subcultured at a 4-week interval. Shoot culturessubcultured for 3-week-old were transferred to root-inducingmedium (1/2 MS medium plus 3 mg L�1 IBA, 20 g L�1 sucrose,8 g L�1 agar, pH 5.8) to induce root generation. The rooted plantletswere then transferred to the pot containing nursery soil for furtherculture. Plantlets cultured for 10 days in nursery soil were used forchemical treatment by spraying with 1 mM SA (Sigma, USA) plus0.1% (v/v) Tween-20, 0.1mMmethyl jasmonate (MeJA, Bio Basic Inc,Canada) plus 0.1% Tween-20, 0.1 mM PAC (Sigma, USA), or 1 mMDIECA (Sigma, USA) plus 0.1% (v/v) Tween-20, respectively. Inparallel, the apple shoot cultures sprayed with water containing0.1% Tween-20 were used as a control for all treatments. Foreach treatment, 21 seedlings were used and leaves were collected0, 3, 6, 12, 24, 36 and 48 h after spraying for gene expressionanalysis.

4.2. cDNA cloning and sequence analysis

For obtaining the ORF (Open Reading Frame) of PR-4 gene ofapple, the genomic DNA sequence ofMdPR-4 gene was obtained bysearching apple genomic database with wheat PR-4 protein,Wheatwin1 (O64392.1) using TBLASTN program and the ORF waspredicted using FGENESH program (SoftBerry, Inc.). Based onputative ORF sequence, the primers P1 and P2 (Table 1) weredesigned to amplify the coding region which, in turn, was usedto design P3eP6 (Table 1) for obtaining the 30 and 50 end of thecDNA.

Total RNA was extracted from bark of the branches usingRNAprep pure Plant Kit (Tiangen Biotech, China). The first-strandcDNA was synthesized using PrimeScript II 1st Strand cDNASynthesis Kit (Promega, USA) following the user manual. Foramplification of 30 end cDNA, the primer Adaptor-oligo dT(Table 1) was used for transcription reaction to synthesize cDNA.With the resultant cDNA as template, the 30 end cDNA wasamplified using nested PCR with Adaptor as reverse primer and P3,P4 as forward primers, respectively. For amplification of 50 endcDNA, the cDNA (synthesized with primer oligo dT17) was purifiedwith DNA fragment purification kit (TaKaRa) and then treatedwith terminal deoxynucleotidyl transferase, (TdT, TaKaRa) to addthe poly C tail in 50 end according to user manual. The resultantcDNAwas used as template for nested PCR to amplify 50 end cDNA.The nested PCR was performed with primers Adaptor-oligo dG13(Table 1) and Adaptor as forward primers and P5, P6 as reverseprimers, respectively. The full length cDNA sequence of PR-4 ofapple was obtained by assembling 30 and 50 end cDNA sequencesand coding region of cDNA with AlignX program. The assembledfull-length cDNA was verified by PCR amplification with primerP7 and P8.

Protein sequence similarity analysis was performed with BLASTalgorithm (http://www.ncbi.nlm.nih.gov/blast). ClustalW program(http://www.ebi.ac.uk/clustalw/) and Multiple Alignment Showprogram (http://www.bio-soft.net/sms/index.html) were used formultiple sequence alignment. The structural feature of MdPR-4protein was analyzed with the Expert Protein Analysis System(http://www.expasy.org/) and Simple Modular ArchitectureResearch Tool (http://smart.embl-heidelberg.de).

4.3. Quantitative analysis of gene expression

Real-time quantitative analysis of MdPR-4 expression wasexecuted using quantitative Real-time PCR. To determine tissuedistribution ofMdPR-4mRNA, six different tissues including leaves,flowers, young barks, roots, buds and young fruits were collectedfrom six-year-old “Jinguan” apple trees for RNA extraction andcDNA synthesis. Young bark collected from two-year-old “Jinguan”apple trees infected by B. dothidea and control trees were used fortemporal expression analysis of MdPR-4 gene. RNA extraction andcDNA synthesis were performed as described above. Quantitativereal-time PCR amplification was conducted using LightCycler� 480SYBR Green I Master in LightCycler� 480 system (Roche,Switzerland) following the manufacturer’s recommended proce-dures. Primers P9 and P10 were used to amplify 250 bp fragment ofMdPR-4 gene for quantitative analysis, and primers P11 and P12 wereused to amplify 108 bp DNA fragment of b-actin gene as internalcontrol. For determining the homogeneity of PCR product, disso-ciation curve was calculated for each sample at the end of each PCRcycle. b-actin gene was used as internal reference to normalize thedifference of total RNA in each reaction mixture. For tissue distri-bution analysis, the tissue with the lowest expression level wasused as calibrator. For temporal expression analysis, the controlsamples collected frommock-infected treeswere used as calibrator.

S. Bai et al. / Plant Physiology and Biochemistry 62 (2013) 23e32 31

Data was analyzed according to the 2�DDCT method [42]. All datarepresented relative mRNA expressed as mean � S.D. The obtaineddata were subjected to one-way analysis of variance (one-wayANOVA) followed by Duncan’s test. Differences were consideredsignificant at P < 0.05.

4.4. Preparation of recombinant MdPR-4 protein

DNA fragment encoding MdPR-4 was amplified with primer P13and P14 from bark cDNA. For convenience of recombination, NcoIand XhoI site was added to the 50 end of the two primers, respec-tively. The resultant PCR product was then subcloned into pMD18-Tsimple vector and transformed into Escherichia coli DH5a. Subse-quently, the pMD18-T simple vector containing MdPR-4 was puri-fied and digested completely with NcoI and XhoI. The digestedproduct was purified and ligated into expression vector pET-30a(þ) which was also digested completely with NcoI and XhoI. Therecombinant pET-30a was then transformed into BL21 (DE3) toexpress MdPR-4 protein. The expressed recombinant protein wasa fusion polypeptide in which a 43-amino acid sequence includingthe 6� His tag peptide derived from pET-30a (þ) expression vectorwas located at the NH2-terminus. The positive clones werescreened by PCR and sequenced to ensure in-frame insertion. Thecorrect positive clones were inoculated into LB broth containing50 mg ml�1 kanamycin and shaking-cultured at 37 �C. When theOD600 of the culture reached 0.6e1.0, isopropyl b-D-1-thiogalactopyranoside (IPTG) was added to the medium at a finalconcentration of 1 mM to induce the expression of target proteinfor 4 more hours at 37 �C.

The recombinant MdPR-4 protein (designated as rMdPR-4) waspurified by a Ni2þ-chelating sepharose column. 400 mM imidazolewas used for elution under denatured condition (8 M urea). Thepurified protein was refolded by six steps dialysis against gradienturea-TBS glycerol buffer (50 mM TriseHCl, 50 mM NaCl, 10% glyc-erol, 2 mM reduced glutathione, 0.2 mM oxide glutathione, 6, 4, 3,2, 1, 0 M urea in each gradient, pH 8.0) and then lyophilized.

To cleave upstream 43-residue N-terminal fusion sequence, thepurified fusion proteins were digested with enterokinase. Thedigested mixtures were re-loaded onto Ni2þ-chelating Sepharosecolumn to remove the fusion peptide. The flow-through proteinswere collected and dialyzed against TBS glycerol buffer. Theconcentration of purified rMdPR-4 was quantified by BCA method[43]. The sequence of the purified recombinant proteinwas verifiedby mass spectrometry.

Expressed and purified recombinant proteins were subjected toSDS-PAGE analysis with 15% polyacrylamide gel and each well wasloaded with about 8 mg of protein sample. Electrophoresis was runfor 2e2.5 h at 4 �C under a voltage corresponding to 15 V/cm.

4.5. Antifungal activity assays

In vitro antifungal activity assays were performed according tothe methods reported by Broekaert et al. [44] with slight modifi-cation. Briefly, 96-well microtiter plates were used for antifungalactivity assay. Each well was filled with 100 ml half strength potatodextrose broth (PDB) containing 2 � 103 fungal spores and serialdiluted recombinant MdPR-4 protein (5e55 mg ml�1). The wellsused for control were filled with the same amount of PDB andspores, as well as 55 mg ml�1 BSA instead of recombinant MdPR-4protein. The microtiter plates were incubated at 25 �C for 8 h,and then hyphal growth inhibitionwas evaluated by measuring theabsorbance at 595 nm and expressed as IC50 (the half maximalinhibitory concentration). The measurement was repeated threetimes and the IC50 was calculated by SPSS16.0. Morphologicalchanges were observed using a light microscope.

4.6. RNase and DNase activity assay

RNase activity was tested with single strand and double strandRNAwhich were synthesized using GFP gene fragment as template.For preparation of double RNA, a pair of GFP-specific primers withT7 promotor sequence in the 50 end (P15 and P16) was used toamplify the GFP gene fragment from pEGFP plasmid. The resultantPCR product containing T7 promotor sequence on both ends waspurified and used as transcription template. For preparation ofsingle strand RNA, P15 and P17 was used to amplify the GFP frag-ment and the resultant PCR product which contained T7 promotorsequence only in 50 end was purified and used as transcriptiontemplate. The transcription reactions were performed usingRiboprobe� System-T7 (Promega, USA) according to manufacture’stechnical manual. The synthesized RNA was purified with a stan-dard phenol/chloroform extraction procedure.

The nuclease activity assay was performed in 20 ml reactionmixtures containing 1 mg synthesized single strand, double strandRNA or lDNA, rMdPR-4 (1 mg, or 2 mg) and 10 mM TriseHCl, pH 7.5.The reaction mixtures were incubated at 37 �C for 30 min and thereaction product was analyzed with 1% agarose gel electrophoresis.To determine if 50-ADP, a potent ribonuclease inhibitor [22,45], caninhibit the nuclease activity of rMdPR-4, the same reactions wereperformed in the presence of 5 mM or 10 mM 50-ADP, respectively.

The correlation between antifungal activity of MdPR-4 and itsribonuclease activity were also examined by adding 50-ADP(10 mM) into the PDB culture medium containing 40 mg ml�1

rMdPR-4 and then measuring hyphal growth as described aboveafter 8 h of incubation at 25 �C.

Acknowledgments

The authors would like to thank Dr. Kai Liu from Institution ofFruit Tree Research, Guangdong Academy of Agricultural Sciencesand Dr. Miao Bai from Hunan Agricultural University for theirtechnical advice. The authors also thank laboratory members forstimulating discussions. The research was supported by ChinaAgricultural Research System (No. CARS-28-01-07), the VarietyImprovement Project of Shandong Province (No. 620902) andQingdao Science and Technology Program (NO. 12-1-4-5-(1)-jch).

References

[1] W. Tang, Z. Ding, Z. Zhou, Y. Wang, L. Guo, Phylogenetic and pathogenicanalyses show that the causal agent of apple ring rot in China is Botryosphaeriadothidea, Plant Dis. 96 (2012) 486e496.

[2] J.D.G. Jones, J.L. Dangl, The plant immune system, Nature 444 (2006) 323e329.[3] J. Zhang, J.M. Zhou, Plant immunity triggered by microbial molecular signa-

tures, Mol. Plant 3 (2010) 783e793.[4] J.S. Venisse, M. Malnoy, M. Faize, J.P. Paulin, M.N. Brisset, Modulation of

defense responses of malus spp. during compatible and incompatibleinteractions with Erwinia amylovora, Mol. Plant Microbe Interact. 15 (2002)1204e1212.

[5] C.M.J. Pieterse, A. Leon-Reyes, S. Van der Ent, S.C.M. Van Wees, Networkingby small-molecule hormones in plant immunity, Nat. Chem. Biol. 5 (2009)308e316.

[6] A. Verhage, S.C.M. van Wees, C.M.J. Pieterse, Plant immunity: it’s thehormones talking, but what do they say? Plant Physiol. 154 (2010) 536e540.

[7] L.C. van Loon, M. Rep, C.M.J. Pieterse, Significance of inducible defense-relatedproteins in infected plants, Annu. Rev. Phytopathol. 44 (2006) 135e162.

[8] L.C. van Loon, W. Pierpoint, T. Boller, V. Conejero, Recommendations fornaming plant pathogenesis-related proteins, Plant Mol. Biol. Rep. 12 (1994)245e264.

[9] J. Bonasera, J. Kim, S. Beer, PR genes of apple: identification and expression inresponse to elicitors and inoculation with Erwinia amylovora, BMC Plant Biol. 6(2006) 23.

[10] A.E. Gau, M. Koutb, M. Piotrowski, K. Kloppstech, Accumulation ofpathogenesis-related proteins in the apoplast of a susceptible cultivar of apple(Malus domestica cv. Elstar) after infection by Venturia inaequalis and consti-tutive expression of PR genes in the resistant cultivar Remo, Eur. J. PlantPathol. 110 (2004) 703e711.

S. Bai et al. / Plant Physiology and Biochemistry 62 (2013) 23e3232

[11] A. Stanford, M. Bevan, D. Northcote, Differential expression within a family ofnovel wound-induced genes in potato, Mol. Gen. Genet. 215 (1989) 200e208.

[12] H.J. Linthorst, N. Danhash, F.T. Brederode, J.A. Van Kan, P.J. De Wit, J.F. Bol,Tobacco and tomato PR proteins homologous to win and pro-hevein lack the“hevein” domain, Mol. Plant Microbe Interact. 4 (1991) 586e592.

[13] S. Potter, S. Uknes, K. Lawton, A. Winter, D. Chandler, J. DiMaio, R. Novitzky,E. Ward, J. Ryals, Regulation of a hevein-like gene in Arabidopsis, Mol. PlantMicrobe Interact. 6 (1993) 680e685.

[14] C. Caruso, C. Caporale, E. Poerio, A. Facchiano, V. Buonocore, The amino acidsequence of a protein from wheat kernel closely related to proteins involvedin the mechanisms of plant defence, J. Protein Chem. 12 (1993) 379e386.

[15] S.C. Lee, Y.J. Kim, B.K. Hwang, A pathogen-induced chitin-binding protein genefrom pepper: its isolation and differential expression in pepper tissues treatedwith pathogens, ethephon, methyl jasmonate or wounding, Plant Cell Physiol.42 (2001) 1321e1330.

[16] C.J. Park, R. Shin, J.M. Park, G.J. Lee, T.H. Yoo, K.H. Paek, A hot pepper cDNAencoding a pathogenesis-related protein 4 is induced during the resistanceresponse to tobacco mosaic virus, Mol. Cells 11 (2001) 122e127.

[17] R. Rompf, G. Kahl, An elicitor-induced cDNA from aerial yam (Dioscorea bul-bifera L.) encodes a pathogenesis-related type 4 protein, Plant Cell Rep. 18(1999) 601e606.

[18] X. Li, B. Xia, Y. Jiang, Q. Wu, C. Wang, L. He, F. Peng, R. Wang, A newpathogenesis-related protein, LrPR4, from Lycoris radiata, and its antifungalactivity against Magnaporthe grisea, Mol. Biol. Rep. 37 (2010) 995e1001.

[19] J.M. Bravo, S. Campo, I. Murillo, M. Coca, B. San Segundo, Fungus- and wound-induced accumulation of mRNA containing a class II chitinase of thepathogenesis-related protein 4 (PR-4) family of maize, Plant Mol. Biol. 52(2003) 745e759.

[20] M.A. Guevara-Morato, M.G. de Lacoba, I. García-Luque, M.T. Serra, Charac-terization of a pathogenesis-related protein 4 (PR-4) induced in Capsicumchinense L3 plants with dual RNase and DNase activities, J. Exp. Bot. 61 (2010)3259e3271.

[21] T.I. Odintsova, A.A. Vassilevski, A.A. Slavokhotova, A.K. Musolyamov,E.I. Finkina, N.V. Khadeeva, E.A. Rogozhin, T.V. Korostyleva, V.A. Pukhalsky,E.V. Grishin, T.A. Egorov, A novel antifungal hevein-type peptide from Triticumkiharae seeds with a unique 10-cysteine motif, FEBS J. 276 (2009) 4266e4275.

[22] L. Bertini, C. Caporale, M. Testa, S. Proietti, C. Caruso, Structural basis of theantifungal activity of wheat PR4 proteins, FEBS Lett. 583 (2009) 2865e2871.

[23] S.B. Altenbach, K.M. Kothari, C.K. Tanaka, W.J. Hurkman, Genes encoding thePR-4 protein wheatwin are developmentally regulated in wheat grains andrespond to high temperatures during grainfill, Plant Sci. 173 (2007) 135e143.

[24] N. Wang, B. Xiao, L. Xiong, Identification of a cluster of PR4-like genesinvolved in stress responses in rice, J. Plant Physiol. 168 (2011) 2212e2224.

[25] C. Caporale, I. Di Berardino, L. Leonardi, L. Bertini, A. Cascone, V. Buonocore,C. Caruso, Wheat pathogenesis-related proteins of class 4 have ribonucleaseactivity, FEBS Lett. 575 (2004) 71e76.

[26] C. Caruso, C. Caporale, G. Chilosi, F. Vacca, L. Bertini, P. Magro, E. Poerio,V. Buonocore, Structural and antifungal properties of a pathogenesis-relatedprotein from wheat kernel, J. Protein Chem. 15 (1996) 35e44.

[27] L. Bertini, L. Leonardi, C. Caporale, M. Tucci, N. Cascone, I. Di Berardino,V. Buonocore, C. Caruso, Pathogen-responsive wheat PR4 genes are inducedby activators of systemic acquired resistance and wounding, Plant Sci. 164(2003) 1067e1078.

[28] I.E. Somssich, K. Hahlbrock, Pathogen defence in plants e a paradigm ofbiological complexity, Trends Plant Sci. 3 (1998) 86e90.

[29] T. Nürnberger, Signal perception in plant pathogen defense, Cell. Mol. Life Sci.55 (1999) 167e182.

[30] B.P.H.J. Thomma, K. Eggermont, I.A.M.A. Penninckx, B. Mauch-Mani,R. Vogelsang, B.P.A. Cammue, W.F. Broekaert, Separate jasmonate-dependentand salicylate-dependent defense-response pathways in Arabidopsis areessential for resistance to distinct microbial pathogens, Proc. Nat. Acad. Sci. U.S. A. 95 (1998) 15107e15111.

[31] B.P.H.J. Thomma, I.A.M.A. Penninckx, B.P.A. Cammue, W.F. Broekaert, Thecomplexity of disease signaling in Arabidopsis, Curr. Opin. Immunol. 13 (2001)63e68.

[32] C.M.J. Pieterse, L.C. van Loon, Salicylic acid-independent plant defence path-ways, Trends Plant Sci. 4 (1999) 52e58.

[33] J.A.L. Kan, T. Cozijnsen, N. Danhash, P.J.G.M. Wit, Induction of tomato stressprotein mRNAs by ethephon, 2,6-dichloroisonicotinic acid and salicylate,Plant Mol. Biol. 27 (1995) 1205e1213.

[34] E.R. Ward, S.J. Uknes, S.C. Williams, S.S. Dincher, D.L. Wiederhold,D.C. Alexander, P. Ahl-Goy, J.P. Metraux, J.A. Ryals, Coordinate gene activity inresponse to agents that induce systemic acquired resistance, Plant Cell 3(1991) 1085e1094.

[35] P.M. Schenk, K. Kazan, I. Wilson, J.P. Anderson, T. Richmond, S.C. Somerville,J.M. Manners, Coordinated plant defense responses in Arabidopsis revealed bymicroarray analysis, Proc. Nat. Acad. Sci. U. S. A. 97 (2000) 11655e11660.

[36] R.R. Shukurov, V.D. Voblikova, A. Nikonorova, R. Komakhin, V.V. Komakhina,T.A. Egorov, E.V.Grishin,A.V. Babakov, Transformationof tobaccoandArabidopsisplants with Stellaria media genes encoding novel hevein-like peptides increasestheir resistance to fungal pathogens, Transgenic Res. 21 (2012) 313e325.

[37] J.C. Koo, S.Y. Lee, H.J. Chun, Y.H. Cheong, J.S. Choi, S.I. Kawabata, M. Miyagi,S. Tsunasawa, K.S. Ha, D.W. Bae, C.D. Han, B.L. Lee, M.J. Cho, Two heveinhomologs isolated from the seed of Pharbitis nil L. exhibit potent antifungalactivity, Biochim. Biophys. Acta 1382 (1998) 80e90.

[38] R.H. Huang, Y. Xiang, X.Z. Liu, Y. Zhang, Z. Hu, D.C. Wang, Two novel antifungalpeptides distinct with a five-disulfide motif from the bark of Eucommiaulmoides Oliv, FEBS Lett. 521 (2002) 87e90.

[39] X. Huang, W.J. Xie, Z.Z. Gong, Characteristics and antifungal activity of a chitinbinding protein from Ginkgo biloba, FEBS Lett. 478 (2000) 123e126.

[40] T. Okuno, S. Oikawa, T. Goto, K. Sawai, H. Shirahama, T. Matsumoto, Structuresand phytotoxicity of metabolites from Valsa ceratosperma, Agric. Biol. Chem.50 (1986) 997e1001.

[41] C.X. Wang, Z.F. Zhang, B.H. Li, H.Y. Wang, X.L. Dong, First report of glomerellaleaf spot of apple caused by Glomerella cingulata in China, Plant Dis. 96 (2012).912e912.

[42] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data usingreal-time quantitative PCR and the 2(-delta delta C(T)) method, Methods 25(2001) 402e408.

[43] P.K. Smith, R.I. Krohn, G.T. Hermanson, A.K. Mallia, F.H. Gartner,M.D. Provenzano, E.K. Fujimoto, N.M. Goeke, B.J. Olson, D.C. Klenk, Measure-ment of protein using bicinchoninic acid, Anal. Biochem. 150 (1985) 76e85.

[44] W.F. Broekaert, F.R.G. Terras, B.P.A. Cammue, J. Vanderleyden, An automatedquantitative assay for fungal growth inhibition, FEMS Microbiol. Lett. 69(1990) 55e59.

[45] D.D. Leonidas, G.B. Chavali, N.G. Oikonomakos, E.D. Chrysina,M.N. Kosmopoulou, M. Vlassi, C. Frankling, K.R. Acharya, High-resolutioncrystal structures of ribonuclease A complexed with adenylic and uridylicnucleotide inhibitors. Implications for structure-based design of ribonucleo-lytic inhibitors, Protein Sci. 12 (2003) 2559e2574.