A Novel Mutation in the 1A Domain of Keratin 2e inIchthyosis Bullosa of Siemens

Meral J. Arin,*† Mary A. Longley,* Ervin H. Epstein, Jr.,‡ Glynis Scott,§¶ Lowell A. Goldsmith,§Joseph A. Rothnagel,*†1 and Dennis R. Roop*†Departments of *Cell Biology and †Dermatology, Baylor College of Medicine, Houston, Texas, U.S.A.; ‡Department of Dermatology, University ofCalifornia, San Francisco, California, U.S.A.; Department of §Dermatology and ¶Pathology, University of Rochester Medical School, Rochester,New York, U.S.A.

Ichthyosis bullosa of Siemens (IBS) is a rare autosomaldominant skin disorder with clinical features similarto epidermolytic hyperkeratosis (EHK). Both diseaseshave been linked to the type II keratin cluster onchromosome 12q. Hyperkeratosis and blister form-ation are relatively mild in IBS compared with EHK,and the lysis of keratinocytes is restricted to the upperspinous and granular layers of the epidermis of IBSpatients, whereas in EHK lysis occurs in the lowerspinous layer. Recently, mutations in the helix initi-ation and termination motifs of keratin 2e (K2e) have

Ichthyosis bullosa of Siemens (IBS) is characterized by mildhyperkeratosis over the flexural areas and blister formationafter mechanical trauma (Traupe et al, 1986). The clinicalfindings resemble those of epidermolytic hyperkeratosis(EHK) and these genodermatoses are often indistinguishable

clinically. In 1937, Siemens made the first distinction between IBSand EHK based on clinical findings. He described localized denudedareas, due to peeling of the outermost layers of the skin, and calledthis appearance the ‘‘molting’’ effect (Siemens, 1937). Histologically,the expanded stratum corneum with acanthokeratolysis is reminis-cent of the features seen in EHK; however, in IBS the cytolysis ofaffected keratinocytes occurs in the granular layer, whereas in EHKcytolysis occurs in spinous layer cells. The major ultrastructuralfinding is a collapsed keratin network with perinuclear distributionin the keratinocytes of the upper spinous and granular layers, similarto the collapsed network seen in other keratin disorders (Traupeet al, 1986).

Keratins comprise the largest and most diverse group of inter-mediate filament proteins and are the major gene products ofkeratinocytes (Steinert and Roop, 1988). Keratin proteins arecoexpressed in specific pairs and form a stable network that is thebasis for the structural integrity of the keratinocyte. Mutations inthe structurally conserved regions of the rod domain are thoughtto impair higher order heteropolymer interactions, thus producing

Manuscript received August 19, 1998; revised October 23, 1998;accepted for publication November 19, 1998.

Reprint requests to: Dr. Dennis R. Roop, Baylor College of Medicine,Department of Cell Biology, One Baylor Plaza, Houston, TX 77030.

Abbreviations: EHK, epidermolytic hyperkeratosis; IBS, ichthyosisbullosa of Siemens.

1Current address: Department of Biochemistry, University ofQueensland, Brisbane, QLD, 4072, Australia.

0022-202X/99/$10.50 · Copyright © 1999 by The Society for Investigative Dermatology, Inc.

380

been described in IBS patients. The majority of themutations reported to date lie in the 2B region. In thisreport, we have examined a large kindred in whichthe disease was originally diagnosed as EHK andmapped to the type II keratin cluster on chromosome12q. Molecular analysis revealed a novel amino acidsubstitution at the beginning of the conserved 1Aregion of the rod domain (I4N) of K2e, resultingfrom a T to A transversion in codon 188. Key words:genodermatosis/ichthyosis bullosa of Siemens/intermediatefilaments/keratin 2e. J Invest Dermatol 112:380–382, 1999

filaments that are prone to collapse (Hatzfeld and Weber, 1991;Steinert et al, 1993).

Keratin 2e (K2e) is expressed in the upper spinous and granularlayers and apparently is integrated into the K1/K10 network (Collinet al, 1992; Reichelt et al, 1997), although its type I partner hasnot been unequivocally identified. Recently, the disease has beenlinked to the type II keratin cluster on chromosome 12q (Steijlenet al, 1994) and mutations in the K2e gene have been identified inIBS patients (Kremer et al, 1994; McLean et al, 1994; Rothnagelet al, 1994; Jones et al, 1997; Yang et al, 1997). Fourteen of the 15reported mutations are located in the 2B region of the rod domain.Here we report a novel mutation in the 1A domain of K2e, whichcauses an isoleucine to asparagine substitution (I4N) due to anATC→AAC transversion.

MATERIALS AND METHODS

DNA purification Genomic DNA was extracted from whole blood asdescribed previously (Rothnagel et al, 1994). Concentration and puritywere assessed by gel analysis and spectrophotometer.

Sequence analysis A 1440 bp fragment spanning the 1A region ofK2e was amplified from genomic DNA. Primers for amplification were59-(CATCATGAGTTGTCAGATCTCTTGC)-39 (sense) and 59-(TCA-CATTGCTGCTGAGGTCT)-39 (anti-sense). Automated fluorescencesequencing was carried out with the sequencing primer 59-(GCTCCCAT-TTGGTCTGTAAC)-39.

Allele specific-polymerase chain reaction (AS-PCR) analysis AS-PCR analysis was performed with following oligonucleotide primers: forthe wild-type allele, 59-(GCCCAAGAGCGTGAGCAGAT)-39 and 59-(ACACCACTGGCTCCTAAGAAATAC)-39; to amplify the mutant allele,we used 59-(GCCCAAGAGCGTGAGCAGAA)-39 and 59-(ACACCAC-TGGCTCCTAAGAAATAC)-39. PCR conditions consisted of 35 cyclesof 30 s at 94°C, 1 min at 60°C, 1 min at 72°C, and a final elongationstep of 15 min at 72°C. PCR products were visualized on a 2% agarose gel.

VOL. 112, NO. 3 MARCH 1999 KERATIN 2E MUTATION IN ICHTHYOSIS BULLOSA OF SIEMENS 381

Figure 1. Pedigree of the IBS family. Circles represent women, squaresrepresent men. Solid symbols denote affected family members, opensymbols indicate unaffected family members.

RESULTS

Clinical and histologic description All affected family mem-bers suffer from generalized IBS. The onset of the disease occurredearly with hyperkeratosis and blistering persisting throughout life.Recurrent infections were a complicating factor. Although thedisease in this family was originally diagnosed as EHK (the familydesignated EHK-Te in the original report; Bonifas et al, 1992), are-examination of the histopathology revealed a thickened stratumcorneum and lysis of upper spinous and granular layer cells, whichwas consistent with a diagnosis of IBS.

Sequence analysis Genomic DNA from individuals I.1, I.2, andII.2 (Fig 1) was used to amplify a 1440 bp fragment in the 1Aregion of keratin 2e. The PCR products were analyzed byautomated fluorescence sequencing. DNA from I.2 and II.2 showedthe transversion of thymidine (T596) to adenosine (A) in theK2e gene, resulting in an asparagine for isoleucine substitution.Sequencing of the PCR product from an unaffected family member(I.1) showed the wild-type sequence at codon 188 (ATC) (Fig 2).

Mutation analysis AS-PCR was carried out to verify the pres-ence of the mutation. Primers specific for the mutant allele andfor the wild-type allele were used. Genomic DNA of affectedfamily members could be amplified with both specific primer pairsindicating a heterozygous genotype (ATC and AAC at codon 188)(Fig 3). Genomic DNA of unaffected family members only gaverise to PCR products with the wild-type allele primer pair(Fig 3). To determine whether the I4N substitution was a normalpolymorphic variant at this residue, we used this same AS-PCRassay to screen the DNA of 50 normal individuals. PCR productswere only observed in reactions containing the wild-type alleleprimer pair (data not shown). Thus, the mutant allele cosegregateswith expression of the disease phenotype, and it does not representa rare polymorphism in the K2e gene.

DISCUSSION

All affected members of this family exhibited a generalized pheno-type that was initially diagnosed as EHK. In addition, the diseasewas mapped to the region of chromosome 12q that contains thetype II keratin gene cluster (Bonifas et al, 1992). After our initialmolecular analysis failed to detect mutations in K1, we examinedK2e, another type II keratin in the gene cluster on chromosome12q, which we had previously discovered to be mutated in otherfamilies that were initially diagnosed with EHK (Rothnagel et al,1994). This analysis revealed a point mutation at codon 188 at thebeginning of the 1A region of the rod domain of K2e, whichcauses an asparagine for isoleucine substitution. Although mutationsin this position of the 1A region have frequently been observed intype I keratins in other genodermatoses (Corden and McLean,1996), this is the first report of an alteration at this particular residuein a type II keratin.

The alpha-helical structure of the rod domain is determined bya seven residue, repeating sequence termed a heptad repeat. The

Figure 2. Analysis of the sequence encoding the 1A region ofkeratin 2e. The I to N substitution at position 188 (numbering accordingto Collin et al, 1992) is marked by an arrow.

Figure 3. AS-PCR of affected and unaffected family members.Amplification products with wild-type primers and primers specific for themutant allele are shown. Both primer pairs amplify a 180 bp fragment.

382 ARIN ET AL THE JOURNAL OF INVESTIGATIVE DERMATOLOGY

amino acid positions within this heptad repeat are denoted asabcdefg, with mainly hydrophobic residues at positions a and d andpolar residues at the other positions. Hydrophobic interactions andhydrogen bonds between two parallel keratin protein chains, whichinvolve residues a and d and e and g, respectively, are thought tostabilize the two-chain coiled-coil molecule (Steinert, 1993). Theaffected isoleucine residue resides in the a position of the firstheptad, and is absolutely conserved in all type II keratins. Thisisoleucine residue is located at the beginning of the helix initiationmotif, which comprises the first 15 residues of the 1A region.These residues are highly conserved and form the predictedmolecular overlap between neighboring coiled-coil heterodimers(Steinert et al, 1993). The interactions between residues of theoverlapping regions are critical for the maintenance of the structuralintegrity of keratin intermediate filaments, and any alteration inthese regions would be expected to seriously impair the lateralassembly of parallel molecules. The substitution of a polar (aspara-gine) for a hydrophobic amino acid (isoleucine) at position 4 (I4N)in the helix initiation motif would be expected to hinder theformation of a regular two-strand coiled-coil in this crucial partof the molecule and diminish interactions between overlappingheterodimers.

Although it is difficult to predict the severity of the phenotypefrom the location of the mutation/substitution, it is interesting thatthe phenotype described here was more severe than that usuallyobserved in IBS and therefore initially led to the diagnosis of EHK.Only one other K2e 1A point mutation has been reported, aproline to glutamine substitution at position 187, which is adjacentto the residue described in this study (Kremer et al, 1994). Thedisease phenotype was similar to the phenotype reported here. Allof the 14 other mutations that have been reported in K2e arelocated within the 2B region (Kremer et al, 1994; McLean et al,1994; Rothnagel et al, 1994; Jones et al, 1997; Yang et al, 1997).

To date, no correlation exists between the location of mutationsand the disease phenotype in IBS (Corden and McLean, 1996).Unlike other keratin diseases, where the majority of mutations,especially those associated with a severe phenotype, lie within the1A region, 2B mutations are more common in K2e. The smallnumber of mutations reported to date in K2e, however, do notallow any conclusions regarding a phenotype-genotype correlation.Thus, an extension of the current catalog of K2e mutations isnecessary to enhance our understanding of this disease.

We appreciate the interest and participation of the family members in this study.M.J.A. was supported by a fellowship from the Deutsche Forschungsgemeinschaftand J.A.R. was supported by a Career Development Award from the DermatologyFoundation, sponsored by Ortho Pharmaceuticals Inc. This work was supported byNIH grant (HD25479) to D.R.R.

REFERENCESBonifas JM, Bare JW, Chen MA, Lee MK, Slater CA, Goldsmith LA, Epstein EH:

Linkage of the epidermolytic hyperkeratosis phenotype and the region of thetype II keratin gene cluster on chromosome 12q. J Invest Dermatol 99:524–527, 1992

Collin C, Moll R, Kubicka S, Ouhayoun J-P, Franke WW: Characterization ofhuman cytokeratin 2, an epidermal cytoskeletal protein synthesized late duringdifferentiation. Exp Cell Res 202:132–141, 1992

Corden LD, McLean WHI: Human keratin diseases. Hereditary fragility of specificepithelial tissues. Exp Dermatol 5:297–307, 1996

Hatzfeld M, Weber K: Modulation of keratin intermediate filament assembly bysingle amino acid exchanges in the consensus sequence of the C-terminal endof the rod domain. J Cell Sci 99:351–362, 1991

Jones DO, Watts C, Mills C, Sharpe G, Marks R, Bowden PE: A new keratin 2emutation in ichthyosis bullosa of Siemens. J Invest Dermatol 108:354–356, 1997

Kremer H, Zeeuwen P, McLean WHI, et al: Ichthyosis bullosa of Siemens is causedby mutations in the keratin 2e gene. J Invest Dermatol 103:286–289, 1994

McLean WHI, Morley SM, Lane EB, et al: Ichthyosis bullosa of Siemens: a diseaseinvolving keratin 2e. J Invest Dermatol 103:277–281, 1994

Reichelt J, Bauer C, Porter RM, Lane EB, Herzog V, Magin TM: Out of balance:consequences of a partial keratin 10 knockout. J Cell Sci 110:2175–2186, 1997

Rothnagel JA, Traupe H, Wojcik S, et al: Mutations in the rod domain of keratin2e in patients with ichthyosis bullosa of Siemens. Nature Genetics 7:485–490, 1994

Siemens HW: Dichtung und Wahrheit uber die ‘‘Ichthyosis bullosa’’ mit Bemerkungenzur Systematik der Epidermolysen. Arch Dermatol Syph (Berl) 175:590–608, 1937

Steijlen PM, Kremer H, Vakilzadeh F, Happle R, Lavrijsen APM, Ropers HH,Mariman ECM: Genetic linkage of the keratin type II gene cluster withichthyosis bullosa of Siemens and with autosomal dominant ichthyosisexfoliativa. J Invest Dermatol 103:282–285, 1994

Steinert PM: Structure, function, and dynamics of keratin intermediate filaments.J Invest Dermatol 100:729–734, 1993

Steinert PM, Marekov LN, Fraser RDB, Parry DAD: Keratin intermediate filamentstructure: crosslinking studies yield quantitative information on moleculardimensions and mechanisms of assembly. J Mol Biol 230:436–452, 1993

Steinert PM, Roop DR: Molecular and cellular biology of intermediate filaments.Ann Rev Biochem 57:593–625, 1988

Traupe H, Kolde G, Hamm H, Happle R: Ichthyosis bullosa of Siemens: a uniquetype of epidermolytic hyperkeratosis. J Am Acad Dermatol 14:1000–1005, 1986

Yang J-M, Lee S, Bang H-D, Kim W-S, Lee E-S, Steinert PM: A novel threonineto proline mutation at the end of the 2B rod domain in the keratin 2e chainin ichthyosis bullosa of Siemens. J Invest Dermatol 109:116–118, 1997