A novel deletion of the l-ferritin iron-responsive element

responsible for severe hereditary hyperferritinaemia–cataract

syndrome

Mario Cazzola,1

Barbara Foglieni,2

Gaetano Bergamaschi,1

Sonia Levi,3

Mario Lazzarino1

and Paolo Arosio4 1Division of Haematology, University of Pavia Medical School, IRCCS Policlinico S. Matteo,

27100 Pavia, 2Unit of Genetics and Molecular Diagnosis and 3Unit of Protein Engineering, IRCCS H. S. Raffaele,

Via Olgettina 58, 20132 Milan, and 4Department of Chemistry, University of Brescia School of Medicine, Italy

Received 5 July 2001; accepted 5 September 2001

Summary. In the last few years, mutations that causedisease through increased efficiency of mRNA translationhave been discovered. Hereditary hyperferritinaemia–cata-ract syndrome (HHCS) arises from various point mutationsor deletions within the iron-responsive element (IRE) in the5¢-UTR of the l-ferritin mRNA. Each unique mutationconfers a characteristic degree of hyperferritinaemia andseverity of cataract in affected individuals. We report anovel six-nucleotide deletion identified in an Italian familypresenting with elevated serum ferritin and early onsetbilateral cataract. This deletion involves a sequence with a

TCT repetition and may have occurred through a mech-anism of slippage mispairing. Because of the above repetition,the observed mutation can be interpreted as deletion 22–27,23–28, 24–29 or 25–30. Structural modelling predicted anIRE stem modification that is expected to markedly reducethe binding to iron-regulatory proteins. A double-gradientdenaturing gradient gel electrophoresis (DG-DGGE) methodeasily detected the above deletion.

Keywords: cataract, ferritin, iron, lens, mRNA translation.

Hereditary hyperferritinaemia–cataract syndrome (HHCS) isa genetic disorder inherited as an autosomal dominant traitand characterized by elevated serum ferritin not related toiron overload and by early onset nuclear cataract (Girelliet al, 1995a). HHCS arises from various point mutations ordeletions within a regulatory sequence in the 5¢-UTR offerritin light-chain mRNA known as iron-responsiveelement (IRE). These lesions reduce the IRE affinity foriron-regulatory proteins (IRPs) that repress ferritin mRNAtranslation. Each unique mutation confers a characteristicdegree of hyperferritinaemia and severity of cataract inaffected individuals (Cazzola et al, 1997).

There are two identified IRPs in humans, IRP1 and IRP2,that have different biological properties. The mutationsresponsible for HHCS impair the IRE affinity for both IRP1and IRP2, suggesting that this dual impairment is requiredfor in vivo loss of translational repression. Evaluation ofin vitro affinity of the IRPs for the mutant IREs from HHCSpatients has shown a close relationship between decreases

in binding affinity and clinical severity (Allerson et al,1999). Thermodynamic analysis of these IREs has alsorevealed that while some HHCS mutations lead to changesin the stability and secondary structure of the IRE, othersappear to disrupt IRP/IRE recognition with minimal effecton IRE stability. Thus, in spite of considerable clinicalheterogeneity, HHCS severity de facto relates to loss of IRP/IRE affinity.

Most of the IRE mutations responsible for HHCS are pointmutations and only three deletions have been reported sofar (Cremonesi et al, 2001; Giansily et al, 2001). In thispaper we describe a novel six-base deletion identified in anItalian family presenting with elevated serum ferritin andsevere bilateral cataract.

PATIENT AND METHODS

A 41-year-old-woman was found to have serum ferritinlevels of 1200–1400 lg/l. Blood cell counts and acute-phase reactants were normal. A complete evaluation ofbody iron status showed that serum iron, transferrinsaturation and soluble transferrin receptor levels werenormal. She was referred to the Division of Haematology,

Correspondence: Professor Mario Cazzola, Division of Haematology,IRCCS Policlinico S. Matteo, 27100 Pavia, Italy. E-mail: m.cazzola@

iol.it

British Journal of Haematology, 2002, 116, 667–670

Ó 2002 Blackwell Science Ltd 667

University of Pavia Medical School, IRCCS PoliclinicoS. Matteo, Pavia, Italy. She reported to have undergonesurgery for bilateral congenital cataract at the age of 44,and the family history revealed that her mother alsounderwent surgery for the same problem.

Informed consent was obtained for genetic studies.Genomic DNA was isolated from peripheral blood samplesaccording to standard procedures. The entire IRE sequenceof the l-subunit gene was amplified by polymerase chainreaction (PCR). The double-gradient denaturing gradient gelelectrophoresis (DG-DGGE) method has been previouslydescribed in detail (Cremonesi et al, 2001). Direct sequenc-ing was carried out in both directions using fluorescentdideoxy chain terminator cycle sequencing on a Abi Prism377 DNA sequencer (Perkin-Elmer, Milan, Italy).

An improved dynamic programming algorithm (Mathewset al, 1999) was employed for RNA secondary structureprediction by free energy minimization.

RESULTS

The combination of isolated hyperferritinaemia and bilateralcataract and familiarity for early onset cataract suggestedthat our proband had hereditary hyperferritinaemia–cata-ract syndrome. To test this hypothesis we employed theDG-DGGE method (Cremonesi et al, 2001) that allows rapidmutational scanning of the l-ferritin IRE sequence in a

single electrophoretic analysis. As shown in Fig 1A, theproband’s DNA sample that had been PCR amplified withthe CC clamped oligonucleotides produced an electropho-retic pattern clearly different from that of controls. Thepatient’s DG-DGGE pattern was characterized by three extrabands, a faster one corresponding to the mutated homo-duplex and two slower bands with similar mobility corre-sponding to heteroduplexes with lower melting points.

Sequence analysis of l-ferritin IRE revealed two distinctsequences starting from position 25. The two sequencesfrom position 6–47 were as follows: wild type, (6)TCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTG(47); deletion, (6) TCGGCGGTCCCGCGGGTCTTGCTTCAAC-AGTGTTTGGACGGA (47).

Comparison of the two sequences clearly indicates asix-base deletion within the fragment 22–30 of the wild-type sequence (underlined). Of these nine bases, only three(underlined) are left in the mutated sequence. The deletionfragment is flanked on both sides by the TCT sequence. Theresulting mutation can be interpreted as deletion 22–27,23–28, 24–29 or 25–30 (Fig 1B). Since they all representthe same sequence, we decided to choose D22–27 becauseof the lower numbering. The presence of short 2- to 8-bpsequence homologies at the breakpoints has been reportedin a number of deletions (Magnani et al, 1996). They arethought to facilitate the formation of single-stranded loopedintermediates that may be excluded during replication or

Fig 1. (A) DG-DGGE analysis of DNA samples for mutations of the l-ferritin IRE sequence, showing the pattern of the new deletion (lane 1)

compared with wild-type control (lane 2). (B) Sequence analysis of l-ferritin IRE. The new mutant shows a six-base deletion within thefragment 22–30 of the wild-type sequence (underlined). Of these nine bases, only three (underlined) are left in the mutated sequence, and the

resulting mutation can be interpreted as deletion 22–27, 23–28, 24–29 or 25–30. (C) Predicted IRE structures of wild-type and D22–27

mutant l-ferritin mRNAs, computed on the RNA mfold server (Mathews et al, 1999).

668 M. Cazzola et al

Ó 2002 Blackwell Science Ltd, British Journal of Haematology 116: 667–670

cleaved by DNA repair enzymes through a slipped mispair-ing mechanism (Magnani et al, 1996).

Computation of mRNA folding of the first 70 nucleotidesof l-ferritin mRNA (Mathews et al, 1999) predicted that theD22–27 introduces a novel loop in the upper stem of IREstructure, very close to the lateral bulge (Fig 1C). This isexpected to markedly reduce the binding to IRPs.

DISCUSSION

HHCS stands as a noteworthy example of a human geneticdisorder that arises from RNA mutations within a protein-binding site, and in which the energetics of the bindinginteraction determine the severity of the disease (Allersonet al, 1999). Each unique mutation, in fact, confers a

characteristic degree of hyperferritinaemia and severity ofcataract in affected individuals. This illustrates the emergingprinciples of translational pathophysiology and exemplifiesa new paradigm in which polymorphisms or mutations inmRNA cis-acting elements may be responsible for pheno-typic variability in normal and disease states (Cazzola &Skoda, 2000).

Table I lists the mutations of l-ferritin IRE structureassociated with HHCS so far reported. Interestingly, all thedeletions reported to date are associated with severe HHCS(Girelli et al, 1997).

Studies on young children from families with HHCS haveshown that cataract is not congenital, but rather of earlyonset (Balas et al, 1999; Girelli et al, 2001; Perez deNanclares et al, 2001). A recent study indicated that thelenses from guinea pigs and humans have disproportion-ately high levels of l-ferritin mRNA relative to the amountsof ferritin protein present, and that l-ferritin message ismarkedly increased in lenses from guinea pigs with hered-itary nuclear cataract (Cheng et al, 2000). This, theevidence that the lens from cataract surgery of a HHCSpatient contained about 10-fold more l-ferritin than acontrol lens (Levi et al, 1998), and the observations byMumford et al (2000) on crystalline deposits of l-ferritinsupport the hypothesis that l-ferritin is directly involved inthe development of lens opacity.

Since HHCS may also reflect de novo mutations (Arosioet al, 1999), a simple tool for identifying IRE molecularlesions might be useful in a clinical setting. We found thatthe DG-DGGE method is rapid, economical and suitable forclinical purposes (Cremonesi et al, 2001). As DG-DGGE isnot in widespread use among diagnosis laboratories, Gian-sily et al (2001) have developed a diagnosis strategy forHHCS based on an initial screening of the mutations locatedin the 5¢-UTR region using simple DGGE. They found thismethod to be easy and safe for dealing with increasingnumbers of samples referred for HHCS diagnosis.

ACKNOWLEDGMENTS

This work was supported in part by IRCCS PoliclinicoS. Matteo and MURST, Rome Italy.

REFERENCES

Aguilar-Martinez, P., Biron, C., Masmejean, C., Jeanjean, P. &Schved, J.F. (1996) A novel mutation in the iron responsive

element of ferritin 1-subunit gene as a cause for hereditary

hyperferritinemia–cataract syndrome. Blood, 88, 1895.

Allerson, C.R., Cazzola, M. & Rouault, T.A. (1999) Clinical severityand thermodynamic effects of iron-responsive element mutations

in hereditary hyperferritinemia ± cataract syndrome. Journal of

Biological Chemistry, 274, 26439–26447.Arnold, J.D., Mumford, A.D., Lindsay, J.O., Hedge, U., Hagan, M. &

Hawkins, J.R. (1997) Hyperferritinemia in the absence of iron

overload. Gut, 41, 408–410.

Arosio, C., Fossati, L., Vigano, M., Trombini, P., Cazzaniga, G. &Piperno, A. (1999) Hereditary hyperferritinemia cataract syn-

drome: a de novo mutation in the iron responsive element of the

l-ferritin gene. Haematologica, 84, 560–561.

Table I. Mutations of l-ferritin IRE structure associated with HHCS

so far reported.

Mutation References

Point mutations*

C14G Cremonesi et al (2001)

C18T T22G Cazzola et al (1997)Giansily et al (2001)

G32A Cazzola et al (1997)

Cicilano et al (1999)Giansily et al (2001)

G32C Giansily et al (2001)

Girelli et al (2001)

G32T Martin et al (1998)Girelli et al (2001)

C33A Giansily et al (2001)

C33T Balas et al (1999)

Giansily et al (2001)Girelli et al (2001)

C36A Mumford et al (1998)

Giansily et al (2001)C39T Arosio et al (1999)

Cicilano et al (1999)

Giansily et al (2001)

Girelli et al (2001)A40G Beaumont et al (1995)

Aguilar-Martinez et al (1996)

Arnold et al (1997)

Barton et al (1998)Cicilano et al (1999)

Perez de Nanclares et al (2001)

Girelli et al (2001)G41C A40G** Cremonesi et al (2001)

G51C Camaschella et al (2000)

Chang-Godinich et al (2001)

DeletionsDelC10-A38 Girelli et al (1997)

DelA38-C39 Giansily et al (2001)

DelT42-G57 Giansily et al (2001)

DelT22-C27 M. Cazzola et al (present work)

*Numbering refers to the start of transcription of the RNA.**Originally described as a G41C single mutation by Girelli et al

(1995b).

Hereditary Hyperferritinaemia–Cataract Syndrome 669

Ó 2002 Blackwell Science Ltd, British Journal of Haematology 116: 667–670

Balas, A., Aviles, M.J., Garcia-Sanchez, F., Vicario, J.L. & Cervera, A.

(1999) Description of a new mutation in the l-ferritin iron-

responsive element associated with hereditary hyperferritinemia–cataract syndrome in a Spanish family. Blood, 93, 4020–4021.

Barton, J.C., Beutler, E. & Gelbart, T. (1998) Coinheritance of alleles

associated with hemochromatosis and hereditary hyperferritin-

emia–cataract syndrome. Blood, 92, 4480.Beaumont, C., Leneuve, P., Devaux, I., Scoazec, J.Y., Berthier, M.,

Loiseau, M.N., Grandchamp, B. & Bonneau, D. (1995) Mutation

in the iron responsive element of the l-ferritin mRNA in a family

with dominant hyperferritinaemia and cataract. Nature Genetics,11, 444–446.

Camaschella, C., Zecchina, G., Lockitch, G., Roetto, A., Campanella,

A., Arosio, P. & Levi, S. (2000) A new mutation (G51C) in the

iron-responsive element (IRE) of l-ferritin associated withhyperferritinaemia–cataract syndrome decreases the binding

affinity of the mutated IRE for iron-regulatory proteins. British

Journal of Haematology, 108, 480–482.Cazzola, M. & Skoda, R.C. (2000) Translational pathophysiology: a

novel molecular mechanism of human disease. Blood, 95, 3280–

3288.

Cazzola, M., Bergamaschi, G., Tonon, L., Arbustini, E., Grasso, M.,Vercesi, E., Barosi, G., Bianchi, P.E., Cairo, G. & Arosio, P.

(1997) Hereditary hyperferritinemia–cataract syndrome:

relationship between phenotypes and specific mutations in the

iron-responsive element of ferritin light-chain mRNA. Blood, 90,814–821.

Chang-Godinich, A., Ades, S., Schenkein, D., Brooks, D., Stambo-

lian, D. & Raizman, M.B. (2001) Lens changes in hereditaryhyperferritinemia-cataract syndrome. American Journal of Oph-

thalmology, 132, 786–788.

Cheng, Q., Gonzalez, P. & Zigler, Jr, J.S. (2000) High level of ferritin

light chain mRNA in lens. Biochemical and Biophysical ResearchCommunications, 270, 349–355.

Cicilano, M., Zecchina, G., Roetto, A., Bosio, S., Infelise, V.,

Stefani, S., Mazza, U. & Camaschella, C. (1999) Recurrent

mutations in the iron regulatory element of l-ferritin inhereditary hyperferritinemia–cataract syndrome. Haematologica,

84, 489–492.

Cremonesi, L., Fumagalli, A., Soriani, N., Ferrari, M., Levi, S.,Belloli, S., Ruggeri, G. & Arosio, P. (2001) Double-gradient

denaturing gradient gel electrophoresis assay for identification of

l-ferritin iron-responsive element mutations responsible for

hereditary hyperferritinemia–cataract syndrome: identification ofthe new mutation C14G. Clinical Chemistry, 47, 491–497.

Giansily, M., Beaumont, C., Desveaux, C., Hetet, G., Schved, J.F. &

Aguilar-Martinez, P. (2001) Denaturing gradient gel electro-

phoresis screening for mutations in the hereditary hyperferriti-naemia cataract syndrome. British Journal of Haematology, 112,

51–54.

Girelli, D., Olivieri, O., De Franceschi, L., Corrocher, R., Bergama-

schi, G. & Cazzola, M. (1995a) A linkage between hereditary

hyperferritinaemia not related to iron overload and autosomaldominant congenital cataract. British Journal of Haematology, 90,

931–934.

Girelli, D., Corrocher, R., Bisceglia, L., Olivieri, O., De Franceschi, L.,

Zelante, L. & Gasparini, P. (1995b) Molecular basis for therecently described hereditary hyperferritinemial-cataract syn-

drome: a mutation in the iron-responsive element of ferritin

l-subunit gene (the ÔVerona mutation’). Blood, 86, 4050–4053.

Girelli, D., Corrocher, R., Bisceglia, L., Olivieri, O., Zelante, L.,Panozzo, G. & Gasparini, P. (1997) Hereditary hyperferritinemia–

cataract syndrome caused by a 29-base pair deletion in the

iron responsive element of ferritin l-subunit gene. Blood, 90,

2084–2088.Girelli, D., Bozzini, C., Zecchina, G., Tinazzi, E., Bosio, S., Piperno, A.,

Ramenghi, U., Peters, J., Levi, S., Camaschella, C. & Corrocher, R.

(2001) Clinical, biochemical and molecular findings in a series offamilies with hereditary hyperferritinaemia-cataract syndrome.

British Journal of Haematology, 115, 334–340.

Levi, S., Girelli, D., Perrone, F., Pasti, M., Beaumont, C., Corrocher,

R., Albertini, A. & Arosio, P. (1998) Analysis of ferritins inlymphoblastoid cell lines and in the lens of subjects with hered-

itary hyperferritinemia–cataract syndrome. Blood, 91, 4180–

4187.

Magnani, C., Cremonesi, L., Giunta, A., Magnaghi, P., Taramelli, R.& Ferrari, M. (1996) Short direct repeats at the breakpoints of a

novel large deletion in the CFTR gene suggest a likely slipped

mispairing mechanism. Human Genetics, 98, 102–108.Martin, M.E., Fargion, S., Brissot, P., Pellat, B. & Beaumont, C.

(1998) A point mutation in the bulge of the iron-responsive

element of the l ferritin gene in two families with the here-

ditary hyperferritinemia–cataract syndrome. Blood, 91, 319–323.Mathews, D.H., Sabina, J., Zuker, M. & Turner, D.H. (1999)

Expanded sequence dependence of thermodynamic parameters

provides robust prediction of RNA secondary structure. Journal of

Molecular Biology, 288, 911–940.Mumford, A.D., Vulliamy, T., Lindsay, J. & Watson, A. (1998)

Hereditary hyperferritinemia–cataract syndrome: two novel

mutations in the l-ferritin iron-responsive element. Blood, 91,367–368.

Mumford, A.D., Cree, I.A., Arnold, J.D., Hagan, M.C., Rixon, K.C. &

Harding, J.J. (2000) The lens in hereditary hyperferritinaemia

cataract syndrome contains crystalline deposits of l-ferritin.British Journal of Ophthalmology, 84, 697–700.

Perez de Nanclares, G., Castano, L., Martul, P., Rica, I., Vela, A.,

Sanjurjo, P., Aldamiz-Echevarria, K., Martinez, R. & Sarrionan-

dia, M.J. (2001) Molecular analysis of hereditary hyperferritin-emia–cataract syndrome in a large Basque family. Journal of

Pediatric Endocrinology and Metabolism, 14, 295–300.

670 M. Cazzola et al

Ó 2002 Blackwell Science Ltd, British Journal of Haematology 116: 667–670