ZOOTAXAISSN 1175-5326 (print edition)

ISSN 1175-5334 (online edition)Copyright copy 2013 Magnolia Press

Zootaxa 3636 (1) 144ndash170 wwwmapresscomzootaxa Article

httpdxdoiorg1011646zootaxa363616httpzoobankorgurnlsidzoobankorgpubFF3A24CC-6545-4B77-83C5-2503143E7F16

A new species of Diadema (Echinodermata Echinoidea Diadematidae) from the eastern Atlantic Ocean and a neotype designation of Diadema antillarum (Philippi 1845)

ADRIANA RODRIacuteGUEZ13 JOSEacute CARLOS HERNAacuteNDEZ1 SABRINA CLEMENTE1

amp SIMON EDWARD COPPARD2

1Biodiversidad Ecologiacutea Marina y Conservacioacuten (BIOECOMAC) Departamento de Biologiacutea Animal Facultad de Biologiacutea Universidad de La Laguna Avenida Astrofiacutesico Francisco Saacutenchez sn La Laguna 38206 Spain 2Smithsonian Tropical Research Institute Post Box 0843-03092 Balboa Ancon Republic of Panama 3Corresponding author E-mailadrianarulles

Abstract

Diadema africanum sp nov Rodriacuteguez et al 2013 occurs in the eastern Atlantic Ocean at depths of 1ndash80 meters off Ma-deira Islands Salvage Islands Canary Islands Cape Verde Islands Sacirco Tome Islands and at the continental coast off Sen-egal and Ghana This species was previously considered an eastern Atlantic population of D antillarum Genetic distances between the holotype of D africanum and the neotype of D antillarum herein designated measured 334 in Cytochrome oxidase I 380 in ATPase-8 and 231 in ATPase-6 Such divergence is similar to that already highlighted between other accepted species of Diadema Morphometric analysis of test spine and pedicellarial characters also separated D africa-num from D antillarum and reveals that this new species is morphologically similar to D antillarum ascensionis from the mid Atlantic The tridentate pedicellariae which have been shown to have diagnostic characters which discriminate among species of Diadema occur as both broad and narrow valved forms in D antillarum from the western Atlantic In D africanum the tridentate pedicellariae occur only as a single form which is characterized by moderately broad and curved valves with an expanded distal gripping region This form of tridentate pedicellaria is very similar to that of D antillarum ascensionis from the central Atlantic with only slight variations in valve serration and valve curvature differ-entiating the two forms

Key words Diadematidae Diadema antillarum Diadema africanum sp nov eastern Atlantic Ocean test spines pedi-cellariae taxonomy

Resumen

Di africanum sp nov Rodriacuteguez et al 2013 se encuentra en el noreste del Oceacuteano Atlaacutentico a 1ndash80 metros de profundidad en las islas de Madeira Salvajes Canarias Cabo Verde y Sacirco Tome y en la plataforma continental de Senegal y Ghana Esta especie fue previamente considerada como una poblacioacuten del Atlaacutentico oriental de Diadema antillarum La distancia geneacutetica entre el holotipo de Diadema africanum y el neotipo de Diadema aff antillarum aquiacute designadas midieron 334 en Citocromo oxidasa I 380 en ATPasa-8 y un 231 en ATPasa-6 Estas divergencias son similares a las ya encontradas entre otras especies aceptadas de Diadema El anaacutelisis de los caracteres morfomeacutetricos del caparazoacuten puacuteas y pedicelarios separa D africanum de D antillarum e indica que esta nueva especie se encuentra muy proacutexima a D antillarum ascensionis del Altaacutentico medio Los pedicelarios tridentados usados normalmente como caraacutecter diagnoacutestico discriminante entre especies de Diadema se encuentran soacutelo en una forma en D africanum los cuales se caracterizan por tener unas valvas moderadamente anchas y valvas curvadas con una amplia regioacuten distal de agarre Esta forma de pedicelario tridentado es muy similar al de Diadema antillarum ascensionis del Atlaacutentico central con solo ligeras variaciones en el aserramiento de las valvas y la curvatura de las mismas que diferencian las dos formas

144 Accepted by M Eleaume 23 Jan 2013 published 3 Apr 2013

Introduction

Diadema Gray 1825 is a genus of sea urchin in the family Diadematidae Peters 1855 Species of this genus are distinctive in having inflated tests that resemble a crown or diadem with a depressed apical region a small inflated periproctal cone and raised ambulacra aborally Ambulacral plating in this genus is trigeminate with non-conjugated pore-pairs and phyllodes developed adorally Both primary and secondary spines are verticillate and have a hollow axial cavity

Diadema is one of the most abundant widespread and ecologically important genera among tropical sea urchins that live in shallow water habitats (Lawrence amp Sammarco 1982 Lessios et al 2001 Coppard amp Campbell 2005a 2007 Muthiga amp McClanahan 2007 Hernaacutendez et al 2008) However much confusion has arisen in the literature concerning species identifications This is because morphological differences between some species are slight (Pearse 1970 1998 Lessios et al 2001) Based on morphology the genus was considered to consist of seven species with the following distributions D setosum (Leske 1778) and D savignyi Michelin 1845 from the mid-Pacific to the East African coasts D paucispinum A Agassiz 1863 was thought to be endemic to Hawaii (Mortensen 1940) D palmeri Baker 1967 from the northern coasts of New Zealand (Baker 1967) and southeast coasts of Australia (Rowe amp Gates 1995) D mexicanum A Agassiz 1863 distributed off the tropical eastern Pacific coasts from the Sea of Cortez to Ecuador including the islands of Revillagigedos Clipperton Isla del Coco and the Galapagos D antillarum (Philippi 1845) distributed on both coasts of the Atlantic Ocean on the western coasts from Florida and Bermuda to Brazil and on the eastern coasts from Madeira to the Gulf of Guinea (this species was erroneously recorded by Mortensen (1940) in the Azores see Wirtz amp Martins 1993) and D ascensionis Mortensen 1909 from the mid-Atlantic Ascension St Helena and Fernando Noronha Islands which was designated as a subspecies of D antillarum by Pawson (1978) Considerable debate occurred in the early literature over whether eastern Atlantic D antillarum should be considered a subspecies (Koehler 1914 Clark 1925 Mortensen 1933) However these authors ultimately concluded that it was insufficiently different from western Atlantic D antillarum

A molecular study of Diadema by Lessios et al (2001) using both mitochondrial DNA (mtDNA) and isozymes revealed that the genus is composed of ten species Six of these are nominal species with an additional four species that are undescribed (see Fig 1) Populations of Diadema from the Central Atlantic islands of Ascension and St Helena were found to be a monophyletic entity nested within a Brazilian clade of D antillarum-a supporting the designation of D antillarum ascensionis as a subspecies Diadema paucispinum D savignyi D antillarum-a from the west and central Atlantic and D antillarum-b (also referred to as D aff antillarum sensu Hernaacutendez 2006 Clemente 2007) from the east Atlantic were found to form a polytomy This suggests that Dantillarum-a and D antillarum-b should be recognised as separate species as their mitochondrial DNA is as different from each other as among three accepted species

Studies by Coppard amp Campbell (2004 2006a 2006b) have described in detail morphological differences in test spine and tridentate pedicellarial structures among established species and subspecies of Diadema However it remains to be determined whether morphological differences can be established for the new species identified through their divergent mtDNA

In this study we undertook to identify diagnostic characters that differentiate eastern Atlantic Diadema from those of the western Atlantic We initially searched for the holotype of D antillarum but after searching through all known records of Philippirsquos collections we believe that the type material of D antillarum has been lost or destroyed Therefore to stabilize the nomenclature and following Article 75 of the International Code for Zoological Nomenclature (International Commission on Zoological Nomenclature 1999) we hereby designate a neotype of D antillarum To verify that the neotype of D antillarum was congruent with D antillarum-a and that D africanum conforms to D antillarum-b we sequenced the same part of Cytochrome oxidase I and Lysine t-RNA-ATPase-6 and ATPase-8 regions used by Lessios et al (2001) Sequences were aligned and phylogenetically analysed to confirm that type specimens belong to respective mitochondrial clades

Methods

Two specimens of D antillarum were collected by scuba diving off Juventud Island Cuba (21deg335592N 83deg

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 145A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

95446W) near Matanzas the type locality of D antillarum as designated by Philippi in the original description One of these specimens (TFMCBMEQ00237) has been deposited as the neotype of D antillarum in the Museo de Ciencias Naturales de Tenerife (TFMC) Tenerife Island (TFMCBMEQ00237)

Twenty-five specimens of D aff antillarum were collected by scuba diving fourteen individuals at three sites of the Canary Islands (Abades 28ordm 08acute 2794acuteacuteN 16ordm 26acute 1077acuteacuteW Las Galletas 28ordm 00acute 2887acuteacuteN 16ordm39acute4375acuteacuteW in Tenerife Island and Costa Teguise 28ordm 59acute3265acuteacuteN 13ordm 29acute1904acuteacuteW in Lanzarote Island) six specimens in Madeira Island (Playa Tivoli 32ordm 38acute0358acuteacuteN 16ordm 56acute0420acuteacuteW) and five specimens in Cape Verde (Mindelo 16ordm 54acute3720acuteacuteN 24ordm 58acute5485acuteacuteW in Sacirco Vicente Island)

Morphology The methodology used was modified from Coppard amp Campbell (2004 2006a 2006b) Fifty-six morphological characters were measured including features of the test spines (ambulacral and interambulacral) and tridentate pedicellariae Twenty-seven morphological characters of the test were measured from living and denuded specimens (Table 1) All characters were examined and measured using a binocular light microscope Tests were carefully cleaned using a solution of 50 Sodium Hypochlorite to reveal test characters which hold important morphological information The arrangement of test plates in the ambulacra and interambulacra were carefully studied This was aided by adding small quantities of 70 ethanol to the naked test which as it evaporated helped define the edges and features of individual plates Photographs were taken to provide a visual record of test structures that are typical of species allowing for a direct comparison

Four ambulacral and four interambulacral spines from each twenty-five specimens were equally cut into four regions comprising the total length of the spinersquos shaft (distal proximal and two intermediate regions) All regions were embedded in Agar 100 resin (Agar Scientific) (William et al 1991) and allowed to harden for four days Transverse sections of 10ndash30 microm were cut from each of the four regions using an Ultracut microtome Sections were mounted on slides using Agar 100 resin and dried on a hot plate for two days The slides were examined using a binocular light microscope Sections were not cut from the neck or base of the spines as such regions have been reported to show little variation among species within genera (Agassiz 1872 Mackintosh 1875 Mortensen 1940 Moreno et al 1980) The axial cavity solid wedges trabeculae and presenceabsence of reticular tissue were studied and photographed The size and proportion of the different features displayed by transverse sections were also measured (Table 2)

Five tridentate pedicellariae and five triphyllous pedicellariae were studied from each specimen These were stored in vials and preserved in 70 ethanol In total 125 pedicellariae of each type and their skeletal ossicles were observed by scanning electron microscopy (SEM) The pedicellariae were placed in 20 hydrogen peroxide (H2O2) to remove the soft tissue and expose the underlying calcareous ossicles To avoid overexposure to H2O2

which might damage the ossicles the cleaning process was observed under a binocular microscope The pedicellarial ossicles were then washed three times in distilled water and dried in absolute ethanol They were left overnight (in air) before being mounted on stubs and sputter coated in gold Preparations were observed using scanning electron microscopy (SEM) and pictures of each sample were taken Sixteen morphological characters used by Coppard amp Campbell (2006b) were measured on the images (Table 3) The peripheral gripping area was calculated from the measured dimensions as a percentage of the distal peripheral area

The morphological characters of test spines and pedicellariae were measured using ldquoImage Jrdquo software Data were statistically analysed using the software PRIMER (Plymouth Routines In Multivariate Ecological Research Clarke amp Warwick 1994) Principal Components Analyses (PCA) was applied only to the quantitative variables to assess the similarity of morphological characters between the neotype of D antillarum and D africanum These morphological characters were as follows Spine characters spine diameter number of solid wedges axial cavity mean diameter ( spine diameter) percentage of spinersquos diameter comprised by solid wedges and percentage of the spinersquos diameter comprised by foraminated ring pedicellarial characters types of pedicellariae length of distal region (mm) width of distal region (mm) length of proximal region (mm) width of proximal region (mm) total area of distal region (mm2) internal area of distal region (mm2)cedil peripheral area of distal region (that does not grip

(mm2) peripheral gripping area (mm2) total area of proximal region (mm2) adductor muscle insertion area (mm2) keel and peripheral area of proximal region (mm2) peripheral gripping area as of distal peripheral area (mm2) height of teeth (mm) and width of teeth (mm) test characters horizontal test diameter (mm) vertical test diameter (mm) mean number of tubercles on genital plates height to width (at widest point) ratio of genital plate diameter of gonopores (as a percentage of the genital platersquos height) apical system (as a percentage of the testrsquos horizontal diameter) periproct (as a percentage of testrsquos horizontal diameter) peristome (as a percentage of the testrsquos

RODRIacuteGUEZ ET AL146 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

horizontal diameter) and relative percentage of ambulacra to interambulacra at the ambitus Morphological differences among species were tested for the quantitative variables using the ANOSIM procedure (Clarke 1993)

DNA extraction sequencing and alignment Genomic DNA was extracted from the tube feet of the holotype of D africanum and from the neotype of D antillarum using a DNeasy tissue kit (Qiagen) Two regions of mitochondrial DNA (mtDNA) were amplified by polymerase chain reaction (PCR) using the protocol of Lessios et al (1998) and the primers of Lessios et al (2001) Cytochrome oxidase I (COI) was amplified using the CO1f 5rsquoCCTGCAGGAGGAG GAGAYCC and CO1a5rsquoAGTATAAGCGTCTGGGTAGTC primers while the Lysine-tRNA ATPase-6 and 8 region was amplified using LYSa 5rsquoAAGCTTTAAACTCTTAATTTAAAAG and ATP6b 5rsquoGCCAGGTAGAACCC GAGAAT primers The PCR products were purified and then cycle sequenced using the PCR primers and Applied Biosystems (ABI) PRISM BigDye Terminators Nucleotides were sequenced in both directions three times to check for consistency on an ABI automatic sequencer The sequences have been deposited into GenBank with the accession numbers KC622669 ndash KC622344 The sequences of both respective mtDNA regions from Lessios et al (2001) were downloaded from GenBank (accession numbers AY012728-AY013241) and aligned using ClustalX 209 (Larkin et al 2007) Sequence alignments were then compared in MacClade (Maddison amp Maddison 2001) jMODELTEST V 211 (Posada 2011) was used to determine the best model of molecular evolution for each gene based on the AIC criterion (Akaike 1974) From the tRNA ATPase region the coding ATPase-6 and ATPase-8 genes were assessed independently Tamura and Neirsquos (1993) model was suggested for both COI (TrN+G) and ATPase-6 (TrN+I+G) with a gamma distribution shape parameter 00970 in COI with a proportion of invariable sites (I=05100) and gamma correction (G=12230) in ATPase-6 A transitiontransversion model TIM1+I+G was suggested for ATPase-8 where I=03890 and G=35380 Genetic distances were calculated between the neotype of D antillarum and the holotype of D africanum and among closely related species of Diadema in PAUP (Swofford 2002) using maximum likelihood and the models base frequencies proportion of invariable sites and gamma correction suggested by jMODELTEST

Phylogenetic analysis Bayesian phylogenetic analyses were carried out on all unique haplotypes from the COI data and concatenated ATPase-6 and ATPase-8 coding regions using MRBAYES V 321 and the models suggested by jMODELTEST These analyses were conducted on the species identified by Lessios et al (2001) to form a polytomy with D antillarum and D africanum (D savignyi D paucispinum-a amp b D antillarum-a amp b) A single haplotype of D mexicanum was randomely chosen as an outgroup (only one outgroup is permitted in MRBAYES) with heating parameter T=02 The analysis was started with Dirichlet priors for rates and nucleotide

frequencies and run for 8 million generations sampling every 100th tree from two runs Convergence was assessed on the average standard deviation of slit frequencies lt001 and the potential scale reduction factor (Gelman amp Rubin 1992) reaching 100 for all parameters The first 25 of trees were discarded from both runs as burn-in and a 50 majority rule tree constructed while clades with less than 85 support were collapsed

A partitioned maximum likelihood analysis was also carried out in GARLI V20 (Zwickl 2006) using the models suggested by jMODELTEST Three replicate runs of one million iterations were conducted Branch support values were calculated in GARLI based on 400 bootstrap replicates and the bootstrap consensus tree calculated in PAUP

Results

Morphology

Diadema from the eastern Atlantic were found to be morphologically very close to D antillarum from the western Atlantic but even closer to D antillarum ascensionis from the mid Atlantic However small differences were found to support its designation as a distinct species Figure 1 illustrates the neotype (whole sea urchin) of D antillarum and Fig 2 a denuded test of D antillarum from the type locality Figs 3 and 4 show the spines and pedicellariae of D antillarum respectively Figure 5 illustrates the holotype of D africanum (whole sea urchin) and Fig 6 the paratype of D africanum (denuded test) Figure 7 shows details of the apical system and the iridophore pattern Figure 8 illustrates ambulacral spines and interambulacral spines of D africanum with transverse sections and Fig 9 the pedicellariae Figure 10 shows PCA plots of quantitative morphological characters of test spines and pedicellariae of D antillarum (neotype) of D africanum

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 147A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 1 NHMTFMCBMEQ00237 neotype of D antillarum A aboral view B oral view C lateral view

RODRIacuteGUEZ ET AL148 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 2 NHMTFMCBMEQ00237 neotype of D antillarum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F apical system

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 149A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 3 NHMTFMCBMEQ00237 neotype of D antillarum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashN) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL150 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 4 Scanning electron microscopy images (SEMs) of individual valves of tridentate pedicellariae and triphyllous pedicellariae of the neotype of D antillarum NHMTFMCBMEQ00237 AndashH tridentate pedicellariae AndashB external and internal views of a broad form CndashD side views of a broad form EndashF narrow form (external views) G internal view of a narrow form H side view of a narrow form I details of a narrow tridentate pedicellaria showing lateral teeth JndashK Triphyllous pedicellariae internal and external views respectively L details of a triphyllous pedicellaria showing peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 151A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Diadema Gray 1825

Gray 1825 p246 Type species Echinometra setosa Leske 1778 by ruling of the ICZN 1954Assigned species D setosum (Leske 1778) D savignyi Michelin 1845 D paucispinum A Agassiz 1863 D palmeri Baker

1967 D mexicanum A Agassiz 1863 D antillarum (Philippi 1845) D ascensionis Mortensen 1909 designated D antillarum ascensionis by Pawson (1978)

Diadema antillarum (Philippi 1845)Figs 1ndash4 tables 1ndash3

Cidaris (Diadema) antillarum Philippi 1845 Arch F Naturg 11 (1) p 355Diadema antillarum A Agassiz 1863 Bull MCZ 1 p19 Nutting 1895 Bull Univ Iowa Lab Nat Hist (3) p224

unnumbered plate fig1 (young Diadema labelled Aspidodiadema sp)

Neotype diagnosis Test and spines typically black with a red tinge However spines vary in colour from whitebrown to black Iridophores occur as a pentamerous ring around the apical disc Arch-shaped depressions are found on the apical disc along the inner edges of genital plates only in juveniles and young adults This character fades with age In transverse section ambulacral and interambulacral spines show an isosceles triangle-shaped solid wedges that constitute the shaft These wedges typically number sixteen in ambulacral spines and twenty in the largest interambulacral spines Only tridentate and triphyllous pedicellariae are present Tridentate pedicellariae occur as two forms one with broad valves and a narrow form Both forms have moderately curved valves and serrations along the edges of the valves

Material examined Neotype (TFMCBMEQ00237) in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material One specimen of the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology The species name refers to the species occurrence in The Antilles Islands Ecology Diadema antillarum is a key herbivore on Caribbean reefs Until 1983 this species was abundant on

Caribbean coral reefs and in seagrass beds In 1983 a non-identified pathogenic infection resulted in a mass die-off of this species which reduced population sizes by more than 97 in the Caribbean Sea and western Atlantic (Lessios 1984b 1988) Such population have failed to recover to pre-die-off numbers (Lessios 2005) Following the mass mortality of D antillarum there was an immediate increase in algal growth particularly in areas where herbivorous fish had been reduced in numbers through intense fishing pressure In such regions a reduction of algal-free areas suitable for coral settlement has been reported and is believed to be responsible for the reduction in coral-cover (Lessios 1988)

Diadema antillarum spawns around the time of the new moon typically on the first two days of the first lunar quarter (Lessios 1984a) Settlement times and levels of recruitment of D antillarum have been found to vary in different localities (Lewis 1966 Bauer 1976 Lessios 1981 1984b)

Distribution Diadema antillarum is found off the coasts of the tropical western Atlantic Ocean including the Caribbean Sea tropical coasts of South America down to Brazil and from Bermuda to Florida It is typically found in shallow waters on coral reefs but has been reported from depths of 70 m (Mortensen 1940)

Neotype description The test is hemispherical with a horizontal diameter of 450 mm and a vertical diameter of 205 mm (Fig 1) The epithelium of the test is black (Fig 1AndashC) with a red tinge In living specimens narrow blue lines of iridophores occur down either side of the naked median areas of the interambulacra and as a ring around the apical disc The apical system is hemicyclic and measures 2394 mm 24 of the testrsquos horizontal diameter (Fig 2D amp Table 1) The genital plates are wider than long with one to three tubercles along their inner edge (Table 1 amp Fig 2F) and a genital pore that measures 45 the genital plate length A faint arch-shaped depression occurs on the inner edge of each genital plate forming the corners of the apical ring Ocular plates are pentagonal in shape with two small tubercles in the centre of the plate The periproctal cone is small and black and does not have any platelets or markings on the skin (Fig 1A amp Table 1) The ambulacra are slightly raised aborally and measure 22 of the width of interambulacral measured at the ambitus (Table 1 amp Fig 2) They have two rows of large crenulate and perforate primary tubercles (Fig 2) with an offset inner series of small tubercles The

RODRIacuteGUEZ ET AL152 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

interambulacra measure 18 mm in width at the ambitus and contain four series of large primary tubercles with an offset inner series of small tubercles Each series contains 14 primary tubercles with areoles of moderate size (Fig 2 amp Table 1) The peristome measures 219 mm at the ambitus 481 of the horizontal diameter It is subcircular in shape and has five pairs of buccal tube feet The peristomial membrane is black and is covered with a large number of triphyllous pedicellariae Auricles are robust with high processes (Fig 2E)

Ambulacral and interambulacral spines differ in their width and ornamentation Ambulacral spines are black with a red tinge (Fig 3) the longest measures 2852 mm in length (6334 of the test horizontal) on the neotype 09 mm in width proximally and 05 mm distally (Fig 3EndashG) These are verticillate with barbs distally (Fig 3AndashC) and are typically composed of sixteen solid wedges

Interambulacral spines are predominantly black with a red tinge but a number of brown and white spines are present aborally (Figs 1 amp 3) They are long and slender the longest measuring 4737 mm in length on the neotype The spines are verticillate formed by 20 solid wedges which radiate out from a hollow axial cavity Spine width varies from 14 mm in diameter proximally to 09 mm distally with numerous barbs present distally (Figs 3HndashJ)

Only tridentate and triphyllous pedicellariae were found on the neotype with no claviform ophicephalous pedicellariae observed (Fig 4 amptable 3) Tridentate pedicellariae occur as two forms one with broad valves (Fig 4AndashD) and a long broad neck on a short stalk and a narrow form (comparing valves of equal length) with narrow valves a short neck and a long stalk (Fig 4EndashH) Both forms have moderately curved valves with serrations along edges of the blades of the valves (Figs 4GndashI) Both forms occur orally and aborally However the broad form is less abundant Triphyllous pedicellariae are typical of the genus in having broad valves that are rounded distally with numerous small peripheral teeth that occur in two rows (Figs 4JndashL) The head of each pedicellaria is supported by a long muscular neck attached to a long stalk

Diadema africanum sp novFigs 5ndash10 tables 1ndash3

Diagnosis Test and spines typically black with a red tinge and a turquoise sheen when viewed in direct sunlight The iridophore pattern occurs as bold blue lines down either side of the naked interambulacral areas as a pentamerous ring around the apical disc and as lines along some plate boundaries Apical disc is hemicyclic with arch-shaped depressions on the denuded genital plates in both adults and juveniles Gonopores measure 33 of the length of the genital plates The periproctal cone is black with no markings The Peristome is proportionally large measuring 40ndash60 of the testrsquos horizontal diameter Spines are verticillate and hollow with distal barbs Verticilations are formed of urn-shaped solid wedges that are visible when the spines are viewed in transverse section These wedges typically number twenty in ambulacral spines and twenty-four in interambulacral spines Only tridentate and triphyllous pedicellariae are present The tridentate pedicellariae occur as a single form with reasonably broad curved valves with almost straight edges that can either be smooth or serrated with an expanded distal gripping region The blades of the valves meet only along the upper fifth of their length The head of each pedicellaria is supported by a long muscular neck attached to a mid-length stalk

Holotype TFMCBMEQ00232 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Paratypes TFMCBMEQ 00233 TFMCBMEQ 00234 TFMCBMEQ 00235 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material Twenty-one specimens in the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology Species name refers to the geographical distribution of the species on the western coasts of Africa It is distributed on islands and continental coasts along the African continental shelf

Ecology Diadema africanum is an important macro-herbivore on subtropical and tropical rocky reefs off the West African coasts In the eastern Atlantic islands and particularly in Madeira and the Canary Islands the species is distributed throughout the islands at densities that can reach more than 12 individuals m2 (Brito et al 1984 Alves et al 2001 Hernaacutendez 2006 Clemente 2007 Hernaacutendez et al 2008) The species can therefore dramatically reduce the abundance of non-crustose macroalgae resulting in the formation of sea urchin-dominated barren grounds (Hernaacutendez et al 2008) This phenomenon is especially relevant in Madeira Salvage and the Canary Islands where macroalgal beds represent the main ecosystem Diadema africanum also occurs on coral dominated

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 153A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

reefs in Cape Verde and Sacirco Tome where sea urchin control of macroalgae via grazing is beneficial for coral settlement and growth Only a few studies have looked at the abundance and ecological role of D africanum along the tropical western African coasts (eg John et al 1977 1992) with further investigations needed

Distribution Diadema africanum occurs in the Eastern Atlantic islands from Madeira Islands to the Guinean Gulf including Salvage Islands Canary Islands Cape Verde Islands (Hernaacutendez et al 2008) and Sacirco Tome Island (Lessios et al 2001) It has also been also recorded in continental areas of Ghana (John et al 1977 1992) and in Ngor Island Senegal (P Wirtz pers com)

Description The test is hemispherical with a horizontal diameter of 6673 mm and a vertical diameter of 3278 mm in the paratype and 6123 mm hd and 3136 mm vd in the holotype The base colour of the test epithelium is black with a red tinge (Fig 5AndashC) while the denuded test is white (Fig 6AndashE) The apical system measures 1814 mm in the paratype and is hemicyclic with ocular plates II and III exsert (Fig 6A) The genital plates are wider than long and have up to four small tubercles along their inner-edge (Table 1amp Fig 7AndashB) with large genital pores that measure 33 of the genital plate length (Fig 7A) The ocular plates are pentagonal with a small pore located at the top of the plate and have from one to three small tubercles along the centre of the plate (Fig 7B)

On the naked test distinct arch-shaped depressions are present on the genital plates of both adults and juveniles (Table 5 ampFig 7B) These depressions correspond to the corners of the pentamerous apical ring of iridophores seen in living sea urchins (Fig 7CndashE) The iridophore pattern is bold and bright on the apical system when viewed in sunlight The periproct is 1126 mm wide in the paratype (approximately 16 of the testrsquos horizontal diameter) and has a small black periproctal cone that has no platelets or markings on the skin (Fig 5A)

The ambulacra are slightly raised aborally (Fig 6C) and measure 30 of the width of the interambulacra (865 mm) at the ambitus in the paratype They have two rows of large primary tubercles and an offset inner series of small tubercles that are perforated and crenulated with non-conjugate pore-pairs and phyllodes developed adorally

The interambulacra are broader than the ambulacra at the ambitus (Fig 6CndashD) with 5ndash6 series (the inner median series is more offset in some specimens giving the impression of two series) of 14 primary tubercles Tubercles are perforate and crenulate and have areoles of moderate size (Fig 7A) During the day blue lines of iridophores can be seen down either side of the naked median regions

The peristome is subcircular (Fig 6B) and in the paratype it measures 269 mm in diameter 40 of the testrsquos horizontal diameter The peristomal membrane is black with a red tinge and has five pairs of buccal tube feet (Fig 5B) with abundant triphyllous pedicellariae The auricles are robust and have high processes (Fig 6F)

In adults the spine epithelium is black with a red tinge and a turquoise sheen when viewed in direct sunlight In juveniles spines are banded red and white which is typical of the genus Ambulacral spines measure 4321 mm in length in the paratype (2883 of the test horizontal diameter) These spines are strongly verticillate with barbs pointing distally (Fig 8AndashD) Proximally these spines have a mean diameter of 089 mm that decreases distally (Fig 8EndashG) The axial cavity comprises 288 of the horizontal diameter which increases to 3522 in the distal region (Fig 8EndashG) The solid wedges are urn-shaped and typically number twenty comprising 6342 of the spinersquos horizontal diameter in the proximal section

Interambulacral spines (Fig 8HndashN) are long and slender with a maximum diameter of 2 mm proximally and taper distally (Fig 8KndashN) These spines measure 5862 mm in the paratype In transverse section the axial cavity comprises 2992 of the horizontal diameter proximally but increases to 3917 in the distal region (Table 2 Fig 8LndashN) The solid wedges are urn-shaped and typically number twenty-four 6257 of the of the spinersquos horizontal diameter in the proximal section

Both tridentate and triphyllous pedicellariae are present in D africanum (Fig 9) No ophicephalous pedicellariae were found either true ophicephalous or of the claviform type which have been reported in other species of Diadema (Mortensen 1940) Only a single form of tridentate pedicellaria is found in this species (Fig 9AndashI) which are abundant orally and aborally but particularly around the periproct and around the peristome This form of tidentate pedicellaria has a long muscular neck on a long stalk which allows a high degree of movement (Fig 9A) The valves of the pedicellariae are moderately curved and only meet along the upper fifth of their length The blade of the valves has almost straight edges that are either smooth or serrated with an expanded distal gripping region (Fig 9DndashI) Triphyllous pedicellariae are more abundant than the tridentate form and are distributed all over the sea urchin test but occur in particularly large numbers around the peristome Their valves are small and broad (Fig 9JndashN) with numerous small peripheral teeth that form two rows along the edges of the valves which interlock when the valves are closed (Fig 9LndashN)

RODRIacuteGUEZ ET AL154 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 5 NHMTFMCBMEQ00232 holotype of Diadema africanum A aboral view B oral view C lateral view

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 155A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 6 NHMTFMCBMEQ00233 paratype of Diadema africanum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F auricle

RODRIacuteGUEZ ET AL156 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 7 NHMTFMCBMEQ00233 paratype of Diadema africanum Apical system and pattern of iridophores A genital plate gonopore and an ambulacrum B close-up of the apical system (paratype) C amp D pattern of iridophores around the apical system on a living specimen in daylight E pattern of iridophores at night F pattern of iridophore on a living specimen in daylight

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 157A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 8 NHMTFMCBMEQ00233 paratype of Diadema africanum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashL) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL158 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Introduction

Diadema Gray 1825 is a genus of sea urchin in the family Diadematidae Peters 1855 Species of this genus are distinctive in having inflated tests that resemble a crown or diadem with a depressed apical region a small inflated periproctal cone and raised ambulacra aborally Ambulacral plating in this genus is trigeminate with non-conjugated pore-pairs and phyllodes developed adorally Both primary and secondary spines are verticillate and have a hollow axial cavity

Diadema is one of the most abundant widespread and ecologically important genera among tropical sea urchins that live in shallow water habitats (Lawrence amp Sammarco 1982 Lessios et al 2001 Coppard amp Campbell 2005a 2007 Muthiga amp McClanahan 2007 Hernaacutendez et al 2008) However much confusion has arisen in the literature concerning species identifications This is because morphological differences between some species are slight (Pearse 1970 1998 Lessios et al 2001) Based on morphology the genus was considered to consist of seven species with the following distributions D setosum (Leske 1778) and D savignyi Michelin 1845 from the mid-Pacific to the East African coasts D paucispinum A Agassiz 1863 was thought to be endemic to Hawaii (Mortensen 1940) D palmeri Baker 1967 from the northern coasts of New Zealand (Baker 1967) and southeast coasts of Australia (Rowe amp Gates 1995) D mexicanum A Agassiz 1863 distributed off the tropical eastern Pacific coasts from the Sea of Cortez to Ecuador including the islands of Revillagigedos Clipperton Isla del Coco and the Galapagos D antillarum (Philippi 1845) distributed on both coasts of the Atlantic Ocean on the western coasts from Florida and Bermuda to Brazil and on the eastern coasts from Madeira to the Gulf of Guinea (this species was erroneously recorded by Mortensen (1940) in the Azores see Wirtz amp Martins 1993) and D ascensionis Mortensen 1909 from the mid-Atlantic Ascension St Helena and Fernando Noronha Islands which was designated as a subspecies of D antillarum by Pawson (1978) Considerable debate occurred in the early literature over whether eastern Atlantic D antillarum should be considered a subspecies (Koehler 1914 Clark 1925 Mortensen 1933) However these authors ultimately concluded that it was insufficiently different from western Atlantic D antillarum

A molecular study of Diadema by Lessios et al (2001) using both mitochondrial DNA (mtDNA) and isozymes revealed that the genus is composed of ten species Six of these are nominal species with an additional four species that are undescribed (see Fig 1) Populations of Diadema from the Central Atlantic islands of Ascension and St Helena were found to be a monophyletic entity nested within a Brazilian clade of D antillarum-a supporting the designation of D antillarum ascensionis as a subspecies Diadema paucispinum D savignyi D antillarum-a from the west and central Atlantic and D antillarum-b (also referred to as D aff antillarum sensu Hernaacutendez 2006 Clemente 2007) from the east Atlantic were found to form a polytomy This suggests that Dantillarum-a and D antillarum-b should be recognised as separate species as their mitochondrial DNA is as different from each other as among three accepted species

Studies by Coppard amp Campbell (2004 2006a 2006b) have described in detail morphological differences in test spine and tridentate pedicellarial structures among established species and subspecies of Diadema However it remains to be determined whether morphological differences can be established for the new species identified through their divergent mtDNA

In this study we undertook to identify diagnostic characters that differentiate eastern Atlantic Diadema from those of the western Atlantic We initially searched for the holotype of D antillarum but after searching through all known records of Philippirsquos collections we believe that the type material of D antillarum has been lost or destroyed Therefore to stabilize the nomenclature and following Article 75 of the International Code for Zoological Nomenclature (International Commission on Zoological Nomenclature 1999) we hereby designate a neotype of D antillarum To verify that the neotype of D antillarum was congruent with D antillarum-a and that D africanum conforms to D antillarum-b we sequenced the same part of Cytochrome oxidase I and Lysine t-RNA-ATPase-6 and ATPase-8 regions used by Lessios et al (2001) Sequences were aligned and phylogenetically analysed to confirm that type specimens belong to respective mitochondrial clades

Methods

Two specimens of D antillarum were collected by scuba diving off Juventud Island Cuba (21deg335592N 83deg

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 145A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

95446W) near Matanzas the type locality of D antillarum as designated by Philippi in the original description One of these specimens (TFMCBMEQ00237) has been deposited as the neotype of D antillarum in the Museo de Ciencias Naturales de Tenerife (TFMC) Tenerife Island (TFMCBMEQ00237)

Twenty-five specimens of D aff antillarum were collected by scuba diving fourteen individuals at three sites of the Canary Islands (Abades 28ordm 08acute 2794acuteacuteN 16ordm 26acute 1077acuteacuteW Las Galletas 28ordm 00acute 2887acuteacuteN 16ordm39acute4375acuteacuteW in Tenerife Island and Costa Teguise 28ordm 59acute3265acuteacuteN 13ordm 29acute1904acuteacuteW in Lanzarote Island) six specimens in Madeira Island (Playa Tivoli 32ordm 38acute0358acuteacuteN 16ordm 56acute0420acuteacuteW) and five specimens in Cape Verde (Mindelo 16ordm 54acute3720acuteacuteN 24ordm 58acute5485acuteacuteW in Sacirco Vicente Island)

Morphology The methodology used was modified from Coppard amp Campbell (2004 2006a 2006b) Fifty-six morphological characters were measured including features of the test spines (ambulacral and interambulacral) and tridentate pedicellariae Twenty-seven morphological characters of the test were measured from living and denuded specimens (Table 1) All characters were examined and measured using a binocular light microscope Tests were carefully cleaned using a solution of 50 Sodium Hypochlorite to reveal test characters which hold important morphological information The arrangement of test plates in the ambulacra and interambulacra were carefully studied This was aided by adding small quantities of 70 ethanol to the naked test which as it evaporated helped define the edges and features of individual plates Photographs were taken to provide a visual record of test structures that are typical of species allowing for a direct comparison

Four ambulacral and four interambulacral spines from each twenty-five specimens were equally cut into four regions comprising the total length of the spinersquos shaft (distal proximal and two intermediate regions) All regions were embedded in Agar 100 resin (Agar Scientific) (William et al 1991) and allowed to harden for four days Transverse sections of 10ndash30 microm were cut from each of the four regions using an Ultracut microtome Sections were mounted on slides using Agar 100 resin and dried on a hot plate for two days The slides were examined using a binocular light microscope Sections were not cut from the neck or base of the spines as such regions have been reported to show little variation among species within genera (Agassiz 1872 Mackintosh 1875 Mortensen 1940 Moreno et al 1980) The axial cavity solid wedges trabeculae and presenceabsence of reticular tissue were studied and photographed The size and proportion of the different features displayed by transverse sections were also measured (Table 2)

Five tridentate pedicellariae and five triphyllous pedicellariae were studied from each specimen These were stored in vials and preserved in 70 ethanol In total 125 pedicellariae of each type and their skeletal ossicles were observed by scanning electron microscopy (SEM) The pedicellariae were placed in 20 hydrogen peroxide (H2O2) to remove the soft tissue and expose the underlying calcareous ossicles To avoid overexposure to H2O2

which might damage the ossicles the cleaning process was observed under a binocular microscope The pedicellarial ossicles were then washed three times in distilled water and dried in absolute ethanol They were left overnight (in air) before being mounted on stubs and sputter coated in gold Preparations were observed using scanning electron microscopy (SEM) and pictures of each sample were taken Sixteen morphological characters used by Coppard amp Campbell (2006b) were measured on the images (Table 3) The peripheral gripping area was calculated from the measured dimensions as a percentage of the distal peripheral area

The morphological characters of test spines and pedicellariae were measured using ldquoImage Jrdquo software Data were statistically analysed using the software PRIMER (Plymouth Routines In Multivariate Ecological Research Clarke amp Warwick 1994) Principal Components Analyses (PCA) was applied only to the quantitative variables to assess the similarity of morphological characters between the neotype of D antillarum and D africanum These morphological characters were as follows Spine characters spine diameter number of solid wedges axial cavity mean diameter ( spine diameter) percentage of spinersquos diameter comprised by solid wedges and percentage of the spinersquos diameter comprised by foraminated ring pedicellarial characters types of pedicellariae length of distal region (mm) width of distal region (mm) length of proximal region (mm) width of proximal region (mm) total area of distal region (mm2) internal area of distal region (mm2)cedil peripheral area of distal region (that does not grip

(mm2) peripheral gripping area (mm2) total area of proximal region (mm2) adductor muscle insertion area (mm2) keel and peripheral area of proximal region (mm2) peripheral gripping area as of distal peripheral area (mm2) height of teeth (mm) and width of teeth (mm) test characters horizontal test diameter (mm) vertical test diameter (mm) mean number of tubercles on genital plates height to width (at widest point) ratio of genital plate diameter of gonopores (as a percentage of the genital platersquos height) apical system (as a percentage of the testrsquos horizontal diameter) periproct (as a percentage of testrsquos horizontal diameter) peristome (as a percentage of the testrsquos

RODRIacuteGUEZ ET AL146 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

horizontal diameter) and relative percentage of ambulacra to interambulacra at the ambitus Morphological differences among species were tested for the quantitative variables using the ANOSIM procedure (Clarke 1993)

DNA extraction sequencing and alignment Genomic DNA was extracted from the tube feet of the holotype of D africanum and from the neotype of D antillarum using a DNeasy tissue kit (Qiagen) Two regions of mitochondrial DNA (mtDNA) were amplified by polymerase chain reaction (PCR) using the protocol of Lessios et al (1998) and the primers of Lessios et al (2001) Cytochrome oxidase I (COI) was amplified using the CO1f 5rsquoCCTGCAGGAGGAG GAGAYCC and CO1a5rsquoAGTATAAGCGTCTGGGTAGTC primers while the Lysine-tRNA ATPase-6 and 8 region was amplified using LYSa 5rsquoAAGCTTTAAACTCTTAATTTAAAAG and ATP6b 5rsquoGCCAGGTAGAACCC GAGAAT primers The PCR products were purified and then cycle sequenced using the PCR primers and Applied Biosystems (ABI) PRISM BigDye Terminators Nucleotides were sequenced in both directions three times to check for consistency on an ABI automatic sequencer The sequences have been deposited into GenBank with the accession numbers KC622669 ndash KC622344 The sequences of both respective mtDNA regions from Lessios et al (2001) were downloaded from GenBank (accession numbers AY012728-AY013241) and aligned using ClustalX 209 (Larkin et al 2007) Sequence alignments were then compared in MacClade (Maddison amp Maddison 2001) jMODELTEST V 211 (Posada 2011) was used to determine the best model of molecular evolution for each gene based on the AIC criterion (Akaike 1974) From the tRNA ATPase region the coding ATPase-6 and ATPase-8 genes were assessed independently Tamura and Neirsquos (1993) model was suggested for both COI (TrN+G) and ATPase-6 (TrN+I+G) with a gamma distribution shape parameter 00970 in COI with a proportion of invariable sites (I=05100) and gamma correction (G=12230) in ATPase-6 A transitiontransversion model TIM1+I+G was suggested for ATPase-8 where I=03890 and G=35380 Genetic distances were calculated between the neotype of D antillarum and the holotype of D africanum and among closely related species of Diadema in PAUP (Swofford 2002) using maximum likelihood and the models base frequencies proportion of invariable sites and gamma correction suggested by jMODELTEST

Phylogenetic analysis Bayesian phylogenetic analyses were carried out on all unique haplotypes from the COI data and concatenated ATPase-6 and ATPase-8 coding regions using MRBAYES V 321 and the models suggested by jMODELTEST These analyses were conducted on the species identified by Lessios et al (2001) to form a polytomy with D antillarum and D africanum (D savignyi D paucispinum-a amp b D antillarum-a amp b) A single haplotype of D mexicanum was randomely chosen as an outgroup (only one outgroup is permitted in MRBAYES) with heating parameter T=02 The analysis was started with Dirichlet priors for rates and nucleotide

frequencies and run for 8 million generations sampling every 100th tree from two runs Convergence was assessed on the average standard deviation of slit frequencies lt001 and the potential scale reduction factor (Gelman amp Rubin 1992) reaching 100 for all parameters The first 25 of trees were discarded from both runs as burn-in and a 50 majority rule tree constructed while clades with less than 85 support were collapsed

A partitioned maximum likelihood analysis was also carried out in GARLI V20 (Zwickl 2006) using the models suggested by jMODELTEST Three replicate runs of one million iterations were conducted Branch support values were calculated in GARLI based on 400 bootstrap replicates and the bootstrap consensus tree calculated in PAUP

Results

Morphology

Diadema from the eastern Atlantic were found to be morphologically very close to D antillarum from the western Atlantic but even closer to D antillarum ascensionis from the mid Atlantic However small differences were found to support its designation as a distinct species Figure 1 illustrates the neotype (whole sea urchin) of D antillarum and Fig 2 a denuded test of D antillarum from the type locality Figs 3 and 4 show the spines and pedicellariae of D antillarum respectively Figure 5 illustrates the holotype of D africanum (whole sea urchin) and Fig 6 the paratype of D africanum (denuded test) Figure 7 shows details of the apical system and the iridophore pattern Figure 8 illustrates ambulacral spines and interambulacral spines of D africanum with transverse sections and Fig 9 the pedicellariae Figure 10 shows PCA plots of quantitative morphological characters of test spines and pedicellariae of D antillarum (neotype) of D africanum

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 147A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 1 NHMTFMCBMEQ00237 neotype of D antillarum A aboral view B oral view C lateral view

RODRIacuteGUEZ ET AL148 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 2 NHMTFMCBMEQ00237 neotype of D antillarum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F apical system

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 149A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 3 NHMTFMCBMEQ00237 neotype of D antillarum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashN) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL150 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 4 Scanning electron microscopy images (SEMs) of individual valves of tridentate pedicellariae and triphyllous pedicellariae of the neotype of D antillarum NHMTFMCBMEQ00237 AndashH tridentate pedicellariae AndashB external and internal views of a broad form CndashD side views of a broad form EndashF narrow form (external views) G internal view of a narrow form H side view of a narrow form I details of a narrow tridentate pedicellaria showing lateral teeth JndashK Triphyllous pedicellariae internal and external views respectively L details of a triphyllous pedicellaria showing peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 151A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Diadema Gray 1825

Gray 1825 p246 Type species Echinometra setosa Leske 1778 by ruling of the ICZN 1954Assigned species D setosum (Leske 1778) D savignyi Michelin 1845 D paucispinum A Agassiz 1863 D palmeri Baker

1967 D mexicanum A Agassiz 1863 D antillarum (Philippi 1845) D ascensionis Mortensen 1909 designated D antillarum ascensionis by Pawson (1978)

Diadema antillarum (Philippi 1845)Figs 1ndash4 tables 1ndash3

Cidaris (Diadema) antillarum Philippi 1845 Arch F Naturg 11 (1) p 355Diadema antillarum A Agassiz 1863 Bull MCZ 1 p19 Nutting 1895 Bull Univ Iowa Lab Nat Hist (3) p224

unnumbered plate fig1 (young Diadema labelled Aspidodiadema sp)

Neotype diagnosis Test and spines typically black with a red tinge However spines vary in colour from whitebrown to black Iridophores occur as a pentamerous ring around the apical disc Arch-shaped depressions are found on the apical disc along the inner edges of genital plates only in juveniles and young adults This character fades with age In transverse section ambulacral and interambulacral spines show an isosceles triangle-shaped solid wedges that constitute the shaft These wedges typically number sixteen in ambulacral spines and twenty in the largest interambulacral spines Only tridentate and triphyllous pedicellariae are present Tridentate pedicellariae occur as two forms one with broad valves and a narrow form Both forms have moderately curved valves and serrations along the edges of the valves

Material examined Neotype (TFMCBMEQ00237) in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material One specimen of the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology The species name refers to the species occurrence in The Antilles Islands Ecology Diadema antillarum is a key herbivore on Caribbean reefs Until 1983 this species was abundant on

Caribbean coral reefs and in seagrass beds In 1983 a non-identified pathogenic infection resulted in a mass die-off of this species which reduced population sizes by more than 97 in the Caribbean Sea and western Atlantic (Lessios 1984b 1988) Such population have failed to recover to pre-die-off numbers (Lessios 2005) Following the mass mortality of D antillarum there was an immediate increase in algal growth particularly in areas where herbivorous fish had been reduced in numbers through intense fishing pressure In such regions a reduction of algal-free areas suitable for coral settlement has been reported and is believed to be responsible for the reduction in coral-cover (Lessios 1988)

Diadema antillarum spawns around the time of the new moon typically on the first two days of the first lunar quarter (Lessios 1984a) Settlement times and levels of recruitment of D antillarum have been found to vary in different localities (Lewis 1966 Bauer 1976 Lessios 1981 1984b)

Distribution Diadema antillarum is found off the coasts of the tropical western Atlantic Ocean including the Caribbean Sea tropical coasts of South America down to Brazil and from Bermuda to Florida It is typically found in shallow waters on coral reefs but has been reported from depths of 70 m (Mortensen 1940)

Neotype description The test is hemispherical with a horizontal diameter of 450 mm and a vertical diameter of 205 mm (Fig 1) The epithelium of the test is black (Fig 1AndashC) with a red tinge In living specimens narrow blue lines of iridophores occur down either side of the naked median areas of the interambulacra and as a ring around the apical disc The apical system is hemicyclic and measures 2394 mm 24 of the testrsquos horizontal diameter (Fig 2D amp Table 1) The genital plates are wider than long with one to three tubercles along their inner edge (Table 1 amp Fig 2F) and a genital pore that measures 45 the genital plate length A faint arch-shaped depression occurs on the inner edge of each genital plate forming the corners of the apical ring Ocular plates are pentagonal in shape with two small tubercles in the centre of the plate The periproctal cone is small and black and does not have any platelets or markings on the skin (Fig 1A amp Table 1) The ambulacra are slightly raised aborally and measure 22 of the width of interambulacral measured at the ambitus (Table 1 amp Fig 2) They have two rows of large crenulate and perforate primary tubercles (Fig 2) with an offset inner series of small tubercles The

RODRIacuteGUEZ ET AL152 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

interambulacra measure 18 mm in width at the ambitus and contain four series of large primary tubercles with an offset inner series of small tubercles Each series contains 14 primary tubercles with areoles of moderate size (Fig 2 amp Table 1) The peristome measures 219 mm at the ambitus 481 of the horizontal diameter It is subcircular in shape and has five pairs of buccal tube feet The peristomial membrane is black and is covered with a large number of triphyllous pedicellariae Auricles are robust with high processes (Fig 2E)

Ambulacral and interambulacral spines differ in their width and ornamentation Ambulacral spines are black with a red tinge (Fig 3) the longest measures 2852 mm in length (6334 of the test horizontal) on the neotype 09 mm in width proximally and 05 mm distally (Fig 3EndashG) These are verticillate with barbs distally (Fig 3AndashC) and are typically composed of sixteen solid wedges

Interambulacral spines are predominantly black with a red tinge but a number of brown and white spines are present aborally (Figs 1 amp 3) They are long and slender the longest measuring 4737 mm in length on the neotype The spines are verticillate formed by 20 solid wedges which radiate out from a hollow axial cavity Spine width varies from 14 mm in diameter proximally to 09 mm distally with numerous barbs present distally (Figs 3HndashJ)

Only tridentate and triphyllous pedicellariae were found on the neotype with no claviform ophicephalous pedicellariae observed (Fig 4 amptable 3) Tridentate pedicellariae occur as two forms one with broad valves (Fig 4AndashD) and a long broad neck on a short stalk and a narrow form (comparing valves of equal length) with narrow valves a short neck and a long stalk (Fig 4EndashH) Both forms have moderately curved valves with serrations along edges of the blades of the valves (Figs 4GndashI) Both forms occur orally and aborally However the broad form is less abundant Triphyllous pedicellariae are typical of the genus in having broad valves that are rounded distally with numerous small peripheral teeth that occur in two rows (Figs 4JndashL) The head of each pedicellaria is supported by a long muscular neck attached to a long stalk

Diadema africanum sp novFigs 5ndash10 tables 1ndash3

Diagnosis Test and spines typically black with a red tinge and a turquoise sheen when viewed in direct sunlight The iridophore pattern occurs as bold blue lines down either side of the naked interambulacral areas as a pentamerous ring around the apical disc and as lines along some plate boundaries Apical disc is hemicyclic with arch-shaped depressions on the denuded genital plates in both adults and juveniles Gonopores measure 33 of the length of the genital plates The periproctal cone is black with no markings The Peristome is proportionally large measuring 40ndash60 of the testrsquos horizontal diameter Spines are verticillate and hollow with distal barbs Verticilations are formed of urn-shaped solid wedges that are visible when the spines are viewed in transverse section These wedges typically number twenty in ambulacral spines and twenty-four in interambulacral spines Only tridentate and triphyllous pedicellariae are present The tridentate pedicellariae occur as a single form with reasonably broad curved valves with almost straight edges that can either be smooth or serrated with an expanded distal gripping region The blades of the valves meet only along the upper fifth of their length The head of each pedicellaria is supported by a long muscular neck attached to a mid-length stalk

Holotype TFMCBMEQ00232 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Paratypes TFMCBMEQ 00233 TFMCBMEQ 00234 TFMCBMEQ 00235 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material Twenty-one specimens in the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology Species name refers to the geographical distribution of the species on the western coasts of Africa It is distributed on islands and continental coasts along the African continental shelf

Ecology Diadema africanum is an important macro-herbivore on subtropical and tropical rocky reefs off the West African coasts In the eastern Atlantic islands and particularly in Madeira and the Canary Islands the species is distributed throughout the islands at densities that can reach more than 12 individuals m2 (Brito et al 1984 Alves et al 2001 Hernaacutendez 2006 Clemente 2007 Hernaacutendez et al 2008) The species can therefore dramatically reduce the abundance of non-crustose macroalgae resulting in the formation of sea urchin-dominated barren grounds (Hernaacutendez et al 2008) This phenomenon is especially relevant in Madeira Salvage and the Canary Islands where macroalgal beds represent the main ecosystem Diadema africanum also occurs on coral dominated

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 153A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

reefs in Cape Verde and Sacirco Tome where sea urchin control of macroalgae via grazing is beneficial for coral settlement and growth Only a few studies have looked at the abundance and ecological role of D africanum along the tropical western African coasts (eg John et al 1977 1992) with further investigations needed

Distribution Diadema africanum occurs in the Eastern Atlantic islands from Madeira Islands to the Guinean Gulf including Salvage Islands Canary Islands Cape Verde Islands (Hernaacutendez et al 2008) and Sacirco Tome Island (Lessios et al 2001) It has also been also recorded in continental areas of Ghana (John et al 1977 1992) and in Ngor Island Senegal (P Wirtz pers com)

Description The test is hemispherical with a horizontal diameter of 6673 mm and a vertical diameter of 3278 mm in the paratype and 6123 mm hd and 3136 mm vd in the holotype The base colour of the test epithelium is black with a red tinge (Fig 5AndashC) while the denuded test is white (Fig 6AndashE) The apical system measures 1814 mm in the paratype and is hemicyclic with ocular plates II and III exsert (Fig 6A) The genital plates are wider than long and have up to four small tubercles along their inner-edge (Table 1amp Fig 7AndashB) with large genital pores that measure 33 of the genital plate length (Fig 7A) The ocular plates are pentagonal with a small pore located at the top of the plate and have from one to three small tubercles along the centre of the plate (Fig 7B)

On the naked test distinct arch-shaped depressions are present on the genital plates of both adults and juveniles (Table 5 ampFig 7B) These depressions correspond to the corners of the pentamerous apical ring of iridophores seen in living sea urchins (Fig 7CndashE) The iridophore pattern is bold and bright on the apical system when viewed in sunlight The periproct is 1126 mm wide in the paratype (approximately 16 of the testrsquos horizontal diameter) and has a small black periproctal cone that has no platelets or markings on the skin (Fig 5A)

The ambulacra are slightly raised aborally (Fig 6C) and measure 30 of the width of the interambulacra (865 mm) at the ambitus in the paratype They have two rows of large primary tubercles and an offset inner series of small tubercles that are perforated and crenulated with non-conjugate pore-pairs and phyllodes developed adorally

The interambulacra are broader than the ambulacra at the ambitus (Fig 6CndashD) with 5ndash6 series (the inner median series is more offset in some specimens giving the impression of two series) of 14 primary tubercles Tubercles are perforate and crenulate and have areoles of moderate size (Fig 7A) During the day blue lines of iridophores can be seen down either side of the naked median regions

The peristome is subcircular (Fig 6B) and in the paratype it measures 269 mm in diameter 40 of the testrsquos horizontal diameter The peristomal membrane is black with a red tinge and has five pairs of buccal tube feet (Fig 5B) with abundant triphyllous pedicellariae The auricles are robust and have high processes (Fig 6F)

In adults the spine epithelium is black with a red tinge and a turquoise sheen when viewed in direct sunlight In juveniles spines are banded red and white which is typical of the genus Ambulacral spines measure 4321 mm in length in the paratype (2883 of the test horizontal diameter) These spines are strongly verticillate with barbs pointing distally (Fig 8AndashD) Proximally these spines have a mean diameter of 089 mm that decreases distally (Fig 8EndashG) The axial cavity comprises 288 of the horizontal diameter which increases to 3522 in the distal region (Fig 8EndashG) The solid wedges are urn-shaped and typically number twenty comprising 6342 of the spinersquos horizontal diameter in the proximal section

Interambulacral spines (Fig 8HndashN) are long and slender with a maximum diameter of 2 mm proximally and taper distally (Fig 8KndashN) These spines measure 5862 mm in the paratype In transverse section the axial cavity comprises 2992 of the horizontal diameter proximally but increases to 3917 in the distal region (Table 2 Fig 8LndashN) The solid wedges are urn-shaped and typically number twenty-four 6257 of the of the spinersquos horizontal diameter in the proximal section

Both tridentate and triphyllous pedicellariae are present in D africanum (Fig 9) No ophicephalous pedicellariae were found either true ophicephalous or of the claviform type which have been reported in other species of Diadema (Mortensen 1940) Only a single form of tridentate pedicellaria is found in this species (Fig 9AndashI) which are abundant orally and aborally but particularly around the periproct and around the peristome This form of tidentate pedicellaria has a long muscular neck on a long stalk which allows a high degree of movement (Fig 9A) The valves of the pedicellariae are moderately curved and only meet along the upper fifth of their length The blade of the valves has almost straight edges that are either smooth or serrated with an expanded distal gripping region (Fig 9DndashI) Triphyllous pedicellariae are more abundant than the tridentate form and are distributed all over the sea urchin test but occur in particularly large numbers around the peristome Their valves are small and broad (Fig 9JndashN) with numerous small peripheral teeth that form two rows along the edges of the valves which interlock when the valves are closed (Fig 9LndashN)

RODRIacuteGUEZ ET AL154 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 5 NHMTFMCBMEQ00232 holotype of Diadema africanum A aboral view B oral view C lateral view

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 155A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 6 NHMTFMCBMEQ00233 paratype of Diadema africanum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F auricle

RODRIacuteGUEZ ET AL156 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 7 NHMTFMCBMEQ00233 paratype of Diadema africanum Apical system and pattern of iridophores A genital plate gonopore and an ambulacrum B close-up of the apical system (paratype) C amp D pattern of iridophores around the apical system on a living specimen in daylight E pattern of iridophores at night F pattern of iridophore on a living specimen in daylight

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 157A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 8 NHMTFMCBMEQ00233 paratype of Diadema africanum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashL) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL158 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

95446W) near Matanzas the type locality of D antillarum as designated by Philippi in the original description One of these specimens (TFMCBMEQ00237) has been deposited as the neotype of D antillarum in the Museo de Ciencias Naturales de Tenerife (TFMC) Tenerife Island (TFMCBMEQ00237)

Twenty-five specimens of D aff antillarum were collected by scuba diving fourteen individuals at three sites of the Canary Islands (Abades 28ordm 08acute 2794acuteacuteN 16ordm 26acute 1077acuteacuteW Las Galletas 28ordm 00acute 2887acuteacuteN 16ordm39acute4375acuteacuteW in Tenerife Island and Costa Teguise 28ordm 59acute3265acuteacuteN 13ordm 29acute1904acuteacuteW in Lanzarote Island) six specimens in Madeira Island (Playa Tivoli 32ordm 38acute0358acuteacuteN 16ordm 56acute0420acuteacuteW) and five specimens in Cape Verde (Mindelo 16ordm 54acute3720acuteacuteN 24ordm 58acute5485acuteacuteW in Sacirco Vicente Island)

Morphology The methodology used was modified from Coppard amp Campbell (2004 2006a 2006b) Fifty-six morphological characters were measured including features of the test spines (ambulacral and interambulacral) and tridentate pedicellariae Twenty-seven morphological characters of the test were measured from living and denuded specimens (Table 1) All characters were examined and measured using a binocular light microscope Tests were carefully cleaned using a solution of 50 Sodium Hypochlorite to reveal test characters which hold important morphological information The arrangement of test plates in the ambulacra and interambulacra were carefully studied This was aided by adding small quantities of 70 ethanol to the naked test which as it evaporated helped define the edges and features of individual plates Photographs were taken to provide a visual record of test structures that are typical of species allowing for a direct comparison

Four ambulacral and four interambulacral spines from each twenty-five specimens were equally cut into four regions comprising the total length of the spinersquos shaft (distal proximal and two intermediate regions) All regions were embedded in Agar 100 resin (Agar Scientific) (William et al 1991) and allowed to harden for four days Transverse sections of 10ndash30 microm were cut from each of the four regions using an Ultracut microtome Sections were mounted on slides using Agar 100 resin and dried on a hot plate for two days The slides were examined using a binocular light microscope Sections were not cut from the neck or base of the spines as such regions have been reported to show little variation among species within genera (Agassiz 1872 Mackintosh 1875 Mortensen 1940 Moreno et al 1980) The axial cavity solid wedges trabeculae and presenceabsence of reticular tissue were studied and photographed The size and proportion of the different features displayed by transverse sections were also measured (Table 2)

Five tridentate pedicellariae and five triphyllous pedicellariae were studied from each specimen These were stored in vials and preserved in 70 ethanol In total 125 pedicellariae of each type and their skeletal ossicles were observed by scanning electron microscopy (SEM) The pedicellariae were placed in 20 hydrogen peroxide (H2O2) to remove the soft tissue and expose the underlying calcareous ossicles To avoid overexposure to H2O2

which might damage the ossicles the cleaning process was observed under a binocular microscope The pedicellarial ossicles were then washed three times in distilled water and dried in absolute ethanol They were left overnight (in air) before being mounted on stubs and sputter coated in gold Preparations were observed using scanning electron microscopy (SEM) and pictures of each sample were taken Sixteen morphological characters used by Coppard amp Campbell (2006b) were measured on the images (Table 3) The peripheral gripping area was calculated from the measured dimensions as a percentage of the distal peripheral area

The morphological characters of test spines and pedicellariae were measured using ldquoImage Jrdquo software Data were statistically analysed using the software PRIMER (Plymouth Routines In Multivariate Ecological Research Clarke amp Warwick 1994) Principal Components Analyses (PCA) was applied only to the quantitative variables to assess the similarity of morphological characters between the neotype of D antillarum and D africanum These morphological characters were as follows Spine characters spine diameter number of solid wedges axial cavity mean diameter ( spine diameter) percentage of spinersquos diameter comprised by solid wedges and percentage of the spinersquos diameter comprised by foraminated ring pedicellarial characters types of pedicellariae length of distal region (mm) width of distal region (mm) length of proximal region (mm) width of proximal region (mm) total area of distal region (mm2) internal area of distal region (mm2)cedil peripheral area of distal region (that does not grip

(mm2) peripheral gripping area (mm2) total area of proximal region (mm2) adductor muscle insertion area (mm2) keel and peripheral area of proximal region (mm2) peripheral gripping area as of distal peripheral area (mm2) height of teeth (mm) and width of teeth (mm) test characters horizontal test diameter (mm) vertical test diameter (mm) mean number of tubercles on genital plates height to width (at widest point) ratio of genital plate diameter of gonopores (as a percentage of the genital platersquos height) apical system (as a percentage of the testrsquos horizontal diameter) periproct (as a percentage of testrsquos horizontal diameter) peristome (as a percentage of the testrsquos

RODRIacuteGUEZ ET AL146 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

horizontal diameter) and relative percentage of ambulacra to interambulacra at the ambitus Morphological differences among species were tested for the quantitative variables using the ANOSIM procedure (Clarke 1993)

DNA extraction sequencing and alignment Genomic DNA was extracted from the tube feet of the holotype of D africanum and from the neotype of D antillarum using a DNeasy tissue kit (Qiagen) Two regions of mitochondrial DNA (mtDNA) were amplified by polymerase chain reaction (PCR) using the protocol of Lessios et al (1998) and the primers of Lessios et al (2001) Cytochrome oxidase I (COI) was amplified using the CO1f 5rsquoCCTGCAGGAGGAG GAGAYCC and CO1a5rsquoAGTATAAGCGTCTGGGTAGTC primers while the Lysine-tRNA ATPase-6 and 8 region was amplified using LYSa 5rsquoAAGCTTTAAACTCTTAATTTAAAAG and ATP6b 5rsquoGCCAGGTAGAACCC GAGAAT primers The PCR products were purified and then cycle sequenced using the PCR primers and Applied Biosystems (ABI) PRISM BigDye Terminators Nucleotides were sequenced in both directions three times to check for consistency on an ABI automatic sequencer The sequences have been deposited into GenBank with the accession numbers KC622669 ndash KC622344 The sequences of both respective mtDNA regions from Lessios et al (2001) were downloaded from GenBank (accession numbers AY012728-AY013241) and aligned using ClustalX 209 (Larkin et al 2007) Sequence alignments were then compared in MacClade (Maddison amp Maddison 2001) jMODELTEST V 211 (Posada 2011) was used to determine the best model of molecular evolution for each gene based on the AIC criterion (Akaike 1974) From the tRNA ATPase region the coding ATPase-6 and ATPase-8 genes were assessed independently Tamura and Neirsquos (1993) model was suggested for both COI (TrN+G) and ATPase-6 (TrN+I+G) with a gamma distribution shape parameter 00970 in COI with a proportion of invariable sites (I=05100) and gamma correction (G=12230) in ATPase-6 A transitiontransversion model TIM1+I+G was suggested for ATPase-8 where I=03890 and G=35380 Genetic distances were calculated between the neotype of D antillarum and the holotype of D africanum and among closely related species of Diadema in PAUP (Swofford 2002) using maximum likelihood and the models base frequencies proportion of invariable sites and gamma correction suggested by jMODELTEST

Phylogenetic analysis Bayesian phylogenetic analyses were carried out on all unique haplotypes from the COI data and concatenated ATPase-6 and ATPase-8 coding regions using MRBAYES V 321 and the models suggested by jMODELTEST These analyses were conducted on the species identified by Lessios et al (2001) to form a polytomy with D antillarum and D africanum (D savignyi D paucispinum-a amp b D antillarum-a amp b) A single haplotype of D mexicanum was randomely chosen as an outgroup (only one outgroup is permitted in MRBAYES) with heating parameter T=02 The analysis was started with Dirichlet priors for rates and nucleotide

frequencies and run for 8 million generations sampling every 100th tree from two runs Convergence was assessed on the average standard deviation of slit frequencies lt001 and the potential scale reduction factor (Gelman amp Rubin 1992) reaching 100 for all parameters The first 25 of trees were discarded from both runs as burn-in and a 50 majority rule tree constructed while clades with less than 85 support were collapsed

A partitioned maximum likelihood analysis was also carried out in GARLI V20 (Zwickl 2006) using the models suggested by jMODELTEST Three replicate runs of one million iterations were conducted Branch support values were calculated in GARLI based on 400 bootstrap replicates and the bootstrap consensus tree calculated in PAUP

Results

Morphology

Diadema from the eastern Atlantic were found to be morphologically very close to D antillarum from the western Atlantic but even closer to D antillarum ascensionis from the mid Atlantic However small differences were found to support its designation as a distinct species Figure 1 illustrates the neotype (whole sea urchin) of D antillarum and Fig 2 a denuded test of D antillarum from the type locality Figs 3 and 4 show the spines and pedicellariae of D antillarum respectively Figure 5 illustrates the holotype of D africanum (whole sea urchin) and Fig 6 the paratype of D africanum (denuded test) Figure 7 shows details of the apical system and the iridophore pattern Figure 8 illustrates ambulacral spines and interambulacral spines of D africanum with transverse sections and Fig 9 the pedicellariae Figure 10 shows PCA plots of quantitative morphological characters of test spines and pedicellariae of D antillarum (neotype) of D africanum

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 147A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 1 NHMTFMCBMEQ00237 neotype of D antillarum A aboral view B oral view C lateral view

RODRIacuteGUEZ ET AL148 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 2 NHMTFMCBMEQ00237 neotype of D antillarum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F apical system

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 149A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 3 NHMTFMCBMEQ00237 neotype of D antillarum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashN) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL150 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 4 Scanning electron microscopy images (SEMs) of individual valves of tridentate pedicellariae and triphyllous pedicellariae of the neotype of D antillarum NHMTFMCBMEQ00237 AndashH tridentate pedicellariae AndashB external and internal views of a broad form CndashD side views of a broad form EndashF narrow form (external views) G internal view of a narrow form H side view of a narrow form I details of a narrow tridentate pedicellaria showing lateral teeth JndashK Triphyllous pedicellariae internal and external views respectively L details of a triphyllous pedicellaria showing peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 151A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Diadema Gray 1825

Gray 1825 p246 Type species Echinometra setosa Leske 1778 by ruling of the ICZN 1954Assigned species D setosum (Leske 1778) D savignyi Michelin 1845 D paucispinum A Agassiz 1863 D palmeri Baker

1967 D mexicanum A Agassiz 1863 D antillarum (Philippi 1845) D ascensionis Mortensen 1909 designated D antillarum ascensionis by Pawson (1978)

Diadema antillarum (Philippi 1845)Figs 1ndash4 tables 1ndash3

Cidaris (Diadema) antillarum Philippi 1845 Arch F Naturg 11 (1) p 355Diadema antillarum A Agassiz 1863 Bull MCZ 1 p19 Nutting 1895 Bull Univ Iowa Lab Nat Hist (3) p224

unnumbered plate fig1 (young Diadema labelled Aspidodiadema sp)

Neotype diagnosis Test and spines typically black with a red tinge However spines vary in colour from whitebrown to black Iridophores occur as a pentamerous ring around the apical disc Arch-shaped depressions are found on the apical disc along the inner edges of genital plates only in juveniles and young adults This character fades with age In transverse section ambulacral and interambulacral spines show an isosceles triangle-shaped solid wedges that constitute the shaft These wedges typically number sixteen in ambulacral spines and twenty in the largest interambulacral spines Only tridentate and triphyllous pedicellariae are present Tridentate pedicellariae occur as two forms one with broad valves and a narrow form Both forms have moderately curved valves and serrations along the edges of the valves

Material examined Neotype (TFMCBMEQ00237) in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material One specimen of the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology The species name refers to the species occurrence in The Antilles Islands Ecology Diadema antillarum is a key herbivore on Caribbean reefs Until 1983 this species was abundant on

Caribbean coral reefs and in seagrass beds In 1983 a non-identified pathogenic infection resulted in a mass die-off of this species which reduced population sizes by more than 97 in the Caribbean Sea and western Atlantic (Lessios 1984b 1988) Such population have failed to recover to pre-die-off numbers (Lessios 2005) Following the mass mortality of D antillarum there was an immediate increase in algal growth particularly in areas where herbivorous fish had been reduced in numbers through intense fishing pressure In such regions a reduction of algal-free areas suitable for coral settlement has been reported and is believed to be responsible for the reduction in coral-cover (Lessios 1988)

Diadema antillarum spawns around the time of the new moon typically on the first two days of the first lunar quarter (Lessios 1984a) Settlement times and levels of recruitment of D antillarum have been found to vary in different localities (Lewis 1966 Bauer 1976 Lessios 1981 1984b)

Distribution Diadema antillarum is found off the coasts of the tropical western Atlantic Ocean including the Caribbean Sea tropical coasts of South America down to Brazil and from Bermuda to Florida It is typically found in shallow waters on coral reefs but has been reported from depths of 70 m (Mortensen 1940)

Neotype description The test is hemispherical with a horizontal diameter of 450 mm and a vertical diameter of 205 mm (Fig 1) The epithelium of the test is black (Fig 1AndashC) with a red tinge In living specimens narrow blue lines of iridophores occur down either side of the naked median areas of the interambulacra and as a ring around the apical disc The apical system is hemicyclic and measures 2394 mm 24 of the testrsquos horizontal diameter (Fig 2D amp Table 1) The genital plates are wider than long with one to three tubercles along their inner edge (Table 1 amp Fig 2F) and a genital pore that measures 45 the genital plate length A faint arch-shaped depression occurs on the inner edge of each genital plate forming the corners of the apical ring Ocular plates are pentagonal in shape with two small tubercles in the centre of the plate The periproctal cone is small and black and does not have any platelets or markings on the skin (Fig 1A amp Table 1) The ambulacra are slightly raised aborally and measure 22 of the width of interambulacral measured at the ambitus (Table 1 amp Fig 2) They have two rows of large crenulate and perforate primary tubercles (Fig 2) with an offset inner series of small tubercles The

RODRIacuteGUEZ ET AL152 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

interambulacra measure 18 mm in width at the ambitus and contain four series of large primary tubercles with an offset inner series of small tubercles Each series contains 14 primary tubercles with areoles of moderate size (Fig 2 amp Table 1) The peristome measures 219 mm at the ambitus 481 of the horizontal diameter It is subcircular in shape and has five pairs of buccal tube feet The peristomial membrane is black and is covered with a large number of triphyllous pedicellariae Auricles are robust with high processes (Fig 2E)

Ambulacral and interambulacral spines differ in their width and ornamentation Ambulacral spines are black with a red tinge (Fig 3) the longest measures 2852 mm in length (6334 of the test horizontal) on the neotype 09 mm in width proximally and 05 mm distally (Fig 3EndashG) These are verticillate with barbs distally (Fig 3AndashC) and are typically composed of sixteen solid wedges

Interambulacral spines are predominantly black with a red tinge but a number of brown and white spines are present aborally (Figs 1 amp 3) They are long and slender the longest measuring 4737 mm in length on the neotype The spines are verticillate formed by 20 solid wedges which radiate out from a hollow axial cavity Spine width varies from 14 mm in diameter proximally to 09 mm distally with numerous barbs present distally (Figs 3HndashJ)

Only tridentate and triphyllous pedicellariae were found on the neotype with no claviform ophicephalous pedicellariae observed (Fig 4 amptable 3) Tridentate pedicellariae occur as two forms one with broad valves (Fig 4AndashD) and a long broad neck on a short stalk and a narrow form (comparing valves of equal length) with narrow valves a short neck and a long stalk (Fig 4EndashH) Both forms have moderately curved valves with serrations along edges of the blades of the valves (Figs 4GndashI) Both forms occur orally and aborally However the broad form is less abundant Triphyllous pedicellariae are typical of the genus in having broad valves that are rounded distally with numerous small peripheral teeth that occur in two rows (Figs 4JndashL) The head of each pedicellaria is supported by a long muscular neck attached to a long stalk

Diadema africanum sp novFigs 5ndash10 tables 1ndash3

Diagnosis Test and spines typically black with a red tinge and a turquoise sheen when viewed in direct sunlight The iridophore pattern occurs as bold blue lines down either side of the naked interambulacral areas as a pentamerous ring around the apical disc and as lines along some plate boundaries Apical disc is hemicyclic with arch-shaped depressions on the denuded genital plates in both adults and juveniles Gonopores measure 33 of the length of the genital plates The periproctal cone is black with no markings The Peristome is proportionally large measuring 40ndash60 of the testrsquos horizontal diameter Spines are verticillate and hollow with distal barbs Verticilations are formed of urn-shaped solid wedges that are visible when the spines are viewed in transverse section These wedges typically number twenty in ambulacral spines and twenty-four in interambulacral spines Only tridentate and triphyllous pedicellariae are present The tridentate pedicellariae occur as a single form with reasonably broad curved valves with almost straight edges that can either be smooth or serrated with an expanded distal gripping region The blades of the valves meet only along the upper fifth of their length The head of each pedicellaria is supported by a long muscular neck attached to a mid-length stalk

Holotype TFMCBMEQ00232 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Paratypes TFMCBMEQ 00233 TFMCBMEQ 00234 TFMCBMEQ 00235 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material Twenty-one specimens in the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology Species name refers to the geographical distribution of the species on the western coasts of Africa It is distributed on islands and continental coasts along the African continental shelf

Ecology Diadema africanum is an important macro-herbivore on subtropical and tropical rocky reefs off the West African coasts In the eastern Atlantic islands and particularly in Madeira and the Canary Islands the species is distributed throughout the islands at densities that can reach more than 12 individuals m2 (Brito et al 1984 Alves et al 2001 Hernaacutendez 2006 Clemente 2007 Hernaacutendez et al 2008) The species can therefore dramatically reduce the abundance of non-crustose macroalgae resulting in the formation of sea urchin-dominated barren grounds (Hernaacutendez et al 2008) This phenomenon is especially relevant in Madeira Salvage and the Canary Islands where macroalgal beds represent the main ecosystem Diadema africanum also occurs on coral dominated

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 153A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

reefs in Cape Verde and Sacirco Tome where sea urchin control of macroalgae via grazing is beneficial for coral settlement and growth Only a few studies have looked at the abundance and ecological role of D africanum along the tropical western African coasts (eg John et al 1977 1992) with further investigations needed

Distribution Diadema africanum occurs in the Eastern Atlantic islands from Madeira Islands to the Guinean Gulf including Salvage Islands Canary Islands Cape Verde Islands (Hernaacutendez et al 2008) and Sacirco Tome Island (Lessios et al 2001) It has also been also recorded in continental areas of Ghana (John et al 1977 1992) and in Ngor Island Senegal (P Wirtz pers com)

Description The test is hemispherical with a horizontal diameter of 6673 mm and a vertical diameter of 3278 mm in the paratype and 6123 mm hd and 3136 mm vd in the holotype The base colour of the test epithelium is black with a red tinge (Fig 5AndashC) while the denuded test is white (Fig 6AndashE) The apical system measures 1814 mm in the paratype and is hemicyclic with ocular plates II and III exsert (Fig 6A) The genital plates are wider than long and have up to four small tubercles along their inner-edge (Table 1amp Fig 7AndashB) with large genital pores that measure 33 of the genital plate length (Fig 7A) The ocular plates are pentagonal with a small pore located at the top of the plate and have from one to three small tubercles along the centre of the plate (Fig 7B)

On the naked test distinct arch-shaped depressions are present on the genital plates of both adults and juveniles (Table 5 ampFig 7B) These depressions correspond to the corners of the pentamerous apical ring of iridophores seen in living sea urchins (Fig 7CndashE) The iridophore pattern is bold and bright on the apical system when viewed in sunlight The periproct is 1126 mm wide in the paratype (approximately 16 of the testrsquos horizontal diameter) and has a small black periproctal cone that has no platelets or markings on the skin (Fig 5A)

The ambulacra are slightly raised aborally (Fig 6C) and measure 30 of the width of the interambulacra (865 mm) at the ambitus in the paratype They have two rows of large primary tubercles and an offset inner series of small tubercles that are perforated and crenulated with non-conjugate pore-pairs and phyllodes developed adorally

The interambulacra are broader than the ambulacra at the ambitus (Fig 6CndashD) with 5ndash6 series (the inner median series is more offset in some specimens giving the impression of two series) of 14 primary tubercles Tubercles are perforate and crenulate and have areoles of moderate size (Fig 7A) During the day blue lines of iridophores can be seen down either side of the naked median regions

The peristome is subcircular (Fig 6B) and in the paratype it measures 269 mm in diameter 40 of the testrsquos horizontal diameter The peristomal membrane is black with a red tinge and has five pairs of buccal tube feet (Fig 5B) with abundant triphyllous pedicellariae The auricles are robust and have high processes (Fig 6F)

In adults the spine epithelium is black with a red tinge and a turquoise sheen when viewed in direct sunlight In juveniles spines are banded red and white which is typical of the genus Ambulacral spines measure 4321 mm in length in the paratype (2883 of the test horizontal diameter) These spines are strongly verticillate with barbs pointing distally (Fig 8AndashD) Proximally these spines have a mean diameter of 089 mm that decreases distally (Fig 8EndashG) The axial cavity comprises 288 of the horizontal diameter which increases to 3522 in the distal region (Fig 8EndashG) The solid wedges are urn-shaped and typically number twenty comprising 6342 of the spinersquos horizontal diameter in the proximal section

Interambulacral spines (Fig 8HndashN) are long and slender with a maximum diameter of 2 mm proximally and taper distally (Fig 8KndashN) These spines measure 5862 mm in the paratype In transverse section the axial cavity comprises 2992 of the horizontal diameter proximally but increases to 3917 in the distal region (Table 2 Fig 8LndashN) The solid wedges are urn-shaped and typically number twenty-four 6257 of the of the spinersquos horizontal diameter in the proximal section

Both tridentate and triphyllous pedicellariae are present in D africanum (Fig 9) No ophicephalous pedicellariae were found either true ophicephalous or of the claviform type which have been reported in other species of Diadema (Mortensen 1940) Only a single form of tridentate pedicellaria is found in this species (Fig 9AndashI) which are abundant orally and aborally but particularly around the periproct and around the peristome This form of tidentate pedicellaria has a long muscular neck on a long stalk which allows a high degree of movement (Fig 9A) The valves of the pedicellariae are moderately curved and only meet along the upper fifth of their length The blade of the valves has almost straight edges that are either smooth or serrated with an expanded distal gripping region (Fig 9DndashI) Triphyllous pedicellariae are more abundant than the tridentate form and are distributed all over the sea urchin test but occur in particularly large numbers around the peristome Their valves are small and broad (Fig 9JndashN) with numerous small peripheral teeth that form two rows along the edges of the valves which interlock when the valves are closed (Fig 9LndashN)

RODRIacuteGUEZ ET AL154 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 5 NHMTFMCBMEQ00232 holotype of Diadema africanum A aboral view B oral view C lateral view

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 155A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 6 NHMTFMCBMEQ00233 paratype of Diadema africanum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F auricle

RODRIacuteGUEZ ET AL156 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 7 NHMTFMCBMEQ00233 paratype of Diadema africanum Apical system and pattern of iridophores A genital plate gonopore and an ambulacrum B close-up of the apical system (paratype) C amp D pattern of iridophores around the apical system on a living specimen in daylight E pattern of iridophores at night F pattern of iridophore on a living specimen in daylight

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 157A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 8 NHMTFMCBMEQ00233 paratype of Diadema africanum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashL) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL158 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

horizontal diameter) and relative percentage of ambulacra to interambulacra at the ambitus Morphological differences among species were tested for the quantitative variables using the ANOSIM procedure (Clarke 1993)

DNA extraction sequencing and alignment Genomic DNA was extracted from the tube feet of the holotype of D africanum and from the neotype of D antillarum using a DNeasy tissue kit (Qiagen) Two regions of mitochondrial DNA (mtDNA) were amplified by polymerase chain reaction (PCR) using the protocol of Lessios et al (1998) and the primers of Lessios et al (2001) Cytochrome oxidase I (COI) was amplified using the CO1f 5rsquoCCTGCAGGAGGAG GAGAYCC and CO1a5rsquoAGTATAAGCGTCTGGGTAGTC primers while the Lysine-tRNA ATPase-6 and 8 region was amplified using LYSa 5rsquoAAGCTTTAAACTCTTAATTTAAAAG and ATP6b 5rsquoGCCAGGTAGAACCC GAGAAT primers The PCR products were purified and then cycle sequenced using the PCR primers and Applied Biosystems (ABI) PRISM BigDye Terminators Nucleotides were sequenced in both directions three times to check for consistency on an ABI automatic sequencer The sequences have been deposited into GenBank with the accession numbers KC622669 ndash KC622344 The sequences of both respective mtDNA regions from Lessios et al (2001) were downloaded from GenBank (accession numbers AY012728-AY013241) and aligned using ClustalX 209 (Larkin et al 2007) Sequence alignments were then compared in MacClade (Maddison amp Maddison 2001) jMODELTEST V 211 (Posada 2011) was used to determine the best model of molecular evolution for each gene based on the AIC criterion (Akaike 1974) From the tRNA ATPase region the coding ATPase-6 and ATPase-8 genes were assessed independently Tamura and Neirsquos (1993) model was suggested for both COI (TrN+G) and ATPase-6 (TrN+I+G) with a gamma distribution shape parameter 00970 in COI with a proportion of invariable sites (I=05100) and gamma correction (G=12230) in ATPase-6 A transitiontransversion model TIM1+I+G was suggested for ATPase-8 where I=03890 and G=35380 Genetic distances were calculated between the neotype of D antillarum and the holotype of D africanum and among closely related species of Diadema in PAUP (Swofford 2002) using maximum likelihood and the models base frequencies proportion of invariable sites and gamma correction suggested by jMODELTEST

Phylogenetic analysis Bayesian phylogenetic analyses were carried out on all unique haplotypes from the COI data and concatenated ATPase-6 and ATPase-8 coding regions using MRBAYES V 321 and the models suggested by jMODELTEST These analyses were conducted on the species identified by Lessios et al (2001) to form a polytomy with D antillarum and D africanum (D savignyi D paucispinum-a amp b D antillarum-a amp b) A single haplotype of D mexicanum was randomely chosen as an outgroup (only one outgroup is permitted in MRBAYES) with heating parameter T=02 The analysis was started with Dirichlet priors for rates and nucleotide

frequencies and run for 8 million generations sampling every 100th tree from two runs Convergence was assessed on the average standard deviation of slit frequencies lt001 and the potential scale reduction factor (Gelman amp Rubin 1992) reaching 100 for all parameters The first 25 of trees were discarded from both runs as burn-in and a 50 majority rule tree constructed while clades with less than 85 support were collapsed

A partitioned maximum likelihood analysis was also carried out in GARLI V20 (Zwickl 2006) using the models suggested by jMODELTEST Three replicate runs of one million iterations were conducted Branch support values were calculated in GARLI based on 400 bootstrap replicates and the bootstrap consensus tree calculated in PAUP

Results

Morphology

Diadema from the eastern Atlantic were found to be morphologically very close to D antillarum from the western Atlantic but even closer to D antillarum ascensionis from the mid Atlantic However small differences were found to support its designation as a distinct species Figure 1 illustrates the neotype (whole sea urchin) of D antillarum and Fig 2 a denuded test of D antillarum from the type locality Figs 3 and 4 show the spines and pedicellariae of D antillarum respectively Figure 5 illustrates the holotype of D africanum (whole sea urchin) and Fig 6 the paratype of D africanum (denuded test) Figure 7 shows details of the apical system and the iridophore pattern Figure 8 illustrates ambulacral spines and interambulacral spines of D africanum with transverse sections and Fig 9 the pedicellariae Figure 10 shows PCA plots of quantitative morphological characters of test spines and pedicellariae of D antillarum (neotype) of D africanum

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 147A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 1 NHMTFMCBMEQ00237 neotype of D antillarum A aboral view B oral view C lateral view

RODRIacuteGUEZ ET AL148 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 2 NHMTFMCBMEQ00237 neotype of D antillarum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F apical system

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 149A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 3 NHMTFMCBMEQ00237 neotype of D antillarum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashN) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL150 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 4 Scanning electron microscopy images (SEMs) of individual valves of tridentate pedicellariae and triphyllous pedicellariae of the neotype of D antillarum NHMTFMCBMEQ00237 AndashH tridentate pedicellariae AndashB external and internal views of a broad form CndashD side views of a broad form EndashF narrow form (external views) G internal view of a narrow form H side view of a narrow form I details of a narrow tridentate pedicellaria showing lateral teeth JndashK Triphyllous pedicellariae internal and external views respectively L details of a triphyllous pedicellaria showing peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 151A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Diadema Gray 1825

Gray 1825 p246 Type species Echinometra setosa Leske 1778 by ruling of the ICZN 1954Assigned species D setosum (Leske 1778) D savignyi Michelin 1845 D paucispinum A Agassiz 1863 D palmeri Baker

1967 D mexicanum A Agassiz 1863 D antillarum (Philippi 1845) D ascensionis Mortensen 1909 designated D antillarum ascensionis by Pawson (1978)

Diadema antillarum (Philippi 1845)Figs 1ndash4 tables 1ndash3

Cidaris (Diadema) antillarum Philippi 1845 Arch F Naturg 11 (1) p 355Diadema antillarum A Agassiz 1863 Bull MCZ 1 p19 Nutting 1895 Bull Univ Iowa Lab Nat Hist (3) p224

unnumbered plate fig1 (young Diadema labelled Aspidodiadema sp)

Neotype diagnosis Test and spines typically black with a red tinge However spines vary in colour from whitebrown to black Iridophores occur as a pentamerous ring around the apical disc Arch-shaped depressions are found on the apical disc along the inner edges of genital plates only in juveniles and young adults This character fades with age In transverse section ambulacral and interambulacral spines show an isosceles triangle-shaped solid wedges that constitute the shaft These wedges typically number sixteen in ambulacral spines and twenty in the largest interambulacral spines Only tridentate and triphyllous pedicellariae are present Tridentate pedicellariae occur as two forms one with broad valves and a narrow form Both forms have moderately curved valves and serrations along the edges of the valves

Material examined Neotype (TFMCBMEQ00237) in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material One specimen of the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology The species name refers to the species occurrence in The Antilles Islands Ecology Diadema antillarum is a key herbivore on Caribbean reefs Until 1983 this species was abundant on

Caribbean coral reefs and in seagrass beds In 1983 a non-identified pathogenic infection resulted in a mass die-off of this species which reduced population sizes by more than 97 in the Caribbean Sea and western Atlantic (Lessios 1984b 1988) Such population have failed to recover to pre-die-off numbers (Lessios 2005) Following the mass mortality of D antillarum there was an immediate increase in algal growth particularly in areas where herbivorous fish had been reduced in numbers through intense fishing pressure In such regions a reduction of algal-free areas suitable for coral settlement has been reported and is believed to be responsible for the reduction in coral-cover (Lessios 1988)

Diadema antillarum spawns around the time of the new moon typically on the first two days of the first lunar quarter (Lessios 1984a) Settlement times and levels of recruitment of D antillarum have been found to vary in different localities (Lewis 1966 Bauer 1976 Lessios 1981 1984b)

Distribution Diadema antillarum is found off the coasts of the tropical western Atlantic Ocean including the Caribbean Sea tropical coasts of South America down to Brazil and from Bermuda to Florida It is typically found in shallow waters on coral reefs but has been reported from depths of 70 m (Mortensen 1940)

Neotype description The test is hemispherical with a horizontal diameter of 450 mm and a vertical diameter of 205 mm (Fig 1) The epithelium of the test is black (Fig 1AndashC) with a red tinge In living specimens narrow blue lines of iridophores occur down either side of the naked median areas of the interambulacra and as a ring around the apical disc The apical system is hemicyclic and measures 2394 mm 24 of the testrsquos horizontal diameter (Fig 2D amp Table 1) The genital plates are wider than long with one to three tubercles along their inner edge (Table 1 amp Fig 2F) and a genital pore that measures 45 the genital plate length A faint arch-shaped depression occurs on the inner edge of each genital plate forming the corners of the apical ring Ocular plates are pentagonal in shape with two small tubercles in the centre of the plate The periproctal cone is small and black and does not have any platelets or markings on the skin (Fig 1A amp Table 1) The ambulacra are slightly raised aborally and measure 22 of the width of interambulacral measured at the ambitus (Table 1 amp Fig 2) They have two rows of large crenulate and perforate primary tubercles (Fig 2) with an offset inner series of small tubercles The

RODRIacuteGUEZ ET AL152 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

interambulacra measure 18 mm in width at the ambitus and contain four series of large primary tubercles with an offset inner series of small tubercles Each series contains 14 primary tubercles with areoles of moderate size (Fig 2 amp Table 1) The peristome measures 219 mm at the ambitus 481 of the horizontal diameter It is subcircular in shape and has five pairs of buccal tube feet The peristomial membrane is black and is covered with a large number of triphyllous pedicellariae Auricles are robust with high processes (Fig 2E)

Ambulacral and interambulacral spines differ in their width and ornamentation Ambulacral spines are black with a red tinge (Fig 3) the longest measures 2852 mm in length (6334 of the test horizontal) on the neotype 09 mm in width proximally and 05 mm distally (Fig 3EndashG) These are verticillate with barbs distally (Fig 3AndashC) and are typically composed of sixteen solid wedges

Interambulacral spines are predominantly black with a red tinge but a number of brown and white spines are present aborally (Figs 1 amp 3) They are long and slender the longest measuring 4737 mm in length on the neotype The spines are verticillate formed by 20 solid wedges which radiate out from a hollow axial cavity Spine width varies from 14 mm in diameter proximally to 09 mm distally with numerous barbs present distally (Figs 3HndashJ)

Only tridentate and triphyllous pedicellariae were found on the neotype with no claviform ophicephalous pedicellariae observed (Fig 4 amptable 3) Tridentate pedicellariae occur as two forms one with broad valves (Fig 4AndashD) and a long broad neck on a short stalk and a narrow form (comparing valves of equal length) with narrow valves a short neck and a long stalk (Fig 4EndashH) Both forms have moderately curved valves with serrations along edges of the blades of the valves (Figs 4GndashI) Both forms occur orally and aborally However the broad form is less abundant Triphyllous pedicellariae are typical of the genus in having broad valves that are rounded distally with numerous small peripheral teeth that occur in two rows (Figs 4JndashL) The head of each pedicellaria is supported by a long muscular neck attached to a long stalk

Diadema africanum sp novFigs 5ndash10 tables 1ndash3

Diagnosis Test and spines typically black with a red tinge and a turquoise sheen when viewed in direct sunlight The iridophore pattern occurs as bold blue lines down either side of the naked interambulacral areas as a pentamerous ring around the apical disc and as lines along some plate boundaries Apical disc is hemicyclic with arch-shaped depressions on the denuded genital plates in both adults and juveniles Gonopores measure 33 of the length of the genital plates The periproctal cone is black with no markings The Peristome is proportionally large measuring 40ndash60 of the testrsquos horizontal diameter Spines are verticillate and hollow with distal barbs Verticilations are formed of urn-shaped solid wedges that are visible when the spines are viewed in transverse section These wedges typically number twenty in ambulacral spines and twenty-four in interambulacral spines Only tridentate and triphyllous pedicellariae are present The tridentate pedicellariae occur as a single form with reasonably broad curved valves with almost straight edges that can either be smooth or serrated with an expanded distal gripping region The blades of the valves meet only along the upper fifth of their length The head of each pedicellaria is supported by a long muscular neck attached to a mid-length stalk

Holotype TFMCBMEQ00232 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Paratypes TFMCBMEQ 00233 TFMCBMEQ 00234 TFMCBMEQ 00235 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material Twenty-one specimens in the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology Species name refers to the geographical distribution of the species on the western coasts of Africa It is distributed on islands and continental coasts along the African continental shelf

Ecology Diadema africanum is an important macro-herbivore on subtropical and tropical rocky reefs off the West African coasts In the eastern Atlantic islands and particularly in Madeira and the Canary Islands the species is distributed throughout the islands at densities that can reach more than 12 individuals m2 (Brito et al 1984 Alves et al 2001 Hernaacutendez 2006 Clemente 2007 Hernaacutendez et al 2008) The species can therefore dramatically reduce the abundance of non-crustose macroalgae resulting in the formation of sea urchin-dominated barren grounds (Hernaacutendez et al 2008) This phenomenon is especially relevant in Madeira Salvage and the Canary Islands where macroalgal beds represent the main ecosystem Diadema africanum also occurs on coral dominated

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 153A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

reefs in Cape Verde and Sacirco Tome where sea urchin control of macroalgae via grazing is beneficial for coral settlement and growth Only a few studies have looked at the abundance and ecological role of D africanum along the tropical western African coasts (eg John et al 1977 1992) with further investigations needed

Distribution Diadema africanum occurs in the Eastern Atlantic islands from Madeira Islands to the Guinean Gulf including Salvage Islands Canary Islands Cape Verde Islands (Hernaacutendez et al 2008) and Sacirco Tome Island (Lessios et al 2001) It has also been also recorded in continental areas of Ghana (John et al 1977 1992) and in Ngor Island Senegal (P Wirtz pers com)

Description The test is hemispherical with a horizontal diameter of 6673 mm and a vertical diameter of 3278 mm in the paratype and 6123 mm hd and 3136 mm vd in the holotype The base colour of the test epithelium is black with a red tinge (Fig 5AndashC) while the denuded test is white (Fig 6AndashE) The apical system measures 1814 mm in the paratype and is hemicyclic with ocular plates II and III exsert (Fig 6A) The genital plates are wider than long and have up to four small tubercles along their inner-edge (Table 1amp Fig 7AndashB) with large genital pores that measure 33 of the genital plate length (Fig 7A) The ocular plates are pentagonal with a small pore located at the top of the plate and have from one to three small tubercles along the centre of the plate (Fig 7B)

On the naked test distinct arch-shaped depressions are present on the genital plates of both adults and juveniles (Table 5 ampFig 7B) These depressions correspond to the corners of the pentamerous apical ring of iridophores seen in living sea urchins (Fig 7CndashE) The iridophore pattern is bold and bright on the apical system when viewed in sunlight The periproct is 1126 mm wide in the paratype (approximately 16 of the testrsquos horizontal diameter) and has a small black periproctal cone that has no platelets or markings on the skin (Fig 5A)

The ambulacra are slightly raised aborally (Fig 6C) and measure 30 of the width of the interambulacra (865 mm) at the ambitus in the paratype They have two rows of large primary tubercles and an offset inner series of small tubercles that are perforated and crenulated with non-conjugate pore-pairs and phyllodes developed adorally

The interambulacra are broader than the ambulacra at the ambitus (Fig 6CndashD) with 5ndash6 series (the inner median series is more offset in some specimens giving the impression of two series) of 14 primary tubercles Tubercles are perforate and crenulate and have areoles of moderate size (Fig 7A) During the day blue lines of iridophores can be seen down either side of the naked median regions

The peristome is subcircular (Fig 6B) and in the paratype it measures 269 mm in diameter 40 of the testrsquos horizontal diameter The peristomal membrane is black with a red tinge and has five pairs of buccal tube feet (Fig 5B) with abundant triphyllous pedicellariae The auricles are robust and have high processes (Fig 6F)

In adults the spine epithelium is black with a red tinge and a turquoise sheen when viewed in direct sunlight In juveniles spines are banded red and white which is typical of the genus Ambulacral spines measure 4321 mm in length in the paratype (2883 of the test horizontal diameter) These spines are strongly verticillate with barbs pointing distally (Fig 8AndashD) Proximally these spines have a mean diameter of 089 mm that decreases distally (Fig 8EndashG) The axial cavity comprises 288 of the horizontal diameter which increases to 3522 in the distal region (Fig 8EndashG) The solid wedges are urn-shaped and typically number twenty comprising 6342 of the spinersquos horizontal diameter in the proximal section

Interambulacral spines (Fig 8HndashN) are long and slender with a maximum diameter of 2 mm proximally and taper distally (Fig 8KndashN) These spines measure 5862 mm in the paratype In transverse section the axial cavity comprises 2992 of the horizontal diameter proximally but increases to 3917 in the distal region (Table 2 Fig 8LndashN) The solid wedges are urn-shaped and typically number twenty-four 6257 of the of the spinersquos horizontal diameter in the proximal section

Both tridentate and triphyllous pedicellariae are present in D africanum (Fig 9) No ophicephalous pedicellariae were found either true ophicephalous or of the claviform type which have been reported in other species of Diadema (Mortensen 1940) Only a single form of tridentate pedicellaria is found in this species (Fig 9AndashI) which are abundant orally and aborally but particularly around the periproct and around the peristome This form of tidentate pedicellaria has a long muscular neck on a long stalk which allows a high degree of movement (Fig 9A) The valves of the pedicellariae are moderately curved and only meet along the upper fifth of their length The blade of the valves has almost straight edges that are either smooth or serrated with an expanded distal gripping region (Fig 9DndashI) Triphyllous pedicellariae are more abundant than the tridentate form and are distributed all over the sea urchin test but occur in particularly large numbers around the peristome Their valves are small and broad (Fig 9JndashN) with numerous small peripheral teeth that form two rows along the edges of the valves which interlock when the valves are closed (Fig 9LndashN)

RODRIacuteGUEZ ET AL154 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 5 NHMTFMCBMEQ00232 holotype of Diadema africanum A aboral view B oral view C lateral view

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 155A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 6 NHMTFMCBMEQ00233 paratype of Diadema africanum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F auricle

RODRIacuteGUEZ ET AL156 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 7 NHMTFMCBMEQ00233 paratype of Diadema africanum Apical system and pattern of iridophores A genital plate gonopore and an ambulacrum B close-up of the apical system (paratype) C amp D pattern of iridophores around the apical system on a living specimen in daylight E pattern of iridophores at night F pattern of iridophore on a living specimen in daylight

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 157A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 8 NHMTFMCBMEQ00233 paratype of Diadema africanum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashL) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL158 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 1 NHMTFMCBMEQ00237 neotype of D antillarum A aboral view B oral view C lateral view

RODRIacuteGUEZ ET AL148 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 2 NHMTFMCBMEQ00237 neotype of D antillarum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F apical system

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 149A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 3 NHMTFMCBMEQ00237 neotype of D antillarum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashN) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL150 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 4 Scanning electron microscopy images (SEMs) of individual valves of tridentate pedicellariae and triphyllous pedicellariae of the neotype of D antillarum NHMTFMCBMEQ00237 AndashH tridentate pedicellariae AndashB external and internal views of a broad form CndashD side views of a broad form EndashF narrow form (external views) G internal view of a narrow form H side view of a narrow form I details of a narrow tridentate pedicellaria showing lateral teeth JndashK Triphyllous pedicellariae internal and external views respectively L details of a triphyllous pedicellaria showing peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 151A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Diadema Gray 1825

Gray 1825 p246 Type species Echinometra setosa Leske 1778 by ruling of the ICZN 1954Assigned species D setosum (Leske 1778) D savignyi Michelin 1845 D paucispinum A Agassiz 1863 D palmeri Baker

1967 D mexicanum A Agassiz 1863 D antillarum (Philippi 1845) D ascensionis Mortensen 1909 designated D antillarum ascensionis by Pawson (1978)

Diadema antillarum (Philippi 1845)Figs 1ndash4 tables 1ndash3

Cidaris (Diadema) antillarum Philippi 1845 Arch F Naturg 11 (1) p 355Diadema antillarum A Agassiz 1863 Bull MCZ 1 p19 Nutting 1895 Bull Univ Iowa Lab Nat Hist (3) p224

unnumbered plate fig1 (young Diadema labelled Aspidodiadema sp)

Neotype diagnosis Test and spines typically black with a red tinge However spines vary in colour from whitebrown to black Iridophores occur as a pentamerous ring around the apical disc Arch-shaped depressions are found on the apical disc along the inner edges of genital plates only in juveniles and young adults This character fades with age In transverse section ambulacral and interambulacral spines show an isosceles triangle-shaped solid wedges that constitute the shaft These wedges typically number sixteen in ambulacral spines and twenty in the largest interambulacral spines Only tridentate and triphyllous pedicellariae are present Tridentate pedicellariae occur as two forms one with broad valves and a narrow form Both forms have moderately curved valves and serrations along the edges of the valves

Material examined Neotype (TFMCBMEQ00237) in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material One specimen of the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology The species name refers to the species occurrence in The Antilles Islands Ecology Diadema antillarum is a key herbivore on Caribbean reefs Until 1983 this species was abundant on

Caribbean coral reefs and in seagrass beds In 1983 a non-identified pathogenic infection resulted in a mass die-off of this species which reduced population sizes by more than 97 in the Caribbean Sea and western Atlantic (Lessios 1984b 1988) Such population have failed to recover to pre-die-off numbers (Lessios 2005) Following the mass mortality of D antillarum there was an immediate increase in algal growth particularly in areas where herbivorous fish had been reduced in numbers through intense fishing pressure In such regions a reduction of algal-free areas suitable for coral settlement has been reported and is believed to be responsible for the reduction in coral-cover (Lessios 1988)

Diadema antillarum spawns around the time of the new moon typically on the first two days of the first lunar quarter (Lessios 1984a) Settlement times and levels of recruitment of D antillarum have been found to vary in different localities (Lewis 1966 Bauer 1976 Lessios 1981 1984b)

Distribution Diadema antillarum is found off the coasts of the tropical western Atlantic Ocean including the Caribbean Sea tropical coasts of South America down to Brazil and from Bermuda to Florida It is typically found in shallow waters on coral reefs but has been reported from depths of 70 m (Mortensen 1940)

Neotype description The test is hemispherical with a horizontal diameter of 450 mm and a vertical diameter of 205 mm (Fig 1) The epithelium of the test is black (Fig 1AndashC) with a red tinge In living specimens narrow blue lines of iridophores occur down either side of the naked median areas of the interambulacra and as a ring around the apical disc The apical system is hemicyclic and measures 2394 mm 24 of the testrsquos horizontal diameter (Fig 2D amp Table 1) The genital plates are wider than long with one to three tubercles along their inner edge (Table 1 amp Fig 2F) and a genital pore that measures 45 the genital plate length A faint arch-shaped depression occurs on the inner edge of each genital plate forming the corners of the apical ring Ocular plates are pentagonal in shape with two small tubercles in the centre of the plate The periproctal cone is small and black and does not have any platelets or markings on the skin (Fig 1A amp Table 1) The ambulacra are slightly raised aborally and measure 22 of the width of interambulacral measured at the ambitus (Table 1 amp Fig 2) They have two rows of large crenulate and perforate primary tubercles (Fig 2) with an offset inner series of small tubercles The

RODRIacuteGUEZ ET AL152 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

interambulacra measure 18 mm in width at the ambitus and contain four series of large primary tubercles with an offset inner series of small tubercles Each series contains 14 primary tubercles with areoles of moderate size (Fig 2 amp Table 1) The peristome measures 219 mm at the ambitus 481 of the horizontal diameter It is subcircular in shape and has five pairs of buccal tube feet The peristomial membrane is black and is covered with a large number of triphyllous pedicellariae Auricles are robust with high processes (Fig 2E)

Ambulacral and interambulacral spines differ in their width and ornamentation Ambulacral spines are black with a red tinge (Fig 3) the longest measures 2852 mm in length (6334 of the test horizontal) on the neotype 09 mm in width proximally and 05 mm distally (Fig 3EndashG) These are verticillate with barbs distally (Fig 3AndashC) and are typically composed of sixteen solid wedges

Interambulacral spines are predominantly black with a red tinge but a number of brown and white spines are present aborally (Figs 1 amp 3) They are long and slender the longest measuring 4737 mm in length on the neotype The spines are verticillate formed by 20 solid wedges which radiate out from a hollow axial cavity Spine width varies from 14 mm in diameter proximally to 09 mm distally with numerous barbs present distally (Figs 3HndashJ)

Only tridentate and triphyllous pedicellariae were found on the neotype with no claviform ophicephalous pedicellariae observed (Fig 4 amptable 3) Tridentate pedicellariae occur as two forms one with broad valves (Fig 4AndashD) and a long broad neck on a short stalk and a narrow form (comparing valves of equal length) with narrow valves a short neck and a long stalk (Fig 4EndashH) Both forms have moderately curved valves with serrations along edges of the blades of the valves (Figs 4GndashI) Both forms occur orally and aborally However the broad form is less abundant Triphyllous pedicellariae are typical of the genus in having broad valves that are rounded distally with numerous small peripheral teeth that occur in two rows (Figs 4JndashL) The head of each pedicellaria is supported by a long muscular neck attached to a long stalk

Diadema africanum sp novFigs 5ndash10 tables 1ndash3

Diagnosis Test and spines typically black with a red tinge and a turquoise sheen when viewed in direct sunlight The iridophore pattern occurs as bold blue lines down either side of the naked interambulacral areas as a pentamerous ring around the apical disc and as lines along some plate boundaries Apical disc is hemicyclic with arch-shaped depressions on the denuded genital plates in both adults and juveniles Gonopores measure 33 of the length of the genital plates The periproctal cone is black with no markings The Peristome is proportionally large measuring 40ndash60 of the testrsquos horizontal diameter Spines are verticillate and hollow with distal barbs Verticilations are formed of urn-shaped solid wedges that are visible when the spines are viewed in transverse section These wedges typically number twenty in ambulacral spines and twenty-four in interambulacral spines Only tridentate and triphyllous pedicellariae are present The tridentate pedicellariae occur as a single form with reasonably broad curved valves with almost straight edges that can either be smooth or serrated with an expanded distal gripping region The blades of the valves meet only along the upper fifth of their length The head of each pedicellaria is supported by a long muscular neck attached to a mid-length stalk

Holotype TFMCBMEQ00232 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Paratypes TFMCBMEQ 00233 TFMCBMEQ 00234 TFMCBMEQ 00235 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material Twenty-one specimens in the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology Species name refers to the geographical distribution of the species on the western coasts of Africa It is distributed on islands and continental coasts along the African continental shelf

Ecology Diadema africanum is an important macro-herbivore on subtropical and tropical rocky reefs off the West African coasts In the eastern Atlantic islands and particularly in Madeira and the Canary Islands the species is distributed throughout the islands at densities that can reach more than 12 individuals m2 (Brito et al 1984 Alves et al 2001 Hernaacutendez 2006 Clemente 2007 Hernaacutendez et al 2008) The species can therefore dramatically reduce the abundance of non-crustose macroalgae resulting in the formation of sea urchin-dominated barren grounds (Hernaacutendez et al 2008) This phenomenon is especially relevant in Madeira Salvage and the Canary Islands where macroalgal beds represent the main ecosystem Diadema africanum also occurs on coral dominated

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 153A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

reefs in Cape Verde and Sacirco Tome where sea urchin control of macroalgae via grazing is beneficial for coral settlement and growth Only a few studies have looked at the abundance and ecological role of D africanum along the tropical western African coasts (eg John et al 1977 1992) with further investigations needed

Distribution Diadema africanum occurs in the Eastern Atlantic islands from Madeira Islands to the Guinean Gulf including Salvage Islands Canary Islands Cape Verde Islands (Hernaacutendez et al 2008) and Sacirco Tome Island (Lessios et al 2001) It has also been also recorded in continental areas of Ghana (John et al 1977 1992) and in Ngor Island Senegal (P Wirtz pers com)

Description The test is hemispherical with a horizontal diameter of 6673 mm and a vertical diameter of 3278 mm in the paratype and 6123 mm hd and 3136 mm vd in the holotype The base colour of the test epithelium is black with a red tinge (Fig 5AndashC) while the denuded test is white (Fig 6AndashE) The apical system measures 1814 mm in the paratype and is hemicyclic with ocular plates II and III exsert (Fig 6A) The genital plates are wider than long and have up to four small tubercles along their inner-edge (Table 1amp Fig 7AndashB) with large genital pores that measure 33 of the genital plate length (Fig 7A) The ocular plates are pentagonal with a small pore located at the top of the plate and have from one to three small tubercles along the centre of the plate (Fig 7B)

On the naked test distinct arch-shaped depressions are present on the genital plates of both adults and juveniles (Table 5 ampFig 7B) These depressions correspond to the corners of the pentamerous apical ring of iridophores seen in living sea urchins (Fig 7CndashE) The iridophore pattern is bold and bright on the apical system when viewed in sunlight The periproct is 1126 mm wide in the paratype (approximately 16 of the testrsquos horizontal diameter) and has a small black periproctal cone that has no platelets or markings on the skin (Fig 5A)

The ambulacra are slightly raised aborally (Fig 6C) and measure 30 of the width of the interambulacra (865 mm) at the ambitus in the paratype They have two rows of large primary tubercles and an offset inner series of small tubercles that are perforated and crenulated with non-conjugate pore-pairs and phyllodes developed adorally

The interambulacra are broader than the ambulacra at the ambitus (Fig 6CndashD) with 5ndash6 series (the inner median series is more offset in some specimens giving the impression of two series) of 14 primary tubercles Tubercles are perforate and crenulate and have areoles of moderate size (Fig 7A) During the day blue lines of iridophores can be seen down either side of the naked median regions

The peristome is subcircular (Fig 6B) and in the paratype it measures 269 mm in diameter 40 of the testrsquos horizontal diameter The peristomal membrane is black with a red tinge and has five pairs of buccal tube feet (Fig 5B) with abundant triphyllous pedicellariae The auricles are robust and have high processes (Fig 6F)

In adults the spine epithelium is black with a red tinge and a turquoise sheen when viewed in direct sunlight In juveniles spines are banded red and white which is typical of the genus Ambulacral spines measure 4321 mm in length in the paratype (2883 of the test horizontal diameter) These spines are strongly verticillate with barbs pointing distally (Fig 8AndashD) Proximally these spines have a mean diameter of 089 mm that decreases distally (Fig 8EndashG) The axial cavity comprises 288 of the horizontal diameter which increases to 3522 in the distal region (Fig 8EndashG) The solid wedges are urn-shaped and typically number twenty comprising 6342 of the spinersquos horizontal diameter in the proximal section

Interambulacral spines (Fig 8HndashN) are long and slender with a maximum diameter of 2 mm proximally and taper distally (Fig 8KndashN) These spines measure 5862 mm in the paratype In transverse section the axial cavity comprises 2992 of the horizontal diameter proximally but increases to 3917 in the distal region (Table 2 Fig 8LndashN) The solid wedges are urn-shaped and typically number twenty-four 6257 of the of the spinersquos horizontal diameter in the proximal section

Both tridentate and triphyllous pedicellariae are present in D africanum (Fig 9) No ophicephalous pedicellariae were found either true ophicephalous or of the claviform type which have been reported in other species of Diadema (Mortensen 1940) Only a single form of tridentate pedicellaria is found in this species (Fig 9AndashI) which are abundant orally and aborally but particularly around the periproct and around the peristome This form of tidentate pedicellaria has a long muscular neck on a long stalk which allows a high degree of movement (Fig 9A) The valves of the pedicellariae are moderately curved and only meet along the upper fifth of their length The blade of the valves has almost straight edges that are either smooth or serrated with an expanded distal gripping region (Fig 9DndashI) Triphyllous pedicellariae are more abundant than the tridentate form and are distributed all over the sea urchin test but occur in particularly large numbers around the peristome Their valves are small and broad (Fig 9JndashN) with numerous small peripheral teeth that form two rows along the edges of the valves which interlock when the valves are closed (Fig 9LndashN)

RODRIacuteGUEZ ET AL154 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 5 NHMTFMCBMEQ00232 holotype of Diadema africanum A aboral view B oral view C lateral view

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 155A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 6 NHMTFMCBMEQ00233 paratype of Diadema africanum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F auricle

RODRIacuteGUEZ ET AL156 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 7 NHMTFMCBMEQ00233 paratype of Diadema africanum Apical system and pattern of iridophores A genital plate gonopore and an ambulacrum B close-up of the apical system (paratype) C amp D pattern of iridophores around the apical system on a living specimen in daylight E pattern of iridophores at night F pattern of iridophore on a living specimen in daylight

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 157A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 8 NHMTFMCBMEQ00233 paratype of Diadema africanum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashL) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL158 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 2 NHMTFMCBMEQ00237 neotype of D antillarum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F apical system

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 149A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 3 NHMTFMCBMEQ00237 neotype of D antillarum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashN) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL150 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 4 Scanning electron microscopy images (SEMs) of individual valves of tridentate pedicellariae and triphyllous pedicellariae of the neotype of D antillarum NHMTFMCBMEQ00237 AndashH tridentate pedicellariae AndashB external and internal views of a broad form CndashD side views of a broad form EndashF narrow form (external views) G internal view of a narrow form H side view of a narrow form I details of a narrow tridentate pedicellaria showing lateral teeth JndashK Triphyllous pedicellariae internal and external views respectively L details of a triphyllous pedicellaria showing peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 151A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Diadema Gray 1825

Gray 1825 p246 Type species Echinometra setosa Leske 1778 by ruling of the ICZN 1954Assigned species D setosum (Leske 1778) D savignyi Michelin 1845 D paucispinum A Agassiz 1863 D palmeri Baker

1967 D mexicanum A Agassiz 1863 D antillarum (Philippi 1845) D ascensionis Mortensen 1909 designated D antillarum ascensionis by Pawson (1978)

Diadema antillarum (Philippi 1845)Figs 1ndash4 tables 1ndash3

Cidaris (Diadema) antillarum Philippi 1845 Arch F Naturg 11 (1) p 355Diadema antillarum A Agassiz 1863 Bull MCZ 1 p19 Nutting 1895 Bull Univ Iowa Lab Nat Hist (3) p224

unnumbered plate fig1 (young Diadema labelled Aspidodiadema sp)

Neotype diagnosis Test and spines typically black with a red tinge However spines vary in colour from whitebrown to black Iridophores occur as a pentamerous ring around the apical disc Arch-shaped depressions are found on the apical disc along the inner edges of genital plates only in juveniles and young adults This character fades with age In transverse section ambulacral and interambulacral spines show an isosceles triangle-shaped solid wedges that constitute the shaft These wedges typically number sixteen in ambulacral spines and twenty in the largest interambulacral spines Only tridentate and triphyllous pedicellariae are present Tridentate pedicellariae occur as two forms one with broad valves and a narrow form Both forms have moderately curved valves and serrations along the edges of the valves

Material examined Neotype (TFMCBMEQ00237) in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material One specimen of the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology The species name refers to the species occurrence in The Antilles Islands Ecology Diadema antillarum is a key herbivore on Caribbean reefs Until 1983 this species was abundant on

Caribbean coral reefs and in seagrass beds In 1983 a non-identified pathogenic infection resulted in a mass die-off of this species which reduced population sizes by more than 97 in the Caribbean Sea and western Atlantic (Lessios 1984b 1988) Such population have failed to recover to pre-die-off numbers (Lessios 2005) Following the mass mortality of D antillarum there was an immediate increase in algal growth particularly in areas where herbivorous fish had been reduced in numbers through intense fishing pressure In such regions a reduction of algal-free areas suitable for coral settlement has been reported and is believed to be responsible for the reduction in coral-cover (Lessios 1988)

Diadema antillarum spawns around the time of the new moon typically on the first two days of the first lunar quarter (Lessios 1984a) Settlement times and levels of recruitment of D antillarum have been found to vary in different localities (Lewis 1966 Bauer 1976 Lessios 1981 1984b)

Distribution Diadema antillarum is found off the coasts of the tropical western Atlantic Ocean including the Caribbean Sea tropical coasts of South America down to Brazil and from Bermuda to Florida It is typically found in shallow waters on coral reefs but has been reported from depths of 70 m (Mortensen 1940)

Neotype description The test is hemispherical with a horizontal diameter of 450 mm and a vertical diameter of 205 mm (Fig 1) The epithelium of the test is black (Fig 1AndashC) with a red tinge In living specimens narrow blue lines of iridophores occur down either side of the naked median areas of the interambulacra and as a ring around the apical disc The apical system is hemicyclic and measures 2394 mm 24 of the testrsquos horizontal diameter (Fig 2D amp Table 1) The genital plates are wider than long with one to three tubercles along their inner edge (Table 1 amp Fig 2F) and a genital pore that measures 45 the genital plate length A faint arch-shaped depression occurs on the inner edge of each genital plate forming the corners of the apical ring Ocular plates are pentagonal in shape with two small tubercles in the centre of the plate The periproctal cone is small and black and does not have any platelets or markings on the skin (Fig 1A amp Table 1) The ambulacra are slightly raised aborally and measure 22 of the width of interambulacral measured at the ambitus (Table 1 amp Fig 2) They have two rows of large crenulate and perforate primary tubercles (Fig 2) with an offset inner series of small tubercles The

RODRIacuteGUEZ ET AL152 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

interambulacra measure 18 mm in width at the ambitus and contain four series of large primary tubercles with an offset inner series of small tubercles Each series contains 14 primary tubercles with areoles of moderate size (Fig 2 amp Table 1) The peristome measures 219 mm at the ambitus 481 of the horizontal diameter It is subcircular in shape and has five pairs of buccal tube feet The peristomial membrane is black and is covered with a large number of triphyllous pedicellariae Auricles are robust with high processes (Fig 2E)

Ambulacral and interambulacral spines differ in their width and ornamentation Ambulacral spines are black with a red tinge (Fig 3) the longest measures 2852 mm in length (6334 of the test horizontal) on the neotype 09 mm in width proximally and 05 mm distally (Fig 3EndashG) These are verticillate with barbs distally (Fig 3AndashC) and are typically composed of sixteen solid wedges

Interambulacral spines are predominantly black with a red tinge but a number of brown and white spines are present aborally (Figs 1 amp 3) They are long and slender the longest measuring 4737 mm in length on the neotype The spines are verticillate formed by 20 solid wedges which radiate out from a hollow axial cavity Spine width varies from 14 mm in diameter proximally to 09 mm distally with numerous barbs present distally (Figs 3HndashJ)

Only tridentate and triphyllous pedicellariae were found on the neotype with no claviform ophicephalous pedicellariae observed (Fig 4 amptable 3) Tridentate pedicellariae occur as two forms one with broad valves (Fig 4AndashD) and a long broad neck on a short stalk and a narrow form (comparing valves of equal length) with narrow valves a short neck and a long stalk (Fig 4EndashH) Both forms have moderately curved valves with serrations along edges of the blades of the valves (Figs 4GndashI) Both forms occur orally and aborally However the broad form is less abundant Triphyllous pedicellariae are typical of the genus in having broad valves that are rounded distally with numerous small peripheral teeth that occur in two rows (Figs 4JndashL) The head of each pedicellaria is supported by a long muscular neck attached to a long stalk

Diadema africanum sp novFigs 5ndash10 tables 1ndash3

Diagnosis Test and spines typically black with a red tinge and a turquoise sheen when viewed in direct sunlight The iridophore pattern occurs as bold blue lines down either side of the naked interambulacral areas as a pentamerous ring around the apical disc and as lines along some plate boundaries Apical disc is hemicyclic with arch-shaped depressions on the denuded genital plates in both adults and juveniles Gonopores measure 33 of the length of the genital plates The periproctal cone is black with no markings The Peristome is proportionally large measuring 40ndash60 of the testrsquos horizontal diameter Spines are verticillate and hollow with distal barbs Verticilations are formed of urn-shaped solid wedges that are visible when the spines are viewed in transverse section These wedges typically number twenty in ambulacral spines and twenty-four in interambulacral spines Only tridentate and triphyllous pedicellariae are present The tridentate pedicellariae occur as a single form with reasonably broad curved valves with almost straight edges that can either be smooth or serrated with an expanded distal gripping region The blades of the valves meet only along the upper fifth of their length The head of each pedicellaria is supported by a long muscular neck attached to a mid-length stalk

Holotype TFMCBMEQ00232 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Paratypes TFMCBMEQ 00233 TFMCBMEQ 00234 TFMCBMEQ 00235 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material Twenty-one specimens in the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology Species name refers to the geographical distribution of the species on the western coasts of Africa It is distributed on islands and continental coasts along the African continental shelf

Ecology Diadema africanum is an important macro-herbivore on subtropical and tropical rocky reefs off the West African coasts In the eastern Atlantic islands and particularly in Madeira and the Canary Islands the species is distributed throughout the islands at densities that can reach more than 12 individuals m2 (Brito et al 1984 Alves et al 2001 Hernaacutendez 2006 Clemente 2007 Hernaacutendez et al 2008) The species can therefore dramatically reduce the abundance of non-crustose macroalgae resulting in the formation of sea urchin-dominated barren grounds (Hernaacutendez et al 2008) This phenomenon is especially relevant in Madeira Salvage and the Canary Islands where macroalgal beds represent the main ecosystem Diadema africanum also occurs on coral dominated

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 153A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

reefs in Cape Verde and Sacirco Tome where sea urchin control of macroalgae via grazing is beneficial for coral settlement and growth Only a few studies have looked at the abundance and ecological role of D africanum along the tropical western African coasts (eg John et al 1977 1992) with further investigations needed

Distribution Diadema africanum occurs in the Eastern Atlantic islands from Madeira Islands to the Guinean Gulf including Salvage Islands Canary Islands Cape Verde Islands (Hernaacutendez et al 2008) and Sacirco Tome Island (Lessios et al 2001) It has also been also recorded in continental areas of Ghana (John et al 1977 1992) and in Ngor Island Senegal (P Wirtz pers com)

Description The test is hemispherical with a horizontal diameter of 6673 mm and a vertical diameter of 3278 mm in the paratype and 6123 mm hd and 3136 mm vd in the holotype The base colour of the test epithelium is black with a red tinge (Fig 5AndashC) while the denuded test is white (Fig 6AndashE) The apical system measures 1814 mm in the paratype and is hemicyclic with ocular plates II and III exsert (Fig 6A) The genital plates are wider than long and have up to four small tubercles along their inner-edge (Table 1amp Fig 7AndashB) with large genital pores that measure 33 of the genital plate length (Fig 7A) The ocular plates are pentagonal with a small pore located at the top of the plate and have from one to three small tubercles along the centre of the plate (Fig 7B)

On the naked test distinct arch-shaped depressions are present on the genital plates of both adults and juveniles (Table 5 ampFig 7B) These depressions correspond to the corners of the pentamerous apical ring of iridophores seen in living sea urchins (Fig 7CndashE) The iridophore pattern is bold and bright on the apical system when viewed in sunlight The periproct is 1126 mm wide in the paratype (approximately 16 of the testrsquos horizontal diameter) and has a small black periproctal cone that has no platelets or markings on the skin (Fig 5A)

The ambulacra are slightly raised aborally (Fig 6C) and measure 30 of the width of the interambulacra (865 mm) at the ambitus in the paratype They have two rows of large primary tubercles and an offset inner series of small tubercles that are perforated and crenulated with non-conjugate pore-pairs and phyllodes developed adorally

The interambulacra are broader than the ambulacra at the ambitus (Fig 6CndashD) with 5ndash6 series (the inner median series is more offset in some specimens giving the impression of two series) of 14 primary tubercles Tubercles are perforate and crenulate and have areoles of moderate size (Fig 7A) During the day blue lines of iridophores can be seen down either side of the naked median regions

The peristome is subcircular (Fig 6B) and in the paratype it measures 269 mm in diameter 40 of the testrsquos horizontal diameter The peristomal membrane is black with a red tinge and has five pairs of buccal tube feet (Fig 5B) with abundant triphyllous pedicellariae The auricles are robust and have high processes (Fig 6F)

In adults the spine epithelium is black with a red tinge and a turquoise sheen when viewed in direct sunlight In juveniles spines are banded red and white which is typical of the genus Ambulacral spines measure 4321 mm in length in the paratype (2883 of the test horizontal diameter) These spines are strongly verticillate with barbs pointing distally (Fig 8AndashD) Proximally these spines have a mean diameter of 089 mm that decreases distally (Fig 8EndashG) The axial cavity comprises 288 of the horizontal diameter which increases to 3522 in the distal region (Fig 8EndashG) The solid wedges are urn-shaped and typically number twenty comprising 6342 of the spinersquos horizontal diameter in the proximal section

Interambulacral spines (Fig 8HndashN) are long and slender with a maximum diameter of 2 mm proximally and taper distally (Fig 8KndashN) These spines measure 5862 mm in the paratype In transverse section the axial cavity comprises 2992 of the horizontal diameter proximally but increases to 3917 in the distal region (Table 2 Fig 8LndashN) The solid wedges are urn-shaped and typically number twenty-four 6257 of the of the spinersquos horizontal diameter in the proximal section

Both tridentate and triphyllous pedicellariae are present in D africanum (Fig 9) No ophicephalous pedicellariae were found either true ophicephalous or of the claviform type which have been reported in other species of Diadema (Mortensen 1940) Only a single form of tridentate pedicellaria is found in this species (Fig 9AndashI) which are abundant orally and aborally but particularly around the periproct and around the peristome This form of tidentate pedicellaria has a long muscular neck on a long stalk which allows a high degree of movement (Fig 9A) The valves of the pedicellariae are moderately curved and only meet along the upper fifth of their length The blade of the valves has almost straight edges that are either smooth or serrated with an expanded distal gripping region (Fig 9DndashI) Triphyllous pedicellariae are more abundant than the tridentate form and are distributed all over the sea urchin test but occur in particularly large numbers around the peristome Their valves are small and broad (Fig 9JndashN) with numerous small peripheral teeth that form two rows along the edges of the valves which interlock when the valves are closed (Fig 9LndashN)

RODRIacuteGUEZ ET AL154 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 5 NHMTFMCBMEQ00232 holotype of Diadema africanum A aboral view B oral view C lateral view

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 155A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 6 NHMTFMCBMEQ00233 paratype of Diadema africanum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F auricle

RODRIacuteGUEZ ET AL156 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 7 NHMTFMCBMEQ00233 paratype of Diadema africanum Apical system and pattern of iridophores A genital plate gonopore and an ambulacrum B close-up of the apical system (paratype) C amp D pattern of iridophores around the apical system on a living specimen in daylight E pattern of iridophores at night F pattern of iridophore on a living specimen in daylight

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 157A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 8 NHMTFMCBMEQ00233 paratype of Diadema africanum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashL) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL158 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 3 NHMTFMCBMEQ00237 neotype of D antillarum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashN) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL150 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 4 Scanning electron microscopy images (SEMs) of individual valves of tridentate pedicellariae and triphyllous pedicellariae of the neotype of D antillarum NHMTFMCBMEQ00237 AndashH tridentate pedicellariae AndashB external and internal views of a broad form CndashD side views of a broad form EndashF narrow form (external views) G internal view of a narrow form H side view of a narrow form I details of a narrow tridentate pedicellaria showing lateral teeth JndashK Triphyllous pedicellariae internal and external views respectively L details of a triphyllous pedicellaria showing peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 151A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Diadema Gray 1825

Gray 1825 p246 Type species Echinometra setosa Leske 1778 by ruling of the ICZN 1954Assigned species D setosum (Leske 1778) D savignyi Michelin 1845 D paucispinum A Agassiz 1863 D palmeri Baker

1967 D mexicanum A Agassiz 1863 D antillarum (Philippi 1845) D ascensionis Mortensen 1909 designated D antillarum ascensionis by Pawson (1978)

Diadema antillarum (Philippi 1845)Figs 1ndash4 tables 1ndash3

Cidaris (Diadema) antillarum Philippi 1845 Arch F Naturg 11 (1) p 355Diadema antillarum A Agassiz 1863 Bull MCZ 1 p19 Nutting 1895 Bull Univ Iowa Lab Nat Hist (3) p224

unnumbered plate fig1 (young Diadema labelled Aspidodiadema sp)

Neotype diagnosis Test and spines typically black with a red tinge However spines vary in colour from whitebrown to black Iridophores occur as a pentamerous ring around the apical disc Arch-shaped depressions are found on the apical disc along the inner edges of genital plates only in juveniles and young adults This character fades with age In transverse section ambulacral and interambulacral spines show an isosceles triangle-shaped solid wedges that constitute the shaft These wedges typically number sixteen in ambulacral spines and twenty in the largest interambulacral spines Only tridentate and triphyllous pedicellariae are present Tridentate pedicellariae occur as two forms one with broad valves and a narrow form Both forms have moderately curved valves and serrations along the edges of the valves

Material examined Neotype (TFMCBMEQ00237) in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material One specimen of the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology The species name refers to the species occurrence in The Antilles Islands Ecology Diadema antillarum is a key herbivore on Caribbean reefs Until 1983 this species was abundant on

Caribbean coral reefs and in seagrass beds In 1983 a non-identified pathogenic infection resulted in a mass die-off of this species which reduced population sizes by more than 97 in the Caribbean Sea and western Atlantic (Lessios 1984b 1988) Such population have failed to recover to pre-die-off numbers (Lessios 2005) Following the mass mortality of D antillarum there was an immediate increase in algal growth particularly in areas where herbivorous fish had been reduced in numbers through intense fishing pressure In such regions a reduction of algal-free areas suitable for coral settlement has been reported and is believed to be responsible for the reduction in coral-cover (Lessios 1988)

Diadema antillarum spawns around the time of the new moon typically on the first two days of the first lunar quarter (Lessios 1984a) Settlement times and levels of recruitment of D antillarum have been found to vary in different localities (Lewis 1966 Bauer 1976 Lessios 1981 1984b)

Distribution Diadema antillarum is found off the coasts of the tropical western Atlantic Ocean including the Caribbean Sea tropical coasts of South America down to Brazil and from Bermuda to Florida It is typically found in shallow waters on coral reefs but has been reported from depths of 70 m (Mortensen 1940)

Neotype description The test is hemispherical with a horizontal diameter of 450 mm and a vertical diameter of 205 mm (Fig 1) The epithelium of the test is black (Fig 1AndashC) with a red tinge In living specimens narrow blue lines of iridophores occur down either side of the naked median areas of the interambulacra and as a ring around the apical disc The apical system is hemicyclic and measures 2394 mm 24 of the testrsquos horizontal diameter (Fig 2D amp Table 1) The genital plates are wider than long with one to three tubercles along their inner edge (Table 1 amp Fig 2F) and a genital pore that measures 45 the genital plate length A faint arch-shaped depression occurs on the inner edge of each genital plate forming the corners of the apical ring Ocular plates are pentagonal in shape with two small tubercles in the centre of the plate The periproctal cone is small and black and does not have any platelets or markings on the skin (Fig 1A amp Table 1) The ambulacra are slightly raised aborally and measure 22 of the width of interambulacral measured at the ambitus (Table 1 amp Fig 2) They have two rows of large crenulate and perforate primary tubercles (Fig 2) with an offset inner series of small tubercles The

RODRIacuteGUEZ ET AL152 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

interambulacra measure 18 mm in width at the ambitus and contain four series of large primary tubercles with an offset inner series of small tubercles Each series contains 14 primary tubercles with areoles of moderate size (Fig 2 amp Table 1) The peristome measures 219 mm at the ambitus 481 of the horizontal diameter It is subcircular in shape and has five pairs of buccal tube feet The peristomial membrane is black and is covered with a large number of triphyllous pedicellariae Auricles are robust with high processes (Fig 2E)

Ambulacral and interambulacral spines differ in their width and ornamentation Ambulacral spines are black with a red tinge (Fig 3) the longest measures 2852 mm in length (6334 of the test horizontal) on the neotype 09 mm in width proximally and 05 mm distally (Fig 3EndashG) These are verticillate with barbs distally (Fig 3AndashC) and are typically composed of sixteen solid wedges

Interambulacral spines are predominantly black with a red tinge but a number of brown and white spines are present aborally (Figs 1 amp 3) They are long and slender the longest measuring 4737 mm in length on the neotype The spines are verticillate formed by 20 solid wedges which radiate out from a hollow axial cavity Spine width varies from 14 mm in diameter proximally to 09 mm distally with numerous barbs present distally (Figs 3HndashJ)

Only tridentate and triphyllous pedicellariae were found on the neotype with no claviform ophicephalous pedicellariae observed (Fig 4 amptable 3) Tridentate pedicellariae occur as two forms one with broad valves (Fig 4AndashD) and a long broad neck on a short stalk and a narrow form (comparing valves of equal length) with narrow valves a short neck and a long stalk (Fig 4EndashH) Both forms have moderately curved valves with serrations along edges of the blades of the valves (Figs 4GndashI) Both forms occur orally and aborally However the broad form is less abundant Triphyllous pedicellariae are typical of the genus in having broad valves that are rounded distally with numerous small peripheral teeth that occur in two rows (Figs 4JndashL) The head of each pedicellaria is supported by a long muscular neck attached to a long stalk

Diadema africanum sp novFigs 5ndash10 tables 1ndash3

Diagnosis Test and spines typically black with a red tinge and a turquoise sheen when viewed in direct sunlight The iridophore pattern occurs as bold blue lines down either side of the naked interambulacral areas as a pentamerous ring around the apical disc and as lines along some plate boundaries Apical disc is hemicyclic with arch-shaped depressions on the denuded genital plates in both adults and juveniles Gonopores measure 33 of the length of the genital plates The periproctal cone is black with no markings The Peristome is proportionally large measuring 40ndash60 of the testrsquos horizontal diameter Spines are verticillate and hollow with distal barbs Verticilations are formed of urn-shaped solid wedges that are visible when the spines are viewed in transverse section These wedges typically number twenty in ambulacral spines and twenty-four in interambulacral spines Only tridentate and triphyllous pedicellariae are present The tridentate pedicellariae occur as a single form with reasonably broad curved valves with almost straight edges that can either be smooth or serrated with an expanded distal gripping region The blades of the valves meet only along the upper fifth of their length The head of each pedicellaria is supported by a long muscular neck attached to a mid-length stalk

Holotype TFMCBMEQ00232 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Paratypes TFMCBMEQ 00233 TFMCBMEQ 00234 TFMCBMEQ 00235 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material Twenty-one specimens in the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology Species name refers to the geographical distribution of the species on the western coasts of Africa It is distributed on islands and continental coasts along the African continental shelf

Ecology Diadema africanum is an important macro-herbivore on subtropical and tropical rocky reefs off the West African coasts In the eastern Atlantic islands and particularly in Madeira and the Canary Islands the species is distributed throughout the islands at densities that can reach more than 12 individuals m2 (Brito et al 1984 Alves et al 2001 Hernaacutendez 2006 Clemente 2007 Hernaacutendez et al 2008) The species can therefore dramatically reduce the abundance of non-crustose macroalgae resulting in the formation of sea urchin-dominated barren grounds (Hernaacutendez et al 2008) This phenomenon is especially relevant in Madeira Salvage and the Canary Islands where macroalgal beds represent the main ecosystem Diadema africanum also occurs on coral dominated

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 153A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

reefs in Cape Verde and Sacirco Tome where sea urchin control of macroalgae via grazing is beneficial for coral settlement and growth Only a few studies have looked at the abundance and ecological role of D africanum along the tropical western African coasts (eg John et al 1977 1992) with further investigations needed

Distribution Diadema africanum occurs in the Eastern Atlantic islands from Madeira Islands to the Guinean Gulf including Salvage Islands Canary Islands Cape Verde Islands (Hernaacutendez et al 2008) and Sacirco Tome Island (Lessios et al 2001) It has also been also recorded in continental areas of Ghana (John et al 1977 1992) and in Ngor Island Senegal (P Wirtz pers com)

Description The test is hemispherical with a horizontal diameter of 6673 mm and a vertical diameter of 3278 mm in the paratype and 6123 mm hd and 3136 mm vd in the holotype The base colour of the test epithelium is black with a red tinge (Fig 5AndashC) while the denuded test is white (Fig 6AndashE) The apical system measures 1814 mm in the paratype and is hemicyclic with ocular plates II and III exsert (Fig 6A) The genital plates are wider than long and have up to four small tubercles along their inner-edge (Table 1amp Fig 7AndashB) with large genital pores that measure 33 of the genital plate length (Fig 7A) The ocular plates are pentagonal with a small pore located at the top of the plate and have from one to three small tubercles along the centre of the plate (Fig 7B)

On the naked test distinct arch-shaped depressions are present on the genital plates of both adults and juveniles (Table 5 ampFig 7B) These depressions correspond to the corners of the pentamerous apical ring of iridophores seen in living sea urchins (Fig 7CndashE) The iridophore pattern is bold and bright on the apical system when viewed in sunlight The periproct is 1126 mm wide in the paratype (approximately 16 of the testrsquos horizontal diameter) and has a small black periproctal cone that has no platelets or markings on the skin (Fig 5A)

The ambulacra are slightly raised aborally (Fig 6C) and measure 30 of the width of the interambulacra (865 mm) at the ambitus in the paratype They have two rows of large primary tubercles and an offset inner series of small tubercles that are perforated and crenulated with non-conjugate pore-pairs and phyllodes developed adorally

The interambulacra are broader than the ambulacra at the ambitus (Fig 6CndashD) with 5ndash6 series (the inner median series is more offset in some specimens giving the impression of two series) of 14 primary tubercles Tubercles are perforate and crenulate and have areoles of moderate size (Fig 7A) During the day blue lines of iridophores can be seen down either side of the naked median regions

The peristome is subcircular (Fig 6B) and in the paratype it measures 269 mm in diameter 40 of the testrsquos horizontal diameter The peristomal membrane is black with a red tinge and has five pairs of buccal tube feet (Fig 5B) with abundant triphyllous pedicellariae The auricles are robust and have high processes (Fig 6F)

In adults the spine epithelium is black with a red tinge and a turquoise sheen when viewed in direct sunlight In juveniles spines are banded red and white which is typical of the genus Ambulacral spines measure 4321 mm in length in the paratype (2883 of the test horizontal diameter) These spines are strongly verticillate with barbs pointing distally (Fig 8AndashD) Proximally these spines have a mean diameter of 089 mm that decreases distally (Fig 8EndashG) The axial cavity comprises 288 of the horizontal diameter which increases to 3522 in the distal region (Fig 8EndashG) The solid wedges are urn-shaped and typically number twenty comprising 6342 of the spinersquos horizontal diameter in the proximal section

Interambulacral spines (Fig 8HndashN) are long and slender with a maximum diameter of 2 mm proximally and taper distally (Fig 8KndashN) These spines measure 5862 mm in the paratype In transverse section the axial cavity comprises 2992 of the horizontal diameter proximally but increases to 3917 in the distal region (Table 2 Fig 8LndashN) The solid wedges are urn-shaped and typically number twenty-four 6257 of the of the spinersquos horizontal diameter in the proximal section

Both tridentate and triphyllous pedicellariae are present in D africanum (Fig 9) No ophicephalous pedicellariae were found either true ophicephalous or of the claviform type which have been reported in other species of Diadema (Mortensen 1940) Only a single form of tridentate pedicellaria is found in this species (Fig 9AndashI) which are abundant orally and aborally but particularly around the periproct and around the peristome This form of tidentate pedicellaria has a long muscular neck on a long stalk which allows a high degree of movement (Fig 9A) The valves of the pedicellariae are moderately curved and only meet along the upper fifth of their length The blade of the valves has almost straight edges that are either smooth or serrated with an expanded distal gripping region (Fig 9DndashI) Triphyllous pedicellariae are more abundant than the tridentate form and are distributed all over the sea urchin test but occur in particularly large numbers around the peristome Their valves are small and broad (Fig 9JndashN) with numerous small peripheral teeth that form two rows along the edges of the valves which interlock when the valves are closed (Fig 9LndashN)

RODRIacuteGUEZ ET AL154 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 5 NHMTFMCBMEQ00232 holotype of Diadema africanum A aboral view B oral view C lateral view

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 155A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 6 NHMTFMCBMEQ00233 paratype of Diadema africanum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F auricle

RODRIacuteGUEZ ET AL156 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 7 NHMTFMCBMEQ00233 paratype of Diadema africanum Apical system and pattern of iridophores A genital plate gonopore and an ambulacrum B close-up of the apical system (paratype) C amp D pattern of iridophores around the apical system on a living specimen in daylight E pattern of iridophores at night F pattern of iridophore on a living specimen in daylight

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 157A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 8 NHMTFMCBMEQ00233 paratype of Diadema africanum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashL) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL158 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 4 Scanning electron microscopy images (SEMs) of individual valves of tridentate pedicellariae and triphyllous pedicellariae of the neotype of D antillarum NHMTFMCBMEQ00237 AndashH tridentate pedicellariae AndashB external and internal views of a broad form CndashD side views of a broad form EndashF narrow form (external views) G internal view of a narrow form H side view of a narrow form I details of a narrow tridentate pedicellaria showing lateral teeth JndashK Triphyllous pedicellariae internal and external views respectively L details of a triphyllous pedicellaria showing peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 151A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Diadema Gray 1825

Gray 1825 p246 Type species Echinometra setosa Leske 1778 by ruling of the ICZN 1954Assigned species D setosum (Leske 1778) D savignyi Michelin 1845 D paucispinum A Agassiz 1863 D palmeri Baker

1967 D mexicanum A Agassiz 1863 D antillarum (Philippi 1845) D ascensionis Mortensen 1909 designated D antillarum ascensionis by Pawson (1978)

Diadema antillarum (Philippi 1845)Figs 1ndash4 tables 1ndash3

Cidaris (Diadema) antillarum Philippi 1845 Arch F Naturg 11 (1) p 355Diadema antillarum A Agassiz 1863 Bull MCZ 1 p19 Nutting 1895 Bull Univ Iowa Lab Nat Hist (3) p224

unnumbered plate fig1 (young Diadema labelled Aspidodiadema sp)

Neotype diagnosis Test and spines typically black with a red tinge However spines vary in colour from whitebrown to black Iridophores occur as a pentamerous ring around the apical disc Arch-shaped depressions are found on the apical disc along the inner edges of genital plates only in juveniles and young adults This character fades with age In transverse section ambulacral and interambulacral spines show an isosceles triangle-shaped solid wedges that constitute the shaft These wedges typically number sixteen in ambulacral spines and twenty in the largest interambulacral spines Only tridentate and triphyllous pedicellariae are present Tridentate pedicellariae occur as two forms one with broad valves and a narrow form Both forms have moderately curved valves and serrations along the edges of the valves

Material examined Neotype (TFMCBMEQ00237) in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material One specimen of the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology The species name refers to the species occurrence in The Antilles Islands Ecology Diadema antillarum is a key herbivore on Caribbean reefs Until 1983 this species was abundant on

Caribbean coral reefs and in seagrass beds In 1983 a non-identified pathogenic infection resulted in a mass die-off of this species which reduced population sizes by more than 97 in the Caribbean Sea and western Atlantic (Lessios 1984b 1988) Such population have failed to recover to pre-die-off numbers (Lessios 2005) Following the mass mortality of D antillarum there was an immediate increase in algal growth particularly in areas where herbivorous fish had been reduced in numbers through intense fishing pressure In such regions a reduction of algal-free areas suitable for coral settlement has been reported and is believed to be responsible for the reduction in coral-cover (Lessios 1988)

Diadema antillarum spawns around the time of the new moon typically on the first two days of the first lunar quarter (Lessios 1984a) Settlement times and levels of recruitment of D antillarum have been found to vary in different localities (Lewis 1966 Bauer 1976 Lessios 1981 1984b)

Distribution Diadema antillarum is found off the coasts of the tropical western Atlantic Ocean including the Caribbean Sea tropical coasts of South America down to Brazil and from Bermuda to Florida It is typically found in shallow waters on coral reefs but has been reported from depths of 70 m (Mortensen 1940)

Neotype description The test is hemispherical with a horizontal diameter of 450 mm and a vertical diameter of 205 mm (Fig 1) The epithelium of the test is black (Fig 1AndashC) with a red tinge In living specimens narrow blue lines of iridophores occur down either side of the naked median areas of the interambulacra and as a ring around the apical disc The apical system is hemicyclic and measures 2394 mm 24 of the testrsquos horizontal diameter (Fig 2D amp Table 1) The genital plates are wider than long with one to three tubercles along their inner edge (Table 1 amp Fig 2F) and a genital pore that measures 45 the genital plate length A faint arch-shaped depression occurs on the inner edge of each genital plate forming the corners of the apical ring Ocular plates are pentagonal in shape with two small tubercles in the centre of the plate The periproctal cone is small and black and does not have any platelets or markings on the skin (Fig 1A amp Table 1) The ambulacra are slightly raised aborally and measure 22 of the width of interambulacral measured at the ambitus (Table 1 amp Fig 2) They have two rows of large crenulate and perforate primary tubercles (Fig 2) with an offset inner series of small tubercles The

RODRIacuteGUEZ ET AL152 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

interambulacra measure 18 mm in width at the ambitus and contain four series of large primary tubercles with an offset inner series of small tubercles Each series contains 14 primary tubercles with areoles of moderate size (Fig 2 amp Table 1) The peristome measures 219 mm at the ambitus 481 of the horizontal diameter It is subcircular in shape and has five pairs of buccal tube feet The peristomial membrane is black and is covered with a large number of triphyllous pedicellariae Auricles are robust with high processes (Fig 2E)

Ambulacral and interambulacral spines differ in their width and ornamentation Ambulacral spines are black with a red tinge (Fig 3) the longest measures 2852 mm in length (6334 of the test horizontal) on the neotype 09 mm in width proximally and 05 mm distally (Fig 3EndashG) These are verticillate with barbs distally (Fig 3AndashC) and are typically composed of sixteen solid wedges

Interambulacral spines are predominantly black with a red tinge but a number of brown and white spines are present aborally (Figs 1 amp 3) They are long and slender the longest measuring 4737 mm in length on the neotype The spines are verticillate formed by 20 solid wedges which radiate out from a hollow axial cavity Spine width varies from 14 mm in diameter proximally to 09 mm distally with numerous barbs present distally (Figs 3HndashJ)

Only tridentate and triphyllous pedicellariae were found on the neotype with no claviform ophicephalous pedicellariae observed (Fig 4 amptable 3) Tridentate pedicellariae occur as two forms one with broad valves (Fig 4AndashD) and a long broad neck on a short stalk and a narrow form (comparing valves of equal length) with narrow valves a short neck and a long stalk (Fig 4EndashH) Both forms have moderately curved valves with serrations along edges of the blades of the valves (Figs 4GndashI) Both forms occur orally and aborally However the broad form is less abundant Triphyllous pedicellariae are typical of the genus in having broad valves that are rounded distally with numerous small peripheral teeth that occur in two rows (Figs 4JndashL) The head of each pedicellaria is supported by a long muscular neck attached to a long stalk

Diadema africanum sp novFigs 5ndash10 tables 1ndash3

Diagnosis Test and spines typically black with a red tinge and a turquoise sheen when viewed in direct sunlight The iridophore pattern occurs as bold blue lines down either side of the naked interambulacral areas as a pentamerous ring around the apical disc and as lines along some plate boundaries Apical disc is hemicyclic with arch-shaped depressions on the denuded genital plates in both adults and juveniles Gonopores measure 33 of the length of the genital plates The periproctal cone is black with no markings The Peristome is proportionally large measuring 40ndash60 of the testrsquos horizontal diameter Spines are verticillate and hollow with distal barbs Verticilations are formed of urn-shaped solid wedges that are visible when the spines are viewed in transverse section These wedges typically number twenty in ambulacral spines and twenty-four in interambulacral spines Only tridentate and triphyllous pedicellariae are present The tridentate pedicellariae occur as a single form with reasonably broad curved valves with almost straight edges that can either be smooth or serrated with an expanded distal gripping region The blades of the valves meet only along the upper fifth of their length The head of each pedicellaria is supported by a long muscular neck attached to a mid-length stalk

Holotype TFMCBMEQ00232 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Paratypes TFMCBMEQ 00233 TFMCBMEQ 00234 TFMCBMEQ 00235 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material Twenty-one specimens in the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology Species name refers to the geographical distribution of the species on the western coasts of Africa It is distributed on islands and continental coasts along the African continental shelf

Ecology Diadema africanum is an important macro-herbivore on subtropical and tropical rocky reefs off the West African coasts In the eastern Atlantic islands and particularly in Madeira and the Canary Islands the species is distributed throughout the islands at densities that can reach more than 12 individuals m2 (Brito et al 1984 Alves et al 2001 Hernaacutendez 2006 Clemente 2007 Hernaacutendez et al 2008) The species can therefore dramatically reduce the abundance of non-crustose macroalgae resulting in the formation of sea urchin-dominated barren grounds (Hernaacutendez et al 2008) This phenomenon is especially relevant in Madeira Salvage and the Canary Islands where macroalgal beds represent the main ecosystem Diadema africanum also occurs on coral dominated

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 153A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

reefs in Cape Verde and Sacirco Tome where sea urchin control of macroalgae via grazing is beneficial for coral settlement and growth Only a few studies have looked at the abundance and ecological role of D africanum along the tropical western African coasts (eg John et al 1977 1992) with further investigations needed

Distribution Diadema africanum occurs in the Eastern Atlantic islands from Madeira Islands to the Guinean Gulf including Salvage Islands Canary Islands Cape Verde Islands (Hernaacutendez et al 2008) and Sacirco Tome Island (Lessios et al 2001) It has also been also recorded in continental areas of Ghana (John et al 1977 1992) and in Ngor Island Senegal (P Wirtz pers com)

Description The test is hemispherical with a horizontal diameter of 6673 mm and a vertical diameter of 3278 mm in the paratype and 6123 mm hd and 3136 mm vd in the holotype The base colour of the test epithelium is black with a red tinge (Fig 5AndashC) while the denuded test is white (Fig 6AndashE) The apical system measures 1814 mm in the paratype and is hemicyclic with ocular plates II and III exsert (Fig 6A) The genital plates are wider than long and have up to four small tubercles along their inner-edge (Table 1amp Fig 7AndashB) with large genital pores that measure 33 of the genital plate length (Fig 7A) The ocular plates are pentagonal with a small pore located at the top of the plate and have from one to three small tubercles along the centre of the plate (Fig 7B)

On the naked test distinct arch-shaped depressions are present on the genital plates of both adults and juveniles (Table 5 ampFig 7B) These depressions correspond to the corners of the pentamerous apical ring of iridophores seen in living sea urchins (Fig 7CndashE) The iridophore pattern is bold and bright on the apical system when viewed in sunlight The periproct is 1126 mm wide in the paratype (approximately 16 of the testrsquos horizontal diameter) and has a small black periproctal cone that has no platelets or markings on the skin (Fig 5A)

The ambulacra are slightly raised aborally (Fig 6C) and measure 30 of the width of the interambulacra (865 mm) at the ambitus in the paratype They have two rows of large primary tubercles and an offset inner series of small tubercles that are perforated and crenulated with non-conjugate pore-pairs and phyllodes developed adorally

The interambulacra are broader than the ambulacra at the ambitus (Fig 6CndashD) with 5ndash6 series (the inner median series is more offset in some specimens giving the impression of two series) of 14 primary tubercles Tubercles are perforate and crenulate and have areoles of moderate size (Fig 7A) During the day blue lines of iridophores can be seen down either side of the naked median regions

The peristome is subcircular (Fig 6B) and in the paratype it measures 269 mm in diameter 40 of the testrsquos horizontal diameter The peristomal membrane is black with a red tinge and has five pairs of buccal tube feet (Fig 5B) with abundant triphyllous pedicellariae The auricles are robust and have high processes (Fig 6F)

In adults the spine epithelium is black with a red tinge and a turquoise sheen when viewed in direct sunlight In juveniles spines are banded red and white which is typical of the genus Ambulacral spines measure 4321 mm in length in the paratype (2883 of the test horizontal diameter) These spines are strongly verticillate with barbs pointing distally (Fig 8AndashD) Proximally these spines have a mean diameter of 089 mm that decreases distally (Fig 8EndashG) The axial cavity comprises 288 of the horizontal diameter which increases to 3522 in the distal region (Fig 8EndashG) The solid wedges are urn-shaped and typically number twenty comprising 6342 of the spinersquos horizontal diameter in the proximal section

Interambulacral spines (Fig 8HndashN) are long and slender with a maximum diameter of 2 mm proximally and taper distally (Fig 8KndashN) These spines measure 5862 mm in the paratype In transverse section the axial cavity comprises 2992 of the horizontal diameter proximally but increases to 3917 in the distal region (Table 2 Fig 8LndashN) The solid wedges are urn-shaped and typically number twenty-four 6257 of the of the spinersquos horizontal diameter in the proximal section

Both tridentate and triphyllous pedicellariae are present in D africanum (Fig 9) No ophicephalous pedicellariae were found either true ophicephalous or of the claviform type which have been reported in other species of Diadema (Mortensen 1940) Only a single form of tridentate pedicellaria is found in this species (Fig 9AndashI) which are abundant orally and aborally but particularly around the periproct and around the peristome This form of tidentate pedicellaria has a long muscular neck on a long stalk which allows a high degree of movement (Fig 9A) The valves of the pedicellariae are moderately curved and only meet along the upper fifth of their length The blade of the valves has almost straight edges that are either smooth or serrated with an expanded distal gripping region (Fig 9DndashI) Triphyllous pedicellariae are more abundant than the tridentate form and are distributed all over the sea urchin test but occur in particularly large numbers around the peristome Their valves are small and broad (Fig 9JndashN) with numerous small peripheral teeth that form two rows along the edges of the valves which interlock when the valves are closed (Fig 9LndashN)

RODRIacuteGUEZ ET AL154 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 5 NHMTFMCBMEQ00232 holotype of Diadema africanum A aboral view B oral view C lateral view

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 155A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 6 NHMTFMCBMEQ00233 paratype of Diadema africanum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F auricle

RODRIacuteGUEZ ET AL156 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 7 NHMTFMCBMEQ00233 paratype of Diadema africanum Apical system and pattern of iridophores A genital plate gonopore and an ambulacrum B close-up of the apical system (paratype) C amp D pattern of iridophores around the apical system on a living specimen in daylight E pattern of iridophores at night F pattern of iridophore on a living specimen in daylight

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 157A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 8 NHMTFMCBMEQ00233 paratype of Diadema africanum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashL) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL158 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Diadema Gray 1825

Gray 1825 p246 Type species Echinometra setosa Leske 1778 by ruling of the ICZN 1954Assigned species D setosum (Leske 1778) D savignyi Michelin 1845 D paucispinum A Agassiz 1863 D palmeri Baker

1967 D mexicanum A Agassiz 1863 D antillarum (Philippi 1845) D ascensionis Mortensen 1909 designated D antillarum ascensionis by Pawson (1978)

Diadema antillarum (Philippi 1845)Figs 1ndash4 tables 1ndash3

Cidaris (Diadema) antillarum Philippi 1845 Arch F Naturg 11 (1) p 355Diadema antillarum A Agassiz 1863 Bull MCZ 1 p19 Nutting 1895 Bull Univ Iowa Lab Nat Hist (3) p224

unnumbered plate fig1 (young Diadema labelled Aspidodiadema sp)

Neotype diagnosis Test and spines typically black with a red tinge However spines vary in colour from whitebrown to black Iridophores occur as a pentamerous ring around the apical disc Arch-shaped depressions are found on the apical disc along the inner edges of genital plates only in juveniles and young adults This character fades with age In transverse section ambulacral and interambulacral spines show an isosceles triangle-shaped solid wedges that constitute the shaft These wedges typically number sixteen in ambulacral spines and twenty in the largest interambulacral spines Only tridentate and triphyllous pedicellariae are present Tridentate pedicellariae occur as two forms one with broad valves and a narrow form Both forms have moderately curved valves and serrations along the edges of the valves

Material examined Neotype (TFMCBMEQ00237) in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material One specimen of the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology The species name refers to the species occurrence in The Antilles Islands Ecology Diadema antillarum is a key herbivore on Caribbean reefs Until 1983 this species was abundant on

Caribbean coral reefs and in seagrass beds In 1983 a non-identified pathogenic infection resulted in a mass die-off of this species which reduced population sizes by more than 97 in the Caribbean Sea and western Atlantic (Lessios 1984b 1988) Such population have failed to recover to pre-die-off numbers (Lessios 2005) Following the mass mortality of D antillarum there was an immediate increase in algal growth particularly in areas where herbivorous fish had been reduced in numbers through intense fishing pressure In such regions a reduction of algal-free areas suitable for coral settlement has been reported and is believed to be responsible for the reduction in coral-cover (Lessios 1988)

Diadema antillarum spawns around the time of the new moon typically on the first two days of the first lunar quarter (Lessios 1984a) Settlement times and levels of recruitment of D antillarum have been found to vary in different localities (Lewis 1966 Bauer 1976 Lessios 1981 1984b)

Distribution Diadema antillarum is found off the coasts of the tropical western Atlantic Ocean including the Caribbean Sea tropical coasts of South America down to Brazil and from Bermuda to Florida It is typically found in shallow waters on coral reefs but has been reported from depths of 70 m (Mortensen 1940)

Neotype description The test is hemispherical with a horizontal diameter of 450 mm and a vertical diameter of 205 mm (Fig 1) The epithelium of the test is black (Fig 1AndashC) with a red tinge In living specimens narrow blue lines of iridophores occur down either side of the naked median areas of the interambulacra and as a ring around the apical disc The apical system is hemicyclic and measures 2394 mm 24 of the testrsquos horizontal diameter (Fig 2D amp Table 1) The genital plates are wider than long with one to three tubercles along their inner edge (Table 1 amp Fig 2F) and a genital pore that measures 45 the genital plate length A faint arch-shaped depression occurs on the inner edge of each genital plate forming the corners of the apical ring Ocular plates are pentagonal in shape with two small tubercles in the centre of the plate The periproctal cone is small and black and does not have any platelets or markings on the skin (Fig 1A amp Table 1) The ambulacra are slightly raised aborally and measure 22 of the width of interambulacral measured at the ambitus (Table 1 amp Fig 2) They have two rows of large crenulate and perforate primary tubercles (Fig 2) with an offset inner series of small tubercles The

RODRIacuteGUEZ ET AL152 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

interambulacra measure 18 mm in width at the ambitus and contain four series of large primary tubercles with an offset inner series of small tubercles Each series contains 14 primary tubercles with areoles of moderate size (Fig 2 amp Table 1) The peristome measures 219 mm at the ambitus 481 of the horizontal diameter It is subcircular in shape and has five pairs of buccal tube feet The peristomial membrane is black and is covered with a large number of triphyllous pedicellariae Auricles are robust with high processes (Fig 2E)

Ambulacral and interambulacral spines differ in their width and ornamentation Ambulacral spines are black with a red tinge (Fig 3) the longest measures 2852 mm in length (6334 of the test horizontal) on the neotype 09 mm in width proximally and 05 mm distally (Fig 3EndashG) These are verticillate with barbs distally (Fig 3AndashC) and are typically composed of sixteen solid wedges

Interambulacral spines are predominantly black with a red tinge but a number of brown and white spines are present aborally (Figs 1 amp 3) They are long and slender the longest measuring 4737 mm in length on the neotype The spines are verticillate formed by 20 solid wedges which radiate out from a hollow axial cavity Spine width varies from 14 mm in diameter proximally to 09 mm distally with numerous barbs present distally (Figs 3HndashJ)

Only tridentate and triphyllous pedicellariae were found on the neotype with no claviform ophicephalous pedicellariae observed (Fig 4 amptable 3) Tridentate pedicellariae occur as two forms one with broad valves (Fig 4AndashD) and a long broad neck on a short stalk and a narrow form (comparing valves of equal length) with narrow valves a short neck and a long stalk (Fig 4EndashH) Both forms have moderately curved valves with serrations along edges of the blades of the valves (Figs 4GndashI) Both forms occur orally and aborally However the broad form is less abundant Triphyllous pedicellariae are typical of the genus in having broad valves that are rounded distally with numerous small peripheral teeth that occur in two rows (Figs 4JndashL) The head of each pedicellaria is supported by a long muscular neck attached to a long stalk

Diadema africanum sp novFigs 5ndash10 tables 1ndash3

Diagnosis Test and spines typically black with a red tinge and a turquoise sheen when viewed in direct sunlight The iridophore pattern occurs as bold blue lines down either side of the naked interambulacral areas as a pentamerous ring around the apical disc and as lines along some plate boundaries Apical disc is hemicyclic with arch-shaped depressions on the denuded genital plates in both adults and juveniles Gonopores measure 33 of the length of the genital plates The periproctal cone is black with no markings The Peristome is proportionally large measuring 40ndash60 of the testrsquos horizontal diameter Spines are verticillate and hollow with distal barbs Verticilations are formed of urn-shaped solid wedges that are visible when the spines are viewed in transverse section These wedges typically number twenty in ambulacral spines and twenty-four in interambulacral spines Only tridentate and triphyllous pedicellariae are present The tridentate pedicellariae occur as a single form with reasonably broad curved valves with almost straight edges that can either be smooth or serrated with an expanded distal gripping region The blades of the valves meet only along the upper fifth of their length The head of each pedicellaria is supported by a long muscular neck attached to a mid-length stalk

Holotype TFMCBMEQ00232 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Paratypes TFMCBMEQ 00233 TFMCBMEQ 00234 TFMCBMEQ 00235 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material Twenty-one specimens in the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology Species name refers to the geographical distribution of the species on the western coasts of Africa It is distributed on islands and continental coasts along the African continental shelf

Ecology Diadema africanum is an important macro-herbivore on subtropical and tropical rocky reefs off the West African coasts In the eastern Atlantic islands and particularly in Madeira and the Canary Islands the species is distributed throughout the islands at densities that can reach more than 12 individuals m2 (Brito et al 1984 Alves et al 2001 Hernaacutendez 2006 Clemente 2007 Hernaacutendez et al 2008) The species can therefore dramatically reduce the abundance of non-crustose macroalgae resulting in the formation of sea urchin-dominated barren grounds (Hernaacutendez et al 2008) This phenomenon is especially relevant in Madeira Salvage and the Canary Islands where macroalgal beds represent the main ecosystem Diadema africanum also occurs on coral dominated

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 153A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

reefs in Cape Verde and Sacirco Tome where sea urchin control of macroalgae via grazing is beneficial for coral settlement and growth Only a few studies have looked at the abundance and ecological role of D africanum along the tropical western African coasts (eg John et al 1977 1992) with further investigations needed

Distribution Diadema africanum occurs in the Eastern Atlantic islands from Madeira Islands to the Guinean Gulf including Salvage Islands Canary Islands Cape Verde Islands (Hernaacutendez et al 2008) and Sacirco Tome Island (Lessios et al 2001) It has also been also recorded in continental areas of Ghana (John et al 1977 1992) and in Ngor Island Senegal (P Wirtz pers com)

Description The test is hemispherical with a horizontal diameter of 6673 mm and a vertical diameter of 3278 mm in the paratype and 6123 mm hd and 3136 mm vd in the holotype The base colour of the test epithelium is black with a red tinge (Fig 5AndashC) while the denuded test is white (Fig 6AndashE) The apical system measures 1814 mm in the paratype and is hemicyclic with ocular plates II and III exsert (Fig 6A) The genital plates are wider than long and have up to four small tubercles along their inner-edge (Table 1amp Fig 7AndashB) with large genital pores that measure 33 of the genital plate length (Fig 7A) The ocular plates are pentagonal with a small pore located at the top of the plate and have from one to three small tubercles along the centre of the plate (Fig 7B)

On the naked test distinct arch-shaped depressions are present on the genital plates of both adults and juveniles (Table 5 ampFig 7B) These depressions correspond to the corners of the pentamerous apical ring of iridophores seen in living sea urchins (Fig 7CndashE) The iridophore pattern is bold and bright on the apical system when viewed in sunlight The periproct is 1126 mm wide in the paratype (approximately 16 of the testrsquos horizontal diameter) and has a small black periproctal cone that has no platelets or markings on the skin (Fig 5A)

The ambulacra are slightly raised aborally (Fig 6C) and measure 30 of the width of the interambulacra (865 mm) at the ambitus in the paratype They have two rows of large primary tubercles and an offset inner series of small tubercles that are perforated and crenulated with non-conjugate pore-pairs and phyllodes developed adorally

The interambulacra are broader than the ambulacra at the ambitus (Fig 6CndashD) with 5ndash6 series (the inner median series is more offset in some specimens giving the impression of two series) of 14 primary tubercles Tubercles are perforate and crenulate and have areoles of moderate size (Fig 7A) During the day blue lines of iridophores can be seen down either side of the naked median regions

The peristome is subcircular (Fig 6B) and in the paratype it measures 269 mm in diameter 40 of the testrsquos horizontal diameter The peristomal membrane is black with a red tinge and has five pairs of buccal tube feet (Fig 5B) with abundant triphyllous pedicellariae The auricles are robust and have high processes (Fig 6F)

In adults the spine epithelium is black with a red tinge and a turquoise sheen when viewed in direct sunlight In juveniles spines are banded red and white which is typical of the genus Ambulacral spines measure 4321 mm in length in the paratype (2883 of the test horizontal diameter) These spines are strongly verticillate with barbs pointing distally (Fig 8AndashD) Proximally these spines have a mean diameter of 089 mm that decreases distally (Fig 8EndashG) The axial cavity comprises 288 of the horizontal diameter which increases to 3522 in the distal region (Fig 8EndashG) The solid wedges are urn-shaped and typically number twenty comprising 6342 of the spinersquos horizontal diameter in the proximal section

Interambulacral spines (Fig 8HndashN) are long and slender with a maximum diameter of 2 mm proximally and taper distally (Fig 8KndashN) These spines measure 5862 mm in the paratype In transverse section the axial cavity comprises 2992 of the horizontal diameter proximally but increases to 3917 in the distal region (Table 2 Fig 8LndashN) The solid wedges are urn-shaped and typically number twenty-four 6257 of the of the spinersquos horizontal diameter in the proximal section

Both tridentate and triphyllous pedicellariae are present in D africanum (Fig 9) No ophicephalous pedicellariae were found either true ophicephalous or of the claviform type which have been reported in other species of Diadema (Mortensen 1940) Only a single form of tridentate pedicellaria is found in this species (Fig 9AndashI) which are abundant orally and aborally but particularly around the periproct and around the peristome This form of tidentate pedicellaria has a long muscular neck on a long stalk which allows a high degree of movement (Fig 9A) The valves of the pedicellariae are moderately curved and only meet along the upper fifth of their length The blade of the valves has almost straight edges that are either smooth or serrated with an expanded distal gripping region (Fig 9DndashI) Triphyllous pedicellariae are more abundant than the tridentate form and are distributed all over the sea urchin test but occur in particularly large numbers around the peristome Their valves are small and broad (Fig 9JndashN) with numerous small peripheral teeth that form two rows along the edges of the valves which interlock when the valves are closed (Fig 9LndashN)

RODRIacuteGUEZ ET AL154 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 5 NHMTFMCBMEQ00232 holotype of Diadema africanum A aboral view B oral view C lateral view

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 155A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 6 NHMTFMCBMEQ00233 paratype of Diadema africanum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F auricle

RODRIacuteGUEZ ET AL156 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 7 NHMTFMCBMEQ00233 paratype of Diadema africanum Apical system and pattern of iridophores A genital plate gonopore and an ambulacrum B close-up of the apical system (paratype) C amp D pattern of iridophores around the apical system on a living specimen in daylight E pattern of iridophores at night F pattern of iridophore on a living specimen in daylight

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 157A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 8 NHMTFMCBMEQ00233 paratype of Diadema africanum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashL) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL158 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

interambulacra measure 18 mm in width at the ambitus and contain four series of large primary tubercles with an offset inner series of small tubercles Each series contains 14 primary tubercles with areoles of moderate size (Fig 2 amp Table 1) The peristome measures 219 mm at the ambitus 481 of the horizontal diameter It is subcircular in shape and has five pairs of buccal tube feet The peristomial membrane is black and is covered with a large number of triphyllous pedicellariae Auricles are robust with high processes (Fig 2E)

Ambulacral and interambulacral spines differ in their width and ornamentation Ambulacral spines are black with a red tinge (Fig 3) the longest measures 2852 mm in length (6334 of the test horizontal) on the neotype 09 mm in width proximally and 05 mm distally (Fig 3EndashG) These are verticillate with barbs distally (Fig 3AndashC) and are typically composed of sixteen solid wedges

Interambulacral spines are predominantly black with a red tinge but a number of brown and white spines are present aborally (Figs 1 amp 3) They are long and slender the longest measuring 4737 mm in length on the neotype The spines are verticillate formed by 20 solid wedges which radiate out from a hollow axial cavity Spine width varies from 14 mm in diameter proximally to 09 mm distally with numerous barbs present distally (Figs 3HndashJ)

Only tridentate and triphyllous pedicellariae were found on the neotype with no claviform ophicephalous pedicellariae observed (Fig 4 amptable 3) Tridentate pedicellariae occur as two forms one with broad valves (Fig 4AndashD) and a long broad neck on a short stalk and a narrow form (comparing valves of equal length) with narrow valves a short neck and a long stalk (Fig 4EndashH) Both forms have moderately curved valves with serrations along edges of the blades of the valves (Figs 4GndashI) Both forms occur orally and aborally However the broad form is less abundant Triphyllous pedicellariae are typical of the genus in having broad valves that are rounded distally with numerous small peripheral teeth that occur in two rows (Figs 4JndashL) The head of each pedicellaria is supported by a long muscular neck attached to a long stalk

Diadema africanum sp novFigs 5ndash10 tables 1ndash3

Diagnosis Test and spines typically black with a red tinge and a turquoise sheen when viewed in direct sunlight The iridophore pattern occurs as bold blue lines down either side of the naked interambulacral areas as a pentamerous ring around the apical disc and as lines along some plate boundaries Apical disc is hemicyclic with arch-shaped depressions on the denuded genital plates in both adults and juveniles Gonopores measure 33 of the length of the genital plates The periproctal cone is black with no markings The Peristome is proportionally large measuring 40ndash60 of the testrsquos horizontal diameter Spines are verticillate and hollow with distal barbs Verticilations are formed of urn-shaped solid wedges that are visible when the spines are viewed in transverse section These wedges typically number twenty in ambulacral spines and twenty-four in interambulacral spines Only tridentate and triphyllous pedicellariae are present The tridentate pedicellariae occur as a single form with reasonably broad curved valves with almost straight edges that can either be smooth or serrated with an expanded distal gripping region The blades of the valves meet only along the upper fifth of their length The head of each pedicellaria is supported by a long muscular neck attached to a mid-length stalk

Holotype TFMCBMEQ00232 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Paratypes TFMCBMEQ 00233 TFMCBMEQ 00234 TFMCBMEQ 00235 in the lsquoMuseo de Ciencias Naturales de Tenerifersquo (TFMC) Santa Cruz de Tenerife Canary Islands Spain

Other material Twenty-one specimens in the Zoological Collection in the lsquoDepartamento de Biologiacutea Animal (Ciencias Marinas)rsquo Universidad de La Laguna Tenerife Canary Islands

Etymology Species name refers to the geographical distribution of the species on the western coasts of Africa It is distributed on islands and continental coasts along the African continental shelf

Ecology Diadema africanum is an important macro-herbivore on subtropical and tropical rocky reefs off the West African coasts In the eastern Atlantic islands and particularly in Madeira and the Canary Islands the species is distributed throughout the islands at densities that can reach more than 12 individuals m2 (Brito et al 1984 Alves et al 2001 Hernaacutendez 2006 Clemente 2007 Hernaacutendez et al 2008) The species can therefore dramatically reduce the abundance of non-crustose macroalgae resulting in the formation of sea urchin-dominated barren grounds (Hernaacutendez et al 2008) This phenomenon is especially relevant in Madeira Salvage and the Canary Islands where macroalgal beds represent the main ecosystem Diadema africanum also occurs on coral dominated

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 153A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

reefs in Cape Verde and Sacirco Tome where sea urchin control of macroalgae via grazing is beneficial for coral settlement and growth Only a few studies have looked at the abundance and ecological role of D africanum along the tropical western African coasts (eg John et al 1977 1992) with further investigations needed

Distribution Diadema africanum occurs in the Eastern Atlantic islands from Madeira Islands to the Guinean Gulf including Salvage Islands Canary Islands Cape Verde Islands (Hernaacutendez et al 2008) and Sacirco Tome Island (Lessios et al 2001) It has also been also recorded in continental areas of Ghana (John et al 1977 1992) and in Ngor Island Senegal (P Wirtz pers com)

Description The test is hemispherical with a horizontal diameter of 6673 mm and a vertical diameter of 3278 mm in the paratype and 6123 mm hd and 3136 mm vd in the holotype The base colour of the test epithelium is black with a red tinge (Fig 5AndashC) while the denuded test is white (Fig 6AndashE) The apical system measures 1814 mm in the paratype and is hemicyclic with ocular plates II and III exsert (Fig 6A) The genital plates are wider than long and have up to four small tubercles along their inner-edge (Table 1amp Fig 7AndashB) with large genital pores that measure 33 of the genital plate length (Fig 7A) The ocular plates are pentagonal with a small pore located at the top of the plate and have from one to three small tubercles along the centre of the plate (Fig 7B)

On the naked test distinct arch-shaped depressions are present on the genital plates of both adults and juveniles (Table 5 ampFig 7B) These depressions correspond to the corners of the pentamerous apical ring of iridophores seen in living sea urchins (Fig 7CndashE) The iridophore pattern is bold and bright on the apical system when viewed in sunlight The periproct is 1126 mm wide in the paratype (approximately 16 of the testrsquos horizontal diameter) and has a small black periproctal cone that has no platelets or markings on the skin (Fig 5A)

The ambulacra are slightly raised aborally (Fig 6C) and measure 30 of the width of the interambulacra (865 mm) at the ambitus in the paratype They have two rows of large primary tubercles and an offset inner series of small tubercles that are perforated and crenulated with non-conjugate pore-pairs and phyllodes developed adorally

The interambulacra are broader than the ambulacra at the ambitus (Fig 6CndashD) with 5ndash6 series (the inner median series is more offset in some specimens giving the impression of two series) of 14 primary tubercles Tubercles are perforate and crenulate and have areoles of moderate size (Fig 7A) During the day blue lines of iridophores can be seen down either side of the naked median regions

The peristome is subcircular (Fig 6B) and in the paratype it measures 269 mm in diameter 40 of the testrsquos horizontal diameter The peristomal membrane is black with a red tinge and has five pairs of buccal tube feet (Fig 5B) with abundant triphyllous pedicellariae The auricles are robust and have high processes (Fig 6F)

In adults the spine epithelium is black with a red tinge and a turquoise sheen when viewed in direct sunlight In juveniles spines are banded red and white which is typical of the genus Ambulacral spines measure 4321 mm in length in the paratype (2883 of the test horizontal diameter) These spines are strongly verticillate with barbs pointing distally (Fig 8AndashD) Proximally these spines have a mean diameter of 089 mm that decreases distally (Fig 8EndashG) The axial cavity comprises 288 of the horizontal diameter which increases to 3522 in the distal region (Fig 8EndashG) The solid wedges are urn-shaped and typically number twenty comprising 6342 of the spinersquos horizontal diameter in the proximal section

Interambulacral spines (Fig 8HndashN) are long and slender with a maximum diameter of 2 mm proximally and taper distally (Fig 8KndashN) These spines measure 5862 mm in the paratype In transverse section the axial cavity comprises 2992 of the horizontal diameter proximally but increases to 3917 in the distal region (Table 2 Fig 8LndashN) The solid wedges are urn-shaped and typically number twenty-four 6257 of the of the spinersquos horizontal diameter in the proximal section

Both tridentate and triphyllous pedicellariae are present in D africanum (Fig 9) No ophicephalous pedicellariae were found either true ophicephalous or of the claviform type which have been reported in other species of Diadema (Mortensen 1940) Only a single form of tridentate pedicellaria is found in this species (Fig 9AndashI) which are abundant orally and aborally but particularly around the periproct and around the peristome This form of tidentate pedicellaria has a long muscular neck on a long stalk which allows a high degree of movement (Fig 9A) The valves of the pedicellariae are moderately curved and only meet along the upper fifth of their length The blade of the valves has almost straight edges that are either smooth or serrated with an expanded distal gripping region (Fig 9DndashI) Triphyllous pedicellariae are more abundant than the tridentate form and are distributed all over the sea urchin test but occur in particularly large numbers around the peristome Their valves are small and broad (Fig 9JndashN) with numerous small peripheral teeth that form two rows along the edges of the valves which interlock when the valves are closed (Fig 9LndashN)

RODRIacuteGUEZ ET AL154 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 5 NHMTFMCBMEQ00232 holotype of Diadema africanum A aboral view B oral view C lateral view

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 155A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 6 NHMTFMCBMEQ00233 paratype of Diadema africanum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F auricle

RODRIacuteGUEZ ET AL156 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 7 NHMTFMCBMEQ00233 paratype of Diadema africanum Apical system and pattern of iridophores A genital plate gonopore and an ambulacrum B close-up of the apical system (paratype) C amp D pattern of iridophores around the apical system on a living specimen in daylight E pattern of iridophores at night F pattern of iridophore on a living specimen in daylight

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 157A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 8 NHMTFMCBMEQ00233 paratype of Diadema africanum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashL) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL158 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

reefs in Cape Verde and Sacirco Tome where sea urchin control of macroalgae via grazing is beneficial for coral settlement and growth Only a few studies have looked at the abundance and ecological role of D africanum along the tropical western African coasts (eg John et al 1977 1992) with further investigations needed

Distribution Diadema africanum occurs in the Eastern Atlantic islands from Madeira Islands to the Guinean Gulf including Salvage Islands Canary Islands Cape Verde Islands (Hernaacutendez et al 2008) and Sacirco Tome Island (Lessios et al 2001) It has also been also recorded in continental areas of Ghana (John et al 1977 1992) and in Ngor Island Senegal (P Wirtz pers com)

Description The test is hemispherical with a horizontal diameter of 6673 mm and a vertical diameter of 3278 mm in the paratype and 6123 mm hd and 3136 mm vd in the holotype The base colour of the test epithelium is black with a red tinge (Fig 5AndashC) while the denuded test is white (Fig 6AndashE) The apical system measures 1814 mm in the paratype and is hemicyclic with ocular plates II and III exsert (Fig 6A) The genital plates are wider than long and have up to four small tubercles along their inner-edge (Table 1amp Fig 7AndashB) with large genital pores that measure 33 of the genital plate length (Fig 7A) The ocular plates are pentagonal with a small pore located at the top of the plate and have from one to three small tubercles along the centre of the plate (Fig 7B)

On the naked test distinct arch-shaped depressions are present on the genital plates of both adults and juveniles (Table 5 ampFig 7B) These depressions correspond to the corners of the pentamerous apical ring of iridophores seen in living sea urchins (Fig 7CndashE) The iridophore pattern is bold and bright on the apical system when viewed in sunlight The periproct is 1126 mm wide in the paratype (approximately 16 of the testrsquos horizontal diameter) and has a small black periproctal cone that has no platelets or markings on the skin (Fig 5A)

The ambulacra are slightly raised aborally (Fig 6C) and measure 30 of the width of the interambulacra (865 mm) at the ambitus in the paratype They have two rows of large primary tubercles and an offset inner series of small tubercles that are perforated and crenulated with non-conjugate pore-pairs and phyllodes developed adorally

The interambulacra are broader than the ambulacra at the ambitus (Fig 6CndashD) with 5ndash6 series (the inner median series is more offset in some specimens giving the impression of two series) of 14 primary tubercles Tubercles are perforate and crenulate and have areoles of moderate size (Fig 7A) During the day blue lines of iridophores can be seen down either side of the naked median regions

The peristome is subcircular (Fig 6B) and in the paratype it measures 269 mm in diameter 40 of the testrsquos horizontal diameter The peristomal membrane is black with a red tinge and has five pairs of buccal tube feet (Fig 5B) with abundant triphyllous pedicellariae The auricles are robust and have high processes (Fig 6F)

In adults the spine epithelium is black with a red tinge and a turquoise sheen when viewed in direct sunlight In juveniles spines are banded red and white which is typical of the genus Ambulacral spines measure 4321 mm in length in the paratype (2883 of the test horizontal diameter) These spines are strongly verticillate with barbs pointing distally (Fig 8AndashD) Proximally these spines have a mean diameter of 089 mm that decreases distally (Fig 8EndashG) The axial cavity comprises 288 of the horizontal diameter which increases to 3522 in the distal region (Fig 8EndashG) The solid wedges are urn-shaped and typically number twenty comprising 6342 of the spinersquos horizontal diameter in the proximal section

Interambulacral spines (Fig 8HndashN) are long and slender with a maximum diameter of 2 mm proximally and taper distally (Fig 8KndashN) These spines measure 5862 mm in the paratype In transverse section the axial cavity comprises 2992 of the horizontal diameter proximally but increases to 3917 in the distal region (Table 2 Fig 8LndashN) The solid wedges are urn-shaped and typically number twenty-four 6257 of the of the spinersquos horizontal diameter in the proximal section

Both tridentate and triphyllous pedicellariae are present in D africanum (Fig 9) No ophicephalous pedicellariae were found either true ophicephalous or of the claviform type which have been reported in other species of Diadema (Mortensen 1940) Only a single form of tridentate pedicellaria is found in this species (Fig 9AndashI) which are abundant orally and aborally but particularly around the periproct and around the peristome This form of tidentate pedicellaria has a long muscular neck on a long stalk which allows a high degree of movement (Fig 9A) The valves of the pedicellariae are moderately curved and only meet along the upper fifth of their length The blade of the valves has almost straight edges that are either smooth or serrated with an expanded distal gripping region (Fig 9DndashI) Triphyllous pedicellariae are more abundant than the tridentate form and are distributed all over the sea urchin test but occur in particularly large numbers around the peristome Their valves are small and broad (Fig 9JndashN) with numerous small peripheral teeth that form two rows along the edges of the valves which interlock when the valves are closed (Fig 9LndashN)

RODRIacuteGUEZ ET AL154 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 5 NHMTFMCBMEQ00232 holotype of Diadema africanum A aboral view B oral view C lateral view

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 155A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 6 NHMTFMCBMEQ00233 paratype of Diadema africanum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F auricle

RODRIacuteGUEZ ET AL156 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 7 NHMTFMCBMEQ00233 paratype of Diadema africanum Apical system and pattern of iridophores A genital plate gonopore and an ambulacrum B close-up of the apical system (paratype) C amp D pattern of iridophores around the apical system on a living specimen in daylight E pattern of iridophores at night F pattern of iridophore on a living specimen in daylight

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 157A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 8 NHMTFMCBMEQ00233 paratype of Diadema africanum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashL) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL158 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 5 NHMTFMCBMEQ00232 holotype of Diadema africanum A aboral view B oral view C lateral view

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 155A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 6 NHMTFMCBMEQ00233 paratype of Diadema africanum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F auricle

RODRIacuteGUEZ ET AL156 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 7 NHMTFMCBMEQ00233 paratype of Diadema africanum Apical system and pattern of iridophores A genital plate gonopore and an ambulacrum B close-up of the apical system (paratype) C amp D pattern of iridophores around the apical system on a living specimen in daylight E pattern of iridophores at night F pattern of iridophore on a living specimen in daylight

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 157A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 8 NHMTFMCBMEQ00233 paratype of Diadema africanum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashL) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL158 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 6 NHMTFMCBMEQ00233 paratype of Diadema africanum A aboral view B oral view C lateral view centered on ambulacrum V D lateral view centered on interambulacrum V E oral view showing auricle F auricle

RODRIacuteGUEZ ET AL156 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 7 NHMTFMCBMEQ00233 paratype of Diadema africanum Apical system and pattern of iridophores A genital plate gonopore and an ambulacrum B close-up of the apical system (paratype) C amp D pattern of iridophores around the apical system on a living specimen in daylight E pattern of iridophores at night F pattern of iridophore on a living specimen in daylight

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 157A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 8 NHMTFMCBMEQ00233 paratype of Diadema africanum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashL) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL158 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 7 NHMTFMCBMEQ00233 paratype of Diadema africanum Apical system and pattern of iridophores A genital plate gonopore and an ambulacrum B close-up of the apical system (paratype) C amp D pattern of iridophores around the apical system on a living specimen in daylight E pattern of iridophores at night F pattern of iridophore on a living specimen in daylight

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 157A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 8 NHMTFMCBMEQ00233 paratype of Diadema africanum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashL) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL158 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 8 NHMTFMCBMEQ00233 paratype of Diadema africanum Ambulacral spines (AndashG) AndashC proximal medium and distal parts of an ambulacral spine respectively D entire ambulacral spine EndashG proximal medium and distal ambulacral spine transverse sections respectively Interambulacral spines (HndashL) HndashJ proximal medium and distal parts of an interambulacral spine respectively K entire interambulacral spine LndashN proximal medium and distal interambulacral spine transverse sections respectively

RODRIacuteGUEZ ET AL158 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 9 Pedicellariae AndashB tridentate pedicellariae CndashI scanning electron microscopy images (SEMs) of tridentate pedicellariae C a tridentate pedicellaria DndashE individual valves of a tridentate pedicellaria (side view) FndashH individual valves of tridentate pedicellariae (internal views) I peripheral teeth on the blade of a tridentate pedicellaria JndashK triphyllous pedicellariae LndashN SEM images of triphyllous pedicellariae L triphyllous pedicellaria M internal view of a triphyllous pedicellaria and N close-up of peripheral teeth

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 159A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Comparisons between D antillarum and D africanum using a PCA ordination based on 29 morphological characters of the test spines and pedicellariae are illustrated in Fig 10 Overall differences observed in the ordination are supported by the R statistic associated with the ANOSIM test (Global R-statistic=1 plt05) which shows that D africanum is morphologically distinct from D antillarum The PCA shows differences between groups of individuals Mean diameter of axial cavity ( spine diameter) (3) and the percentage of the spinersquos diameter comprised of solid wedges (4) are variables that are highly correlated with axis 1 which means that the two species highly differ on this variables Diadema africanum specimens have wider diameters of spines and a larger portion of the spine comprised of solid wedges The peripheral gripping area as of distal peripheral area (mm2) (18) and the diameter of gonopores ( of genital plate height) (25) are negatively correlated with axis 1 meaning that D africanum shows reduced peripheral gripping area and narrower gonopores than D antillarum There are also intraspecific variations on horizontal test diameter (mm) (21) and vertical test diameter (mm) (22) for both species which can be seen in the ordination plot as vertical spread of the points following axis 2

FIGURE 10 Principal Components Analyses (PCA) showing the first 2 axes that explain the 761 of variability (549 first axis 213 second axis and 73 third axis) based on 29 quantitative variables including morphological characters of the test spines and pedicellariae in D antillarum (two specimens neotype plus another individual) and D africanum (17 specimens) The numbers correspond to 1ndash5 spine characters 6ndash20 pedicellarial characters and 21ndash29 test characters 1 Spine diameter 2 Number of solid wedges 3 Mean diameter of axial cavity ( spine diameter) 4 Percentage of the spinersquos diameter comprised of solid wedges 5 Percentage of the spinersquos diameter comprised by the foraminated ring 6 Number of types of pedicellariae 7 Length of distal region (mm) 8 Width of distal region (mm) 9 Length of proximal region (mm) 10 Width of proximal region (mm) 11 Total area of distal region (mm2) 12 Internal area of distal region (mm2)cedil13 Peripheral area of distal region (that does not grip mm2) 14 Peripheral gripping area (mm2) 15 Total area of proximal region (mm2)16 Adductor muscle insertion area (mm2) 17 Keel and peripheral area of proximal region (mm2) 18 Peripheral gripping area as of distal peripheral area (mm2) 19 Height of teeth (mm) 20 Width of teeth (mm) 21 Horizontal test diameter (mm) 22 Vertical test diameter (mm) 23 Number of tubercles on genital plate 24 Height to width (at widest point) ratio of genital plate 25 Diameter of gonopores ( of genital plate height) 26 Apical system ( of horizontal test diameter) 27 Periproct ( of horizontal test diameter) 28 Peristome ( of horizontal test diameter) 29 Ambulacra of interambulacra (at ambitus)

RODRIacuteGUEZ ET AL160 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 161A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL162 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 163A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

RODRIacuteGUEZ ET AL164 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 165A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

mtDNA analysis

Sequencing of the andashf COI region produced 633 bp of protein coding sequence Bayesian inference (BI) and Maximum likelihood (ML) analysis produced an identical polytomy consisting of D savignyi D africanum D antillarum and D paucispinum (a amp b) (see Fig 11) with high posterior support for subclades Using the COI data we calculated a genetic distance of 334 between the holotype of D africanum and the neotype of D antillarum with mean genetic difference between the holotype of D africanum and other species in this polytomy measuring 356 for D savignyi 559 for D paucispinum-a and 503 for D paucispinum-b The COI sequence of the holotype of D africanum had 100 maximum identity over 99 coverage to sequences of D antillarum-b (sensu Lessios et al 2001) from Grand Canaria Island (GenBank accession numbers AY012730 and AY012731) The neotype of D antillarum formed a well-supported clade with the sequences of D antillarum-a and had 99 maximum identity over 99 coverage to sequences of COI from Fort Randolph Panama (accession number AY012728 and AY012728)

FIGURE 11 Partial phylogeny of Diadema using COI data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Sequencing the Lysine-tRNA ATPase-6 and 8 region produced 581 bp of nucleotides Within this region the protein coding genes ATPase-8 of ATPase-6 consisted of 171 bp and 363 bp respectively These genes overlapped by 10 bp Bayesian inference (BI) and Maximum likelihood (ML) analysis of the concatenated ATPase-8 and ATPase-6 data indicate that D africanum forms a polytomy with D savignyi and D paucispinum (a amp b) (see Fig 12) nested within a clade of D antillarum Within this clade is a subclade consisting of Brazilian D antillarum and D antillarum ascensionis No BI support was found for the D paucispinum-a clade however ML methods produced a clade credibility of 88 Genetic distance between the holotype of D africanum and the neotype of D antillarum measured 380 in ATPase-8 and 231 in ATPase-6 Mean genetic difference in ATPase-8 and ATPase-6 between the holotype of D africanum and other species in this polytomy measured 404 and 278 in D savignyi 559 and 333 in D paucispinum-a and 740 and 336 in D paucispinum-b The ATPase-8 and ATPase-6 sequences of the holotype of D africanum were identical to those from specimens from Sacirco Tome The Canary Islands Cape Verde and Madeira with haplotype accession number AY012873 while the neotype of D antillarum had 99 identity over 99 coverage to a haplotype from San Blas Panama (accession number AF366131)

RODRIacuteGUEZ ET AL166 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

FIGURE 12 Partial phylogeny of Diadema using the concatenated ATPase-6 and ATPase-8 data of unique haplotypes reconstructed with MRBAYES Clade credibility values (BIML) gt85 shown (clades with lt85 collapsed) scale bar reflects changes per site

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 167A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Discussion

Intraspecific variation of COI in animals (except the Cnidaria) is reported to be rarely more than 2 and more typically less than 1 (Avise 2000) with a mean intraspecific divergence of 062 recorded from fifty-one species of echinoderm (Ward et al 2008) Our molecular data revealed a genetic difference of 334 in COI between the holotype of D africanum and the neotype of D antillarum Such divergence is similar to that of between D africanum (eastern Atlantic) and D savignyi (southwest to mid-South Pacific) The genetic distances in ATPase-8 and ATPase-6 between the holotype of D africanum and the neotype of D antillarum are also similar to that between D africanum and D savignyi and provides further evidence to justify recognising D africanum as a separate species

Divergence between D antillarum and D africanum occurred in the Pleistocene or Late Pliocene probably due to the isolation of population as the result of low sea levels and changes in the direction of currents during glacial cycles (Lessios et al 2001) Today these species are isolated from one another by the mid-Atlantic barrier This barrier has also more recently isolated D antillarum ascensionis in the central Atlantic islands of Ascension and St Helena from Brazilian D antillarum (Lessios et al 2001) Contrary to the molecular phylogenetic analysis D africanum is morphologically closer to D antillarum ascensionis than to other species of Diadema suggesting a morphological convergence through environmental constraints in the mid and eastern Atlantic Both species have spines with an almost identical internal structure and similar tridentate pedicellariae These are rostrate-like in D antillarum ascensionis (see Coppard amp Campbell 2006b) with highly curved valves and no peripheral teeth while in D africanum the valves are only moderately curved with the presence of peripheral serrations varying among members

The presence of arch-shaped depressions on the denuded genital plates of adults is reflected in the bold apical ring of iridophores observed in D africanum D savignyi D antillarum ascensionis and D mexicanum Such markings are fainter or absent on the denuded genital plates of D antillarum corresponding to a narrower ring of iridophores in life Iridophores are absent on the genital plates of D paucispinum and occur as dots of iridophores on the genital plates of D setosum and D palmeri (Coppard amp Campbell 2006a)

In all species of Diadema the spines taper distally (Coppard amp Campbell 2004) However in D africanum this reduction in spine diameter from the proximal region to the distal region was less pronounced than in other species (Table 2) Mortensen (1940) reported specimens of D antillarum with spine lengths that varied from 300 to 400 mm Coppard amp Campbell (2004) observed specimens of D antillarum with a test diameter of 96 mm with spines of 196 mm in length Individuals with such large spines were not found in this study in the eastern Atlantic islands the maximum spine length recorded was 94 mm in a specimen with a test diameter of 57 mm Therefore spines in D africanum appear to be proportionally shorter relative to test diameter than in other species of Diadema

Morphometric analysis of the test revealed a proportionally broader range of variability in D africanum than has previously been recorded in other Diadema species (see Table 1) Notably the width of the peristome periproct and ambulacra which can attain a proportionally larger size than reported in closely related species The apical system of D africanum is similar in size (21ndash28 hd) to that of D savignyi (22ndash28 h d) D antillarum ascensionis (20ndash26 h d) and D mexicanum (20ndash25 h d) but is proportionally larger than in D antillarum(18ndash23 hd 23 hd in the neotype) However it should be noted that in D antillarum data were recorded from larger individuals Therefore such differences may reflect allometric growth

Acknowledgments

We thank to A Brito for his comments on an early version of this paper and to A Vicente D Girard K Toledo and JM Landeira for their help in the field We are grateful to the lsquoDepartamento de Microbiologiacutea y Biologiacutea Celularrdquo especially to MC Alfayate for help with cutting spine sections We are indebted to N Dollahan (Villanova University) for his advice on scanning electron microscopy Thanks to O Monterroso for aiding in collecting samples in Cape Verde Islands and to R Pestano Farintildea for clarifications concerning species Latin names To also thank A Peacuterez-Ruzafa for allowing us access to his private collection of sea urchins from Azores and Madeira Islands and to P Salinas for collecting D antillarum from Cuba We dedicate this paper to our friend and colleague I Lozano who recently passed away and to the newcomer Saulo

RODRIacuteGUEZ ET AL168 middot Zootaxa 3636 (1) copy 2013 Magnolia Press

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

References

Agassiz A (1872) Revision of the Echini Illustrated Catalogue of the Museum of Comparative Zoology Harvard College 7 Cambridge MA Harvard University Press 7 423ndash458 amp 618ndash620

Alves FMA Chiacutecharo LM SerraoE amp Abreu AD (2001) Algal cover and sea urchin spatial distribution at Madeira Island (NE Atlantic) Scientia Marine 65 383ndash392

Avise JC (2000) Phylogeography The History and Formation of Species Harvard University Press Cambridge MA 447 ppBaker AN (1967) Two new echinoids from northern New Zealand incluiding new species of DiademaTransactions of the

Royal Society of New Zealand (Zoology) 8 (23) 239ndash245Bauer JC (1976) Growthagregration and maduration in the echinoid Diadema antillarum PhilippiBulletin Marine Science

26273ndash277Brito A Cruz T Moreno E amp Peacuterez M (1984) Fauna Marina en las Islas Canarias In Edirca (Eds) Fauna marina y

terrestre del Archipieacutelago Canario Las Palmas de Gran Canaria pp42ndash65Clark HL (1925) Catalogue of the recent sea-urchins in the collection of the British Museum (Natural History) Oxford

University Press250 ppClarke KR (1993) Non-parametric multivariate analyses of changes in community structureAustralian Journaly of Ecology

18 117ndash143 httpdxdoiorg101111j1442-99931993tb00438x

Clarke KR amp Warwick RM (1994) Change in marine Communities an Approach to Statistical Analysis and InterpretationPlymouth Marine Laboratory PlymouthBourne Press Limited Bournemouth United Kingdom144p

Clemente S (2007) Evolucioacuten de las poblaciones del erizo Diadema aff antillarum en Canarias y valoracioacuten de la depredacioacuten como factor de control PhD thesis University of La Laguna 421pp

Coppard SE amp Campbell AC (2004) Taxonomic significance of spine morphology in the echinoid genera Diadema and EchinothrixInvertebrate Biology 123(4) 357ndash371 httpdxdoiorg101111j1744-74102004tb00168x

Coppard SE amp Campbell AC (2005a) Distribution and abundance of regular echinoids on two coral reefs in Fiji Micronesica 37 (2) 249ndash269

Coppard SE amp Campbell AC (2006a) Taxonomic significance of test morphology in the echinoid genera Diadema and Echinothrix Zoosystema 28 93ndash112

Coppard SE amp Campbell AC (2006b) Systematic significance of tridentade pedicellariae in the echinoid genera Diademaand Echinotrix Invertebrate Biology 125(4) 363ndash378 httpdxdoiorg101111j1744-7410200600068x

Coppard SE amp Campbell AC (2007) Grazing preferences of diadematid echinoids in Fiji Aquatic Botany 86 204ndash212 httpdxdoiorg101016jaquabot200610005

Hernaacutendez JC (2006) Estrategia reproductiva de la poblacioacuten canaria del erizo Diadema aff antillarum Philippi 1845 maduracioacuten gonadal asentamiento larvario y reclutamiento PhD thesis University of La Laguna 241pp

Hernaacutendez JC Clemente S Sangil C amp Brito A (2008) Actual status of the sea urchin Diadema affantillarum populations and macroalgal cover in the Marine Protected Areas comparing to a highly fished area (Canary Islands-Eastern Atlantic Ocean)Aquatic Conservation Marine and Freshwater Research 66 259ndash270

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature Fourth edition Available from httpwwwicznorgicznindexjsp (25March2013)

John DM Lieberman D amp Lieberman M (1977) A Quantitative study of the structure and dynamics of benthic subtidal algal vegetation in Ghana (Tropical west Africa) Journal of Ecology 65 497ndash521 httpdxdoiorg1023072259497

John DM Price JH amp Lawson GW (1992) Tropical east Atlantic and Islands plant-animal interactions on tropical shores free of biotic reef In Jonh PM Hawkins SJ amp Price JH (Eds) Animal Interactions in the Marine Benthos Oxford ClarendonPressOxford pp87ndash99

Koehler R (1914) Echinoderma I In WBeitraumlge zur Kenntnis der Meeresfauna Westafrikas Michaelsen (Eds) LFriederichsen and Co Hamburg pp 129ndash303

Larkin MA Blackshields G Brown NP et al (2007) ClustalW and ClustalX version 20 Bioinformatics 23 2947ndash2948 httpdxdoiorg101093bioinformaticsbtm404

Lawrence JM amp Sammarco PW (1982) Effects of feeding in the environment In Jangoux M amp Lawrence JM(Eds) Echinoderm Nutrition A A Balkema Rotterdam pp 499ndash519

Lessios HA (1981) Reproductive periodicity of the echinoids Diadema and Echinometra on the two coasts of PanamaJournal of Experimental Marine Biology and Ecology 50 47ndash61 httpdxdoiorg1010160022-0981(81)90062-9

Lessios HA (1984a) Possible prezygotic reproduction isolation in sea urchins separated by the Isthmus of Panama Evolution 38 1144ndash1148 httpdxdoiorg1023072408446

Zootaxa 3636 (1) copy 2013 Magnolia Press middot 169A NEW SPECIES OF DIADEMA FROM THE EASTERN ATLANTIC OCEAN

Lessios HA Cubir JD Robertson DR Shulman MJ Parker MR Garrity SD amp Levings SC (1984b) Mass mortality of Diadema antillarum on the Caribbean coast of Panama Coral Reefs 3 173ndash182 httpdxdoiorg101007BF00288252

Lessios HA (1988) Mass mortality of Diadema antillarum in the Caribbean what have we learned Annual Review of Ecology Evolution and Systematics 19 371ndash393 httpdxdoiorg101146annureves19110188002103

Lessios HA (1990) Adaptation and phylogeny as determinants of egg size in echinoderms from two sides of isthmus of Panama American Naturalist 135 1ndash13 httpdxdoiorg101086285028

Lessios HA (2005) Echinoids of the Pacific Waters of Panama Status of knowledge and new records International Journal Tropical Biology 53(3) 147ndash170

Lessios HA Kessing BD amp Robertson DR(1998)Massive gene flow across the worldrsquos most potent marine biogeographic barrier Proceedings of the Royal Society of London265(B) 583ndash588

Lessios HA Kessing BD amp Pearse JS (2001) Population structure and speciation in tropical seas global phylogeography of the sea urchin Diadema Evolution 55 955ndash975 httpdxdoiorg1015540014-3820(2001)055[0955PSASIT]20CO2

Lewis JB (1966) Growth and breeding in the tropical echinoid Diadema antillarum Philippi Bulletin of Marine Science 16 151ndash157

Mackintosh HW (1875) Researches on the Structure of the spines of the Diadematidae (Peters)Transactions of the Royal Irish Academy 25 519ndash556

Maddison DR amp Maddison WP (2001) MacClade 4 analysis of phylogeny and character evolution Version 403Sunderlan (MA) Sinauer Associates

Muthiga NA amp McClanahan TR (2007) Ecology of Diadema In Lawrence JM (Eds) Edible Sea Urchins Biology and Ecology Elsevier Amsterdam The Netherlands pp 205ndash225 httpdxdoiorg101016S0167-9309(07)80075-5

Moreno E Fernaacutendez Palacios H amp Bacallado JJ (1980) Estudio morfoloacutegico de las puacuteas de ocho especies de equinodermos de las islas Canarias Vieraea 10 39ndash52

Mortensen T (1933) Papers from Dr Th Mortensenrsquos Pacific Expedition 1914ndash18 LXVI The echinoderms of St Helena (Other than crinoids)VidenskMedd Dan NathistForen 93 473 pp

Mortensen T (1940) A Monograph of the Echinoidea Vol 3 Aulodonta 1 CA Reitzel Copenhagen 370 ppPawson DL (1978) The echinoderm fauna of Ascension Island South Atlantic Ocean Smithsonian Contributions to the

marine sciences 2 1ndash31 httpdxdoiorg105479si0196076821

Pearse JS (1970) Reproductive periodicities of Indo-Pacific invertebrates in the gulf of Suez IIIThe echinoid Diadema setosum (Leske) Bulletin of Marine Science 20 679ndash720

Pearse JS (1998) Distribution of Diadema savignyi and Dsetosum in the tropical Pacific In Mooi R amp Telford M (Eds) Echinoderms San Francisco AA Balkema Rotterdam pp 778ndash782

Rowe FWE amp Gates J (1995) EchinodermataIn Wells A (Eds) Zoological catalogue of Australia CSIRO Melbourne pp1ndash510

Swofford DL (2002) PAUP Phylogenetic Analysis Using Parsimony (and Other Methods) Sinauer Associates Sunderland Massachusetts

Tamura K amp Nei M (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees Molecular Biology and Evolution 10 512ndash526

Ward RD Holmes BH amp OHara TD (2008) DNA barcoding discriminates echinoderm species Molecular Ecology Resources 8 1202ndash1211 httpdxdoiorg101111j1755-0998200802332x

William LJMc Curry A Rowland PL amp Watson JS (1991) Spinous injury caused by a sea urchinJournal of clinicalPatology 44 428

Wirtz P amp Martins HM (1993) Notes on some rare and little known marine invertebrates from the Azores with a discussion of the zoogeography of the region Arquipeacutelago 11A 55ndash63

RODRIacuteGUEZ ET AL170 middot Zootaxa 3636 (1) copy 2013 Magnolia Press