1

A Kelbert et al. Nature 460, 1003-1006 (2009) doi:10.1038/nature08257 Regularized degree and order nine electrical conductivity inverse solution.

A Kelbert et al. Nature 460 , 1003 - 1006 (2009) doi:10.1038/nature08 257

Download PPT Report

Upload
illiana-aguilar
View
44
Download
2

Embed Size (px)

DESCRIPTION

Regularized degree and order nine electrical conductivity inverse solution. A Kelbert et al. Nature 460 , 1003 - 1006 (2009) doi:10.1038/nature08 257. - PowerPoint PPT Presentation

Citation preview

Page 1: A Kelbert et al. Nature 460 , 1003 - 1006 (2009) doi:10.1038/nature08 257

A Kelbert et al. Nature 460, 1003-1006 (2009) doi:10.1038/nature08257

Regularized degree and order nine electrical conductivity inverse solution.

DOI: 10.1038/NNANO.2015 - Nature · Oxygen-Activated Growth and Bandgap Tunability of Large Single-Crystal Bilayer ... 10.1038/NNANO.2015.322 ULEENTARY ... Dual Beam235) was then

DOI: 10.1038/NNANO.2015 - Nature · Oxygen-Activated Growth and Bandgap Tunability of Large Single-Crystal Bilayer ... 10.1038/NNANO.2015.322 ULEENTARY ... Dual Beam235) was then

Documents

doi:10.1038/nature12886 Neanderthal from the Altai

doi:10.1038/nature12886 Neanderthal from the Altai

Documents

Data Protection in a Cloud-enabled Smart Gridfkelbert/papers/smartgridsec12.pdf · 2016-05-05 · Data Protection in a Cloud-enabled Smart Grid? Alexander Fromm1, Florian Kelbert

Data Protection in a Cloud-enabled Smart Gridfkelbert/papers/smartgridsec12.pdf · 2016-05-05 · Data Protection in a Cloud-enabled Smart Grid? Alexander Fromm1, Florian Kelbert

Documents

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

Documents

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

Documents

1 November 2007 doi:10.1038/nature06221 LETTERS

1 November 2007 doi:10.1038/nature06221 LETTERS

Documents

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Documents

Hexahydroquinolines are antimalarial candidates with ...10.1038... · ARTICLES DOI: 10.1038/s41564-017-0007-4 © 2017 Macmillan Publishers Limited, part of Springer Nature. All rights

Hexahydroquinolines are antimalarial candidates with ...10.1038... · ARTICLES DOI: 10.1038/s41564-017-0007-4 © 2017 Macmillan Publishers Limited, part of Springer Nature. All rights

Documents

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

Documents

Nature Biotechnology: doi:10.1038/nbt

Nature Biotechnology: doi:10.1038/nbt

Documents

CD Putnam et al. Nature 000 , 1 - 6 (2009) doi:10.1038/nature08 217

CD Putnam et al. Nature 000 , 1 - 6 (2009) doi:10.1038/nature08 217

Documents

static- 10.1038/s41598-017...PDF filestatic-

static- 10.1038/s41598-017...PDF filestatic-

Documents

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

Documents

Maru: SGX-Spark Deep Divejac22/talks/samsung-secure-ml.pdf · 2020. 1. 15. · Maru: SGX-Spark Deep Dive Florian Kelbert, Peter Pietzuch, Jon Crowcroft Imperial College London,

Maru: SGX-Spark Deep Divejac22/talks/samsung-secure-ml.pdf · 2020. 1. 15. · Maru: SGX-Spark Deep Dive Florian Kelbert, Peter Pietzuch, Jon Crowcroft Imperial College London,

Documents

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Documents

Macroporous nanowire nanoelectronic scaffolds …cmliris.harvard.edu/assets/10.1038-nmat3404.pdfARTICLES PUBLISHED ONLINE: 26 AUGUST 2012 |DOI:10.1038/NMAT3404 Macroporous nanowire

Macroporous nanowire nanoelectronic scaffolds …cmliris.harvard.edu/assets/10.1038-nmat3404.pdfARTICLES PUBLISHED ONLINE: 26 AUGUST 2012 |DOI:10.1038/NMAT3404 Macroporous nanowire

Documents

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Documents

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Documents

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Documents

doi:10.1038/nature05150 LETTERS

doi:10.1038/nature05150 LETTERS

Documents

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

Documents

GI Motility online (May 2006) | doi:10.1038/gimo31

GI Motility online (May 2006) | doi:10.1038/gimo31

Documents

Published in Nature Materials (2016) doi:10.1038/nmat4569

Published in Nature Materials (2016) doi:10.1038/nmat4569

Documents

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Documents

JB Kim et al. Nature 461 , 649 - 653 (2009) doi:10.1038/nature08 436

JB Kim et al. Nature 461 , 649 - 653 (2009) doi:10.1038/nature08 436

Documents

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Documents

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

Documents

XQ Wang et al. Nature 461 , 947 - 955 (2009) doi:10.1038/nature08 435

XQ Wang et al. Nature 461 , 947 - 955 (2009) doi:10.1038/nature08 435

Documents

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

Documents

17 September 2009 doi:10.1038/nature08355 LETTERS

17 September 2009 doi:10.1038/nature08355 LETTERS

Documents