of June 20, 2018.This information is current as

Perkinsus marinusProtistan Parasite ) Is a Receptor for theCrassostrea virginica

from Hemocytes of the Eastern Oyster (A Galectin of Unique Domain Organization

Satoshi Tasumi and Gerardo R. Vasta

http://www.jimmunol.org/content/179/5/3086doi: 10.4049/jimmunol.179.5.3086

2007; 179:3086-3098; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/179/5/3086.full#ref-list-1

, 21 of which you can access for free at: cites 68 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2007 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on June 20, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

by guest on June 20, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

A Galectin of Unique Domain Organization from Hemocytes ofthe Eastern Oyster (Crassostrea virginica) Is a Receptor for theProtistan Parasite Perkinsus marinus1,2

Satoshi Tasumi and Gerardo R. Vasta3

Invertebrates display effective innate immune responses for defense against microbial infection. However, the protozoanparasite Perkinsus marinus causes Dermo disease in the eastern oyster Crassostrea virginica and is responsible for cata-strophic damage to shellfisheries and the estuarine environment in North America. The infection mechanisms remain un-clear, but it is likely that, while filter feeding, the healthy oysters ingest P. marinus trophozoites released to the water columnby the infected neighboring individuals. Inside oyster hemocytes, trophozoites resist oxidative killing, proliferate, and spreadthroughout the host. However, the mechanism(s) for parasite entry into the hemocyte are unknown. In this study, we showthat oyster hemocytes recognize P. marinus via a novel galectin (C. virginica galectin (CvGal)) of unique structure. Thebiological roles of galectins have only been partly elucidated, mostly encompassing embryogenesis and indirect roles in innateand adaptive immunity mediated by the binding to endogenous ligands. CvGal recognized a variety of potential microbialpathogens and unicellular algae, and preferentially, Perkinsus spp. trophozoites. Attachment and spreading of hemocytes toforeign surfaces induced localization of CvGal to the cell periphery, its secretion and binding to the plasma membrane.Exposure of hemocytes to Perkinsus spp. trophozoites enhanced this process further, and their phagocytosis could be par-tially inhibited by pretreatment of the hemocytes with anti-CvGal Abs. The evidence presented indicates that CvGal facil-itates recognition of selected microbes and algae, thereby promoting phagocytosis of both potential infectious challenges andphytoplankton components, and that P. marinus subverts the host’s immune/feeding recognition mechanism to passively gainentry into the hemocytes. The Journal of Immunology, 2007, 179: 3086 –3098.

I nvertebrate and vertebrate species are endowed with efficientinnate immune recognition and effector mechanisms that aresuccessful in fighting infectious disease (1). Recognition of

potential pathogens is achieved by either humoral factors presentin plasma and other body fluids or by cell-associated receptors thatlead to various effector functions, such as activation of comple-ment and coagulation cascades, opsonization, and phagocytosis(2). Phagocytosis is usually followed by intracellular killing anddestruction of the microorganism (3). Among the various receptorspresent on the surface of phagocytic cells of both vertebrates andinvertebrates, lectins are critical factors for defense against poten-tial microbial pathogens (4). Lectins are carbohydrate-binding pro-teins that are ubiquitous in body fluids, tissues, and cells. Based ontheir structure and binding properties, they have been classified inseveral families, such as C-, P-, F-, and I-types, ficolins, pentrax-ins, and galectins (5). In mammals, lectins from the C-type, fico-lins, and pentraxins mostly recognize exogenous ligands, such as

glycans on the surface of virus, bacteria, fungi, and protozoa,thereby acting as nonself recognition molecules and engaging ef-fector functions such as immobilization, opsonization, and phago-cytosis of the potential pathogens (6–9). In contrast, galectinsmostly recognize endogenous ligands and indirectly participate ininflammation and adaptive immunity by mediating chemotaxis, ap-optosis, and developmental and regulatory aspects of adaptive im-mune responses (10–17). However, in invertebrates, our knowl-edge of the biological roles of galectins in innate immunity is verylimited and fragmentary (5).

Although like most invertebrate species, oysters possess effec-tive innate immune mechanisms, they become readily infectedwhen exposed to Perkinsus marinus trophozoites. This parasitecauses Dermo disease, which is responsible for the catastrophicdecline of natural and farmed oyster populations, and, thus, sig-nificant damage to the estuarine ecosystem along the Atlantic andGulf coasts of North America (18). The infection mechanism(s)are still unknown, but it is likely that while filter-feeding, thehealthy oysters ingest P. marinus trophozoites released to the wa-ter column by the infected neighboring individuals (19–21). Be-cause unlike the biflagellated zoospores the trophozoite is not mo-tile, entry into the host cells is passive, and mediated byrecognition and phagocytosis by the host’s hemocytes. Uptake oflive P. marinus trophozoites fails to invoke an oxidative response,although hemocytes are equipped with the pathways that can leadto a strong respiratory burst. This is due to the parasite’s antioxi-dative machinery that catalytically prevents the formation and/ordegrades the reactive oxygen intermediates produced by the he-mocyte upon phagocytosis (22). Thus, the parasite survives theoxidative attack, and proliferates intracellularly, leading to sys-temic infection and eventually overwhelming the host (19–23).

Center of Marine Biotechnology, University of Maryland Biotechnology Institute,Baltimore, MD 21202

Received for publication May 30, 2007. Accepted for publication June 25, 2007.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported by National Institutes of Health Grant R01 GM070589-01,National Oceanic and Atmospheric Administration Grant NA05NMF4571243, andNational Science Foundation Grant IOB 0618409.2 The sequence presented in this article has been submitted to GenBank under acces-sion number DQ779197.3 Address correspondence and reprint requests to Dr. Gerardo R. Vasta, Center ofMarine Biotechnology, University of Maryland Biotechnology Institute, 701 EastPratt Street, Baltimore, MD 21202. E-mail address: vasta@umbi.umd.edu

Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00

The Journal of Immunology

www.jimmunol.org

by guest on June 20, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

However, the molecular mechanisms for recognition and phago-cytosis of P. marinus trophozoites by the oyster hemocytes areunknown.

In this study, we identified and characterized in oyster hemo-cytes a galectin (Crassostrea virginica galectin (CvGal)4) ofunique carbohydrate recognition domain (CRD) organization that,unlike most mammalian galectins, recognizes exogenous carbohy-drate ligands. CvGal binds to a variety of potential microbialpathogens and phytoplankton components, thus representing notonly a nonself recognition component of the host cellular defensemechanisms, but also for feeding and intracellular digestion. Fur-thermore, we show that CvGal strongly interacts with Perkinsustrophozoites, functions as a hemocyte surface receptor for the par-asite, and mediates its phagocytosis. Therefore, we propose thatthe parasite successfully competes with potential pathogens andalgal food for binding to CvGal, to gain entry into the host phago-cytic cells.

Materials and MethodsReagents

Carbohydrates (monosaccharides, oligosaccharides, and glycoproteins, atthe highest purity available), LPS, and lipoteichoic acid were purchasedfrom Sigma-Aldrich. DNA primers were obtained from Invitrogen LifeTechnologies. Protein electrophoresis reagents were purchased from Bio-Rad. Restriction enzymes were acquired from New England Biolabs. Rab-bit erythrocytes were obtained from Immucor. Ex-TaqDNA polymeraseand dNTPs were from Takara.

Animals

Adult eastern oysters (C. virginica), averaging 40–50 g each, were ob-tained from Mook Sea Farm and maintained in 2000-liter tanks at 30 pptsalinity, 20°C, and fed daily with live algae (Tetraselmis sp. and Isochrysissp., each species on alternate days). Oysters were confirmed as P. marinus-free by diagnostic PCR (24).

Microbial, algal, and parasite species and strains

Aeromonas veronii bv sobria (FL5-50K), Carnobacterium sp. (FL7-92-33e), Edwardsiella tarda, Vibrio anguillarum (FL5-45-32A), Vibrio dam-sela (FL6-36-2KB), Vibrio mimicus (FL6-27), and Vibrio vulnificus (FL5-53-8LA) were obtained from Dr. A. Baya (Maryland CooperativeExtension, College Park, MD). Bacillus subtilis, Pseudomonas aeruginosa(ATCC 27853), Streptococcus aureus (ATCC 25923), Streptococcus fae-calis (ATCC 29212), and Vibrio parahaemolyticus (ATCC 27968) wereobtained from American Type Culture Collection. Escherichia coli D21(CGSC 5158) was obtained from the Coli Genetic Stock Collection at theE. coli Genetic Resource Center, MCD Biology Department, Yale Univer-sity. Bacterial strains except Vibrio were cultured in tryptic soy broth me-dium, whereas Vibrio strains were in tryptic soy broth containing 3% NaClat 37°C. Culture periods were as follows: E. tarda, S. aureus, V. damsela,and V. parahaemolyticus, 1 day; E. coli D21, P. aeruginosa, S. faecalis,and V. mimicus, 2 days; A. veronii bv sobria, B. subtilis, Carnobacteriumsp., V. anguillarum, and V. vulnificus, 3 days. Monoclonal cultures of Per-kinsus spp. established in our laboratory (P. marinus strains CB5D4,NR10, and TXsc, and P. andrewsi A8) were propagated as reported earlier(25). Unicellular algae (Isochrysis sp. and Tetraselmis sp.) were providedby the algal culture facility at Aquaculture Research Center (Center ofMarine Biotechnology, Baltimore, MD).

Immune challenge, extraction of RNA and DNA,and cDNA synthesis

Oysters were notched at the anterior side of the shell, close to the adductormuscle, allowed to acclimate for 3 days, and injected with 100 �l of LPS(E. coli 0111:B4, 100 �g/ml in artificial sea water (ASW)) into the adduc-tor muscle sinus using a 30-gauge hypodermic needle. After 24 h, oysterswere bled from the adductor muscle using 18-gauge needle, and subse-

quently dissected. Palp, gill, mantle, midgut, and rectum tissues were col-lected and stored in �80°C until use for RNA or genomic DNA extraction.Hemolymph samples were pooled and centrifuged at 800 � g at 4°C for 10min. After removing the supernatant, total RNA was isolated from hemo-cytes by using TRI reagent (MRC). A similar procedure was used to extractRNA from all other tissues collected. For RT-PCR, first-strand cDNA wassynthesized from 1 �g of tissues’ total RNA using SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen Life Technologies).First-strand cDNA for 3�- and 5�-RACE was synthesized from 5 �g ofhemocytes’ total RNA using GeneRacer kit (Invitrogen LifeTechnologies).

Primers used for RT-PCR, 3�- and 5�-RACE, and genomic PCR

Primers used for all PCR are shown in Table I. F2 and R3 primers weredesigned based on a partial sequence of C. virginica galectin (CD526748),whereas the others were designed based on the clones sequences obtainedby 3�- and 5�- RACE or genomic PCR described below.

RT-PCR

Each PCR amplification described below was conducted using a thermalcycler PCR Express (Hybaid) in a total volume of 20 �l with 0.5 U ofEx-TaqDNA polymerase (Takara), 800 �M dNTP, and forward and re-verse primers (500 nM each) otherwise mentioned. For CvGal, F2 and R3primers were used. For actin, ACTIN_F and ACTIN_R primers were used.PCR products were separated in 2% agarose gels, and DNA bands werevisualized by staining with ethidium bromide.

3�- and 5�-RACE

To determine the sequence of the region containing the 3�-untranslatedregion (UTR), PCR was conducted with primer F2 and GeneRacer 3�-primer (1.5 �M). To determine the sequence of the region containing 5�-UTR, PCR was conducted with primer R3 and GeneRacer 5�-primer (1.5�M). The full-length sequence was obtained by overlapping sequencesdetermined by 3�- and 5�-RACE, and the encoded lectin was designated asCvGal.

Genomic PCR

Genomic DNA was purified using DNeasy 96 Tissue kit (Qiagen). PCRamplification was conducted using 100 ng of genomic DNA in a totalvolume of 20 �l with 0.4 U of KOD HiFi DNA polymerase (Novagen),200 �M of dNTPs, 1 mM MgCl2, and forward and reverse primers (400nM each). At first, PCR was conducted with sets of GENE_F1 andGENE_R1, GENE_F2 and GENE_R2, GENE_F3 and GENE_R3,GENE_F1 and GENE_R2, GENE_F2 and GENE_R3, GENE_F1and GENE_R3, and with F4 and GENE_R1 primers. PCR amplification of thegenomic region containing 3�-UTR was conducted with GENE_F3 and R3primers.

4 Abbreviations used in this paper: CvGal, Crassostrea virginica galectin; CRD, car-bohydrate recognition domain; ASW, artificial sea water; UTR, untranslated region;GalNAc, N-acetyl-D-galactosamine; GlcNAc, N-acetyl-D-glucosamine; LacNAc, N-acetyllactosamine; TDG, thiodigalactose; PFA, paraformaldehyde; HBS, HEPES-buffered saline; N-J, neighbor-joining.

Table I. Primers used for amplification of DNA fragments

Name Sequence

F2 TTCAGGCACAGCCGGACAGGTTTGF4 CAAAATCTCCCAACCCTTCAR3 TGCGACAGTGCGTTTCTGTAGCCGTAAAGENE_F1 AGAGACCAACCCCATTTCCCGTTTGATGENE_F2 AGGAGAGGGACTACGAGGCCGAGTTTGENE_F3 CTTCATGAACGGATACAGTGTGGAGGAGENE_F7 TCGTTTTTCAGTTAGCCAGAAGCATGAGENE_R1 AAGTGGAAAGCGCAATTCTCATTGTCTGENE_R2 ATGTCATCCTCCACACTGTATCCGTTCGENE_R3 TGGAAGGCAATGTCGCTGTCTTCATCGENE_R7 CGGTTCAGGATTTTGTTGAAGGTTGATGGGENE_R9 ACAGTGCGATTAAACAAGGGCTCCGACAGENE_R10 CGACAACGCCCACGTCAAGAAAAGTGAEXP-F CATATGACTTACCAAATCAGCAAAATCTCCEXP-R CTCGAGTCTTCTTTGGATCTCAGCGCAAAGeneRacer

5�-primerCGACTGGAGCACGAGGACACTGA

GeneRacer3�-primer

GCTGTCAACGATACGCTACGTAACG

AP-1 GTAATACGACTCACTATAGGGCAP-2 ACTATAGGGCACGCGTGGT

3087The Journal of Immunology

by guest on June 20, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

Amplification of the genomic region containing the start codon wasconducted with the GENE_F7 and GENE_R7 primers. To amplify 5�-region of this gene, GenomeWalker Universal Kit (BD Biosciences)was used to construct a genomic library, and PCR was conducted withAP1 and GENE_R9 primers. For this reaction, Ex-Taq was used. Thesecond PCR was conducted with AP2 and GEGE_R10 primers using thefirst PCR product (diluted 50 times with sterile distilled water) as atemplate. PCR amplicons with Ex-TaqDNA polymerase were directlysubcloned into pGEM-T vector using pGEM-T vector System (Pro-mega). PCR amplicons with KOD HiFi DNA polymerase were purified,and the A-tailing reaction was conducted. Subcloning was conducted bythe same method as Ex-TaqDNA polymerase amplicon describedabove.

Analysis of cDNA and genomic sequences

DNA sequencing was conducted from both directions using dye termina-tion reactions, and analyzed on an Applied Biosystems model 373 Stretchsequencer. Sequence assembly was performed manually. Calculations oftheoretical molecular mass and pI from the deduced amino acid sequencewere performed with ProtParam (www.expasy.ch). Nucleotide sequence ofCvGal cDNA was analyzed by National Center for Biotechnology In-formation (NCBI) protein-protein BLAST (blastp; http://www.ncbi.nlm.nih.gov/BLAST/). Identification of the CvGal putative promoter waspredicted by NNPP, version 2.2, program (http://www.fruitfly.org/seq_tools/promoter.html).

Genomic Southern hybridization

Ten micrograms of the same genomic DNA used for genomic PCR wasdigested by BglI, EcoRI, EcoRV, HindIII, NdeI, or NsiI at 37°C for 18 h.Digested DNA was resolved with 0.8% agarose gel at 15 V for 7 h in TAEbuffer, and blotted onto Hybond-XL membrane (Amersham Biosciences).After cross-linking by baking at 80°C for 2 h, the membrane was rinsedwith 5� SSC, and prehybridized with ULTRAhyb (Ambion) at 42°C for30 min. The probe was prepared by PCR amplification using 10 ng of DNAfragment in a total volume of 100 �l with 2 U of KOD HiFi DNA poly-merase, and GENE_F1 and GENE_R2 primers (400 nM each). The am-plified band was purified by Gel Extraction kit (Qiagen) after separationwith 1% agarose gel electrophoresis. This probe was radiolabeled with 32Pusing Rediprime II Random Prime Labeling System (Amersham Bio-sciences) following the manufacturer’s instructions. After hybridizationat 42°C for 20 h, the membrane was washed twice in 2� SSC, 0.1%SDS at 42°C for 5 min, and twice in 0.1� SSC, 0.1% SDS at 42°C for15 min. BioMax MS Film (Kodak) was exposed to the membrane at�80°C for 24 h.

Homology modeling

Based on results of a conserved domain search by NCBI Conserved Do-main Search program (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi), four galectin domains were isolated from the full-length CvGal cDNAsequence and aligned with the bovine spleen galectin-1 (26), zebrafishDrgal1-L2 (27), and Caenorhabditis elegans 16-kDa galectin, N16 (28) bythe T-COFFEE program (http://www.ch.embnet.org/software/TCoffee.html). The alignment was used for homology modeling by the SWISS-MODEL program (http://swissmodel.expasy.org/) using the structure ofbovine spleen galectin-1 and N-acetyllactosamine (LacNAc) complex(1SLT_B) as a template.

Phylogenetic analysis

Amino acid sequences of invertebrate galectins were obtained using DDBJARSA software (http://arsa.ddbj.nig.ac.jp/index.jsp), and only sequencescontaining full-length of open reading frame were selected (Table II). Ga-lectin domains in were identified and isolated from the alignment describedabove. These selected and trimmed sequences were aligned by clustal Wsoftware, version 1.83 (http://align.genome.jp/), using slow/accurate modewith matrix of GONNET for both pairwise and multiple alignment param-eters. Other parameters were left as default. Relationships were analyzedby the neighbor-joining (N-J) distance method, and an unrooted tree wasconstructed.

Construction of an expression vector and purification ofrecombinant galectin

A DNA fragment encoding this galectin was amplified by PCR with EXP-Fand EXP-R primers. The amplicon was subcloned into pGEM-T vector,and a plasmid with the correct sequence was digested with NdeI and XhoI,purified after 1% agarose gel electrophoresis, and subcloned into

pET30a(�) vector (Novagen). This construct was transformed into E. coliBL21 (DE3) competent cell (Novagen). rCvGal was induced by 0.1 mMisopropyl �-D-thiogalactoside at 23°C for 16 h in 3 liters of LB mediumcontaining 30 �g/ml kanamycin. Soluble proteins extracted by BugBuster(Novagen) with 1 mM PMSF and 0.07% mercaptoethanol, contained mostof the recombinant CvGal (�80%). This fraction was loaded onto a columnpacked with 5 ml of Lactose-Gel (EY Laboratories). After washing thecolumn thoroughly (washing buffer: 50 mM Tris-HCl (pH 7.5), 150 mMNaCl, 0.07% mercaptoethanol), CvGal was eluted with 0.2 M lactose inwashing buffer. This fraction was further purified with MonoQ 5/5 column(Amersham Biosciences) connected to an Akta HPLC system (AmershamBiosciences). From a 3-liter E. coli culture, �20 mg of recombinant CvGalwere purified.

Protein determinations

Protein concentrations were estimated with the Bio-Rad Protein Assay kitI, in 96-well flat-bottom plates as described by the manufacturer in themicroassay format, using crystalline BSA as a standard. After 5 min ofcombining protein and dye, the reactions were read at 595 nm on Spec-traMax340 Plate Reader (Molecular Devices) controlled by SoftmaxProsoftware, version 1.

Characterization of the carbohydrate specificity of rCvGal

Hemagglutination assays. Microhemagglutination tests were conductedin BSA-blocked, 96-well Terasaki plates (Robbins Scientific) as reportedearlier (29). Briefly, 5 �l of a 5 � 106 cells/ml suspension of rabbit eryth-rocytes (previously fixed with 0.05% glutaraldehyde in PBS for 10 min atroom temperature) in PBS were added to equal volumes of 2-fold dilutionsof rCvGal in PBS. The plates were gently vortex-mixed for 10 s and in-cubated at room temperature for 1 h. Agglutination was read under a lightmicroscope (BH-2; Olympus), and scored from 0 (negative) to �3. Rela-tive activity was calculated by dividing the score of each sample by thescore of the positive control (only CvGal and rabbit erythrocytes). Negativecontrols were conducted by adding PBS instead of rCvGal dilution.Hemagglutination-inhibition assays. The carbohydrate-binding specific-ity of rCvGal was examined by the microhemagglutination assay describedabove. Two-fold serial dilutions of rCvGal (5-0.31 �g/ml; 2.5 �l/well)were incubated for 1 h with equal volumes of the potential carbohydrateinhibitors at various concentrations in 96-well plates at room temperature.All carbohydrates to be tested as inhibitors were dissolved in PBS atconcentrations of 200, 100, 50, 25, or 12.5 mM for mono- and oligo-saccharides, and 1.0, 0.5, 0.25, 0.125 mg/ml for glycoproteins, mucins,

Table II. Amino acid sequences used for phylogenetic analysis

Name Organisms ID

As_gal Anopheles stephensi AY162251Bm_gal Brugia malayi AF237486Di_gal Dirofilaria immitis AF237485Dm_gal Drosophila melanogaster AF338142Gc_gal Geodia cydonium X93925Gc_galec3 G. cydonium AJ400909Gc_lecII G. cydonium X70849GRG Globodera rostochiensis AF002989Hc-gal1 Haemonchus contortus AF077944Hc-gal2 H. contortus AF036098Hc-gal4 H. contortus AF105967Hc_F_gal H. contortus AY253330Hc_gal16 H. contortus AJ243873LEC-1 Caenorhabditis elegans M94671LEC-2 C. elegans AB038503LEC-3 C. elegans AB038504LEC-4 C. elegans AB038505LEC-5 C. elegans AB038506LEC-6 C. elegans D63575LEC-7 C. elegans NP_509650LEC-8 C. elegans AB038499LEC-9 C. elegans AB038500LEC-10 C. elegans AB038501LEC-11 C. elegans AB038502Oc_gal Ostertagia circumcincta U67147Oc_gal2 O. circumcincta U67148Ov87 Onchocerca volvulus U96175Pp_gal Phlebotomus papatasi AY538600

3088 A NOVEL OYSTER GALECTIN AS A PHAGOCYTE RECEPTOR

by guest on June 20, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

or proteoglycans. The carbohydrates used were as follows: L-fucose,D-galactose, D-glucose, D-mannose, galactosamine, N-acetyl-D-galac-tosamine (GalNAc), N-acetyl-D-glucosamine (GlcNAc), melibiose, lac-tose, lactulose, 3-o-D-galactopyranosyl-D-arabinose, 4-o-(�-galactopyr-anosyl)-�-D-mannopyranose, LacNAc, thiodigalactose (TDG), transferrin,fetuin, asialofetuin, fibronectin, lactoferrin, laminin, thyroglobulin, human �1-acid glycoprotein (orosomucoid) bovine submaxillary mucin, ovine submax-illary mucin, arabinogalactan, chondroitin sulfate, and hyaluronic acid. Con-trols were the substitutions of the carbohydrate solution by PBS, andsubstitution of purified lectin by PBS. Results were expressed as the reciprocalpercentage agglutinating activity relative to the no-carbohydrate-added control(100%; no sugar, glycoprotein, mucin, or proteoglycan added). For glycopro-teins, the actual sugar concentrations in the inhibition tests were calculatedbased on the carbohydrate percentage contents as follows: asialofetuin (30),16%; fetuin (30), 23%; fibronectin (31), 5%; lactoferrin (32), 6%; laminin (33),13%; thyroglobulin (34), 10%; transferrin (35), 6%.

Preparation of rabbit anti-CvGal antisera and purification ofspecific antibodies

Anti-CvGal antisera were raised by Open Biosystems. IgG was purified bya HiTrap Protein A HP 1-ml column (Amersham Biosciences). Anti-CvGal-specific IgG was further purified on an Ag-bound affinity column preparedby coupling 2 mg of rCvGal to a HiTrap NHS-activated HP 1-ml column.The flow-through fraction of this column (absorbed IgG) and preimmuneIgG, purified as described above, were used as negative controls.

Western blot analysis

Specificity analysis of purified anti-CvGal IgG in hemocyte extracts. He-mocyte extracts were prepared by treating the packed cells with 1� SDS-sample buffer at 100°C for 5 min, and clearing the supernatant by centrif-ugation. rCvGal (10 ng) and hemocyte extract (40 �g of total protein) wereresolved in 10% SDS-PAGE gel, and blotted onto polyvinylidene difluo-ride membranes (Immobilon-P; Millipore) using a TE 22 Mini Tank Trans-fer Unit (Amersham Biosciences) with Towbin buffer (36) at 0.4 A for 90min. After blocking with blocking buffer (5% skim milk in PBS containing0.05% Tween 20 (PBST)), membranes were incubated with 200 ng/mlanti-CvGal, preimmune, or absorbed IgGs in blocking buffer at room tem-perature for 1 h. After washing with PBST for 5 min three times, mem-branes were incubated with diluted HRP-conjugated goat anti-rabbit IgG(1/3000; Bio-Rad) in blocking buffer at room temperature for 30 min. Afterwashing with PBST for 5 min five times, the membranes were incubatedwith SuperSignal West Pico Chemiluminescent Substrate (Pierce) at roomtemperature for 5 min, and signals were detected on CL-X Posure Film(Pierce) after a 10-s exposure.Examination of CvGal secretion. One hemolymph aliquot containing2.50 � 105/ml hemocytes was centrifuged at 800 � g for 5 min at 4°Cimmediately after collection, the plasma was separated from the hemo-cytes, and both were maintained on wet ice. A second hemolymph aliquotwas plated in a 24-well tissue culture-treated polystyrene plate (BD Bio-sciences) and incubated at room temperature for 30 min to allow the at-tachment of hemocytes to the bottom of the wells. After removing thesupernatant, 500 �l of ASW were added to each well and incubated atroom temperature for 1 h. For each experiment, three replicate wells wereused. After incubation, supernatants were removed and cleared by centrif-ugation, and the proteins were precipitated by trichloroacetic acid. Theattached cells were lysed by addition to each well of 160 �l of 1� SDS-sample buffer, and incubation for 5 min at room temperature. Proteins fromunattached and attached hemocytes (equivalent to 2.50 � 103 cells/lane),plasma (5 �l/lane), and whole ASW supernatant (proteins from 500 �l ofASW/lane) were separated by 10% SDS-PAGE gel, and blotted onto poly-vinylidene difluoride membrane. Detection of CvGal was conducted thesame as described above, with exception of primary Ab concentration as 50ng/ml and exposure time as 1 min.In vivo challenge of hemocytes with bacterial wall and P. marinus. At-tachment of hemocytes to plastic plates was conducted as described above.After removing the supernatant, 500 �l of ASW containing 100 �g/mlbacterial wall mixture (LPS from E. coli 026:B6, 055:B5, 0111:B4, 0127:B8, 0128:B12, EH100 (Ra mutant), F583 (Rd[2] mutant), J5 (Rc mutant),Klebsiella pneumoniae, Salmonella minnesota, S. minnesota Re595 (Remutant), Salmonella typhimurium, S. typhimurium SL684 (Rc mutant), Shi-gella flexneri 1A, Vibrio cholerae Inaba 569B, and lipoteichoic acid fromB. subtilis, Staphylococcus aureus, S. faecalis, Streptococcus mutans,Streptococcus pyogenes, Streptococcus sanguis) or 2.00 � 105 cells P.marinus trophozoites suspended in ASW were added and incubated atroom temperature for 1 h. For each experiment, three wells were used.After incubation, treatment of supernatants and pellets were conducted asdescribed above. SDS-PAGE, blotting, and detection of CvGal was con-

ducted as described above, with exception of exposure time as 5 min. Filmswere scanned, images were analyzed by the ImageJ software, and the re-sults were expressed as relative intensity to that of the ASW pellet.

Immunofluorescence studies

Fluorescence staining of unattached hemocytes. After bleeding, an equalvolume of ice-cold 2% paraformaldehyde (PFA) in ASW was added to theice-cold hemolymph to reach a final concentration of 1% PFA and incu-bated on wet ice for 30 min. The fixed cells were washed with 10 mMHEPES, 430 mM NaCl, 10 mM CaCl2 (pH 7.3) (HEPES-buffered saline(HBS)) three times, with centrifugation at 800 � g for 5 min at 4°C. Halfof the pellets were resuspended in 0.1% saponin in HBS and incubated atroom temperature for 30 min. The remaining pellets had no saponin added.Untreated and saponin-treated cells were washed three times with HBS andincubated with 200 �l of 5% BSA in HBS at room temperature for 1 h. Toeach tube, 100 �l of CvGal-specific or absorbed IgG (10 �g/ml in HBScontaining 1% BSA) was added and incubated for 1 h at room temperature.After washing with HBS three times, 100 �l of Alexa 488-labeled donkeyanti-rabbit IgG (BD Biosciences) (1:200 in HBS containing 1% BSA) wereadded and incubated for 1 h at room temperature in the dark. After washingwith HBS three times, the final pellet was resuspended in VectaShieldH-1500 (Vector). Images were captured at 23°C using DP controller soft-ware 1.2.1.108 with a digital camera (DP70; Olympus) and fluorescentmicroscope (Axioplan2; Zeiss) using a Plan-NEOFLUAR 40�/0.75 andwere annotated using Photoshop (Adobe).Fluorescence staining of attached hemocytes. Two hundred microlitersof hemolymph were added to each well of poly-D-lysine-coated eight-wellchamber slides (Biocoat; BD Biosciences) and incubated at room temper-ature for 1 h. Each well was gently washed with HBS three times, and cellswere fixed with 200 �l of 2% PFA in HBS for 15 min at room temperature.After washing with HBS for 5 min three times, half of the wells weretreated with 200 �l of 0.05% Triton X-100 in HBS for 10 min at roomtemperature, whereas the remaining wells were incubated with buffer only.After washing all wells with HBS three times, blocking was conductedwith 1% BSA in HBS for 1 h at room temperature. To each well, 200 �lof CvGal-specific or absorbed IgG (10 �g/ml in HBS containing 1% BSA)was added and incubated for 1 h at room temperature. After washing withHBS three times, each well was incubated with 200 �l of 200 times dilutedAlexa 488-labeled goat anti-rabbit IgG (BD Biosciences) (1:200 in HBScontaining 1% BSA), for 1 h in the dark at room temperature. After wash-ing with HBS three times, the slides were enclosed and observed as de-scribed above.Binding of rCvGal to the hemocyte surface. Hemocytes were fixed by thesame method as for the staining of unattached hemocytes described above.After washing with HBS three times, cells were incubated with 100 �g/mlrCvGal in HBS, rCvGal and 50 mM TDG, or HBS only, at room temper-ature for 1 h. Cells were washed with HBS three times, and the boundrCvGal was detected by the same method as for unattached hemocyte stain-ing described above. Staining with absorbed IgG was conducted as a neg-ative control.Binding of rCvGal to P. marinus trophozoites. A monoclonal culture ofP. marinus CB5D4 trophozoites (10 ml; �5.00 � 106 cells/ml) was har-vested by centrifugation at 800 � g for 10 min. Cells were washed withHBS three times and incubated with 5% BSA in HBS for 1 h at roomtemperature. Cells were treated with 100 �g/ml rCvGal in HBS at roomtemperature for 1 h and washed three times with HBS. Controls were setby the addition of TDG or Glc (100 mM) as potential inhibitors of rCvGal-specific binding. Detection of CvGal bound to P. marinus trophozoites wasconducted by using anti-CvGal Abs as described above.

Phagocytosis assay

On each glass slide, two poly-L-lysine (0.01%)-treated areas (2 � 2 cm)were seeded with 2 � 105 hemocytes each, and the slides incubated atroom temperature for 30 min, to allow for hemocyte attachment andspreading. After discarding the supernatant, 100 �l of ASW, 50 �g/mlabsorbed IgG, or 20, 50, or 100 �g/ml CvGal-specific IgG in ASW wereadded to each well. For each experiment, four wells were prepared. Afterincubation at room temperature for 30 min, the supernatants were dis-carded, and 100 �l of 2.00 � 105 cells of P. marinus trophozoites sus-pended in each solution mentioned above were added to each well. Afterincubation at room temperature for an additional 30 min, supernatants werediscarded, and cells were fixed with 1% PFA in ASW at room temperaturefor 15 min. Slides were washed with HBS once, and after rinsing withMilli-Q water briefly, wells were enclosed with VectaShield H-1500. Foreach well, nine different fields were randomly selected, and the number oftotal cells and cells engulfing P. marinus trophozoites were counted. Thephagocytosis ratio was calculated dividing the number of phagocytosing

3089The Journal of Immunology

by guest on June 20, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

cells by total number of cells. The result was expressed as phagocytosisratio relative to that in ASW.

ResultsThe oyster hemocyte galectin (CvGal) is a novel protein ofunique CRD organization and distinct carbohydrate specificity

Recent information from public genomic and expressed sequencetag databases from C. virginica and the Asian oyster Crassostreagigas confirmed our earlier findings (37, 38) by revealing the pres-ence of multiple lectins with potential galactosyl-binding proper-ties, either belonging to the C-type or galectin families (http://www.ifremer.fr/GigasBase/ and http://www.marinegenomics.org).To examine the spatial distribution of galectin transcripts inoyster hemocytes and selected tissues, we used RT-PCR withprimers based on a partial galectin sequence (accession numberCD526748), and detected galectin transcripts in all tissuestested (Fig. 1).

In the next step, we elucidated the primary structure of the pro-tein by cloning the full-length cDNA encoding the galectin’s se-quence, obtained by overlapping partial sequences determined by3�- and 5�-RACE. The CvGal cDNA spanned 2005 nt (Fig. 2),containing a 1665-nt open reading frame encoding 555 aa residues,with a calculated molecular mass of 63,360.50 Da, and predictedisoelectric point of 4.83. This sequence was verified by amplifyingfull-length of coding region, which yielded a product of identicalsequence. The 5�- and 3�-UTRs were 46 and 294 nt, respectively.

To determine the structure of the gene that encode for CvGal,we used a PCR amplification approach on genomic DNA. TheCvGal gene (�6.7 kb), obtained by the alignment of multiple se-quences of overlapping PCR products is composed of 12 exons(lengths in downstream order: 0.024, 0.089, 0.328, 0.086, 0.202,0.120, 0.089, 0.205, 0.120, 0.086, 0.205, and 0.114 kbp) separatedby 11 introns (2.35, 0.698, 0.318,0.202, 0.094, 0.167, 0.365, 0.375,0.186, 0.154, and 0.136 kbp), none of which is present within theregions encoding the individual CRDs (Fig. 3A). The nearest pre-dicted promoter region was from �124 to �75 bp and predictedtranscription initiation site was �84 bp (score, 0.81). Southern blotanalysis of the genomic DNA digests with various restriction en-zymes revealed bands of approximate sizes as follows: BglI, 6.5;EcoRI, 5.0; EcoRV, 3.0; HindIII, 2.8; NdeI, 5.7; NsiI, 6.1 kbp (Fig.3B), in good agreement with expected sizes based on genomicDNA sequence and the identified restriction sites.

The sequence alignment of CvGal with galectins from verte-brates and invertebrate species revealed that from the 9 aa residuesthat in bovine galectin-1 participate in ligand binding, 7 are con-served in all four CvGal CRDs (His44, Asn46, Arg48, Asn61, Trp68,

Glu71, and Arg73; numbers corresponding to the bovine galectin 1are circled in Fig. 2). This is due to the lack of four consecutiveamino acid residues that are present in the mammalian prototypegalectins and include His53 and Asp55, residues that participate inligand binding by interacting with the nitrogen of the NAc groupvia a water molecule (Fig. 3C). We examined the potential con-sequences of this deletion on the structural aspects of the CvGal byhomology modeling of the C-backbones of all four CvGal CRDson the structure of a mammalian prototype galectin CRD (26). Inthe model (Fig. 3D), it becomes clear that the seven conservedresidues from all four CvGal CRDs maintain their positions and

FIGURE 1. CvGal is expressed in hemocytes and various tissues.cDNAs were synthesized from total RNA from hemocytes, palps, gills,mantle, midgut, and rectal tissues. Results of PCR amplification usingCvGal-specific primers (upper) and that of actin-specific primers(lower) are shown.

FIGURE 2. Nucleotide sequence of cDNA and deduced amino acid se-quence of CvGal. Numbers on the left and the right indicate the nucleotideand amino acid positions, respectively. Asterisks mark the stop codon, andthe polyadenylation signal is shown in italics. Conserved amino acid res-idues that are supposed to bind the sugar ligand are circled.

3090 A NOVEL OYSTER GALECTIN AS A PHAGOCYTE RECEPTOR

by guest on June 20, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

orientations in the binding cleft, relative to the bovine spleen ga-lectin, whereas the lack of four residues results in a dramaticallyshortened loop (indicated by the solid arrow for CRD-2, -3, and -4,and by a dashed arrow for CRD-1).

To experimentally test this possibility, we prepared the rCvGaland characterized its carbohydrate-binding specificity by hemag-glutination-inhibition assays using a panel of mono-, oligo-, poly-saccharides, and glycoproteins (Fig. 3, E–H; the 50% inhibitionvalues are shown in Table III). Among the monosaccharides,galactosamine and N-acetylgalactosamine showed high inhibition

relative to others such as L-fucose. Disaccharides containing non-reducing terminal D-galactose showed high inhibitory capacity rel-atively to the monosaccharides, particularly lactose (100% at 50mM), LacNAc (100% at 25 mM), and TDG (100% at 50 mM).Similarly, among the glycoproteins, lactoferrin, laminin, thyro-globulin, and asialofetuin showed relatively high inhibition. Incomparison, most mucins and proteoglycans tested showed lowinhibition capacity, except for hyaluronic acid (78% at 250 �g/ml).Although mucin and fibronectin behave as good ligands for theavian and amphibian galectins, it was not the case for CvGal.

FIGURE 3. Molecular and biochemical characterization of CvGal. A, Gene organization of CvGal. Exons are shown as white boxes, whereasintrons are shown as a black thick line. Restriction sites are shown at the top. Location of the probe used for Southern blotting is shown at the top.Locations of each CRD are shown at the bottom. B, Genomic Southern analysis. Molecular sizes are shown at the left. C, Alignment of bovinegalectin-1, Drgal1-L2, N16, and CRD1 to -4 of CvGal. D, Homology modeling of CvGal CRDs. Bovine galectin-1, CRD-1, -2, -3, and -4 are shownin white, blue, yellow, red, and green, respectively. Numbering of amino acid residues is based on bovine galectin-1. An arrow shows the strandsof CRD-2, 3, 4, whereas a dashed arrow shows the strand of CRD-1. E–H, Carbohydrate specificity of CvGal. Hemagglutination-inhibition assaysfor monosaccharides (L-fucose (�), D-galactose (Œ), D-glucose (f), D-mannose (F), galactosamine (�), GalNAc (‚), and GlcNAc (�)) (E),disaccharides containing D-galactose (melibiose (�), lactose (Œ), lactulose (f), 3-o-D-galactopyranosyl-D-arabinose (F), 4-o-(�-galactopyranosyl)-�-D-mannopyranose (�), LacNAc (‚), and TDG (�)) (F), glycoproteins (asialofetuin (�), fetuin (Œ), fibronectin (f), lactoferrin (F), laminin (�),thyroglobulin (‚), and transferrin (�)) (G), and mucins and proteoglycans (�1-acid glycoprotein (orosomucoid) human (�), BSM (Œ), OSM (f),arabinogalactan (F), chondroitin sulfate (�), and hyaluronic acid (‚)) (H). Saccharide contents of glycoproteins were calculated as described inMaterials and Methods. The 50% inhibition values are shown in Table III.

3091The Journal of Immunology

by guest on June 20, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

To examine the possible ancestry of the individual CvGalCRDs, we constructed a tree based on genetic distance that in-cluded most galectins from invertebrate species described to date.These consisted of 28 sequences, and because most of them werefrom the tandem-repeat type, they provided a total of 50 CRDs, ofwhich 48 were included in the analysis (Table II). The unrootedN-J tree (Fig. 4) revealed three clusters of single CRD galectinsand two clusters of tandem-repeat galectins, the first including theC-terminal CRD, and the second clustering the N-terminal CRDsand CvGal group, with only a few exceptions. All four CvGalCRDs clustered relatively closer to the single CRD galectins fromAnopheles stephensi, C. elegans, Geodia cydonium, and Haemon-chus contortus.

Upon hemocyte attachment and spreading, CvGal istranslocated to the periphery, secreted to the extracellularspace, and remains associated to the cell surface

To examine the subcellular localization of the mature CvGal pro-tein, we raised an antiserum against the rCvGal, and validated the

specificity of purified anti-rCvGal Abs by Western blot. Singlebands of the expected size were detected for the crude hemocyteextract and rCvGal (Fig. 5A), whereas no signal was observed inthe absorbed IgG and preimmune IgG controls (data not shown).These results showed that the Ab is specific for the authenticCvGal, supported RT-PCR results indicating that the gene is tran-scribed in the hemocyte, and revealed that significant amounts ofmonomeric CvGal remain associated to these cells.

Because the oyster hemocytes become motile and avidlyphagocytic upon attachment and spreading on a foreign surface,

FIGURE 4. Phylogenetic analysis of invertebrate galectins. The un-rooted tree constructed by the N-J distance method is shown. Sequencesused to generate phylogenetic analysis are shown in Table II.

FIGURE 5. Upon hemocyte attachment and spreading, CvGal is trans-located to the periphery and secreted. A, Western blotting of rCvGal andoyster hemocyte extract. Molecular sizes of markers are shown on the left.B, Western blotting of unattached hemocyte, plasma, attached-spread he-mocyte, and supernatant. C and D, Immunofluorescence staining of unat-tached (C) and attached-spread (D) hemocytes. Scale bar, 10 �m.

Table III. The 50% inhibition values of saccharides, glycoproteins, andproteoglycans

Compound I50

Melibiose 17.7 mMLactose 15.8 mM3-o-D-Galactopyranosyl-D-arabinose 27.5 mM4-o-(�-Galactopyranosyl)-�-D-mannopyranose 26.3 mMLacNAc 9.13 mMTDG 8.48 mMAsialofetuin 16.4 �g/mlLactoferrin 2.02 �g/mlLaminin 5.53 �g/mlThyroglobulin 13.7 �g/mlHyaluronic acid 117 �g/ml

3092 A NOVEL OYSTER GALECTIN AS A PHAGOCYTE RECEPTOR

by guest on June 20, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

we examined by Western blot the presence of CvGal in circu-lating hemocytes, in plasma, and in the attached and spreadcells. Both the unattached and attached hemocytes revealed astrong band, whereas only the attached cells released solubleCvGal (Fig. 5B). Subsequently, we examined the subcellulardistribution of CvGal in unattached and attached hemocytes byimmunofluorescence (Fig. 5, C and D). In the unattached he-mocytes, CvGal was observed in the cytoplasm of �20 –30% ofthe saponin-permeabilized cells, but none in the untreated cells.In contrast, intense diffuse staining was observed in both per-meabilized and untreated attached cells, approximately in thesame proportion as in the unattached saponin-permeabilized he-mocytes (20 –30%). We identified these cells as granulocytes,as judged from their distinct morphology under phase contrastmicroscopy (39). On the untreated attached hemocytes, a highconcentration of CvGal was detected on the plasma membrane,particularly in the filopodia. No fluorescence was observed inthe absorbed IgG (Fig. 5, C and D) and preimmune IgG controls(data not shown). We also examined the possibility that thelectin released by the attached granulocytes binds to the hemo-cyte surface moieties. For this, we exposed unattached hemo-cytes to rCvGal and tested its potential binding by immunoflu-orescence. Intense staining was observed in �100% of the cells(Fig. 6), indicating that CvGal can strongly bind to both at-tached and unattached hemocytes. Furthermore, this suggeststhat, as CvGal is secreted by the attached granulocytes, it firstbinds to the cell surface, and after saturation the remaininggalectin is released to the environment.

CvGal binds to a variety of microorganisms and phytoplanktoncomponents, but preferentially to Perkinsus spp. trophozoites

In addition to binding endogenous ligands from the hemocyte sur-face, CvGal may bind exogenous ligands, namely surface sugarson potential bacterial pathogens, parasites, or phytoplankton. Toexamine this possibility, we used a lectin adsorption assay to testthe binding capacity of CvGal to a variety of ligands relative torabbit erythrocytes. These included bacteria, both Gram-positiveand -negative, Perkinsus spp. parasites including P. marinus, andunicellular algae. Most bacterial strains that were tested failed toadsorb the rCvGal over 20% of the control. However, A. veronii bvsobria and Carnobacterium sp. adsorbed �90%, and S. faecalis, B.subtilis, and V. mimicus absorbed between 30 and 50% of thelectin activity (Fig. 7A). Most interestingly, all tested Perkinsusspp. and isolates consistently adsorbed between 95 and 100% ofthe lectin activity, indicating that CvGal preferentially binds to thesurface of the Perkinsus spp. parasites over most microbes tested.This was in sharp contrast with the poor binding of CvGal to

Isochrysis sp. (4% absorption), a unicellular alga that is a maincomponent of the phytoplankton on which oysters feed. Thisobservation was further confirmed with a quantitative adsorp-tion assay; P. marinus adsorbed �75% of the lectin activity at

FIGURE 6. Binding of rCvGal to unattached hemocytes. Fixed unat-tached hemocytes were incubated with rCvGal and detected by anti-CvGalIgG. Scale bar, 10 �m.

FIGURE 7. CvGal binds to a variety of microorganisms, especially toP. marinus trophozoites. A, Absorption test of rCvGal with selected mi-croorganisms. Results are shown as relative absorption. Bars show SDs ofquadruplicate experiments. B and C, Absorption test of rCvGal with Iso-chrysis sp. (B) or P. marinus trophozoites (C) at various cell pellet-to-lectinsolution ratios. Bars show SDs of quadruplicate experiments. D, Binding ofrCvGal to P. marinus trophozoites. Scale bar, 10 �m.

3093The Journal of Immunology

by guest on June 20, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

a ratio of 1:80, whereas Isochrysis sp. did not adsorb any sig-nificant amount (Fig. 7, B and C). P. marinus and Isochrysis sp.cells are of similar size (4 – 6 and 4 –5 �m, respectively), rulingout the possibility of differences due to the extent of exposedcell surface area. Another abundant phytoplankton componentin the oyster’s diet, Tetraselmis spp., strongly adsorbed theCvGal. The specificity of the CvGal-Perkinsus interaction wasexamined by immunofluorescence. P. marinus CB5D4 tropho-zoites were incubated with CvGal alone, or preincubated withTDG (a disaccharide that behaves as a strong inhibitor of CvGal(Fig. 3F and Table III)), or with glucose followed by treatmentwith rabbit anti-CvGal IgG. Our results indicate that rCvGalbinds to P. marinus trophozoites in a carbohydrate-specificmanner (Fig. 7D).

Expression of CvGal is up-regulated by challenge with P.marinus trophozoites, and the hemocyte surface-associatedCvGal is a receptor for P. marinus

Because CvGal preferentially binds P. marinus trophozoites, andis present on the surface of the actively phagocytic hemocytes, itmay have a role as a receptor for parasite phagocytosis. We there-fore tested the effect of exposure of attached and spread oysterhemocytes to P. marinus trophozoites in vitro, compared with ex-posure to a mix of cell walls from various bacterial species, usinguntreated hemocytes as controls. Exposure of hemocytes to P. ma-rinus trophozoites consistently resulted in a slightly higher releaseof CvGal to the supernatant than from those exposed to bacterialcell walls, or from the untreated hemocytes (Fig. 8A). Similarly, asthe exposure time increased to 2 h, the content of CvGal in at-tached hemocytes was consistently higher in those exposed to P.marinus trophozoites (results not shown).

Finally, we examined the potential role of the hemocyte-asso-ciated CvGal in phagocytosis of P. marinus trophozoites. For this,we treated hemocytes with increasing concentrations of the anti-CvGal Abs or anti-CvGal-depleted Igs, and compared phagocyto-sis of P. marinus trophozoites between the treated hemocytes anduntreated controls (Fig. 8B). The increase in concentration of theanti-CvGal Abs was concomitant with an increased inhibition ofphagocytosis, revealing that the hemocyte surface-associatedCvGal is a receptor for P. marinus that mediates phagocytosis.However, only partial inhibition of phagocytosis was observed

(�40%) at the highest concentration tested, suggesting that othersurface receptors may also participate in phagocytosis of Perkinsustrophozoites.

DiscussionIt is widely accepted that recognition of exposed glycans on thecell surface of potential pathogens by host humoral or cell-associated lectins is a key component of the innate immuneresponse of vertebrates and invertebrates. During earlier stud-ies, we partially characterized multiple lectins in the oysterplasma and hemocytes, which recognize glycoproteins that dis-play terminal galactose and N-acetylated sugars (37, 38). Al-though the family identity of these lectins remained unresolved,further studies revealed that some of the sugars recognized co-incided with the sugars present on the surface of the P. marinustrophozoites (40). These observations led us to hypothesize thatthe parasite may have adapted to exploit the host recognitionmechanisms to gain entry into the hemocytes. A search of pub-lic genomic and expressed sequence tag databases from the oys-ters C. virginica and C. gigas yielded multiple lectin sequences,either belonging to the C-type or galectin families, with signa-ture motifs indicative of galactosyl-binding properties. In con-trast to C-type lectins, galectins constitute a relatively homo-geneous lectin family and virtually all members bind�-galactosyl residues (5, 14, 26). Therefore, we considered theoyster galectin a good candidate as a hemocyte receptor for P.marinus trophozoites. By the use of a PCR approach based ona galectin sequence, we identified transcripts in oyster hemo-cytes and all selected tissues tested, and based on the similarintensity of the amplicons, it is likely that the signals observedarise from the hemocytes that infiltrate these tissues. Infectionsby Perkinsus species take place through trophozoites that arereleased by infected oysters into the environment that becomein contact with or are ingested through filter-feeding by healthyneighboring oysters (19). The trophozoites are phagocytosed byhemocytes located in the mantle, palps, gills, or gut epithelium(41) and reside in a phagosome-like structure, where they pro-liferate by multiple fission and budding. Infected hemocyteseventually lyse and the released trophozoites are phagocytosedby other hemocytes, which migrate throughout the tissues anddisseminate the parasite. Thus, it is noteworthy that hemocytes,

FIGURE 8. CvGal is up-regulated by challenge with P. marinus trophozoites, and surface-associated CvGal is a receptor for P. marinus. A, Westernblotting of in vitro-challenged hemocytes with bacterial cell wall components or P. marinus. Relative intensities of bands to ASW pellet band werecalculated and plotted. Bars show SDs from three independent experiments. The inserted image is from a representative experiment. B, Phagocytosis assay.Results are shown as relative phagocytosis ratio to that of ASW. Statistical analysis was conducted by one-way ANOVA, followed by Turkey’s multiple-comparison test. Bars are SDs.

3094 A NOVEL OYSTER GALECTIN AS A PHAGOCYTE RECEPTOR

by guest on June 20, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

which are the main cellular components of the oyster’s immunesystem, and tissues expressing galectin transcripts such as gills,palps, gut, and mantle, are all in direct contact with the externalenvironment, and have been proposed as portals for P. marinusinfection (20, 21).

The CvGal sequence revealed that it is a novel member ofthis family, of unique CRD organization. Sequence comparisonof CvGal to multiple galectins from various organisms revealedthe presence of four canonical galectin CRDs connected bylinkers ranging from 8 to 17 amino acids, a domain organizationthat does not fit any of the known galectin types. Proto- andchimera-type galectins contain one CRD per subunit, whereastandem-repeat galectins contain two CRDs joined by a linkerpeptide (5, 15). Elucidation of the gene organization of CvGalconfirmed the presence of four tandemly arrayed CRDs and thatthe position of first intron of CvGal, between eighth and ninthamino acid residues, is identical with that of Lec-6, a 16-kDagalectin from C. elegans (42), and different from the mamma-lian prototype galectins, where it is located between second andthird, or third and fourth amino acid residues (43). Southernblot analysis was in good agreement with expected sizes basedon genomic DNA sequence and the identified restriction sites,and suggested that the gene encoding CvGal is present as asingle copy. The presence of four similar, albeit distinct tan-demly arrayed CRDs in CvGal, represents a unique feature fora member of the galectin family, and its structure and specificitypose novel questions about its binding properties. Lectin-ligandinteractions are relatively weak compared with other immunerecognition molecules, but high avidity for the target isachieved by the association of peptide subunits into oligomericstructures in which multiple CRDs simultaneously interact withligand (44). In the soluble collectins (45) such as the mannose-binding lectin, the subunits possessing a single CRD associateto form a bouquet-like oligomer with all CRDs facing a potentialtarget surface. In contrast, the cruciform subunit organization of theconglutinins, enables the single CRDs to cross-link the target surfaces.A less frequent organizational plan is the presence of tandemlyarrayed CRDs encoded within a single polypeptide such as inF-lectins (46), immulectins (47), and tandem-type galectins(48). In this context, the four-CRD CvGal may have the poten-tial for cooperative binding as well as cross-linking of the rec-ognized glycans.

The sequence alignment of CvGal CRDs with those of ver-tebrates and invertebrate species showed that two amino acidresidues (His53 and Asp55) that participate in ligand binding byinteracting with the nitrogen of the NAc group via a water mol-ecule, are missing in all four CvGal CRDs. In the C. elegansgalectin Lec-6, the absence of these two residues confersbroader carbohydrate specificity relative to that of the mamma-lian prototype galectins (28). The structural analysis of theCvGal CRDs by homology modeling strongly suggested that,although CvGal CRDs bind �-galactosyl residues, their speci-ficity for N-acetylated disaccharides and oligosaccharides maydiffer from the mammalian galectins. Carbohydrate specificitystudies on rCvGal confirmed that the relative inhibitory effi-ciency of each one of these sugars is different, and that CvGalhas a broader sugar specificity, although its inhibition profilesare similar to that for the mammalian prototype galectins.

A distance-based tree, which was consistent with phyloge-netic analysis of galectins reported elsewhere (49, 50), revealedthat all four CvGal CRDs clustered relatively closer to the sin-gle-CRD galectins, suggesting not only that they may haveoriginated by repeated duplication of a primordial CRD, rather

than a single duplication of a tandem-repeat galectin gene, butalso their possible orthology with galectin CRDs from the ear-liest metazoans. However, in contrast with galectins from ver-tebrate species, those from invertebrates and parazoa are quitedivergent both at the amino acid and genomic structure levels,and predictions about their phylogenetic relationships should beinterpreted cautiously.

Studies on the subcellular localization of the mature CvGalprotein in both circulating and attached hemocytes revealed thatin the former CvGal is present in the cytoplasm of about one-third of the hemocytes, but upon attachment and spreading, ofthe granulocyte subpopulation, is translocated to the periphery,and is secreted to the extracellular space. Galectins lack a signalpeptide, and are secreted by an unconventional mechanism (51).Because CvGal also lacks a signal peptide, its presence in theextracellular space suggests that a similar secretion mechanismmay be involved. Immunofluorescence studies also revealedthat, as CvGal is secreted by the attached granulocytes, it bindsto the cell surface, and the remaining galectin is released to theenvironment. The soluble CvGal can then bind to all other cir-culating (nonactivated) cells, both granulocytes and hyalino-cytes. A variety of biological functions may result from the cis-and trans- galectin-glycocalyx interactions, such as increasedhalf-life of surface receptors, cell adhesion, and signaling (52–54). A similar role may be proposed for CvGal upon binding tosurface moieties of the cells that secrete it. Furthermore, al-though hyalinocytes may lack the mechanisms to synthesizeCvGal, they express cell surface � integrins (39), which arewell-known galectin ligands (15, 55). Thus, binding of CvGalto hyalinocytes may lead to their phagocytic activation.

However, the most surprising observation in this study wasthat CvGal also binds to exogenous ligands, including a varietyof microorganisms and phytoplankton components, and prefer-entially, to Perkinsus spp. trophozoites, in a carbohydrate-spe-cific manner. Galectins bind to endogenous ligands and havebeen proposed to mediate developmental processes in variousanimal models including sponges and other invertebrates (15)and, more recently, to participate in regulation of adaptive im-mune mechanisms by modulating inflammation (10, 15), apo-ptosis (11, 12), and B cell development (13, 14). Only a fewexamples of recognition of exogenous ligands by galectins havebeen reported, namely the binding of mammalian galectins-3and -9 to polygalactose moieties of Leishmania major (56, 57),and the binding of galectin-3 to soluble and egg shell-associatedglycans of the parasite helminth Schistosoma mansoni display-ing GalNAc�1– 4GlcNAc (58). Our finding that CvGal is pro-duced by hemocytes and secreted to the surrounding plasma bythe activated, attached, and spread cells, and directly binds notonly to the oyster hemocytes but also to a wide variety of mi-crobes and phytoplankton components is intriguing in terms ofits binding to both endogenous and exogenous ligands. CvGalrecognized with various degrees of intensity most bacteria, al-gae, and Perkinsus spp. tested, suggesting a direct role in rec-ognition of potential microbial pathogens, as well as algal food.The secreted CvGal was also found strongly bound to the he-mocyte surface, suggesting that it may either function as a sol-uble opsonin for potential pathogens entering the oyster’s cir-culatory system, or as a hemocyte surface receptor for bothmicrobial pathogens, and algal food ingested into the digestiveducts of the alimentary canal. Furthermore, the observation thatexpression of CvGal in hemocytes is up-regulated by exposureto P. marinus trophozoites, suggests that the surface-associatedCvGal may also activate signaling pathways leading to the syn-thesis of additional CvGal. Although the experimental time

3095The Journal of Immunology

by guest on June 20, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

course is substantially different, our results are consistent withthose from Tanguy et al. (59) in which gene expression profilingin oysters revealed a 4.6-fold increase in galectin-like tran-scripts 10 days after challenge with Perkinsus spp.

The partial inhibition of phagocytosis of P. marinus tropho-zoites by pretreatment of hemocytes with anti-CvGal revealedthat the hemocyte surface-associated CvGal is a phagocytosisreceptor for P. marinus, albeit most likely not the only one.These results are noteworthy in the context of the oyster’s feed-ing and digestion mechanisms. Oysters filter-feed on planktonand other particles in suspension, which enter the gut and areeither extracellularly digested, or are phagocytosed by the nu-merous granulocytes that are present in the digestive ducts andare subject to intracellular killing and digestion (60). Duringthis process, hemocytes may migrate from the gut lumen intothe internal milieu (61). Oyster hemocytes can phagocytose bi-otic or abiotic particles, via nonspecific or specific mechanisms.In other invertebrate species, wettability, hydrophobicity, orcharge of the particle, have been proposed as surface propertiesthat determine nonspecific recognition leading to phagocytosisor encapsulation (62). However, a variety of pattern recogni-tion receptors including peptidoglycan recognition proteins(63– 65), � integrins (39), and lectins (66, 67) have been shownto mediate specific recognition leading to phagocytosis, Oystershave a very diversified lectin repertoire, which includes C- andF-type lectins, ficolins, and galectins, some of which are presenton the hemocyte surface (37, 38), but their potential roles asphagocytosis receptors have not been explored. The presentstudy shows that the four-CRD galectin CvGal is present on thecell surface of attached and spread hemocytes, most likelyalong other specific and nonspecific receptors. Nonetheless,CvGal is able to recognize at various degrees of avidity poten-tially pathogenic bacteria and phytoplankton (Fig. 9A). Like inthe mammalian collectins (45), the multiple CRDs in secretedCvGal may facilitate cooperative binding, agglutination, andimmobilization of microbial cells, and their cross-linking to thehemocyte cell surface, thereby enhancing phagocytosis, fol-lowed by intracellular killing and digestion of the infectiouschallenge or algal food. However, the highest binding of CvGalwas to P. marinus trophozoites, the parasite’s infective form. Atwo-CRD tandem-repeat galectin-like protein of the sandflyPhlebotomus papatasi mediates attachment of L. major procy-clic promastigotes to the midgut epithelium, a mechanism thatenables the parasite’s transition to the following life stage bypreventing it from being flushed away by the fluids ingestedduring further meals (68). In contrast, CvGal is unique not onlyin structure, but its role in the host-parasite interaction is dif-ferent from any galectin described so far, because it selectivelymediates phagocytosis of the parasite. If during filter-feeding afew P. marinus trophozoites are ingested in a pool of phyto-plankton, i.e., Isochrysis spp. and Tetraselmis spp., althoughmultiple receptors may participate specifically or nonspecifi-cally in the recognition and phagocytosis of most particles in-gested, the hemocyte surface CvGal can provide a selectiveadvantage for the preferential phagocytosis of the parasite rel-ative to the algal food by the gut hemocytes (Fig. 9, B and C).This would ensure the parasite’s access to the internal milieu,where it would proliferate, lyse the carrier hemocytes, and thereleased trophozoites ingested by other circulating or attachedhemocytes that would become activated upon recognition of theparasite surface and the binding of released CvGal (Fig. 9D).Thus, P. marinus may have evolved to adapt the trophozoite’sglycocalyx to be selectively recognized by the oyster hemocyteCvGal over algal food or bacterial pathogens, thereby subvert-

ing the oyster’s innate immune/feeding recognition mechanismto gain entry into the host cells. In contrast to their behaviortoward P. marinus, oyster hemocytes will not phagocytose Hap-losporidium spp., but rather quickly retract any filopodia thatbecome in contact with the parasite (69); it is noteworthy thatHaplosporidium spp. are oyster parasites that reside in the ex-tracellular space. The lack of effective treatments for Dermodisease stresses the need for a detailed understanding of thebasic biology of this parasite that may lead to novel interventionstrategies, and the identification of a specific hemocyte-associ-ated receptor may enable the accomplishment of such goal.

FIGURE 9. Schematic model of CvGal binding to P. marinus andCvGal function(s) in the oyster alimentary and circulatory systems. A,Schematic model of CvGal binding to P. marinus. B and C, Large numbersof hemocytes, particularly granulocytes, are present in the lumen of thedigestive ducts of the alimentary canal, where they phagocytose planktonfood particles and migrate to the hemocoele. Stronger recognition of Per-kinsus spp. trophozoites by the hemocyte CvGal provides a selective ad-vantage to the parasite over algal cells for uptake, and results in an efficienthost entry mechanism. D, Trophozoites survive intrahemocytic killingmechanisms and proliferate. Once carried into tissues and the circulatorysystem, the heavily burdened hemocytes lyse and trophozoites are released.Circulating uninfected hemocytes that initially lack CvGal at cell surface,become activated upon recognition of released trophozoites or by surfacebinding of CvGal released to the plasma by activated granular hemocytes.This process may contribute to infection of the surrounding uninfectedhemocytes, either by CvGal acting as an opsonin and/or cross-linking theparasite to hemocytes displaying CvGal at their surface, leading tophagocytosis.

3096 A NOVEL OYSTER GALECTIN AS A PHAGOCYTE RECEPTOR

by guest on June 20, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

AcknowledgmentsWe thank Drs. Martin F. Flajnik, Michael F. Criscitiello, and Ashley N.Haines for assistance on immunofluorescence microscopy. We thank Drs.Tsvetan R. Bachvaroff and Jun G. Inoue for useful discussions on thephylogenetic analysis, and Drs. Zeev Pancer and Hafiz Ahmed for usefulcomments on the manuscript.

DisclosuresThe authors have no financial conflict of interest.

References1. Bachere, E., Y. Gueguen, M. Gonzalez, J. de Lorgeril, J. Garnier, and

B. Romestand. 2004. Insights into the anti-microbial defense of marine inverte-brates: the penaeid shrimps and the oyster Crassostrea gigas. Immunol. Rev. 198:149–168.

2. Janeway, C. A., Jr., and R. Medzhitov. 2002. Innate immune recognition. Annu.Rev. Immunol. 20: 197–216.

3. Jutras, I., and M. Desjardins. 2005. Phagocytosis: at the crossroads of innate andadaptive immunity. Annu. Rev. Cell Dev. Biol. 21: 511–527.

4. Robinson, M. J., D. Sancho, E. C. Slack, S. LeibundGut-Landmann, andC. Reis e Sousa. 2006. Myeloid C-type lectins in innate immunity. Nat. Immunol.7: 1258–1265.

5. Vasta, G. R., H. Ahmed, and E. W. Odom. 2004. Structural and functional di-versity of lectin repertoires in invertebrates, protochordates and ectothermic ver-tebrates. Curr. Opin. Struct. Biol. 14: 617–630.

6. Brown, G. D. 2006. Dectin-1: a signalling non-TLR pattern-recognition receptor.Nat. Rev. Immunol. 6: 33–43.

7. Zhou, T., Y. Chen, L. Hao, and Y. Zhang. 2006. DC-SIGN and immunoregula-tion. Cell. Mol. Immunol. 3: 279–283.

8. Endo, Y., M. Takahashi, and T. Fujita. 2006. Lectin complement system andpattern recognition. Immunobiology 211: 283–293.

9. Bottazzi, B., C. Garlanda, G. Salvatori, P. Jeannin, A. Manfredi, andA. Mantovani. 2006. Pentraxins as a key component of innate immunity. Curr.Opin. Immunol. 18: 10–15.

10. Rabinovich, G. A., N. Rubinstein, and M. A. Toscano. 2002. Role of galectins ininflammatory and immunomodulatory processes. Biochim. Biophys. Acta 1572:274–284.

11. Hsu, D. K., R. Y. Yang, and F. T. Liu. 2006. Galectins in apoptosis. MethodsEnzymol. 417: 256–273.

12. Hernandez, J. D., and L. G. Baum. 2002. Ah, sweet mystery of death! Galectinsand control of cell fate. Glycobiology 12: 127R–136R.

13. Barrionuevo, P., M. Beigier-Bompadre, J. M. Ilarregui, M. A. Toscano,G. A. Bianco, M. A. Isturiz, and G. A. Rabinovich. 2007. A novel function forgalectin-1 at the crossroad of innate and adaptive immunity: galectin-1 regulatesmonocyte/macrophage physiology through a nonapoptotic ERK-dependent path-way. J. Immunol. 178: 436–445.

14. Gauthier, L., B. Rossi, F. Roux, E. Termine, and C. Schiff. 2002. Galectin-1 is astromal cell ligand of the pre-B cell receptor (BCR) implicated in synapse for-mation between pre-B and stromal cells and in pre-BCR triggering. Proc. Natl.Acad. Sci. USA 99: 13014–13019.

15. Leffler, H., S. Carlsson, M. Hedlund, Y. Qian, and F. Poirier. 2004. Introductionto galectins. Glycoconj. J. 19: 433–440.

16. Toscano, M. A., J. M. Ilarregui, G. A. Bianco, L. Campagna, D. O. Croci,M. Salatino, and G. A. Rabinovich. 2007. Dissecting the pathophysiologic role ofendogenous lectins: glycan-binding proteins with cytokine-like activity? CytokineGrowth Factor Rev. 18: 57–71.

17. Chen, H. Y., B. B. Sharma, L. Yu, R. Zuberi, I. C. Weng, Y. Kawakami,T. Kawakami, D. K. Hsu, and F. T. Liu. 2006. Role of galectin-3 in mast cellfunctions: galectin-3-deficient mast cells exhibit impaired mediator release anddefective JNK expression. J. Immunol. 177: 4991–4997.

18. Harvell, C. D., K. Kim, J. M. Burkholder, R. R. Colwell, P. R. Epstein,D. J. Grimes, E. E. Hofmann, E. K. Lipp, A. D. Osterhaus, R. M. Overstreet,J. W. Porter, G. W. Smith, and G. R. Vasta. 1999. Emerging marine diseases-climate links and anthropogenic factors. Science 285: 1505–1510.

19. Andrews, J. D. 1996. History of Perkinsus marinus, a pathogen of oysters inChesapeake Bay 1950–1984. J. Shellfish Res. 15: 13–16.

20. Chu, F.-L. E. 1996. Laboratory investigations of susceptibility, infectivity, andtransmission of Perkinsus marinus in oysters. J. Shellfish Res. 15: 57–66.

21. Bushek, D., S. E. Ford, and M. M. Chintala. 2002. Comparison of in vitro-cultured and wild-type Perkinsus marinus. III. Fecal elimination and its role intransmission. Dis. Aquat. Organ. 51: 217–225.

22. Schott, E. J., W. T. Pecher, F. Okafor, and G. R. Vasta. 2003. The protistanparasite Perkinsus marinus is resistant to selected reactive oxygen species. Exp.Parasitol. 105: 232–240.

23. Perkins, F. O. 1996. The structure of Perkinsus marinus (Mackin, Owen, andCollier, 1950) Levine, 1978 with comments on taxonomy and phylogeny of Per-kinsus spp. J. Shellfish Res. 15: 67–87.

24. Robledo, J. A., P. A. Nunes, M. L. Cancela, and G. R. Vasta. 2002. Developmentof an in vitro clonal culture and characterization of the rRNA gene cluster ofPerkinsus atlanticus, a protistan parasite of the clam Tapes decussatus.J. Eukaryot. Microbiol. 49: 414–422.

25. Coss, C. A., J. A. Robledo, G. M. Ruiz, and G. R. Vasta. 2001. Description ofPerkinsus andrewsi n. sp. isolated from the Baltic clam (Macoma balthica) by

characterization of the ribosomal RNA locus, and development of a species-specific PCR-based diagnostic assay. J. Eukaryot. Microbiol. 48: 52–61.

26. Liao, D. I., G. Kapadia, H. Ahmed, G. R. Vasta, and O. Herzberg. 1994. Structureof S-lectin, a developmentally regulated vertebrate �-galactoside-binding protein.Proc. Natl. Acad. Sci. USA 91: 1428–1432.

27. Ahmed, H., S. J. Du, N. O’Leary, and G. R. Vasta. 2004. Biochemical andmolecular characterization of galectins from zebrafish (Danio rerio): notochord-specific expression of a prototype galectin during early embryogenesis. Glyco-biology 14: 219–232.

28. Ahmed, H., M. A. Bianchet, L. M. Amzel, J. Hirabayashi, K. Kasai,Y. Giga-Hama, H. Tohda, and G. R. Vasta. 2002. Novel carbohydrate specificityof the 16-kDa galectin from Caenorhabditis elegans: binding to blood groupprecursor oligosaccharides (type 1, type 2, T�, and T�) and gangliosides. Gly-cobiology 12: 451–461.

29. Vasta, G. R., and J. J. Marchalonis. 1986. Galactosyl-binding lectins from thetunicate Didemnum candidum: carbohydrate specificity and characterization ofthe combining site. J. Biol. Chem. 261: 9182–9186.

30. Spiro, R. G., and V. D. Bhoyroo. 1974. Structure of the O-glycosidically linkedcarbohydrate units of fetuin. J. Biol. Chem. 249: 5704–5717.

31. Hynes, R. O., and K. M. Yamada. 1982. Fibronectins: multifunctional modularglycoproteins. J. Cell Biol. 95: 369–377.

32. Castellino, F. J., W. W. Fish, and K. G. Mann. 1970. Structural studies on bovinelactoferrin. J. Biol. Chem. 245: 4269–4275.

33. Engvall, E., T. Krusius, U. Wewer, and E. Ruoslahti. 1983. Laminin from rat yolksac tumor: isolation, partial characterization, and comparison with mouse lami-nin. Arch. Biochem. Biophys. 222: 649–656.

34. Spiro, R. G., and M. J. Spiro. 1965. The carbohydrate composition of the thy-roglobulins from several species. J. Biol. Chem. 240: 997–1001.

35. Jamieson, G. A. 1965. Studies on glycoproteins. II. Isolation of the carbohydratechains of human transferrin. J. Biol. Chem. 240: 2914–2920.

36. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of pro-teins from polyacrylamide gels to nitrocellulose sheets: procedure and some ap-plications. Proc. Natl. Acad. Sci. USA 76: 4350–4354.

37. Vasta, G. R., J. T. Sullivan, T. C. Cheng, J. J. Marchalonis, and G. W. Warr.1982. A cell membrane-associated lectin of the oyster hemocyte. J. Invert.Pathol. 40: 367–377.

38. Vasta, G. R., T. C. Cheng, and J. J. Marchalonis. 1984. A lectin on the hemocytemembrane of the oyster (Crassostrea virginica). Cell. Immunol. 88: 475–488.

39. Terahara, K., K. G. Takahashi, A. Nakamura, M. Osada, M. Yoda, T. Hiroi,M. Hirasawa, and K. Mori. 2006. Differences in integrin-dependent phagocytosisamong three hemocyte subpopulations of the Pacific oyster “Crassostrea gigas.”Dev. Comp. Immunol. 30: 667–683.

40. Gauthier, J. D., J. A. Jenkins, and J. F. La Peyre. 2004. Flow cytometric analysisof lectin binding to in vitro-cultured Perkinsus marinus surface carbohydrates.J. Parasitol. 90: 446–454.

41. Allam, B., K. A. Ashton-Alcox, and S. E. Ford. 2002. Flow cytometric compar-ison of haemocytes from three species of bivalve molluscs. Fish Shellfish Immu-nol. 13: 141–158.

42. Arata, Y., J. Hirabayashi, and K. Kasai. 1997. Structure of the 32-kDa galectingene of the nematode Caenorhabditis elegans. J. Biol. Chem. 272: 26669–26677.

43. Hirabayashi, J., and K. Kasai. 1993. The family of metazoan metal-independent�-galactoside-binding lectins: structure, function and molecular evolution. Gly-cobiology 3: 297–304.

44. Ng, K. K., K. Drickamer, and W. I. Weis. 1996. Structural analysis of monosac-charide recognition by rat liver mannose-binding protein. J. Biol. Chem. 271:663–674.

45. Holmskov, U., S. Thiel, and J. C. Jensenius. 2003. Collections and ficolins: hu-moral lectins of the innate immune defense. Annu. Rev. Immunol. 21: 547–578.

46. Odom, E. W., and G. R. Vasta. 2006. Characterization of a binary tandem domainF-type lectin from striped bass (Morone saxatilis). J. Biol. Chem. 281:1698–1713.

47. Yu, X. Q., Y. F. Zhu, C. Ma, J. A. Fabrick, and M. R. Kanost. 2002. Patternrecognition proteins in Manduca sexta plasma. Insect Biochem. Mol. Biol. 32:1287–1293.

48. Hadari, Y. R., K. Paz, R. Dekel, T. Mestrovic, D. Accili, and Y. Zick. 1995.Galectin-8: a new rat lectin, related to galectin-4. J. Biol. Chem. 270: 3447–3453.

49. Houzelstein, D., I. R. Goncalves, A. J. Fadden, S. S. Sidhu, D. N. Cooper,K. Drickamer, H. Leffler, and F. Poirier. 2004. Phylogenetic analysis of the ver-tebrate galectin family. Mol. Biol. Evol. 21: 1177–1187.

50. Lensch, M., M. Lohr, R. Russwurm, M. Vidal, H. Kaltner, S. Andre, andH. J. Gabius. 2006. Unique sequence and expression profiles of rat galectins-5and -9 as a result of species-specific gene divergence. Int. J. Biochem. Cell. Biol.38: 1741–1758.

51. Hughes, R. C. 1999. Secretion of the galectin family of mammalian carbohydrate-binding proteins. Biochim. Biophys. Acta 1473: 172–185.

52. Partridge, E. A., C. Le Roy, G. M. Di Guglielmo, J. Pawling, P. Cheung,M. Granovsky, I. R. Nabi, J. L. Wrana, and J. W. Dennis. 2004. Regulation ofcytokine receptors by Golgi N-glycan processing and endocytosis. Science 306:120–124.

53. Camby, I., M. Le Mercier, F. Lefranc, and R. Kiss. 2006. Galectin-1: a smallprotein with major functions. Glycobiology 16:137R–157R.

54. Ohtsubo, K., and J. D. Marth. 2006. Glycosylation in cellular mechanisms ofhealth and disease. Cell 126: 855–867.

55. Zick, Y., M. Eisenstein, R. A. Goren, Y. R. Hadari, Y. Levy, and D. Ronen. 2004.Role of galectin-8 as a modulator of cell adhesion and cell growth. Glycoconj. J.19: 517–526.

3097The Journal of Immunology

by guest on June 20, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

56. Pelletier, I., and S. Sato. 2002. Specific recognition and cleavage of galectin-3 byLeishmania major through species-specific polygalactose epitope. J. Biol. Chem.277: 17663–17670.

57. Pelletier, I., T. Hashidate, T. Urashima, N. Nishi, T. Nakamura, M. Futai,Y. Arata, K. Kasai, M. Hirashima, J. Hirabayashi, and S. Sato. 2003. Specificrecognition of Leishmania major poly-�-galactosyl epitopes by galectin-9: pos-sible implication of galectin-9 in interaction between L. major and host cells.J. Biol. Chem. 278: 22223–22230.

58. van den Berg, T. K., H. Honing, N. Franke, A. van Remoortere, W. E. Schiphorst,F. T. Liu, A. M. Deelder, R. D. Cummings, C. H. Hokke, and I. van Die. 2004.LacdiNAc-glycans constitute a parasite pattern for galectin-3-mediated immunerecognition. J. Immunol. 173: 1902–1907.

59. Tanguy, A., X. Guo, and S. E. Ford. 2004. Discovery of genes expressed inresponse to Perkinsus marinus challenge in Eastern (Crassostrea virginica) andPacific (C. gigas) oysters. Gene 338: 121–131.

60. Galstoff, P. S. 1964. The American oyster, Crassostrea virginica Gmelin. USFish Wildl. Serv. Fish Bull. 64.

61. Morton, B. S. 1971. The diurnal rhythm and tidal rhythm of feeding and digestionin Ostrea edulis. Biol. J. Linnean Soc. Lond. 3: 329–342.

62. Lackie, A. M. 1988. Immune mechanisms in insects. Parasitol. Today 4: 98–105.63. Jomori, T., and S. Natori. 1992. Function of the lipopolysaccharide-binding pro-

tein of Periplaneta americana as an opsonin. FEBS Lett. 296: 283–286.

64. Levashina, E. A., L. F. Moita, S. Blandin, G. Vriend, M. Lagueux, andF. C. Kafatos. 2001. Conserved role of a complement-like protein in phagocytosisrevealed by dsRNA knockout in cultured cells of the mosquito, Anopheles gam-biae. Cell 104: 709–718.

65. Ramet, M., P. Manfruelli, A. Pearson, B. Mathey-Prevot, and R. A. Ezekowitz.2002. Functional genomic analysis of phagocytosis and identification of a Dro-sophila receptor for E. coli. Nature 416: 644–648.

66. Yu, X. Q., and M. R. Kanost. 2000. Immulectin-2, a lipopolysaccharide-specificlectin from an insect. Manduca sexta, is induced in response to gram-negativebacteria. J. Biol. Chem. 275: 37373–37381.

67. Wang, X., T. A. Rocheleau, J. F. Fuchs, J. F. Hillyer, C. C. Chen, andB. M. Christensen. 2004. A novel lectin with a fibrinogen-like domain and itspotential involvement in the innate immune response of Armigeres subalbatusagainst bacteria. Insect Mol. Biol. 13: 273–282.

68. Kamhawi, S., M. Ramalho-Ortigao, V. M. Pham, S. Kumar, P. G. Lawyer,S. J. Turco, C. Barillas-Mury, D. L. Sacks, and J. G. Valenzuela. 2004. A role forinsect galectins in parasite survival. Cell 119: 329–341.

69. Ford, S. E., K. A. Ashtonalcox, and S. A. Kanaley. 1993. In vitro interactionsbetween bivalve hemocytes and the oyster pathogen Haplosporidium nelsoni(Msx). J. Parasitol. 79: 255–265.

3098 A NOVEL OYSTER GALECTIN AS A PHAGOCYTE RECEPTOR

by guest on June 20, 2018http://w

ww

.jimm

unol.org/D

ownloaded from