A disintegrin and metalloprotease 21 (ADAM21) is associated with neurogenesis and axonal growth in developing and adult rodent CNS

A Disintegrin and Metalloprotease 21(ADAM21) Is Associated with

Neurogenesis and Axonal Growth inDeveloping and Adult Rodent CNS

PENG YANG,1,2 K. ADAM BAKER,1,2,3AND THEO HAGG1,2,4*

1Kentucky Spinal Cord Injury Research Center, University of Louisville School ofMedicine, Louisville, Kentucky 40292

2Department of Neurological Surgery, University of Louisville School of Medicine,Louisville, Kentucky 40292

3Department of Anatomical Sciences and Neurobiology, University of Louisville School ofMedicine, Louisville, Kentucky 40292

4Department of Pharmacology and Toxicology, University of Louisville School of Medicine,Louisville, Kentucky 40292

ABSTRACTWe have reported that �6�1 integrin regulates the directed migration of neuroblasts from

the adult rodent subventricular zone (SVZ) through the rostral migratory stream (RMS). ADAM(a disintegrin and metalloprotease) proteins bind integrins. Here, we show that ADAM21, but notADAM2, -3, -9, -10, -12, -15, or -17, is expressed in adult rats and mice by ependyma and SVZ cellswith long basal processes, and in radial glia at early postnatal times. ADAM21-positive processesprojected into the RMS, contacted blood vessels, and were present within the RMS intermingledwith neuroblasts up to where neuroblasts start their radial migration and differentiation in theolfactory bulb. Tissue inhibitors of metalloproteases (TIMPs) 1, 2, and 3 are present in theependymal layer but not in the SVZ and RMS. Thus, ADAM21 could regulate neurogenesis andguide neuroblast migration through cleavage-dependent activation of proteins and integrinbinding. ADAM21 is also present in growing axonal tracts during postnatal development and ingrowing primary olfactory axons in adults. In the olfactory nerve layer, ADAM21 often, but notalways, colocalizes with OMP, a marker of mature olfactory neurons, but is not colocalized withthe immature marker �III-tubulin. This suggests that ADAM21 is involved in the final axonaloutgrowth phase and/or synapse formation. TIMP3 is present in periglomerular neurons, whereit could restrict ADAM21-mediated axonal growth to the glomeruli. ADAM21’s unique disinte-grin and metalloprotease sequences and its restricted expression suggest that it might be a goodtarget for influencing neurogenesis and neuronal plasticity. J. Comp. Neurol. 490:163–179, 2005.© 2005 Wiley-Liss, Inc.

Indexing terms: migration; neuroblast; olfactory; radial glia; regeneration; tanycyte; tissue

inhibitor of metalloproteases

Newly generated neuroblasts of the adult rodent sub-ventricular zone (SVZ) migrate tangentially in a cohesivemanner along the thin rostral migratory stream (RMS) tothe olfactory bulb, where they migrate radially to theirperiglomerular destination and differentiate into inter-neurons (Lois and Alvarez-Buylla, 1993; Luskin, 1993).The mechanisms that regulate this neurogenesis and mi-gration are beginning to be understood. Self-renewal andproliferation of these neural precursors are dependent onmolecules such as transforming growth factor �/epidermalgrowth factor (TGF�/EGF) receptor (Kuhn et al., 1997;Tropepe et al., 1997) and Notch-1 (Wang et al., 1998;Hitoshi et al., 2002; Chojnacki et al., 2003), which requireextracellular cleavage by metalloproteases for their acti-vation. The endogenous metalloproteases have not been

identified. Integrin receptors bind extracellular matrixmolecules and have critical roles in cell migration and

Grant sponsor: the Kentucky Spinal Cord and Head Injury Research Trust(training awards to P.Y., K.A.B.); Grant sponsor: National Institutes ofHealth; Grant number: RR15576; Grant sponsor: the Department of Neuro-logical Surgery; Grant sponsor: an endowment funded by a partnershipamong the University of Louisville, Bucks for Brains, Kentucky Spinal Cordand Head Injury Research, and Norton Healthcare (to T.H.).

*Correspondence to: Theo Hagg, Kentucky Spinal Cord Injury ResearchCenter, 511 S. Floyd Street, MDR Building Rm 616, Louisville, KY 40292.E-mail: [email protected]

Received 12 October 2004; Revised 9 February 2005; 26 April 2005DOI 10.1002/cne.20659Published online in Wiley InterScience (www.interscience.wiley.com).

THE JOURNAL OF COMPARATIVE NEUROLOGY 490:163–179 (2005)

© 2005 WILEY-LISS, INC.

axonal outgrowth (Reichardt and Tomaselli, 1991; Hynes,1992; Huber et al., 2003), including neural precursor mi-gration during development (Galileo et al., 1992). Specificintegrins are expressed by neural precursors and neuro-blasts of the adult rodent forebrain and play a role inprecursor proliferation in vitro (�5�1, �v�1, �v�5, �v�8integrins; Jacques et al., 1998) and directed migration ofneuroblasts during postnatal development (�v, (Muraseand Horwitz, 2002)) and adulthood (�6�1, (Emsley andHagg, 2003)). However, the endogenous ligands of theseintegrins are unknown.

ADAM (a disintegrim and metalloprotease) proteinshave an extracellular metalloprotease and a disintegrindomain (Wolfsberg et al., 1995; Primakoff and Myles,2000; White, 2003), which could be involved in cleavage-dependent activation of extracellular proteins and in in-tegrin binding, respectively, to orchestrate neurogenesisand neuroblast migration in the SVZ/RMS. Many of theADAMs, including ADAM21 (Hooft van Huijsduijnen,1998; Liu and Smith, 2000), are predominantly expressedin the testis to regulate spermatogenesis and sperm-eggfusion. Examples of ADAMs in the nervous system areADAM17 (tumor necrosis factor �-converting enzyme[TACE]), which can cleave tumor necrosis factor � (TNF�;Moss and Lambert, 2002) and TGF� (Sunnarborg et al.,2002), and ADAM10 (Kuzbanian), which can cleaveNotch1 and its ligands (Pan and Rubin, 1997; Qi et al.,1999). ADAM10 may also activate ephrins and slit (Schim-melpfeng et al., 2001; McFarlane, 2003), which affect mi-gration of the neuroblasts in the RMS (Conover et al.,2000; Wong et al., 2001). ADAM9, -10, and -17 are�-secretases involved in the non-amyloidogenic processingof amyloid precursor protein (APP; Asai et al., 2003)),which promotes proliferation of SVZ neural precursors(Caille et al., 2004) and mediates nerve growth factor(NGF)-induced neurite outgrowth of cultured PC12 cells(Milward et al., 1992).

Metalloproteases can be inhibited by tissue inhibitors ofmetalloproteases (TIMPs 1–4). TIMP3 is unique in that itinhibits not only matrix metalloproteases (MMPs) but alsoseveral ADAMs (Nagase and Brew, 2003; Lee et al., 2004).Metalloproteases and TIMPs are thought to play a dy-namic role in neuronal plasticity (Wright et al., 2002;Dzwonek et al., 2004); however, whether ADAMs andTIMPs play a role in adult forebrain neurogenesis is notknown. Not much is known about the integrin-bindingcapabilities of ADAMs in the nervous system. SeveralADAMs have an ECD motif (functionally equivalent to theclassical RGD) in the disintegrin loop, which can bind tovarious integrin subunits, including �6 (Bigler et al.,2000), and it is conceivable that they could be involved inthe �6�1 integrin-dependent and -directed neuroblast mi-gration in the adult forebrain (Emsley and Hagg, 2003).

Here, we investigated the presence of ADAM2, -3, -9,-10, -12, -15, -17, and -21 and their potential endogenousinhibitors, TIMPs 1–4, in the SVZ, RMS, and olfactorybulb of adult rats and mice. As ADAM21 was found in theconstantly regenerating olfactory nerve layer, we also doc-umented the presence of ADAM21 during postnatal ax-onal development, in addition to the SVZ.

MATERIALS AND METHODS

Animals and surgeries

Naive young adult male C57BL/6 mice (n � 3 for his-tology, n � 3 for olfactory nerve transection; n � 3 for

intraperitoneal bromodeoxyuridine [BrdU] injection; n �6 for Western blotting and mRNA measurements; 6–8weeks old, weight 20–30 g; Jackson Laboratory, Bar Har-bor, ME) and young adult female Sprague-Dawley rats(n � 5 for histology, n � 3 for Western blotting, n � 3 forintraperitoneal BrdU infusion; 2–3 months old, weight180–220 g; Harlan, Indianapolis, IN) were housed ingroups under a 12-hour light/dark cycle and with freeaccess to water and food. Rat pups were randomly selectedat postnatal day 1 (P1), P5, P10, P15, and P20 fromSprague-Dawley dams housed singly (n � 4 for each time-point). Striatal tissue from three additional P1 rats wasisolated for Western blotting and mRNA analysis. Allanimals were treated in accordance with the guidelines ofthe National Institutes of Health Guide for the Care andUse of Laboratory Animals and the University of Louis-ville Guidelines for the Care and Use of Laboratory Ani-mals.

For surgeries or euthanasia, mice were deeply anesthe-tized by an intraperitoneal injection of avertin (0.4 mg2,2,2-tribromoethanol in 0.2 ml of 1.25% [v/v] 2-methyl-2-butanol in saline, per gram body weight; Sigma-Aldrich,St. Louis, MO; Papaioannou and Fox, 1993). Adult ratswere anesthetized by intramuscular injection of a mixtureof 75 mg/kg ketamine, 3.6 mg/kg xylazine, and 0.75 mg/kgacepromazine in 0.9% saline. Pups were injected with 0.1ml of an anesthetic mixture consisting of 25 mg/ml ofketamine, 1.2 mg/ml of acepromazine maleate, and 0.25mg/ml of xylazine. They would receive subsequent injec-tions of 0.05 ml if not adequately anesthetized as assessedby gentle pinching of the hindpaws with forceps.

To confirm that ADAM21 in the olfactory nerve layerwas present in olfactory axons, a group of three micereceived a unilateral olfactory nerve transection (Pas-terkamp et al., 1998). Briefly, the lateral part of the rightolfactory bulb was exposed through a hole drilled in thedorsal skull, and a 30-gauge needle bent at a slight anglewas inserted into the space between the olfactory bulb andthe cribriform plate at the border between the bulb andcerebral cortex. The tip of the needle was carefully movedtoward the midline of the brain and then moved rostrallytoward the end of the bulb to transect the primary olfac-tory afferents that course through the cribriform plate.Bleeding was stopped by using Gelfoam, and the skin wassutured. These mice were euthanized after 7 days. Tolabel proliferating cells in the SVZ, a group of three micereceived daily intraperitoneal injections of 100 mg/kgBrdU (Sigma-Aldrich) for 7 days. To label every prolifer-ating cell, including slowly dividing ones, another group ofthree rats received a continuous infusion of 50 mg/kg/dayBrdU via an intraperitoneal Alzet pump (model 2ML2,Durect, Cupertino, CA) for 14 days.

Immunohistochemical procedures

Adult mice and rats were perfused transcardially with30 or 100 ml of ice-cold 0.1 M phosphate-buffered saline(PBS), pH 7.4, followed by 30 or 200 ml 4% paraformalde-hyde (PFA) in 0.1 M phosphate buffer (PB), respectively.The brains were postfixed in 4% PFA overnight and cryo-protected in 30% sucrose in 0.1 M PB overnight; then30-�m-thick coronal or parasagittal sections were cut on afreezing-stage microtome and stored in anatomical orderin 24-well plates filled with phosphate-based Millonig’sbuffer containing 0.06% sodium azide. Anesthetized ratpups were perfused transcardially with 20 ml of ice-cold0.1 M PBS followed by 20 ml of 4% PFA in 0.1 M PB. The

164 P. YANG ET AL.

brains were collected and postfixed in 4% PFA overnightand cryoprotected in 30% sucrose for 48 hours. Brains ofP1 and P5 pups were cut in half and placed in tissuefreezing medium (OCT Compound, Sakura Finetek USA,Torrance, CA) so that both coronal and parasagittal sec-tions would be produced. Blocks of tissue were stored at�80°C prior to cryostat sectioning. Twenty-micrometer-thick sections were cut, with every third section beingcollected on warm electrostatic slides. P10–20 brains werecut both coronally and parasagittally by using the freezingmicrotome.

Brain sections were immunostained by using primaryantibodies against ADAM2 (immunogen: a 13-amino-acidpeptide [SEEQFESESESKD] identical to the C-terminusof the protein, peptide affinity-purified rabbit IgG, cat. no.AB19030, Chemicon, Temecula, CA), ADAM3 (immuno-gen: recombinant murine cyritestin, purified mouse IgG,clone 7C1.2, MAB19291, Chemicon), ADAM9 (immuno-gen: GST-ADAM9 disintegrin domain fusion protein, pep-tide affinity-purified rabbit IgG, AB19024, Chemicon),ADAM10 (immunogen: a 13-amino-acid peptide [QRPE-SYQMGHMRR] identical to the C-terminus of the protein,peptide affinity-purified rabbit IgG, AB19031, Chemicon),ADAM12 (immunogen: a 13-amino-acid peptide [HQV-VPRPSHNAYIK] identical to the C-terminus of the pro-tein, rabbit serum, AB19032, Chemicon), ADAM15 (im-munogen: a 13-amino-acid peptide [RPAPPPPAASSLYL]identical to the C-terminus of the protein, peptide affinity-purified rabbit IgG, AB19035, Chemicon), ADAM17 (im-munogen: a 13-amino-acid peptide identical to theC-terminus of the protein [QRQSRVDSKETEC], rabbitserum, AB19037, Chemicon), and ADAM21 (immunogen:a 13-amino-acid peptide [PSGPKETKASSPG]; identical tothe C-terminus of the protein, peptide affinity-purifiedrabbit IgG, AB19001, Chemicon), all at 100-, 300-, 1,000-,3,000-, and 10,000-fold dilutions.

Other primary antibodies were against �6�1 integrin(immunogen: rat esophageal carcinoma cell line B2T,mouse ascites fluid, IgG1, 1:3,000, MAB1410, Chemicon[Jamasbi et al., 1992]), vimentin (immunogen: vimentinpurified from bovine lens, protein-A-purified mouseIgG2a, clone 3B4, 1:1,000, CBL202, Chemicon [Bohn etal., 1992]), glial fibrillary acidic protein (GFAP; immuno-gen: purified glial filament, chromatographic column-purified mouse IgG1, clone G-A-5, 1:1,000, MAB3402,Chemicon [Debus et al., 1983]), NeuN (immunogen; puri-fied cell nuclei from mouse brain, purified mouse IgG1,1:1,000, MAB377, Chemicon [Mullen et al., 1992]), neuro-nal class III �tubulin (protein-A-purified mouse IgG2a,clone Tuj1, 1:3,000, MMS-435P, Babco, Richmond, CA[Lee et al., 1990]), olfactory marker protein (OMP; goatIgG, 1:500, a gift from Dr. F. Margolis, University ofMaryland, Baltimore, MD [Keller and Margolis, 1975;Baker et al., 1989]), p75 neurotrophin receptor (192-IgG,mouse IgG1, 1:100, a gift from Dr. Eugene Johnson, Jr.,Washington University, St. Louis, MO [Chandler et al.,1984]), rat endothelial cell antigen-1 (RECA-1, immuno-gen: stromal cells from rat lymph node, tissue culturesupernatant, mouse IgG1, HIS52, 1:100, MCA970, Sero-tec, Raleigh, NC [Duijvestijn et al., 1992]), TIMP1 (ascitesfluid purified by protein-G chromatography, mouse IgG1,102D1, 1:100, MAB13429, Chemicon [Hurskainen et al.,1996]), TIMP2 (purified mouse IgG1/k, 67-4H11, 1:500,MAB3310, Chemicon [Fujimoto et al., 1993, 1995]),TIMP3 (purified mouse IgG1/k, 136-13H4, 1:500,MAB3318, Chemicon [Fariss et al., 1997]), and TIMP4

(peptide affinity-purified rabbit IgG, 1:300, AB816,Chemicon). As a positive control for ADAM21, sectionsthrough the testis were also processed for immunostain-ing. As a routine negative control, immunostaining omit-ting the primary antibody was performed.

For 3,3�-diaminobenzidine (DAB)-based staining, tissuesections were sequentially incubated for 1 hour with 10%normal serum (species corresponding to the species inwhich the secondary antibody was produced and in Tris-buffered saline [TBS, pH 7.4] containing zero or 0.25%Triton X-100) to block nonspecific binding, primary anti-bodies for 20 hours at 4°C (diluted in TBS containing 5%serum and zero or 0.25% Triton X-100), and biotinylatedhorse anti-mouse IgG, rabbit anti-goat IgG, goat anti-rabbit IgG, goat anti-mouse IgM (1:500 in TBS containing5% serum; Vector, Burlingame, CA) for 2 hours, followedby avidin-biotin complex conjugated with peroxidase for 2hours (1:600; Vector). Peroxidase activity was visualizedby the addition of 0.04% DAB (Sigma-Aldrich) and inten-sified with 0.06% nickel ammonium sulfate and 1% hydro-gen peroxide in 0.05 M TBH. After development in DAB,the sections were rinsed in 0.1 M PB, mounted on gelatin-coated slides, dried, dehydrated in a series of ethanoldilutions, and coverslipped in Entellan (Electron Micros-copy Sciences, Gibbstown, NJ). Between incubations, sec-tions were washed in TBS. Sections from early P1–P20tissues were first treated for half an hour with 10% meth-anol and 3% hydrogen peroxide in TBS to quench endog-enous peroxides. For double immunofluorescence staining,tissue sections were incubated with two primary antibod-ies made in different species, followed by a 1.5-hour incu-bation in secondary antibodies conjugated with AlexaFluor 546 or Alexa Fluor 488 (1:500; Molecular Probes,Eugene, OR). After rinsing with PB, the sections weremounted on uncoated slides and coverslipped with theProLong anti-fade kit (Molecular Probes).

BrdU immunohistochemistry was performed accordingto a reported protocol (Kuhn et al., 1996). Briefly, floatingtissue sections were incubated in 50% formamide in 2�standard saline citrate (SSC) at 65°C for 2 hours, rinsed infresh 2� SSC for 5 minutes, and incubated in 2 N HCl at37°C for 30 minutes. Sections were then neutralized in 0.1M boric acid, pH 8.5, for 10 minutes and washed in PBS,followed by the immunostaining procedures describedabove, using primary antibodies against BrdU (immuno-gen: bromodeoxyuridine, mouse IgG, clone BU-1, 1:30,000,MAB3510, Chemicon).

To document light microcopic results, digital images of1,600 � 1,200 pixels were taken by using a Leica DMIRE2microscope equipped with a SPOT RT-KE Slider digitalcamera and the associated software SPOT for Window,version 4.08 (Diagnostic Instruments, Sterling Heights,MI). For confocal microscopy, 1,024 � 975-pixel imageswere obtained on an Olympus laser scanning confocalmicroscope system FV500 (Olympus America, Melville,NY). Adobe Photoshop 6.0 (Adobe Systems, San Jose, CA)was used to make the final composite images.

Western blotting

To confirm that the ADAM21 antibody was specific,adult rats and mice were transcardially perfused withice-cold PBS, and their brains as well as P1 rat striatumwere homogenized in PBS on ice. After centrifugation,pellets were lysed in the lysis buffer containing 50 mMTris-HCl, pH 7.4, 1% Nonidet P-40, 0.25% sodium deoxy-cholate, 150 mM NaCl, 1 mM EDTA, 1 mM phenylmeth-

165ADAM21 IN PLASTIC CNS REGIONS

ylsulfonyl fluoride (PMSF), 1 �g/ml aprotinin, leupeptin,pepstatin, 1 mM Na3VO4, and 1 mM NaF (Sigma-Aldrich)on ice for 30 minutes; they were then centrifuged at12,000g for 10 minutes. Protein concentrations of clearedsupernatants were measured with a protein assay kitaccording to the manufacturer’s instruction (P5656,Sigma-Aldrich). Individual lysates were aliquoted andstored at �80°C until further use. Proteins were electro-phoretically separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in 10%polyacrylamide gels and transferred to 0.2-�m PVDFmembrane (Bio-Rad, Hercules, CA). The membranes wereblocked with 5% reconstituted dry milk and incubatedwith primary and secondary antibodies, which were thenvisualized with an ECL Plus chemiluminescence detectionkit (Amersham Biosciences, Piscataway, NJ). TheC-terminal ADAM21 peptide (PSGPKETKASSPG, NCBIaccession number: NP_065063) used to produce the anti-body has five contiguous amino acids homologous to thatof the 90-kDa mouse nuclear protein XRCC1 (KETKA,NCBI accession number: Q60596), potentially producing ashared epitope. To rule out the possibility of cross-reactivity, nuclear-free lysates were prepared from P1 andadult striatum and probed with the anti-ADAM21 anti-body. The nuclear-free protein isolation solution contained30 mM HEPES, pH 8, 1.5 mM MgCl2, 450 mM KCl, 0.3mM EDTA, 10% glycerol, 1 mM dithiothreitol (DTT), 5�g/ml leupeptin, 5 �g/ml aprotinin, 2 mM benzamidine,and 1 mM PMSF.

ADAM21 mRNA measurements

After transcardial flushing with cold PBS, whole P1 ratstriatum or subdissected adult mouse striatum containingthe anterior SVZ was processed to isolate total RNA byusing a commercial isolation kit (Qiagen, Valencia, CA).The RNA was used as templates in reverse transcription,which included 4.5 �l Rnase free water, 1.0 �l 10� reversetranscriptase (RT) buffer, 1.0 �l of 100 ng/�l random prim-ers, 2.0 �l of 20 mM dNTP mix, 1.0 �l total RNA (1.0 �g),and 0.5 �l of 20 U/�l StrataScript reverse transcriptase(Stratagene, La Jolla, CA). As a negative control, waterwas used instead of reverse transcriptase. The reactionmixture was incubated first at 25°C for 10 minutes andthen at 45°C for 30 minutes. The reverse transcriptasewas inactivated at 95°C for 3 minutes. Primers were de-signed by using Beacon Designer 2 software (PremierBiosoft, Palo Alto, CA), taking into account the predictedtertiary RNA structure and yielding an 88-bp ampliconcorresponding to a specific sequence in mouse ADAM21.The first-strand cDNA was amplified by polymerase chainreaction (PCR) containing 1.0 �l of 2 �M sense primerAGATGGATATGTACAGGATGGGGT, 1.0 �l of 2 �Manti-sense primer CCTGCACTGTTGGTCATGGTTA, 1.0�l of 10� PCR buffer, 1.0 �l of 50 mM magnesium chlo-ride, 2.0 �l of 20 mM dNTP mix, 0.1 �l of 5 U/�l SureStartTaq RNA polymerase, 2.9 �l water, and 1.0 �l cDNA fromthe RT reaction. PCR of 35 cycles was carried out bydenaturing at 95°C for 30 seconds, annealing at 55°C for30 seconds, and extension at 72°C for 30 seconds. The finalPCR products were verified in a 2% agarose gel containingethidium bromide and photographed.

For real-time quantitative PCR, total RNA was reversetranscribed, and cDNA was amplified for up to 35 cycles byusing the ADAM21 primer pair. 18S RNA was used as aninternal standard to normalize the ADAM21 values andwas amplified with a specific primer set yielding 101 bp.

TaqMan probes labeled with FAM/BHQ (Biosearch Tech-nologies, Novato, CA) were designed specifically for theexpected amplicons (ADAM21: 5-TTCACCGCCGGGACC-TCTGTAGCC-3). After digestion of the hybridized probe,the fluorescent FAM is freed from the BHQ quencher toprovide signal in each cycle, thus providing additionalevidence for the fidelity of the RT-PCR reaction. The cor-rect amplicon size was confirmed after the last cycle.

RESULTS

The locations of the photomicrographs presented beloware indicated schematically in Figure 1.

ADAM21 is uniquely expressed amongvarious ADAMs in adult rodent SVZ

We set out to identify ADAMs present in the neurogenicregion of the SVZ. In sections through the forebrain ofadult rats (Fig. 2) and mice (not shown), only immuno-staining for ADAM21 was found in the SVZ compartment.Omitting the primary antibody yielded no staining.ADAM21 was robustly expressed in cells and processesthrough the entire ependymal and subependymal layers ofthe SVZ (Fig. 2H), in a pattern that overlapped withBrdU-labeled neural precursors in the SVZ and RMS (Fig.2I). The other ADAMs were not present in cells or struc-tures in the SVZ (Fig. 2B–G), although they were seen inother cells in other regions. ADAM2 staining was seenonly in ependymal cells (Fig. 2A). ADAM3 staining waspresent in astrocytes in the ventral hypothalamus sur-rounding the third ventricle (not shown). ADAM9 stainingwas intense in most striatal neurons (Fig. 2C). ADAM10and -12 were localized in some neurons in the hypothala-mus and brainstem, and ADAM15 staining was present inmany large neurons throughout the cerebral cortex, thestriatum, and the septum (not shown). ADAM17 stainingwas most clearly seen in some structures dorsal to thethird ventricle (not shown).

Fig. 1. Schematic drawings of (A) parasagittal brain sections, (B)coronal forebrain sections, and (C) coronal olfactory bulb sections toindicate the relative positions of the images illustrated in Figures 2and 4–10. OB, olfactory bulb; CC, corpus callosum; CX, cerebralcortex; G, glomerulus layer; M, mitral cell layer; NS, neostriatum;ON, olfactory nerve. Modified from Paxinos and Watson (1986).

166 P. YANG ET AL.

ADAM21 mRNA and protein are present inthe SVZ

Western blots of protein extracts prepared from adultrat striatal tissues containing the SVZ revealed a singleADAM21-immunoreactive band at approximately 62 kDa,the expected size of mature ADAM21 (Fig. 3, lane 2). Theband was much more prominent in P1 rat striatal tissueextracts (Fig. 3, lane 1), consistent with the finding that

ADAM21 immunostaining was more widely present inbrain sections of P1 animals (see below). Nuclear-freeprotein extracts also showed an ADAM21-positive band atthe correct molecular weight (Fig. 3, lanes 3 and 4). Thetissue isolated from subdissected SVZ tissue of adult miceand rats contained ADAM21 mRNA as detected by RT-PCR (Fig. 3, lanes 5 and 6) and real-time quantitativePCR (not shown). These results indicate that the ADAM21

Fig. 2. ADAM21 is uniquely present in the neurogenic SVZ ofadult rats. Coronal sections through the SVZ were immunostained forADAM2 (A), ADAM3 (B), ADAM9 (C), ADAM10 (D), ADAM12 (E),ADAM15 (F), ADAM17 (G), and ADAM21 (H). ADAM2 is present inthe ependyma (“E”), but only ADAM21 is present in the SVZ, where

proliferated neural precursors were labeled by i.p. injections of BrdU(I). Staining for other ADAMs was seen in other regions of the brain(C,F, or not shown). All images are taken in phase contrast. BV, bloodvessels; LV, lateral ventricle; NS, neostriatum; RMS, rostral migra-tory stream. Scale bar � 50 �m in I (applies to A–I).


immunostaining in sections represents only genuineADAM21 protein and that the mRNA for ADAM21 istranscribed in the SVZ.

ADAM21-positive processes areinterspersed with neural precursors in adult

SVZ/RMS

ADAM21 was present in cells and structures of theadult mouse and rat ependymal and subependymal layersof the SVZ. Vimentin, also expressed by ependyma andtanycytes (Chauvet et al., 1998), and ADAM21 were al-most completely colocalized (Fig. 4A). Only a fewvimentin-positive processes did not stain for ADAM21(Fig. 4B). In the dorsolateral triangular area of the SVZ,where neuroblasts enter the RMS, most ADAM21-positiveprocesses were projecting into the RMS (Fig. 4A–D).ADAM21 was not present in the GFAP-positive cells orprocesses in the SVZ and surrounding area (Fig. 4C) or in�III-tubulin-positive neuroblasts (Fig. 4D) or NeuN-positive neurons (not shown).

The ADAM21-positive subependymal cells often hadlong thin processes emanating from their cell bodies, typ-ical of radial glia-like cells or astrocytes in this region, orof hypothalamic tanycytes (which also stained forADAM21; not shown). Tanycytes are specialized ependy-mal cells that contact the cerebrospinal fluid and have aprocess that extends within the central nervous system(CNS) parenchyma, touching or wrapping around bloodvessels or terminating on various cell types, includingneurons and pia (Bruni, 1998). Some of the ADAM21-positive processes could be followed from the SVZ to bloodvessels (Fig. 4A, arrows). Many of the ADAM21-positiveprocesses in the RMS terminated close to RECA-positive

blood vessels (Fig. 5A). The processes sometimes projectedinto the neighboring striatum, where they also contactedblood vessel walls. In parasagittal sections through theforebrain, longitudinal blood vessels could be seen cours-ing along the RMS in close proximity to the ADAM21-positive processes (Fig. 5B). The ADAM21-positive pro-cesses in the RMS were surrounded by GFAP-positiveastrocytes and were contained within the RMS (Fig. 5C).ADAM21-positive processes in the RMS terminated in thecaudal end of the olfactory bulb (Fig. 5D). In the RMS, theADAM21-positive processes were intermingled intimatelywith migrating neuroblasts and their processes, as recog-nized by �III-tubulin (Fig. 5E) or BrdU immunostaining(Fig. 5F). We had set out to find potential ADAM partnersof �6�1 integrin. In the SVZ/RMS, ADAM21 was seen inclose association with �6�1 integrin-positive neuroblasts(Fig. 5G), implying that the extracellular disintegrin do-main of ADAM21 present in the process-bearing SVZ cellscould bind �6�1 integrin on neuroblasts.

Ependymal cells have been suggested to give rise toneural precursors in the SVZ (Johansson et al., 1999), andit was possible that the process-bearing ADAM21-positiveSVZ cells also do. In rodents that had received continuousintraperitoneal infusions of 50 mg/kg/day BrdU for 14days, none of the ADAM21-positive cells were stained forBrdU (Fig. 5H). Many subependymal cells were BrdUpositive, but ependymal cell labeling was very rare (insome animals a single cell per three sections) (Fig. 5I).

To exclude the possibility that ADAM21-positive pro-cesses in the RMS were axons (as we found ADAM21 inaxons elsewhere; see below) double labeling for neurofila-ment was performed. Most neurofilament-positive axons(Fig. 5J,J��) were located outside the ADAM21-positiveprocesses in the RMS (Fig. 5J�,J��). No colocalization ofneurofilament and ADAM21 was noted (Fig. 5J��).

TIMP3 borders the regions of neurogenesis,migration, and terminal differentiation

To determine whether potential endogenous inhibitorsof ADAM21 exist in the SVZ/RMS, we tested antibodiesagainst the four known TIMPs. TIMP1 (Fig. 6A), -2 (Fig.6B), and -3 (Fig. 6C) were clearly present in ependymalcells of the first layer of the ventricular wall but not in theSVZ or RMS compartments. In the olfactory bulb, TIMP3was present in mitral cells and periglomerular neurons(Fig. 6D; Jaworski and Fager, 2000), the final destinationof the migrating neuroblasts, but was not closely associ-ated with ADAM21 processes in the RMS. TIMP4 stainingwas not present in either the ependyma or SVZ/RMS,although it was found elsewhere in the CNS. Neurons inregions neighboring the SVZ/RMS, including the striatum(Fig. 6C), septum (Fig. 6E), and cerebral cortex (Fig. 6F),all had TIMP3 immunostaining.

ADAM21 is present in growing primaryolfactory axons and is bordered by TIMP3

During analysis of the RMS, we observed very intenseADAM21 staining in fibers of the adult olfactory nervelayer and the accessory olfactory nerve layer (Fig. 7A).These tracts contain the growing axons from new neuronsin the olfactory mucosa, which are constantly produced(Graziadei and Graziadei, 1979a,b; Mackay-Sim and Kit-tel, 1991). ADAM21 immunostaining in glomeruli was lessrobust than in the nerve layer, with only a few fibers perglomerulus containing ADAM21 (Fig. 7B,C). Many but notall of the ADAM21-immunoreactive fibers were positive

Fig. 3. ADAM21 protein and mRNA are present in the SVZ. Lanes1 and 2, Western blots probed with the ADAM21 antibody reveal asingle �62-kD band corresponding to the mature form of ADAM21 inwhole cell lysates prepared from P1 (lane 1) or adult (lane 2) ratstriatal tissues. Lanes 3 and 4, ADAM21 immunoblots of nuclear-freelysates from P1 (lane 3) and adult (lane 4) rat striatal tissues show thesame band, excluding potential cross-reactivity with the nuclear pro-tein XRCC1. Lanes 5 and 6, RT-PCR of subdissected adult mouse SVZtissue using an ADAM21-specific primer set produced the expected88-bp amplicon (lane 5), evidence that ADAM21 mRNA is present.The negative control RT-PCR without reverse transcriptase yieldedno amplicon (lane 6).

168 P. YANG ET AL.

Fig. 4. ADAM21 is present in adult rat vimentin-positiveependyma and SVZ cells. A: ADAM21 colocalizes almost completelywith vimentin, which is normally expressed by cells of the radial glialcell lineage such as ependymal cells and tanycytes. Note the longbasal processes that project into the RMS and to blood vessels (ar-rows). Inset is a confocal image showing the colocalization of ADAM21and vimentin in ependymal and subependymal cell bodies and pro-cesses. B: Confocal image of the RMS close to the SVZ showing clear

colocalization of vimentin and ADAM21 in processes. C: Confocalimages showing that none of the ADAM21-positive processes arepositive for glial fibrillary acidic protein (GFAP; compare structuresat arrowheads). D: A confocal image shows processes intermixed with�III-tubulin-positive immature neuroblasts. BV, blood vessel; E,ependymal layer; LV, lateral ventricle; RMS, rostral migratorystream. Scale bar � 40 �m in D; 100 �m for A; 20 �m for inset A; 25�m for B,C.

Figure 5

170 P. YANG ET AL.

for OMP (Fig. 7D), a marker of mature olfactory axons(Kream and Margolis, 1984). Conversely, many OMP-positive fibers were not positive for ADAM21. ADAM21-positive fibers did not have staining for �III-tubulin, amarker for immature neurons and axons (Fig. 7E), whichwas present in some fibers in the nerve layer and theglomeruli. In the olfactory epithelium (mucosa), many ofthe olfactory neuronal cell bodies and their axons hadADAM21 immunostaining (Fig. 7F). The staining in theaxons was much more intense than that of the cell bodies.Most of the ADAM21-positive cell bodies were not cola-beled for OMP (Fig. 7G), similar to the finding of axonalstaining in the olfactory bulb (Fig. 7A–D). The morphologyof the OMP-positive and ADAM21-positive cell bodies wassimilar. ADAM21 staining was not present in olfactoryensheathing cells identified by p75 neurotrophin receptor,nor was it present in cells stained for GFAP or vimentin(not shown). A unilateral transection of the olfactory nervebetween the cribriform plate, through which the olfactoryaxons project, and the basal side of the bulb resulted in thecomplete disappearance of ADAM21-positive and OMP-positive fibers in the olfactory nerve layer (Fig. 8). Thesedata show that ADAM21 is present in a subset of olfactoryaxons. These data also suggest that there are four types ofolfactory axons, possibly representing different stages ofoutgrowth, i.e., �III-tubulin/ADAM21�, �III-tubulin�/ADAM21, OMP/ADAM21, and OMP/ADAM21�.

In the olfactory bulb, immunostaining for ADAM21 andTIMP3 were in non-overlapping but adjacent locations(Fig. 6G). The TIMP3-expressing processes appeared tooriginate from mitral cells and periglomerular interneu-rons and extended toward and surrounded the glomeruliand nerve layer.

Postnatal developmental expression ofADAM21

Formation of new cells from the SVZ is more prominentduring early postnatal times when cells migrate through-

out the brain parenchyma, not just within the RMS (Ka-kita and Goldman, 1999). Therefore, we investigatedwhether ADAM21 could also play a role in such wide-spread migration in developing rats. Several neuronalsystems have growing axons during this time period, and

Fig. 5. ADAM21-positive processes project to blood vessels and arepresent along the adult RMS. A: A confocal image shows ADAM21-positive processes ending close to RECA-positive endothelial cells inblood vessels (arrows � example). The space between the endothelialcells and ADAM21-positive structures is the blood vessel wall.B: ADAM21-positive processes are prominent in and confined to theRMS, which also contains many longitudinally oriented blood vessels(stained for RECA; rat parasagittal section). C,D: ADAM21-positiveprocesses in the RMS are surrounded (C) by a glial fibrillary acidicprotein (GFAP)-positive astrocyte scaffold (rat coronal section) andstop (D) at the boundary between the forebrain and the olfactory bulb(OB, rat parasagittal section). E: A confocal image shows thatADAM21-positive processes in the RMS are intimately intermingledwith �III-tubulin-positive migrating neuroblasts (rat parasagittalsections). F: Double staining showing ADAM21-positive processes inthe rostral RMS closely associated with BrdU-positive migrating neu-roblasts (rat parasagittal section). G: ADAM21-expressing cells andprocesses and �6�1 integrin-positive neuroblasts are close together inthe SVZ (rat coronal section). H: After a chronic 14-day intraperito-neal infusion with BrdU, many precursors in the SVZ are positive forBrdU, but none co-label for ADAM21 (confocal image). I: An occa-sional ependymal cell contains BrdU (arrowhead). J–J��: Confocalimages of a cross-section through the rostral RMS show thatADAM21-positive processes (J� and J��) do not colocalize withneurofilament-positive axons, which are located outside the RMS (Jand J��). BV, blood vessel; CC, corpus callosum; CX, cerebral cortex; E,ependymal cell layer; LV, lateral ventricle; NS, neostriatum; RMS,rostral migratory stream. Scale bar in J � 50 �m in J�� (applies toC,F,G,I,J); 20 �m for A; 100 �m for B,D,E,H; 35 �m for I.

Fig. 6. TIMP3 is present around but not in the adult rat SVZ andRMS. TIMP1 (A), 2 (B), and 3 (C), but not 4 (not shown) are presentin ependyma (“E”). D: In the olfactory bulb, TIMP3 is not present closeto the RMS but is seen in mitral cells (MC) and periglomerular (PG)interneurons as well as their processes around the glomeruli (“G”).TIMP3 is also present in the septum (E) and cerebral cortex (F).G: Double immunostaining shows that ADAM21-expressing fibers inthe glomeruli are surrounded by TIMP3-positive periglomerular in-terneurons and their processes (rat coronal section). BV, blood vessel;LV; lateral ventricle; NS, neostriatum. Scale bar � 50 �m in G(applies to A–G).


Fig. 7. ADAM21 is present in growing adult olfactory receptoraxons. A: ADAM21 immunostaining is robustly present in the nervelayer (NL) of the accessory olfactory (AOB) and olfactory bulb (OB;section colabeled for NeuN). B: A section colabeled for OMP, a markerfor mature olfactory axons, shows overlap (yellow) with ADAM21most prominently in the nerve layer. C: ADAM21 staining is muchmore robust in the nerve layer than in the glomeruli (“G”; sectioncostained from OMP). D: Confocal image showing that someADAM21-positive fibers colocalize with OMP (arrowheads), many do

not (asterisks), and many OMP-positive fibers do not containADAM21 (arrows). E: ADAM21 does not colocalize with �III-tubulin(confocal image; arrowheads) or vice versa (arrows). F: The cell bodies(asterisk) and axon bundles (arrow) of olfactory receptor neurons inthe olfactory mucosa are positive for ADAM21. G: ADAM21-positivecell bodies of olfactory receptor neurons were not labeled for OMP(confocal images). MUC, epithelial side of the olfactory mucosa. Scalebar � 15 �m in G; 500 �m for A,B; 100 �m for C; 6 �m for D; 10 �mfor E; 150 �m for F.

172 P. YANG ET AL.

we determined whether, similar to the growing olfactoryaxons, they would also contain ADAM21.

As was observed in the adult brain, intense ADAM21immunoreactivity was seen along the lateral ventriclesand RMS, within the olfactory nerve layer and glomeruliat each developmental age. At P1, ADAM21-positivecuboid ependyma (one to two cell layers thick) were seenprimarily along the ventrocaudal wall of the lateral ven-tricles. Occasionally, large round cell bodies could be seenabout three cell layers from the ventricular wall, withtheir basal processes projecting to the ventricular surfaceand end-feet contacts (Fig. 9A). Many ADAM21-positivefibrous processes were seen throughout the brain project-ing from the ventricular wall (Fig. 9A,D). Processes fromthe SVZ projected into the RMS, where they formed adense mesh-like pattern, with many perpendicularly ori-ented processes extending for short distances along theRMS and into the olfactory bulb, where they appeared tostop (Fig. 9G). Many processes projected from the dorso-lateral ventricular wall through the corpus callosum intothe overlying cerebral cortex with end-feet-like connec-tions to the pia, typical of radial glia (Fig. 9A,D; Gates etal., 1995).

Beginning at P15, fewer ADAM21-positive processeswere seen projecting from the ventricular wall and withinthe parenchyma (Fig. 9C,F). The number of processeswithin the RMS was also decreased, and they radiatedpredominantly in a tangential direction along the RMS(Fig. 9I), similar to adults. The processes projecting dor-sally through the cerebral cortex had largely disappearedby P15, corresponding to the expected maturation of ra-dial glia before this time (Pixley and de Vellis, 1984;Tramontin et al., 2003). More ADAM21-positive processeswere associated with blood vessels at these later times(Fig. 9, compare J and K with L).

ADAM21 immunostaining was observed in several fibertracts during early neonatal development. At all ages,from P1 to adulthood, ADAM21 staining was intense infibers of the olfactory nerve layer and stopped in theglomeruli (Fig. 10A), where many more ADAM21-positivefibers could be seen than in adults (cf. Fig. 7). At P1,ADAM21 staining was robust in the corpus callosum (Fig.10B), the anterior commissure (Fig. 10C), the fimbria andfornix (Fig. 10D), and the white matter fascicles thatcourse through the neostriatum and that contain cortico-spinal axons (Fig. 9J). Less intense staining was evidentwithin the optic tract and cerebral peduncle; the latteralso contained corticospinal axons (Fig. 10E). Axonswithin these fiber tracts are unmyelinated at this postna-tal developmental age and are densely packed, making theidentification of individual fibers difficult. Individual de-fasciculated fibers could occasionally be seen as they sep-arated from the tracts (Fig. 10B,D). At P5, ADAM21 stain-ing was absent from the corpus callosum and neostriatumand very light within the optic tract (not shown). ADAM21staining was present in the anterior commissure, fimbria,and fornix, at both P5 and P10, but not later (not shown).

Another neurogenic region in adult mammals is the den-tate gyrus of the hippocampal formation. Cells and processesof the subgranular layer and dentate gyrus were devoid ofADAM21 immunoreactivity at each developmental age.ADAM21 was present in neurons and small axonal processesin the CA1, CA2, and CA3 regions of the hippocampal for-mation from P1 (Fig. 10F) up to P15; however, by P20 noADAM21-immunoreactive cells remained.

DISCUSSION

The current study shows that ADAM21 is also presentin the CNS, in addition to its reported expression predom-inantly in the testis and its presence in the epididymis,vas deferens, kidney, and stomach (Hooft van Huijsdui-jnen, 1998; Liu and Smith, 2000). ADAM21 is uniquelyexpressed among many of the ADAMs in SVZ cells withlong basal processes, which are intimately associated withthe proliferating neural precursors in the SVZ and neuro-blasts migrating into the RMS. ADAM21-positive pro-cesses are present all along the RMS. ADAM21 is alsopresent in growing axons of the developing brain andadult olfactory nerve. The data also suggest that TIMP3may be the natural inhibitor of ADAM21. Because of itsexpression pattern, as well as its integrin-binding andmetalloprotease domains, ADAM21 is well positioned toplay a unique, multifunctional, and orchestrating role inneurogenesis, neuroblast migration, axonal growth, andplasticity.

Unique expression and potential functionsof ADAM21 in the SVZ/RMS

ADAM21 was the only ADAM present in the SVZ/RMSamong the eight we looked for. This suggests thatADAM21 plays a unique role and could be a selectivetarget for regulating adult neurogenesis and migration. Inother systems, other ADAMs regulate the cleavage-dependent activation of TGF� (Sunnarborg et al., 2002),Notch1 and its ligands (Pan and Rubin, 1997; Qi et al.,1999; Mishra-Gorur et al., 2002), and APP (Asai et al.,2003), all known to promote neurogenesis in the SVZ(Tropepe et al., 1997; Hitoshi et al., 2002; Chojnacki et al.,2003; Caille et al., 2004). As those ADAMs were not

Fig. 8. Both ADAM21 and OMP are lost 1 week after a unilateralolfactory nerve transection. Shown is a coronal section through thecaudal end of both the olfactory bulbs of the same mouse, with thelesion being on the right side. Note the staining in the rostral migra-tory stream (RMS). ONL, outer nuclear layer. Scale bar � 250 �m inlower panel (applies to both panels).


present in the SVZ, ADAM21 may uniquely influence neu-rogenesis by cleavage of such membrane-bound proteins.

The disintegrin domain of ADAMs can bind to integrinreceptors, including �5�1, �6�1, �9�1, �v�3, and �v�5integrin (Evans, 2001; Moss et al., 2001). The �5�1, �v�1,�v�5, and �v�8 integrins regulate proliferation in cul-tured neonatal rat SVZ neural precursors (Jacques et al.,

1998). The �6�1 integrin regulates migration in vitro(Jacques et al., 1998) and is critical for the directed mi-gration of neuroblasts through the adult mouse RMS(Emsley and Hagg, 2003). Because of its location amongthe neural precursors and neuroblasts, ADAM21 couldalso regulate proliferation in the SVZ and migration in theRMS through its disintegrin domain.

Fig. 9. ADAM21 is present in radial glia and ependyma duringpostnatal development. Shown is ADAM21 immunostaining in para-sagittal sections through the rat SVZ (asterisk; A–F), rostral migra-tory stream (RMS; G–I), and neostriatum (J–L) in P1 (A,D,G,J), P10(B,E,H,K), and P20 (C,F,I,L) rat brains. D–F are higher magnifica-tions of A,B and C, respectively. Many ADAM21-positive processessurround the ventricles at P1 (A,D) and P10 (B,E), with far fewerremaining at P20 (C,F). Note the projection of processes through thecorpus callosum (CC) into the cerebral cortex (CX) at P1. At P1 (G)

and P10 (H), many ADAM21 processes are intimately associated withthe RMS and are primarily oriented perpendicular to the axis of theRMS. I: At P20 the RMS mainly contains tangentially oriented pro-cesses. J: ADAM21-immunoreactive processes extend throughout theneostriatum at P1 (arrowheads) and often project parallel to bloodvessels at P10 (K) to make bouton-like contacts, which are no longerevident by P20 (L). The P1 neostriatum also contains axonal fiberbundles (arrows). LV, lateral ventricle. Scale bar � 100 �m in L(applies to D–L); 200 �m for A–C.

174 P. YANG ET AL.

The metalloprotease domain of ADAM21 could also playa role in guiding neuroblast migration. By analogy toother ADAMs, ADAM21 could inactivate inhibitory chon-droitin sulfate proteoglycans that are expressed by neural

precursors or are enriched in the RMS (Lemons et al.,2001). Similarly, ADAM21 could activate ephrins and slit(Hattori et al., 2000; Schimmelpfeng et al., 2001; McFar-lane, 2003), which affect the migration of neuroblasts in

Fig. 10. ADAM21 is present in growing axons at early postnataltimes. In P1 rats, ADAM21 staining was readily detectable within fibersof the (A) olfactory nerve layer and glomeruli (“G”). Fiber staining wasalso seen in the (B) corpus callosum (CC), (C) anterior commissure (AC),(D) fornix (FX), (E) optic tract (OT) and cerebral peduncle (CP), and (F)in fibers within the CA1 region of the hippocampus. Axons are densely

packed within these unmyelinated tracts at this developmental age, butindividual defasciculated fibers can be seen (arrowheads). Note the la-beling of ADAM21 along the brain surface, possibly from glial end-feetand/or processes from other ADAM21-positive cells (asterisk in E). E istaken from a coronal section caudal to those illustrated in Figure 1. Scalebar � 100 �m in F (applies to A–F).


the RMS (Conover et al., 2000; Wong et al., 2001). Alter-natively, ADAM21 might activate netrin/deleted in colo-rectal cancer signaling (Galko and Tessier-Lavigne, 2000),which is important for SVZ neuroblast migration (Muraseand Horwitz, 2002).

Metalloproteases are inhibited by TIMPs with some selec-tivity of TIMP3 for ADAMs (Borland et al., 1999; Horiuchi etal., 2003; Nagase and Brew, 2003; Lee et al., 2004). Here,TIMP1, -2, and -3 were all present in the ependymal layer,and TIMP3 was also seen in the brain regions surroundingthe SVZ and RMS. This raises the possibilities thatADAM21 is only active in the SVZ and RMS and that TIMP3may be the natural inhibitor of ADAM21.

ADAM21-positive processes may directadult neuroblast migration

ADAM21-positive processes projected from the SVZcells into the RMS and were seen up to the location whereneuroblasts start their radial migration and differentiateinto neurons. ADAM21-positive processes were intermin-gled with migrating neuroblasts. This suggests that theseprocesses could act as guiding “rails” for the migratingneuroblasts. The intimate topographical relationship alsoputs ADAM21 in a position to suppress directly or other-wise regulate neuroblast differentiation into neurons. Wedo not know whether the processes in the more rostralparts of the RMS derive from the subependymal cells,despite the finding that there were no ADAM21-positivecell bodies in the RMS. The ADAM21-positive processes inthe RMS were surrounded by astrocytes and their pro-cesses, which may help to contain the neuroblasts withinthe RMS, as has been proposed (Lois and Alvarez-Buylla,1994; Lois et al., 1996; Peretto et al., 1997).

The ADAM21-positive processes from the SVZ cells of-ten projected onto blood vessels that coursed along theRMS. These processes potentially project along the base-ment membrane processes named fractones that emanatefrom blood vessels in the SVZ (Mercier et al., 2002). Bloodvessels can be a source of BDNF for neural precursors(Leventhal et al., 1999), which is important for neuroblastsurvival (Linnarsson et al., 2000). Therefore, process-bearing ADAM21-positive cells may also function to guideneuroblasts to the trophic environment around blood ves-sels. In the dentate gyrus, neuroblasts are also located inclose proximity to blood vessels (Palmer et al., 2000). Theabsence of ADAM21-positive processes in the dentate gy-rus is consistent with the much shorter distance of migra-tion and the earlier neuroblast differentiation.

The cell lineage of process-bearing ADAM21-positiveSVZ cells is not clear. The location of their cell body, theirmorphology, the connection of their single basal process toblood vessels, and our finding of ADAM21 in hypothalamictanycytes raise the possibility that the subependymal cellsare related to tanycytes (Bruni, 1998). Although tanycyteshave been described and studied predominantly aroundthe third ventricle, they have also been found around thecerebral aqueduct, the fourth ventricle, and the centralcanal in the spinal cord and in the medial habenularnucleus (Burnett and Felten, 1981; Felten et al., 1981;Cupedo and de Weerd, 1985; Rafols and Goshgarian,1985). A few tanycytes have also been described in theadult mouse SVZ (Doetsch et al., 1997). Those cells wereGFAP positive (Doetsch et al., 1997), whereas theADAM21-positive cells were not, suggesting that the lat-ter are not genuine tanycytes. Most adult rat tanycytes donot have GFAP (Ludwin et al., 1976; Juanes et al., 1992),

whereas tanycytes of other species do. The lack of GFAP inthe mouse and rat ADAM21-positive SVZ cells does notexclude an astrocytic nature, as GFAP can be absent fromastrocytes in different regions of the CNS. Moreover, as-trocytes are also located subependymally and may haveend-feet contacting blood vessels.

The morphology of the ADAM21-positive SVZ cells isalso similar to that of APP-positive SVZ cells, many ofwhich contain GFAP (Yasuoka et al., 2004). Radial gliaare another potentially related cell type, as these alsohave a subependymal location and a long basal processand can contact blood vessels (Virgintino et al., 1998).Radial glia-like cells morphologically similar to theADAM21-expressing cells in the SVZ of the forebrain havebeen described at the base of the lateral ventricle(Sundholm-Peters et al., 2004). However, those cells haveGFAP and do not have ADAM21. Future ultrastructuraland further immunophenotypical characterization, as wellas comparison among these similar cells types, may clarifythe nature of the ADAM21-positive cells. This cell type ismost likely of the same lineage that produces radial glia,tanycytes, and ependymal cells (Tramontin et al., 2003),and it is possible that ADAM21 identifies one physiologi-cal state of a single adult radial glial cell type that under-goes plastic and phenotypic changes.

Radial glia are important for neuroblast and glial mi-gration during embryonic and early postnatal develop-ment of the brain (Antonopoulos et al., 2002). ADAM21was present in a mesh of processes surrounding the RMSduring early postnatal times arising from cells along theventricles with a morphology of radial glial fibers in theRMS (Alves et al., 2002; Suzuki and Goldman, 2003).Before P15, ADAM21-positive radial glial processes alsoprojected from the ventricle through the corpus callosumto the pial surface but then disappeared. Radial glia dis-appear by P14 in the rodent brain (Pixley and de Vellis,1984; Tramontin et al., 2003), presumably differentiatinginto astrocytes (Schmechel and Rakic, 1979; Voigt, 1989;Gaiano et al., 2000). Thus, ADAM21 expressed by radialglia may play a role in neurogenesis.

Adult subependymal ADAM21-positive cellsdo not become neural precursors

Proliferation occurs in the embryonic ventricular zoneand SVZ (Tramontin et al., 2003) but shortly after birthsubsides in the ventricular zone, which becomes the singleependymal layer. Ependyma retain rare proliferative ac-tivity and have been proposed (Johansson et al., 1999) anddisputed (Chiasson et al., 1999) to be stem cells in theadult. Here, with a 14-day intraperitoneal infusion of 50mg/kg/day BrdU, an occasional ependymal cell and manysubependymal cells were positive for BrdU. However,none of the BrdU-positive cells, which would have in-cluded the slowly proliferating stem cell population, werepositive for ADAM21. This suggests that the ADAM21-positive ependyma and subependymal cells do not produceneural precursors and are mature, nondividing cells. Wecannot exclude the possibility that ADAM21 is downregu-lated prior to proliferation.

ADAM21 is present in growing CNS axonsduring postnatal development and

adulthood

Olfactory receptor neurons are constantly generated torenew the population in the olfactory mucosa. These new

176 P. YANG ET AL.

neurons grow their axons through the olfactory nerve toinnervate the glomeruli (Graziadei and Graziadei,1979a,b; Mackay-Sim and Kittel, 1991). ADAM21 par-tially colocalized with the mature olfactory axon markerOMP and was absent from �III-tubulin-positive immaturegrowing axons and was reduced in the adult glomerulicompared with that seen in neonates. This raises thepossibility that ADAM21 plays a role when the axonsundergo their final outgrowth phase into the glomeruli orwhen they make synapses. Kuzbanian (ADAM10) andunc-71 (ADAM14) are important for axonal outgrowth(Fambrough et al., 1996; Schimmelpfeng et al., 2001), andADAM21 may play a similar role in rodents. ADAM21 isin a position to activate APP in olfactory ensheathing cells(Moreno-Flores et al., 2003), which are crucial for olfactoryaxon outgrowth into the CNS. APP mediates NGF-induced neurite outgrowth from PC12 cells (Milward etal., 1992). Conversely, ADAM21 might inactivate out-growth inhibitors such as aggrecan that are found in theglomeruli (Koppe et al., 1997; Russo et al., 1997). Thedisintegrin domain of ADAM21 could also play a role inaxonal outgrowth in the olfactory system, as integrinscontaining the �1 integrin subunit mediate laminin-induced outgrowth of olfactory and retinal axons in vitro(Calof et al., 1994).

The presence of TIMP3 (but not TIMP1, -2, or -4) in theperiglomerular compartment would be consistent with theidea that ADAM21-induced growth is terminated once theaxons reach the glomeruli, thus preventing ingrowth intothe rest of the olfactory bulb.

ADAM21 was also present in several fiber tracts knownto contain growing axons during postnatal times, includ-ing the corpus callosum, anterior commissure, optic tract,and fornix. ADAM21 was seen in the corpus callosum atP1 but not at P5, coinciding with the time that callosalaxons enter the contralateral hemisphere just before P5,with very few axons extending into the corpus callosumbeyond that time (Valentino and Jones, 1982; Floeter andJones, 1985; Gravel et al., 1990). The number of anteriorcommissural axons that reach their targets increase up toP10 (Lent et al., 1990), growing optic fibers have beenfound at P8 (Dallimore et al., 2002), projections throughthe fornix grow beyond the mammillary bodies during thefirst postnatal week (Stanfield et al., 1987), and cortico-spinal axons continue to grow until P9 (Donatelle, 1977;Gribnau et al., 1986; Gianino et al., 1999). ADAM21 ex-pression in the above fiber tracts coincides with the timeframe in which these axons are growing toward theirtargets and form synapses. This suggests that ADAM21not only regulates neurogenesis and neuroblast migrationbut is also involved in axonal outgrowth and synapseformation.

ACKNOWLEDGMENTS

We greatly appreciate the excellent technical assistanceof Kimberley Jenkins-Milton and Jyoti Sahi. We are grate-ful for the kind gift of antibodies from Carol Birminghamof Chemicon International, Dr. Frank Margolis, Univer-sity of Maryland, Baltimore, MD, and Dr. Eugene John-son, Jr., Washington University, St. Louis, MO. Dr. RugaoLiu is appreciated for help with ADAM21 primer andprobe design and Dr. Scott R. Whittemore for use of hiscryostat and PCR equipment.

LITERATURE CITED

Alves JA, Barone P, Engelender S, Froes MM, Menezes JR. 2002. Initialstages of radial glia astrocytic transformation in the early postnatalanterior subventricular zone. J Neurobiol 52:251–265.

Antonopoulos J, Dori I, Dinopoulos A, Chiotelli M, Parnavelas JG. 2002.Postnatal development of the dopaminergic system of the striatum inthe rat. Neuroscience 110:245–256.

Asai M, Hattori C, Szabo B, Sasagawa N, Maruyama K, Tanuma S, IshiuraS. 2003. Putative function of ADAM9, ADAM10, and ADAM17 as APPalpha-secretase. Biochem Biophys Res Commun 301:231–235.

Baker H, Grillo M, Margolis FL. 1989. Biochemical and immunocytochem-ical characterization of olfactory marker protein in the rodent centralnervous system. J Comp Neurol 285:246–261.

Bigler D, Takahashi Y, Chen MS, Almeida EA, Osbourne L, White JM.2000. Sequence-specific interaction between the disintegrin domain ofmouse ADAM 2 (fertilin beta) and murine eggs. Role of the alpha(6)integrin subunit. J Biol Chem 275:11576–11584.

Bohn W, Wiegers W, Beuttenmuller M, Traub P. 1992. Species-specificrecognition patterns of monoclonal antibodies directed against vimen-tin. Exp Cell Res 201:1–7.

Borland G, Murphy G, Ager A. 1999. Tissue inhibitor ofmetalloproteinases-3 inhibits shedding of L-selectin from leukocytes.J Biol Chem 274:2810–2815.

Bruni JE. 1998. Ependymal development, proliferation, and functions: areview. Microsc Res Tech 41:2–13.

Burnett BT, Felten DL. 1981. Aqueductal tanycytes in the rabbit brain: AGolgi study. Anat Rec 200:337–347.

Caille I, Allinquant B, Dupont E, Bouillot C, Langer A, Muller U, Prochi-antz A. 2004. Soluble form of amyloid precursor protein regulatesproliferation of progenitors in the adult subventricular zone. Develop-ment 131:2173–2181.

Calof AL, Campanero MR, O’Rear JJ, Yurchenco PD, Lander AD. 1994.Domain-specific activation of neuronal migration and neuriteoutgrowth-promoting activities of laminin. Neuron 13:117–130.

Chandler CE, Parsons LM, Hosang M, Shooter EM. 1984. A monoclonalantibody modulates the interaction of nerve growth factor with PC12cells. J Biol Chem 259:6882–6889.

Chauvet N, Prieto M, Alonso G. 1998. Tanycytes present in the adult ratmediobasal hypothalamus support the regeneration of monoaminergicaxons. Exp Neurol 151:1–13.

Chiasson BJ, Tropepe V, Morshead CM, van der Kooy D. 1999. Adultmammalian forebrain ependymal and subependymal cells demonstrateproliferative potential, but only subependymal cells have neural stemcell characteristics. J Neurosci 19:4462–4471.

Chojnacki A, Shimazaki T, Gregg C, Weinmaster G, Weiss S. 2003. Glyco-protein 130 signaling regulates Notch1 expression and activation in theself-renewal of mammalian forebrain neural stem cells. J Neurosci23:1730–1741.

Conover JC, Doetsch F, Garcia-Verdugo JM, Gale NW, Yancopoulos GD,Alvarez-Buylla A. 2000. Disruption of Eph/ephrin signaling affectsmigration and proliferation in the adult subventricular zone. Nat Neu-rosci 3:1091–1097.

Cupedo RN, de Weerd H. 1985. Tanycytes in the medial habenular nucleusof the rat. Anat Embryol (Berl) 172:7–10.

Dallimore EJ, Cui Q, Beazley LD, Harvey AR. 2002. Postnatal innervationof the rat superior colliculus by axons of late-born retinal ganglion cells.Eur J Neurosci 16:1295–1304.

Debus E, Weber K, Osborn M. 1983. Monoclonal antibodies specific for glialfibrillary acidic (GFA) protein and for each of the neurofilament tripletpolypeptides. Differentiation 25:193–203.

Doetsch F, Garcia-Verdugo JM, Alvarez-Buylla A. 1997. Cellular composi-tion and three-dimensional organization of the subventricular germi-nal zone in the adult mammalian brain. J Neurosci 17:5046–5061.

Donatelle JM. 1977. Growth of the corticospinal tract and the developmentof placing reactions in the postnatal rat. J Comp Neurol 175:207–231.

Duijvestijn AM, van Goor H, Klatter F, Majoor GD, van Bussel E, vanBreda Vriesman PJ. 1992. Antibodies defining rat endothelial cells:RECA-1, a pan-endothelial cell-specific monoclonal antibody. Lab In-vest 66:459–466.

Dzwonek J, Rylski M, Kaczmarek L. 2004. Matrix metalloproteinases andtheir endogenous inhibitors in neuronal physiology of the adult brain.FEBS Lett 567:129–135.

Emsley JG, Hagg T. 2003. alpha6beta1 integrin directs migration of neu-ronal precursors in adult mouse forebrain. Exp Neurol 183:273–285.


Evans JP. 2001. Fertilin beta and other ADAMs as integrin ligands:insights into cell adhesion and fertilization. Bioessays 23:628–639.

Fambrough D, Pan D, Rubin GM, Goodman CS. 1996. The cell surfacemetalloprotease/disintegrin Kuzbanian is required for axonal exten-sion in Drosophila. Proc Natl Acad Sci U S A 93:13233–13238.

Fariss RN, Apte SS, Olsen BR, Iwata K, Milam AH. 1997. Tissue inhibitorof metalloproteinases-3 is a component of Bruch’s membrane of the eye.Am J Pathol 150:323–328.

Felten DL, Cummings JP, Burnett BT. 1981. Ontogeny of caudal fourthventricular tanycytes in the rabbit brain: a Golgi study. Anat Rec200:321–330.

Floeter MK, Jones EG. 1985. Transplantation of fetal postmitotic neuronsto rat cortex: survival, early pathway choices and long-term projectionsof outgrowing axons. Brain Res 354:19–38.

Fujimoto N, Zhang J, Iwata K, Shinya T, Okada Y, Hayakawa T. 1993. Aone-step sandwich enzyme immunoassay for tissue inhibitor ofmetalloproteinases-2 using monoclonal antibodies. Clin Chim Acta220:31–45.

Fujimoto N, Tokai H, Iwata K, Okada Y, Hayakawa T. 1995. Determina-tion of tissue inhibitor of metalloproteinases-2 (TIMP-2) in experimen-tal animals using monoclonal antibodies against TIMP-2-specific oli-gopeptides. J Immunol Methods 187:33–39.

Gaiano N, Nye JS, Fishell G. 2000. Radial glial identity is promoted byNotch1 signaling in the murine forebrain. Neuron 26:395–404.

Galileo DS, Majors J, Horwitz AF, Sanes JR. 1992. Retrovirally introducedantisense integrin RNA inhibits neuroblast migration in vivo. Neuron9:1117–1131.

Galko MJ, Tessier-Lavigne M. 2000. Function of an axonal chemoattrac-tant modulated by metalloprotease activity. Science 289:1365–1367.

Gates MA, Thomas LB, Howard EM, Laywell ED, Sajin B, Faissner A, GotzB, Silver J, Steindler DA. 1995. Cell and molecular analysis of thedeveloping and adult mouse subventricular zone of the cerebral hemi-spheres. J Comp Neurol 361:249–266.

Gianino S, Stein SA, Li H, Lu X, Biesiada E, Ulas J, Xu XM. 1999.Postnatal growth of corticospinal axons in the spinal cord of developingmice. Brain Res Dev Brain Res 112:189–204.

Gravel C, Sasseville R, Hawkes R. 1990. Maturation of the corpus callosumof the rat: II. Influence of thyroid hormones on the number and matu-ration of axons. J Comp Neurol 291:147–161.

Graziadei GA, Graziadei PP. 1979a. Neurogenesis and neuron regenera-tion in the olfactory system of mammals. II. Degeneration and recon-stitution of the olfactory sensory neurons after axotomy. J Neurocytol8:197–213.

Graziadei PP, Graziadei GA. 1979b. Neurogenesis and neuron regenera-tion in the olfactory system of mammals. I. Morphological aspects ofdifferentiation and structural organization of the olfactory sensoryneurons. J Neurocytol 8:1–18.

Gribnau AA, de Kort EJ, Dederen PJ, Nieuwenhuys R. 1986. On thedevelopment of the pyramidal tract in the rat. II. An anterograde tracerstudy of the outgrowth of the corticospinal fibers. Anat Embryol (Berl)175:101–110.

Hattori M, Osterfield M, Flanagan JG. 2000. Regulated cleavage of acontact-mediated axon repellent. Science 289:1360–1365.

Hitoshi S, Alexson T, Tropepe V, Donoviel D, Elia AJ, Nye JS, Conlon RA,Mak TW, Bernstein A, van der Kooy D. 2002. Notch pathway moleculesare essential for the maintenance, but not the generation, of mamma-lian neural stem cells. Genes Dev 16:846–858.

Hooft van Huijsduijnen R. 1998. ADAM 20 and 21; two novel humantestis-specific membrane metalloproteases with similarity to fertilin-alpha. Gene 206:273–282.

Horiuchi K, Weskamp G, Lum L, Hammes HP, Cai H, Brodie TA, LudwigT, Chiusaroli R, Baron R, Preissner KT, Manova K, Blobel CP. 2003.Potential role for ADAM15 in pathological neovascularization in mice.Mol Cell Biol 23:5614–5624.

Huber AB, Kolodkin AL, Ginty DD, Cloutier JF. 2003. Signaling at thegrowth cone: ligand-receptor complexes and the control of axon growthand guidance. Annu Rev Neurosci 26:509–563.

Hurskainen T, Hoyhtya M, Tuuttila A, Oikarinen A, Autio-Harmainen H.1996. mRNA expressions of TIMP-1, -2, and -3 and 92-KD type IVcollagenase in early human placenta and decidual membrane as stud-ied by in situ hybridization. J Histochem Cytochem 44:1379–1388.

Hynes RO. 1992. Integrins: versatility, modulation, and signaling in celladhesion. Cell 69:11–25.

Jacques TS, Relvas JB, Nishimura S, Pytela R, Edwards GM, Streuli CH,ffrench-Constant C. 1998. Neural precursor cell chain migration and

division are regulated through different beta1 integrins. Development125:3167–3177.

Jamasbi RJ, Kennel SJ, Stoner GD. 1992. A monoclonal antibody producedagainst a rat esophageal carcinoma cell line reacts with an integrin-like molecule expressed by rat epithelial cells. Hybridoma 11:581–594.

Jaworski DM, Fager N. 2000. Regulation of tissue inhibitor ofmetalloproteinase-3 (Timp-3) mRNA expression during rat CNS devel-opment. J Neurosci Res 61:396–408.

Johansson CB, Momma S, Clarke DL, Risling M, Lendahl U, Frisen J.1999. Identification of a neural stem cell in the adult mammaliancentral nervous system. Cell 96:25–34.

Juanes JA, Riesco JM, Sanchez F, Carretero J, Blanco E, Vazquez R. 1992.Glial fibrillary acidic protein-like immunoreactive ependymal elementsin the third ventricle of the rat. A study at different stages of develop-ment. Acta Anat (Basel) 145:364–369.

Kakita A, Goldman JE. 1999. Patterns and dynamics of SVZ cell migrationin the postnatal forebrain: monitoring living progenitors in slice prep-arations. Neuron 23:461–472.

Keller A, Margolis FL. 1975. Immunological studies of the rat olfactorymarker protein. J Neurochem 24:1101–1106.

Koppe G, Bruckner G, Hartig W, Delpech B, Bigl V. 1997. Characterizationof proteoglycan-containing perineuronal nets by enzymatic treatmentsof rat brain sections. Histochem J 29:11–20.

Kream RM, Margolis FL. 1984. Olfactory marker protein: turnover andtransport in normal and regenerating neurons. J Neurosci 4:868–879.

Kuhn HG, Dickinson-Anson H, Gage FH. 1996. Neurogenesis in the den-tate gyrus of the adult rat: age-related decrease of neuronal progenitorproliferation. J Neurosci 16:2027–2033.

Kuhn HG, Winkler J, Kempermann G, Thal LJ, Gage FH. 1997. Epidermalgrowth factor and fibroblast growth factor-2 have different effects onneural progenitors in the adult rat brain. J Neurosci 17:5820–5829.

Lee MH, Rapti M, Murphy G. 2004. Delineating the molecular basis of theinactivity of tissue inhibitor of metalloproteinase (TIMP)-2 againstTNF-� converting enzyme (TACE). J Biol Chem. 279:45121–45129.

Lee MK, Rebhun LI, Frankfurter A. 1990. Posttranslational modification ofclass III beta-tubulin. Proc Natl Acad Sci U S A 87:7195–7199.

Lemons ML, Sandy JD, Anderson DK, Howland DR. 2001. Intact aggrecanand fragments generated by both aggrecanse and metalloproteinase-like activities are present in the developing and adult rat spinal cordand their relative abundance is altered by injury. J Neurosci 21:4772–4781.

Lent R, Hedin-Pereira C, Menezes JR, Jhaveri S. 1990. Neurogenesis anddevelopment of callosal and intracortical connections in the hamster.Neuroscience 38:21–37.

Leventhal C, Rafii S, Rafii D, Shahar A, Goldman SA. 1999. Endothelialtrophic support of neuronal production and recruitment from the adultmammalian subependyma. Mol Cell Neurosci 13:450–464.

Linnarsson S, Willson CA, Ernfors P. 2000. Cell death in regeneratingpopulations of neurons in BDNF mutant mice. Brain Res Mol BrainRes 75:61–69.

Liu L, Smith JW. 2000. Identification of ADAM 31: a protein expressed inLeydig cells and specialized epithelia. Endocrinology 141:2033–2042.

Lois C, Alvarez-Buylla A. 1993. Proliferating subventricular zone cells inthe adult mammalian forebrain can differentiate into neurons and glia.Proc Natl Acad Sci U S A 90:2074–2077.

Lois C, Alvarez-Buylla A. 1994. Long-distance neuronal migration in theadult mammalian brain. Science 264:1145–1148.

Lois C, Garcia-Verdugo JM, Alvarez-Buylla A. 1996. Chain migration ofneuronal precursors. Science 271:978–981.

Ludwin SK, Kosek JC, Eng LF. 1976. The topographical distribution ofS-100 and GFA proteins in the adult rat brain: an immunohistochem-ical study using horseradish peroxidase-labelled antibodies. J CompNeurol 165:197–207.

Luskin MB. 1993. Restricted proliferation and migration of postnatallygenerated neurons derived from the forebrain subventricular zone.Neuron 11:173–189.

Mackay-Sim A, Kittel PW. 1991. On the life span of olfactory receptorneurons. Eur J Neurosci 3:209–215.

McFarlane S. 2003. Metalloproteases: carving out a role in axon guidance.Neuron 37:559–562.

Mercier F, Kitasako JT, Hatton GI. 2002. Anatomy of the brain neurogeniczones revisited: fractones and the fibroblast/macrophage network.J Comp Neurol 451:170–188.

Milward EA, Papadopoulos R, Fuller SJ, Moir RD, Small D, Beyreuther K,Masters CL. 1992. The amyloid protein precursor of Alzheimer’s dis-

178 P. YANG ET AL.

ease is a mediator of the effects of nerve growth factor on neuriteoutgrowth. Neuron 9:129–137.

Mishra-Gorur K, Rand MD, Perez-Villamil B, Artavanis-Tsakonas S. 2002.Down-regulation of Delta by proteolytic processing. J Cell Biol 159:313–324.

Moreno-Flores MT, Lim F, Martin-Bermejo MJ, Diaz-Nido J, Avila J,Wandosell F. 2003. High level of amyloid precursor protein expressionin neurite-promoting olfactory ensheathing glia (OEG) and OEG-derived cell lines. J Neurosci Res 71:871–881.

Moss ML, Lambert MH. 2002. Shedding of membrane proteins by ADAMfamily proteases. Essays Biochem 38:141–153.

Moss ML, White JM, Lambert MH, Andrews RC. 2001. TACE and otherADAM proteases as targets for drug discovery. Drug Discov Today6:417–426.

Mullen RJ, Buck CR, Smith AM. 1992. NeuN, a neuronal specific nuclearprotein in vertebrates. Development 116:201–211.

Murase S, Horwitz AF. 2002. Deleted in colorectal carcinoma and differ-entially expressed integrins mediate the directional migration of neu-ral precursors in the rostral migratory stream. J Neurosci 22:3568–3579.

Nagase H, Brew K. 2003. Designing TIMP (tissue inhibitor of metallopro-teinases) variants that are selective metalloproteinase inhibitors. Bio-chem Soc Symp 70:201–212.

Palmer TD, Willhoite AR, Gage FH. 2000. Vascular niche for adult hip-pocampal neurogenesis. J Comp Neurol 425:479–494.

Pan D, Rubin GM. 1997. Kuzbanian controls proteolytic processing ofNotch and mediates lateral inhibition during Drosophila and verte-brate neurogenesis. Cell 90:271–280.

Papaioannou VE, Fox JG. 1993. Efficacy of tribromoethanol anesthesia inmice. Lab Anim Sci 43:189–192.

Pasterkamp RJ, De Winter F, Holtmaat AJ, Verhaagen J. 1998. Evidencefor a role of the chemorepellent semaphorin III and its receptorneuropilin-1 in the regeneration of primary olfactory axons. J Neurosci18:9962–9976.

Paxinos G, Watson C. 1986. The rat brain in stereotaxic coordinates. SanDiego: Academic Press.

Peretto P, Merighi A, Fasolo A, Bonfanti L. 1997. Glial tubes in the rostralmigratory stream of the adult rat. Brain Res Bull 42:9–21.

Pixley SK, de Vellis J. 1984. Transition between immature radial glia andmature astrocytes studied with a monoclonal antibody to vimentin.Brain Res 317:201–209.

Primakoff P, Myles DG. 2000. The ADAM gene family: surface proteinswith adhesion and protease activity. Trends Genet 16:83–87.

Qi H, Rand MD, Wu X, Sestan N, Wang W, Rakic P, Xu T, Artavanis-Tsakonas S. 1999. Processing of the notch ligand delta by the metallo-protease Kuzbanian. Science 283:91–94.

Rafols JA, Goshgarian HG. 1985. Spinal tanycytes in the adult rat: acorrelative Golgi gold-toning study. Anat Rec 211:75–86.

Reichardt LF, Tomaselli KJ. 1991. Extracellular matrix molecules andtheir receptors: functions in neural development. Annu Rev Neurosci14:531–570.

Russo VC, Bach LA, Fosang AJ, Baker NL, Werther GA. 1997. Insulin-likegrowth factor binding protein-2 binds to cell surface proteoglycans inthe rat brain olfactory bulb. Endocrinology 138:4858–4867.

Schimmelpfeng K, Gogel S, Klambt C. 2001. The function of leak andkuzbanian during growth cone and cell migration. Mech Dev 106:25–36.

Schmechel DE, Rakic P. 1979. A Golgi study of radial glial cells in devel-oping monkey telencephalon: morphogenesis and transformation intoastrocytes. Anat Embryol (Berl) 156:115–152.

Stanfield BB, Nahin BR, O’Leary DD. 1987. A transient postmamillarycomponent of the rat fornix during development: implications for in-terspecific differences in mature axonal projections. J Neurosci 7:3350–3361.

Sundholm-Peters NL, Yang HK, Goings GE, Walker AS, Szele FG. 2004.Radial glia-like cells at the base of the lateral ventricles in adult mice.J Neurocytol 33:153–164.

Sunnarborg SW, Hinkle CL, Stevenson M, Russell WE, Raska CS, PeschonJJ, Castner BJ, Gerhart MJ, Paxton RJ, Black RA, Lee DC. 2002.Tumor necrosis factor-alpha converting enzyme (TACE) regulates epi-dermal growth factor receptor ligand availability. J Biol Chem 277:12838–12845.

Suzuki SO, Goldman JE. 2003. Multiple cell populations in the earlypostnatal subventricular zone take distinct migratory pathways: adynamic study of glial and neuronal progenitor migration. J Neurosci23:4240–4250.

Tramontin AD, Garcia-Verdugo JM, Lim DA, Alvarez-Buylla A. 2003.Postnatal development of radial glia and the ventricular zone (VZ): acontinuum of the neural stem cell compartment. Cereb Cortex 13:580–587.

Tropepe V, Craig CG, Morshead CM, van der Kooy D. 1997. Transforminggrowth factor-alpha null and senescent mice show decreased neuralprogenitor cell proliferation in the forebrain subependyma. J Neurosci17:7850–7859.

Valentino KL, Jones EG. 1982. The early formation of the corpus callosum:a light and electron microscopic study in foetal and neonatal rats.J Neurocytol 11:583–609.

Virgintino D, Maiorano E, Errede M, Vimercati A, Greco P, Selvaggi L,Roncali L, Bertossi M. 1998. Astroglia-microvessel relationship in thedeveloping human telencephalon. Int J Dev Biol 42:1165–1168.

Voigt T. 1989. Development of glial cells in the cerebral wall of ferrets:direct tracing of their transformation from radial glia into astrocytes.J Comp Neurol 289:74–88.

Wang S, Sdrulla AD, diSibio G, Bush G, Nofziger D, Hicks C, WeinmasterG, Barres BA. 1998. Notch receptor activation inhibits oligodendrocytedifferentiation. Neuron 21:63–75.

White JM. 2003. ADAMs: modulators of cell-cell and cell-matrix interac-tions. Curr Opin Cell Biol 15:598–606.

Wolfsberg TG, Straight PD, Gerena RL, Huovila AP, Primakoff P, MylesDG, White JM. 1995. ADAM, a widely distributed and developmentallyregulated gene family encoding membrane proteins with a disintegrinand metalloprotease domain. Dev Biol 169:378–383.

Wong K, Ren XR, Huang YZ, Xie Y, Liu G, Saito H, Tang H, Wen L,Brady-Kalnay SM, Mei L, Wu JY, Xiong WC, Rao Y. 2001. Signaltransduction in neuronal migration: roles of GTPase activating pro-teins and the small GTPase Cdc42 in the Slit-Robo pathway. Cell107:209–221.

Wright JW, Kramar EA, Meighan SE, Harding JW. 2002. Extracellularmatrix molecules, long-term potentiation, memory consolidation andthe brain angiotensin system. Peptides 23:221–246.

Yasuoka K, Hirata K, Kuraoka A, He JW, Kawabuchi M. 2004. Expressionof amyloid precursor protein-like molecule in astroglial cells of thesubventricular zone and rostral migratory stream of the adult ratforebrain. J Anat 205:135–146.


Documents

A disintegrin and metalloprotease 21 (ADAM21) is associated with neurogenesis and axonal growth in developing and adult rodent CNS