INTRODUCTION

During the development of the vertebrate central nervoussystem, a large number of different neuronal and glial pheno-types are generated by the progenitor cells of the germinal neu-roepithelium. The mechanisms that control the generation ofthis phenotypic diversity are not well understood. Several linesof evidence indicate that the ultimate choice of fate by a prog-enitor cell comes about as a complex interplay between factorswithin the surrounding microenvironment and factors intrinsicto the progenitor cell that restrict its ability to respond to theextrinsic cues (Anderson, 1989; Reh, 1992b). In the retina, forexample, cell ablation experiments (Reh and Tully, 1986; Reh,1987; Negishi et al., 1983) and heterochronic co-culture exper-iments (Watanabe and Raff, 1990, 1992; Reh, 1992a;Altschuler and Cepko, 1992) have shown that the differen-tiation of particular types of retinal neurons is regulated by themicroenvironment. Nevertheless, there is also evidence thatprogenitor cells change during development in their responseto differentiating factors (Taylor and Reh, 1989) and todifferent mitotic agents (Lillien and Cepko, 1992).

In order to identify potential factors intrinsic to a progenitorcell that restrict its ability to respond to the extrinsic cues, wehave looked to invertebrate developing systems wheremolecules with similar functions have already been identified.One such class of molecules, that is of particular interest in thiscontext, is the

Drosophila achaete-scute complex (AS-C),involved in sense organ development (see Ghysen andDambly-Chaudiére, 1988, or Campuzano and Modolell, 1992,for reviews). The cuticle of Drosophila is endowed with anumber of sensory organs, both external and internal, whichoccupy defined, sometimes precise, locations in the embryo,

larva and adult. All of the cells of a sensory organ (SO), bothneuronal and non-neuronal, are derived from a single precursorcell, the sensory mother cell (SMC). Some sensory organsdevelop in precise positions, while others form at a particulardensity in a given region. Mutational analysis has revealed thatmembers of the AS-C and related proteins play a role inendowing cells with the competence to become SMCs (Cabreraet al., 1987; Cubas et al., 1991; deCelis et al., 1991). Theexpression of AS-C members is correlated with a particularstate of a sensory organ-forming progenitor cell, which may beacted upon subsequently, through cell-cell interactions, tobring about overt differentiation of a particular SO-formingSMC.

The AS-C encodes four proteins — scute (sc or T4), achaete(ac or T5), asense (ase or T8) and lethal of scute (l’sc or T3).The AS-C products, as well as modulators of their activity —daughterless, hairy and extramacrochaete — all sharesequence similarity over a 57- to 71-amino acid region, theregion encoding the (basic) helix-loop-helix motif (b-hlh). Thismotif is also similar to those of the proto-oncogene c-myc(Villares and Cabrera, 1987) and the muscle determinationgenes, including MyoD and myogenin (Murre et al., 1989a,b).The helix-loop-helix region mediates the protein-protein inter-actions giving rise to DNA-binding dimers, while the basicregion functions in binding DNA (Murre et al., 1989b).Although the level at which AS-C acts in SO formation is notobviously analogous to the restriction of neuroepithelial cellpotential in the vertebrate retina, the AS-C does act to definea particular, transient, state of a progenitor. It confers upon theprospective SMC the ability to differentiate as a SMC, andperhaps restricts the range of phenotypes the SMC canproduce, to yield specific SO types. Thus, we sought to identify

769Development 120, 769-783 (1994)Printed in Great Britain © The Company of Biologists Limited 1994

We have identified a basic helix-loop-helix encoding cDNAfrom embryonic chicken retina which shares sequence sim-ilarity with the

achaete-scute family of genes of Drosophila.The deduced amino acid sequence of this chicken achaete-scute homolog (CASH-1) is identical, over the regionencoding the basic helix-loop-helix domain, to the recentlyidentified mammalian achaete-scute homolog (MASH-1)and to the Xenopus homolog (XASH1), and 70% identical,over the same region, to Drosophila achaete-scute complexmembers. The expression of CASH-1 is restricted to subsets

of neuronal progenitor cells in the developing chickennervous system, similar in distribution to that reported forMASH-1 and XASH1. In addition, in situ localization in theretina reveals a dynamic character of expression of thegene in a particular region of the CNS, and suggests thatthe expression of CASH-1 may be important in defining aparticular stage in the progenitor cell necessary for thedifferentiation of particular neuronal phenotypes.

Key words: retina, neural progenitors, achaete-scute homolog

SUMMARY

A chicken achaete-scute homolog (CASH-1) is expressed in a temporally and

spatially discrete manner in the developing nervous system

C. L. Jasoni, M. B. Walker, M. D. Morris and T. A. Reh

Department of Biological Structure, SM-20, University of Washington, Seattle, Washington 98195, USA

770

chicken homologs of the AS-C which may be expressed duringthe development of the retina.

MATERIALS AND METHODS

PCR cloning, cDNA isolation and sequencing Stage 24 (embryonic day 4) chicken retinae were dissected in DEPC-treated PBS. Total cellular RNA was extracted by homogenizing thetissue and centrifuging through a 0%-25% sucrose gradient to pelletnuclei. Isolated cytoplasmic nucleic acids were treated with 400

µg/mlproteinase K, phenol/chloroform extracted, and ethanol precipitated.5 µg of total cellular RNA was reverse transcribed using 5 pmol/µlrandom hexamers (Pharmacia) to prime DNA synthesis. Polymerasechain reaction (PCR) was carried out using 2 µg (each end) modestly(2-fold) degenerate primers per 50 µl PCR (see Fig. 1 for primerpositions). For the first four cycles, annealing was carried out at 45˚C,followed by 35 cycles with an annealing temperature of 60˚C.Products of the PCR were examined by electrophoresing 10 µl (20%)of the reaction through a 3% Nusieve agarose (FMC) gel. Total PCRswere blunt-end-ligated into the pBluescript II (SK−) vector (Strata-gene) for 24 hours at 12˚C and ligation products were used totransform E. coli strain DH5α made competent using CaCl2. Cloneswith the appropriately sized insert (approx. 140 bp) were sequencedusing the dideoxy chain termination method (Sequenase, USB).

We screened an approx. stage 29 (embryonic day 6) chick headcDNA library (a kind gift from Dr D. Johnston, University of Cali-fornia, San Francisco), using the cloned PCR fragment as a probe.The probe was prepared by random-primed synthesis (Boehringer-Mannheim Biochemicals), following the manufacturers procedure,with the incorporation of 32P-dCTP to a specific activity of ≥109

cts/minute/µg. A single positive plaque was isolated, purified, and its2-kb insert cloned into the EcoRI site of the pBluescript II vector(SK−). Single-stranded DNA was produced and complementarystrands were sequenced, in both directions, either with the dideoxychain termination method (Sequenase, USB) or by using an automatedsequencer (Applied Biosystems, Model 373A).

Northern blots 15 µg of total cellular RNA (extracted by the procedure describedabove) was fractionated by electrophoresis on a 1.5%agarose/3% formaldehyde gel, as described bySambrook et al. (1989), transferred to a nylonmembrane and immobilized by UV cross-linking.Blots were probed with the PCR product, labelled byrandom-primed synthesis incorporating 32P-dCTP to aspecific activity of ≥109 cts/minute/µg. Blots werehybridized (107 cts/minute/ml) overnight at 42˚C inthe presence of 50% formamide, were washed at highstringency (0.1× SSC, 1% SDS at 65˚C, 2×15minutes), and exposed to X-ray film for 72 hours at−70˚C.

For several stages of development, poly(A)+ RNAwas isolated from extracts of total cellular RNA byfirst binding to oligo(dT)-biotin followed by separa-tion with avidin-conjugated magnetic beads (poly(A)-tract mRNA isolation system II, Promega). 1 µg ofpoly(A)+ RNA was electrophoresed and blotted asdescribed for total RNA. Blots were probed with a32P-end-labelled 21-base oligonucleotide, comple-mentary to CASH-1 in a region outside of and N-terminal to the bHLH-encoding region. Blots werehybridized for 4 hours at a temperature equal to thecalculated Tm minus 5 to 10˚C, washed at high strin-gency (6×SSC at 65˚C, 2×15 minutes), and exposedto X-ray film for 72 hours at −70˚C.

In situ hybridization RNA probes were synthesized, using the CASH-1 cDNA as atemplate, from T7 (sense) and T3 (anti-sense) promoters of the pBlue-script II (SK−) vector, incorporating approx. 37% digoxigenin-11-rUTP (Boehringer-Mannheim Biochemicals). Whole embryos orwhole retinas were fixed in 0.1 M MOPS, 2 mM EGTA, 1 mMMgSO4 and 3.7% formaldehyde for 1-2 hours at room temperature orovernight at 4˚C. Fixed tissue was hybridized in solution at 60˚C forat least 12 hours (for details see Harland, 1991). Bound probe wasvisualized using an alkaline phosphatase-conjugated antibody todigoxigenin (Boehringer-Mannheim Biochemicals). Alkaline phos-phatase reactions were allow to proceed for various times up to 18hours. Reacted tissue was fixed in 4% paraformaldehyde/4% sucrosefor 2 hours (4˚C), frozen and sectioned at 10 µm. To analyze the dis-tribution of CASH-1-expressing cells in the retina, sections weredigitized using an MTI DS2000 integrating CCD camera, and thedistances between clusters were measured using an Apple Quadra 950with Image 1.49 software (NIH).

Immunocytochemical analyses Following whole-mount in situ hybridization, sectioned embryos andretinas from various developmental stages were further analyzed withimmunohistochemistry using the following antibodies to identify par-ticular types of neurons: (1) anti-NF-160 (a generous gift from Dr G.Bennett, University of Florida, Gainsville), which is only expressedin ganglion cells, in the retina and in differentiated neurons through-out the rest of the CNS; (2) HPC-1, which is present in a subpopula-tion of amacrine cells in the retina (a gift from Dr C. Barnstable, YaleUniversity; Barnstable, 1980); (3) Rho-4D2 (a gift from Dr R.Molday, University of British Colombia, Canada and Dr D. Hicks,Strasbourg, France), which labels rod photoreceptors and (4) Visinin(a gift from Dr A. Polans, Dow Neurological Institute, Portland, OR),which labels cone receptors. Tissue sections were prepared forantibody binding by blocking with 1% BSA in PBS. Primary antibodywas allowed to bind to sections overnight at 4˚C and visualized usinga FITC-conjugated secondary antibody, diluted 1:300 in PBS(Cappell).

To determine the number and distribution of progenitor cells atvarious stages, whole retina explants were cultured for 18 hours inF12/DMEM (Gibco) containing 10% fetal bovine serum and 0.01 mM

C. L. Jasoni and others

Fig. 1. The deduced amino acid sequence of the bHLH region of the CASH-1 PCRproduct. Modestly degenerate primers (bold) were based on conserved residues inthe basic region and second helix of the bHLH domain. The nucleotide sequence ofthe primers (5′-3′) is: upstream (1) GCCGTGGCCAGGAGAAACGAG (2)GCCGTGGCCAGGAGAAACGAA downstream (1)CTGCAAGGCTCTGATGTACTC (2) CTGCAAGGCTCTGATGTATTC. Thededuced amino acid sequence of CASH-1 is identical to MASH-1 and XASH-1over this region, but exhibits less similarity (approx. 65-70%) to MASH-2 and theDrosophila AS-C products.

771CASH in the nervous system

bromodeoxyuridine (BrdU, Boehringer-Mannheim). After 24 hours,the retinas were fixed in 4% paraformaldehyde for 2 hours (4˚C),frozen and sectioned at 10 µm. Cells that had taken up BrdU duringthe culture period were visualized using an anti-BrdU antibody(Becton-Dickenson).

RESULTS

Identification and sequencing We used a degenerate polymerase chainreaction (PCR) strategy to identify AS-Chomologs in the chicken retina. In an effort toidentify bHLH family DNA-binding transcrip-tion factors, the design of our upstream primerset was based on amino acids in the basicregion, while the downstream primer set wasbased on the second helix of the bHLH (Fig.1). This approach has been successful in theidentification of achaete-scute homologs in rat(MASH-1 and -2; Johnson et al., 1990) andXenopus (XASH1; Ferreiro et al., 1992).bHLH-containing proteins, includingDrosophila AS-C members as well as the ver-tebrate AS-C homolog XASH1 (Villares andCabrera, 1987; Ferreiro et al., 1992), bind to aconsensus DNA sequence, the E box (Murre etal., 1989b). The basic region of the bHLHappears to be responsible for DNA binding;HLH-containing proteins which lack basicregions are deficient in DNA binding andtherefore transcriptional activation (Benezra etal., 1990; Ellis et al., 1990). Amplification ofthe region extending from the basic domain tothe second helix spans the loop region, whichvaries in composition and length amongvarious HLH-containing proteins, andprovides a means for assessing product het-erogeneity based on differential elec-trophoretic mobility.

PCR, of random hexamer reverse-tran-scribed total RNA extracted from stage 24(embryonic day 4) retina, yielded a single bandof approx. 140 bp, which was cloned intopBluescript II (described in Materials andMethods). Thirty clones were selected, all ofwhich had appropriately sized inserts and, ofthese, seven were randomly selected andsequenced. One of the seven was identical toMASH-1 and XASH1 and 70% identical toAS-C products, at the deduced amino acidlevel (Fig. 1), while others were unrelated. Thenucleotide sequence of our PCR productexhibits 88% identity with MASH-1, 85%identity with XASH1, and 65-69% identitywith Drosophila AS-C family members overthe corresponding bHLH-encoding region(Fig. 2).

Using our PCR product as a probe, wescreened a stage 29 (embryonic day 6) chickenhead cDNA library. A single positive plaque

was isolated, which contained an insert of approx. 1.9 kb. Webelieve that our 1.9 kb cDNA includes the entirety of theCASH-1 protein coding region as well as several hundred basepairs of 5′ and 3′ untranslated sequence, since northern blotanalysis reveals a species of approx. 2 kb (see below). TheCASH-1 cDNA has a 657-nt open reading frame encoding twoin-frame methionines, spaced 36 nt apart, and a single stopcodon. Of the two potential translation initiation sites, the firstbetter fits the consensus for eukaryotic translation initiation

1 GAATTCGGCACGAGCCGTGCACACGTGAGCGTCACGAGCCTCCCCGACGTCGACGAAGTT 60

61 CGGAGGGAGAAGGGAGGGGGGGCCCGAGCCGTCCCGTTCCCGGACGGTCGACGTCCTCCG 120

121 TGGACGCTCTCCCCTCTCCGACTTCCGCGCGTGACGAGCGGAGCCGCCGCTCCTCTCTCT 180

181 CCCCCCTCTATCTCTCCACCTCCGGCGGGGGGGCAACGGGGAGCGCCCCCGCCTCGCACG 240

DM A S G S P A G M A S G Q P P F

241 ACGCCCCCGCGCCCATGGCCAGCGGCAGCCCCGCCGGGATGGCCAGCGGGCAGCCGCCCT 300

L Q P A C F F A A A V A A A A A A A P P301 TCCTGCAGCCCGCCTGCTTCTTCGCCGCCGCCGTGGCCGCCGCCGCCGCCGCCGCTCCGC 360

G P P P G A P P P P L P Q L S P A G G R361 CGGGGCCGCCCCCGGGGGCGCCGCCGCCGCCGCTCCCGCAGCTGAGCCCGGCGGGCGGGC 420

P S P G G K P S A A R A A K R Q R S A S421 GGCCGTCTCCCGGCGGGAAGCCGTCCGCGGCGCGGGCCGCCAAGCGGCAGCGCTCGGCCT 480

P E L M R C K R R L N F S G F G Y S L P481 CGCCGGAGCTGATGCGCTGCAAGAGGCGGCTCAACTTCAGCGGCTTCGGCTACAGCCTCC 540

Q Q Q P

A A V A R R N E R E R N R V K L541 CGCAGCAGCAGCCCGCCGCCGTAGCGCGGCGCAACGAGCGGGAGCGCAACCGAGTCAAGC 600

V N L G F A T L R E H V P N G A A N K K601 TGGTGAACCTTGGGTTCGCCACGCTCCGCGAGCACGTCCCCAACGGCGCGGCTAACAAGA 660

M S K V E T L R S A V E Y I R A L Q Q L661 AGATGAGCAAAGTGGAGACGCTGCGCTCCGCCGTCGAGTACATCCGCGCCCTGCAGCAGC 720

L D E H D A V S A A S Q A G V L S P T I721 TGCTCGACGAGCACGACGCCGTCAGCGCCGCCTCCCAGGCCGGCGTGCTGTCGCCCACCA 780

S P G Y S H D M N S M A G S P V S S Y S781 TCTCGCCCGGTTACTCCCACGACATGAACTCCATGGCGGGCTCCCCCGTCTCCTCCTACT 840

S D E G S Y D P L (S) P E E Q E L L D F T841 CCTCCGACGAGGGCTCCTACGACCCGCTCAGCCCCGAGGAGCAGGAGCTGCTCGACTTCA 900

S W F *901 CCAGCTGGTTCTGATCCGGCCCCGGCAGGACGCTCGCGAAAGGGGAGATAAGCGCCTCTC 960

961 CCGCAACCACGCTCGCGGAGCACGCCACCGCCGGCCCACTACCAACTGTTGCGTTTTCCT1020

1021 CTCCCCGCCGTCGGAGGGCGGTGCGGGCACGGCTCTCGGCGGGCGGCTGCGTCCCCGCGG1080

1081 GGCGGGCGGGGCGGCCACCCTCAGCCCGGAGGCCCGAACCCCGTTCTGTGCCCCGCGGTG1140

1141 GCCCCGAGGAGCCCTTTCCCTGCTGCCCGTCCCCTCCGTACGGCGTCCGCGCTCTCTGGA1200

1201 CCACGTTTCCCGGTGTTTGTGGAGATGTCGAGATGAAGCTATGCTGTACTCAAAGAACCC1260

1261 CCCCCCCGACCCGTTCCAGAGTCGCCCTCCCTCCGACCCTTTTTTTTTTCACCATAGAAT1320

1321 GCTTCCAATTTTTTTTTTTTTAATTATTATTTTGGTGAATTTTTTTATTATAAGAAAATC1380

1381 TATTTGTATCCTCCCTGACCAGTTTGGGGACATATATTAAGCTATTTTTGTACATAAGAG1440

1441 AGAGAGAGATTTATAGAGGTTTTGTACAAATGGTTTAAAATGTGTATATCTTGATACGTT

Fig. 2. Sequence of the 1.9 kb CASH-1-encoding cDNA determined by the dideoxychain termination method (Sanger et al., 1977). The deduced amino acid sequence ofthe coding region is also shown. The translation inititation site most likely to beutilized is marked (triangle). The bHLH domain is shown in bold. This cDNA alsoencodes several additional potential functional domains. Near the N terminus, there isa proline-rich region (double-underline), an alanine-rich region (dotted underline),and a nuclear localization signal (underline). C-terminally there are several potentialsites for phosphoryation of serine, threonine and tyrosine, one of which (parentheses)conforms to the consensus sequence shared by c-myc and c-jun. The CASH-1sequence reported here has been submitted to the GenBank data base, accessionnumber UO1339.

772

(Kozak, 1984). Conceptual translation from the first in-framemethionine yields a protein of 219 amino acids.

A best-fit sequence analysis of the coding region revealed81% identity with MASH-1 at the nucleotide level (over 727bp; Fig. 2). There is no homology between CASH-1 andmembers of the AS-C or MASH-2 beyond the bHLH-encodingregion. We have also sequenced approx. 1 kb of 3′ untrans-lated sequence. There is no significant homology betweenMASH-1 and CASH-1 in this 3′ region. In addition to thebHLH, CASH-1 possesses several other potential functionaldomains. Amino-terminal to the bHLH there is a proline-richregion and an alanine-rich region, both of which may functionin transcriptional modulation (Mitchell and Tjian, 1989).Although the alanine-rich region is also present in MASH-1,the proline-rich region of CASH-1 substitutes for a glutamicacid-rich region found in MASH-1. The XASH-1 cDNA doesnot encode either of these domains. The CASH-1 cDNA alsoencodes a potential nuclear localization signal (Fig. 2), whichis similar to that found in XASH-1, and which loosely fits theconsensus described by Garcia-Bustos et al. (1991). C-terminalto the bHLH domain there are serine, threonine and tyrosineresidues which represent potential phosphorylation sites. Oneof the serine residues lies within a consensus sequence whichconforms to the serine/threonine kinase consensus sequenceshared by c-myc and c-jun (Pearson and Kemp, 1991; Alvarezet al., 1991), while several others fit the consensus for phos-phorylation by casein kinase I (Pearson and Kemp, 1991).There are several tyrosine residues which represent potentialsites for phosphorylation, similar to those described by Villaresand Cabrera (1987) for AS-C proteins. However, since tyrosinekinase substrate sequences do not exhibit consensus recogni-tion motifs (Pearson and Kemp, 1991) it is difficult todetermine the significance of these residues. Thus, althoughMASH-1 and XASH1 share considerable sequence identitywith CASH-1, each of these genes has unique domains outsidethe bHLH. The different domains may reflect species differ-ences in regulation and/or usage (e.g. different effectors, down-stream genes) of achaete-scute homologs (ASHs), but it isdifficult to determine, from our current level of understanding,whether they all perform the same (homologous) function inthe cells in which they are expressed.

Analysis of

CASH-1 expressionWe used both northern blot and in situ hybridization toexamine CASH-1 expression. Northern blot analysis, with arandom-primed probe containing bHLH-encoding sequences(Fig. 3A) or an oligonucleotide probe outside the bHLH region(Fig. 3B), reveals the presence of a single major transcript ofapprox. 2 kb and a minor species of 1.2 kb in several differentbrain regions, including diencephalon, midbrain and telen-cephalon at stage 28 (embryonic day 5.5). The highest level ofexpression was present in the midbrain. Although message forCASH-1 was not detectable in the eye at stage 28 from totalcellular RNA blots, we were able to detect message for CASH-1 by in situ hybridization at this stage and in retina at laterstages using poly(A)+-selected RNA (Fig. 3B). The same twospecies were found in the blots of retinal RNA as we hadobserved in blots from other CNS regions (Fig. 3A).

To characterize further the cells that express this gene duringdevelopment of the chick, we undertook a series of in situlocalization studies. The overall distribution of CASH-1

expression in stage 14 (50-53 hours of incubation), stage 17(52-64 hours of incubation), and stage 20 (70-72 hours of incu-bation) embryos was examined with whole-mount in situ local-ization, followed by serial sectioning. At stage 14, CASH-1-expressing cells are present in the ventral telencephalon, theoptic stalk, the diencephalon, the midbrain (not shown) and therhombencephalon (Fig. 7A). In all of these regions, exceptmidbrain, only a few expressing cells can be discerned;midbrain contains many CASH-1-expressing cells even at thisearly age. The number of CASH-1-expressing cells increasesin all of these regions as development proceeds (see below),suggesting that in many regions of the CNS stage 14 representsthe onset of CASH-1 expression. Fig. 4 shows the distributionof expressing cells in a sagittal section through the stage 17embryo. At this stage there is a small patch of cells expressingCASH-1 in the ventral prosencephalon, a part of the basal pros-encephalic plate (Fig. 4A, single arrowhead). A few cells inthe anterior prosencephalon also express the gene. At thisstage, however, there is no expression of CASH-1 in either theretina or the pigment epithelium (Fig. 4B). The dorsal mesen-cephalon has a large number of intensely labelled, denselypacked CASH-1-expressing cells (Fig. 4C). The most anteriorpart of the rhombencephalon, probably the prospective meten-cephalon, contains cells that express CASH-1 (Fig. 4A, doublearrowhead). Additionally, ventricular zone cells within andadjacent to the developing trigeminal nucleus express CASH-1 (Fig. 4A, open triangle). There are distinct groups of CASH-1-expressing cells in several of the rhombomeres (Fig. 4D,arrowheads). In a caudal to rostral sequence, CASH-1-express-ing cells are present in the first, third (very intense), fourth, andfifth (slightly) rhombomeres, but not in the second or anyrhombomeres rostral to the fifth. Throughout the rhomben-

C. L. Jasoni and others

A

B

Fig. 3. The temporalpattern of CASH-1expression is unique fordifferent CNS regions.(A) Northern blot of 10µg of total cellular RNAfrom various brainregions at two differentages. Arrowheadsrepresent 2 kb (major)and 1.2 kb (minor)transcripts. There is arelatively low level ofexpression at stage 23(lanes 1-3) in the tissues

examined (1 = whole eye, 2 =midbrain, 3 = forebrain). By stage28 (lanes 4-7), however, there is atissue-specific increase in theamount of CASH-1 mRNA (4 =diencephalon, 5 = whole eye, 6 =midbrain, 7 = telencephalon).Open triangles represent theposition of 28 S and 18 Sribosomal RNA species. (B)Northern blot of 1.5 µg ofpoly(A)+-selected RNA extractedfrom the highest-expressing retinastages (lane 1 = Ed6.5 and lane 2= Ed7.5).

773CASH in the nervous system

cephalon, sagittal sections show two distinct stripes of labelledcells extending through the rhombencephalon and the fullextent of the spinal cord (Fig. 4A, arrows). Transverse sectionsthrough the developingrhombencephalon and thespinal cord, which better showthe distribution of these cells,reveal that the ventricular zoneimmediately adjacent to thegeneral somatic afferent cellcolumn possesses the highestdensity of CASH-1-expressingcells in the rhombencephalon(not shown for stage 17). Thereis a lower level of expressionthroughout both the alar andbasal plates, both in therhombencephalon andextending the length of thespinal cord. The cells thatexpress this gene appear tostop abruptly at the margin ofthe floor plate, and immedi-ately adjacent to the floor platea column of cells that expressCASH-1 at very high levelsextends throughout therhombencephalon and thespinal cord (Fig. 6G shows thisfor a stage 20 embryo, whichexhibits an identical pattern tothat of stage 17). Scatteredcells in the preaortic gangliaexpress CASH-1 at this stage,but there is little or noexpression of the gene in thedorsal root ganglia or otherneural crest derivatives (notshown).

At stage 20, CASH-1-expressing cells persist in theelaborated derivatives of allstage 17-expressing regionsand in areas in which CASH-1expression was undetectable atstage 17. The ventral telen-cephalic plate has expandedlaterally, and the CASH-1-expressing cells are present inthe ventricular zone of themost lateral extent of the telen-cephalic vesicles (Fig. 5A). Bycontrast, labelled cells are notfound in the dorsal telen-cephalon. The diencephalonhas expanded considerably bythis stage, and here cells in theinfundibulum and ventrallateral diencephalic plates nowexpress CASH-1. There is noexpression in the retina by

stage 20. Despite the paucity of CASH-1-expressing cells in theretina at these early embryonic stages, a few (approx. 3)expressing cells can be identified in the optic stalk as early as

Fig. 4. Stage 17 embryo. (A) Sagittal view of a stage 17 chick embryo which has been subjected to insitu hybridization in solution using a digoxigenin-labelled RNA probe derived from the 1.9 kb CASH-1cDNA. (arrowhead, ventral telencephalon; double arrowhead, prospective metencephalon; opentriangle, trigeminal ganglion; arrows, dorsal and ventral spinal cord expression). (B) A highermagnification of a stage 17 eye. CASH-1 is not expressed anywhere in the eye at this stage. (C) Ahigher magnification of a stage 17 midbrain. Midbrain possesses the highest density of CASH-1-expressing cells. Scale bar, 40 µm. (D) A higher magnification of stage 17 hindbrain showingdifferential expression of CASH-1 in the rhombomeres (arrowheads). This section of hindbrain is lateralto that shown in A, but was selected because it gives better rhombomere resolution. Scale bars, 110 µm(A), 40 µm (B,C) and 70 µm (D).

774

stage 14 and this number increases slightly by stage 20 (Fig.5A). By stage 20, the dorsal mesencephalon is greatlyenlarged, and virtually the entire tectal plate contains intenselylabelled cells. This region of the CNS remains as one of the

highest expressing areas. The CASH-1-expressing cells reachthe anterior pole of the developing tectum, while the ventricu-lar cells at the posterior pole do not express the gene; thechange in CASH-1 expression may represent the division

C. L. Jasoni and others

Fig. 5. Stage 20 embryo. (A) Sagittal section showing CASH-1-expressing cells in the ventral telencephalic vesicles (T) as well as the opticstalk (OS, arrowheads). (B) Sagittal section showing CASH-1-expressing cells in the rostral two-thirds of the midbrain. Cells that expressCASH-1 are not present in the caudal third of the mesencephalon, which may represent a distinction between optic and auditory regions of themesencephalon (arrowhead). Also, there is a paucity of CASH-1 expression in cells at the meso-metencephalic fold (arrow) and inmetencephalic regions which will give rise to cerebellum. (C) Sagittal section showing CASH-1 expression in the ventricular zone underlying alarge nuclear group in the ventral mesencephalon. The highly expressing cell population of the dorsal mesencephalon has been folded over onitself and is, therefore, not easily visible. (D) Cross-section of the hindbrain. CASH-1-expressing cells are located in both ventral (arrows),adjacent to the general somatic efferent cell column, and dorsal (arrowheads), adjacent to the general somatic afferent cell column, positions.CASH-1-expressing cells are not found in the floorplate. Scale bars, 45 µm (A), 60 µm (B,C,D).

Fig. 6. CASH-1 in situ retina sections reacted with antibodies thatrecognize the 160×103 Mr neurofilament subunit reveal that althoughboth CASH-1-expressing and NF-160×103 Mr-immunoreactive cellsmay be present in a given region, the two cell types occupy discreteand non-overlapping positions. (A,B) Sagittal section of a stage 17embryo showing otic vesicle. There are a few CASH-1-expressingcells in otic vesicle at this time (B, arrowheads), although there arenot any NF-160×103 Mr-immunoreactive cells (A). (C,D) Sagittalsection of a stage 17 embryo showing the trigeminal ganglion. NF-immunoreactive cells and their processes outline the perimeter of theganglion. In contrast, CASH-1-expressing cells are present in thecenter of the ganglion, a region devoid of NF-immunoreactive cells.(E,F) Sagittal section of a stage 20 embryo showing the rhombomere(#3) which exhibits the highest density of CASH-1-expressing cells.

Caudal is up and ventral is to the right. NF-immunoreactive cells arerestricted to the ventral surface of this structure (E), while CASH-1-expressing cells occupy more dorsal positions (F). Interestingly,there appears to be heterogeneity in the level of CASH-1-expression— rostral to the highest expressing cell cluster (arrowhead) is a patchof cells which appear to express an intermediate level of CASH-1mRNA (arrow), while caudal to the highest expressing region is azone of cells which do not express any detectable CASH-1 mRNA.(G,H) Cross-section of a stage 20 embryo at the level of thehindbrain. NF-160×103 Mr-immunoreactive cells and many of theirprocesses are restricted to the ventral margins fo the ventricular zone(G). CASH-1-expressing cells are present in the ventral hindbrain,flanking, but conspicuously absent from, the floor plate. Scale bar, 45µm (A-H).

775CASH in the nervous system

776

between the developing optic and auditory tectal regions (Fig.5B). At this stage, the meso-metencephalic fold has establisheda distinction between the midbrain and the developing meten-cephalon (Fig. 5B). The ventral and lateral regions of themetencephalon contain CASH-1-expressing cells, while themore dorsal regions contain few, if any, labelled cells. Inaddition, there are CASH-1-expressing cells in the ventricularzone underlying a large nuclear group in the ventral mesen-cephalon (Fig. 5C). The pattern of labelling in the rhomben-cephalon and spinal cord is essentially the same as thatdescribed for stage 17, with CASH-1-expressing cells in twomajor zones, which probably correspond to the progenitor cellsthat give rise to the general somatic afferent and generalsomatic efferent cell columns (Fig. 5D).

Chick embryos were also processed for combined in situlocalization of CASH-1 and immunohistochemical localizationof neurofilament (Bennett and DiLullo, 1985) to identify somedifferentiated neurons at stages 17 and 20. Fig. 6 demonstratesthat at both stage 17 and 20, none of the neurofilamentimmunoreactive cells in any CNS region co-express CASH-1.At stage 17, very few scattered CASH-1-expressing cells arepresent in the otic vesicle (Fig. 6B), which possesses no neu-rofilament immunoreactive cells (Fig. 6A) at this stage. Thestage 17 developing trigeminal ganglion contains cells thatexpress CASH-1; however, the CASH-1-expressing cells arenot immunoreactive for neurofilament proteins (Fig. 6C,D). Atstage 20, neurofilament immunoreactive cells are abundant inthe medulla, as are CASH-1-expressing cells (Fig. 6E,F), butCASH-1 and neurofilament expression are mutually exclusive.A cross-section of a stage 20 hindbrain is shown in Fig. 6G,H.Although many differentiating neurons are immunoreactive forneurofilament in this region, none of the CASH-1-expressingcells also express neurofilament (Fig. 6G,H).

Expression during retinogenesis We were particularly interested in examining the distributionof CASH-1-expressing cells in the retina, since this was wherewe initially identified this gene and since the dynamic changesin the expression pattern of this gene might be better under-stood in the retina, where the details of the neurogenesis aremore well characterized than in most other CASH-1-express-ing areas. As stated above, there is no CASH-1 expression inthe retina at stage 20. By stage 24 a few CASH-1-expressingcells are present in the central retina (Fig. 7C), although noexpressing cells can be detected yet in the less matureperiphery (Fig. 7B). As development proceeds, CASH-1-expressing cells become organized into radially arrayedclusters that span the neuroepithelium. As histogenesiscontinues, the number of CASH-1-expressing cells per clusterand the number of clusters across the retina increases. By stage30 (embryonic day 6.5), the number of clusters, as well as thenumber of CASH-1-expressing cells per cluster, has increasedsubstantially (Fig. 7D), and by stage 33-34 (embryonic day7.5-8) the number of CASH-1-expressing cells has reached itspeak (not shown). Importantly, while the number of CASH-1-expressing cells per cluster increases between stage 30 andstage 33-34, the cluster density does not change; the numberof intervening non-CASH-1-expressing cells decreases. Atstage 36 (embryonic day 10), individual CASH-1-expressingcells are scattered throughout the retinal inner nuclear layer andare no longer grouped into clusters (Fig. 7F). Cells in the

pigment epithelial layer do not express the gene at this, or any,stage examined.

To investigate a possible correlation between the expressionof CASH-1 and progenitor cell proliferation, retinas werecultured for 18 hours in the presence of BrdU. As shown inFig. 7E, at stage 30, cells which have incorporated BrdU, andwere therefore mitotically active during the culture period, areevenly distributed across the retina. This distribution is incontrast to the periodicity displayed by CASH-1-expressingcells at the same stage. From this experiment it appears thatCASH-1 is expressed in a subpopulation of the mitoticallyactive neuroepithelial cells in the retina at this stage.

To gain a better understanding of the temporal pattern ofexpression of CASH-1 in the retina, we counted the number ofCASH-1-expressing cells in the neuroblastic layer (i.e. thosecells outside the ganglion cell layer) as a percentage of cells atdifferent ages (Fig. 8A). The percentage of cells expressingCASH-1 steadily increases from stage 24 and peaks three dayslater, at stage 33, when CASH-1-expressing cells make upapprox. 65% of the total cells in the neuroblastic layer. Thesedata can be directly compared to previous [3H]thymidine birth-dating studies of the developing chick retina (Fig. 8B; Pradaet al., 1991). From this figure, it is apparent that CASH-1expression occurs in the progenitor cells relatively late in thegeneration of the various retinal phenotypes. Although birth-dating analysis of the chick retina (Prada et al., 1991) hasshown a great deal of overlap in the generation of retinal celltypes, the peak of CASH-1 expression in the retina correspondsto a time when some of the later-appearing retinal cell classesare being generated.

Because the number of CASH-1-expressing cells increasesin concert with an increase in the generation of some of thelater-appearing retinal cell classes, we were interested in deter-mining whether the differentiation of any retinal cell type moreclosely parallels the expression of CASH-1. Of the differentretinal cell types that we examined with cell-type-specific anti-bodies, we found that the expression of CASH-1 in progenitorcells correlates best with the generation of amacrine cells. Fig.9 shows sections from whole-mount CASH-1 in in situ local-izations which have also been processed by immunohisto-chemistry for HPC-1 (Fig. 9E,F), an amacrine cell-specificprotein, and 160×103 Mr neurofilament subunit antibodies (Fig.9A-D), specific for ganglion cells, in the chick retina. As notedabove, the cells of the retinal neuroepithelium do not expressCASH-1 at stage 17; however, already by stage 17, thymidinebirthdating (Prada et al., 1991) and immunohistochemicallabelling with neurofilament antibodies (Fig. 9A,B) indicatethat the first ganglion cells have become postmitotic.Therefore, CASH-1 expression in the retinal neuroepitheliumdoes not appear to be necessary for the generation of retinalganglion cells. In central retina at stage 30, CASH-1-express-ing progenitor cells are flanked by HPC-1-immunoreactiveamacrine cells at the vitreal surface (Fig. 9E,F; arrows) and bynewly generated, premigratory, HPC-1-immunoreactiveamacrine cells at the scleral surface (Fig. 9E,F; arrowheads).Moreover, CASH-1-expressing cells are most abundant incentral stage 30 retina, where amacrine cells are being activelygenerated, and appear to decrease in correspondence with adecrease in amacrine cell generation moving into the lessmature peripheral retina (not shown). As noted above, theredoes not appear to be a similar correlation of CASH-1

C. L. Jasoni and others

777CASH in the nervous system

Fig. 7. CASH-1-expressing cells are distributed in a unique spatialarray in the developing retina and hindbrain, where they compriseonly a subpopulation of BrdU-incorporating cells. (A) A crosssection of a stage 14 hindbrain. CASH-1-expressing cells (arrows)flank the floor plate. Floor plate cells themselves do not expressCASH-1 nor do those of the notochord (N). (B) Peripheral stage 24retina. At this age there are not yet any CASH-1-expressing cells inthe periphery of the retina. PE, pigment epithelium; NE,neuroepithelium. (C) Central stage 24 retina. The first CASH-1-expressing cells (arrows) are present and can be found at both theventricular (pair of labeled cells adjacent to PE) and vitreal surfaces.PE, pigment epithelium; NE, neuroepithelium. (D) Central stage 30retina. CASH-1-expressing cells are present throughout theneuroepithelium (NE), but are absent from the ganglion cell layer(GCL) and the pigment epithelium (PE). Expressing cells areorganized in a repeating array of clusters (arrows). (E) Central stage30 retina, which had been cultured as an explant for 18 hours in thepresence of BrdU. BrdU-incorporating cells are localized almostexclusively to the neuroblast zone in which CASH-1-expressing cellsare also located. (F) Central stage 36 retina. Individual CASH-1-expressing cells (arrows) are scattered through the inner nuclearlayer. Scale bar, 45 µm for A,B,C; 25 µm for D,E,F.

778

expression and ganglion cell production; NF-immunoreactiveganglion cells are being generated in the far peripheral retinaat stage 30, but there is only a low level of CASH-1 expressionin the peripheral retina at this stage (Fig. 9C,D). In addition,neither of the photoreceptor cell-specific antibodies that wetested — Rho 4D2 and visinin — showed the presence of pho-toreceptors prior to the appearance of CASH-1-expressing cells(not shown), although it should be noted that neither of thesestain normal retina until quite a few days after the time at whichphotoreceptor progenitor cells undergo their terminal mitosis,as judged by [3H]thymidine incorporation birthdating studies(Prada et al., 1991).

An especially intriguing feature of CASH-1 expression in theretina is that clusters of CASH-1-expressing cells are periodi-

cally distributed across the retina and these clusters vary in sizeat different developmental ages. We have used video imaging(see Materials and Methods) to analyze the changing distribu-tion of CASH-1-expressing cells across the retina during devel-opment; the results are shown in Fig. 10. At the peak express-ing ages (stage 30-34), the density or periodicity of clustersvaries across the retina, such that in central retina clusters areclosely apposed (Fig. 7D), while in mid-peripheral retina,clusters are spaced farther apart. Although CASH-1-expressingcells are still detectable near the ciliary margin, the distancebetween clusters is quite large in peripheral retina, such thatthere is no longer any discernible periodicity (Fig. 10). Also,peripheral ‘clusters’ consist of fewer cells than those in centraland mid-peripheral locations (not shown). As developmentproceeds there is a change in the spacing of the clusters;clusters are widely spaced at the onset of expression andincrease in density as expression peaks (Fig. 10). As expressiondeclines, the periodicity breaks down, such that the remainingexpressing cells appear to be randomly scattered across theretina.

DISCUSSION

We have identified an achaete-scute homolog, CASH-1, abasic helix-loop-helix-containing protein in the chicken that ishomologous to the Drosophila achaete-scute family of tran-scription factors. CASH-1 is expressed in the developing chicknervous system in a region- and stage-specific manner. CASH-1-expressing cells are most abundant in the midbrain, and arealso present in the developing spinal cord, hindbrain, dien-cephalon and telencephalon. Moreover, throughout the CNS,CASH-1 is expressed in cells of the ventricular neuroepithe-lium and not in regions occupied by neurofilament-expressingdifferentiated neurons. The pattern of CASH-1 expression issimilar to the pattern of expression observed for MASH-1, oneof two mammalian achaete-scute homologs (Johnson et al.,1990; Lo et al., 1991) and XASH-1, a similar gene expressedin the Xenopus nervous system (Ferreiro et al., 1992). The highdegree of sequence conservation, as well as the similarities inthe anatomical and developmental localization of expressionbetween the chicken, the rat and the frog, suggests that thefunctions of these genes may be conserved. Moreover, thepattern of expression of CASH-1 is distinctly different fromthat of the other achaete-scute homologs that have beendescribed, namely MASH-2, which is not specific to thenervous system and XASH-3, which is expressed earlier in thedeveloping nervous system, in cells near the sulcus limitans(Zimmerman et al., 1993).

CASH-1 expression in the retina is restricted to asubpopulation of the dividing progenitor cellpopulation In the retina, the anatomical location of CASH-1-expressingcells suggests that CASH-1 is expressed by a subpopulation ofprogenitor cells whose density varies both temporally andspatially across the retina. At early stages of retinal develop-ment, none of the progenitor cells express this gene; however,as development proceeds, an increasing fraction of the prog-enitor population expresses CASH-1, until at the peak ofexpression at stage 32-34, most if not all of the progenitor cells

C. L. Jasoni and others

Fig. 8. The percentage of inner nuclear layer cells expressing CASH-1 changes during development, peaking during the latter part ofretinogenesis. (A) Time course of CASH-1 expression in retina wasdetermined by in situ hybridization. At each age, the number ofCASH-1-expressing cells (CASH-1+) in the inner nuclear layer(INL) is expressed as a percentage of the total INL cells. Only cellsin most central retina were counted, to avoid variability in retinalmaturity, and therefore CASH-1 expression and INL cell number, atdifferent eccentricities. (B) Time course of chick retinogenesis asdetermined by [3H]thymidine birthdating studies (adapted fromPrada et al., 1991). Comparison with A reveals that the percentage ofINL cells expressing CASH-1 peaks when all of the cell types foundin the mature retina are being generated.

779CASH in the nervous system

express the gene. The fact that CASH-1 expression appears tobe restricted to the latter part of retinal histogenesis, mayprovide some indication as to its function in neurogenesis inthe retina, as well as in other areas of the CNS (see below).We have found that CASH-1 is not expressed in progenitorcells prior to, or concomitant with, the onset of ganglion cellcommitment or differentiation in the chick retina. This is also

likely to be the case in mammals; MASH-1 is not expressed inprogenitor cells in the early embryonic rat retina (Lo et al.,1991), but is expressed at later developmental times (Jasoniand Reh, 1993). By contrast, XASH1, which is expressed in thefrog retina, is present throughout the period of retinal neuro-genesis. The difference in expression between species may bedue to a difference in the function of this gene in neurogen-

Fig. 9. CASH-1expression in theretina is preceded byNF 160×103 Mr-immunoreactivityand is best correlatedwith the genesis ofHPC-1-immunoreactiveamacrine cells in theretina. (A,B) Sagittalsection of a stage 17chicken eye. Thefirst NF-immunoreactiveganglion cells, whichare birthdated tostage 16-18 (Prada etal., 1991), can beseen in central retina(A). CASH-1-expressing cells arenot present in theretina at this age,although they areabundant in otherCNS regions (B) (L,lens; R, retina; P,pigment epithelium).(C,D) PeripheralEd6.5 retina reactedwith anti-NF160×103 Mrantibodies, whichlabel retinal ganglioncells. The majorityof ganglion cellgeneration isrestricted toperipheral retina bythis age. NF-immunoreactivecells are present nearthe vitreal surface(arrowhead) and amigratory, likely tobe newly post-mitotic, NF-immunoreactive cell(arrow) can also beseen (C).Comparison with D,a bright field of the

same section showing CASH-1-expressing cells, demonstrates that NF-immunoreactive cells do not also express CASH-1 mRNA (D, arrow andarrowhead). (E,F) Central Ed6.5 retina reacted with anti-HPC1 antibodies, which label most retinal amacrine cells. CASH-1-expressing cells(F) are flanked by HPC1-immunoreactive cells (E) in both vitreal (arrowheads) and sclearal (arrows) positions. A bright field (F) photo showsthat the HPC1-immunoreactive cells are not also expressing CASH-1 (arrows and arrowheads). Scale bars, 45 µm (A,B), 30 µm (C-F).

780

esis, or alternatively, may simply reflect differences in thetiming of cell generation between chicken and frog. Despitetheir temporal differences in expression, all three homologs aresimilar in that they appear to be expressed by a subpopulationof proliferating neuroepithelial cells.

CASH 1 is expressed in a repetitive array in thedeveloping retinaAlthough CASH-1 is expressed in the mitotically active retinalprogenitor cells, at any particular stage in development itsexpression is confined to a subset of the progenitor cells, whichare organized in radially arrayed repeating clusters. Theintriguing periodicity displayed by CASH-1-expressing cells isreminiscent of the distinct spatial array of AS-C-expressingcells seen in the CNS and thoracic imaginal discs (precursors

to PNS) of Drosophila (Dambly-Chaudiere and Ghysen, 1986,Cabrera et al., 1987), a pattern which reflects the differentiationof SMCs. It is thought that the AS-C genes somehow ‘read’the gridwork of positional information available to them frompreviously expressed positionally restricted genes, i.e. gap, pairrule, segment polarity and homeotic genes. The mechanismsby which this positional information is translated into therestricted expression of AS-C, in specific locations within thedeveloping cuticle, are not understood.

Might CASH-1 be important in setting the periodicity ofsome aspect of the retinal mosaic, in a manner analogous tothat of the Drosophila achaete-scute genes? Many of the celltypes found in the mature vertebrate retina show a regularperiodic arrangement; these repetitive arrays of differentiatedneurons are known as mosaics. Both the pattern and precision

C. L. Jasoni and others

B

C D

Num

ber

of C

ASH

-1-e

xpre

ssin

g ce

ll cl

uste

rs

Distance between cluster centers (in µm)

A

Fig. 10. The periodicity displayed by CASH-1-expressing cells in the retina changes with developmental age and central-peripheral position.(A) Periodicity of central clusters at stage 30. Although there is quite a range in the spacing between expressing clusters, most centrally placedclusters at this age are spaced 30-50 µm apart. (B) Periodicity of central clusters at stage 32. At this age the majority of clusters are spaced 30-40 µm apart, although there are still many clusters spaced more closely. (C) Periodicity of central clusters at stage 34. At this age the majorityof clusters are spaced 30-40 µm apart. Importantly, although the cluster spacing does not change from stage 32 to stage 34, there are more cellsin each cluster. Thus, there appears to be a decrease in the number of intervening non-CASH-1-expressing cells. (D) Periodicity of clusters inthe peripheral 10% of the retina at stage 32. At this eccentricity the majority of CASH-1-expressing clusters are 40-50 µm apart, more widelyspaced than in central retina at any other age. Additionally, clusters present in the most peripheral areas (peripheral approx. 2%) become verywidely spaced, accounting for the large number of clusters spaced greater than 70 µm apart.

781CASH in the nervous system

of this mosaicism is unique for different cell types, and appearsto be independent of cell density (Wassle and Riemann, 1978).Recent evidence on the development of the cone mosaic(Wikler and Rakic, 1991; Mack and Fernald, 1992) and theganglion cell mosaic (M. W. Kelley and T. A. Reh, unpub-lished observations) suggests that the orderly arrangement ofthese cells occurs soon after their generation, rather than as alater recruitment or sharpening. Therefore it is possible thatmosaicism is the result of a discrete pattern of progenitordifferentiation across the retina. A mechanism that controls thedifferentiation of particular cell types at regularly spacedpositions during development would be consistent with theperiodicity of CASH-1 expression in a subset of the progenitorcells, and by analogy with Drosophila, this gene might beinvolved in the translation of axial positional information intoregular arrays of cells.

CASH 1 expression may define a particular stage ofthe retinal progenitor Another aspect of CASH-1 expression that is interesting in thelight of a potential function for the protein, is that it is restrictedto the latter half of retinogenesis. The generation of retinal celltypes from neuroepithelial cells occurs in a precisely timedsequence, such that each cell type found in the adult retina isgenerated normally only at a particular period of developmen-tal time (Sidman, 1961). Although the mechanisms responsi-ble for orchestrating the developmentally timed appearance ofretinal cell phenotypes remain to be elucidated, the expressionof CASH-1 by subsets of retinal progenitor cells clearly shows,for the first time, that there are molecular differences amongthese cells.

As noted in the Introduction, in the Drosophila cuticle,members of the AS-C gene family appear to confer compe-tence to generate SMCs which then go on to generate the SOs.Moreover, individual members of the AS-C, which specifydifferent SO types or regions of the central nervous system,are expressed in different subsets of the neuroblast popula-tion. Mutational analyses have revealed that members of theAS-C and related proteins play a role in endowing cells withthe competence to become SMCs. In addition a recent studyof a newly identified bHLH gene, atonal, indicates thatproneural genes may also restrict the range of phenotypes theSMC can produce, to yield specific SO types. Ectopicexpression of atonal preferentially gives rise to chordotonalorgans rather than to external sense organs (Jarman et al.,1993). Thus, the AS-C proteins act to define a particular,transient, state of a progenitor. CASH-1 may be analogous toone of the AS-C members in that it is expressed in a progen-itor population which is unique with respect to the phenotypesit is capable of generating. Moreover, CASH-1, by virtue ofthe complement of genes whose expression it modulates, mayplay a role in defining this state of progenitor differentiativeability.

Although the degree of overlap in the generation of thevarious retinal cell classes in the chick retina is too great togive a definitive prediction as to which cell classes are likelyto relate to this gene, the data suggest that it would have to beone or more of the later-generated cell classes. Both thethymidine birthdating data, and the double labelling withvarious neuron-specific antibodies presented in this report,indicate that at least ganglion cells are generated prior to the

expression of CASH-1 by the progenitor cells. A role forachaete-scute homologs (ASHs) in late-appearing phenotypegeneration is consistent with the late expression of MASH-1 inthe developing rat retina, a time during which only about halfof the major classes of retinal cell types are still beinggenerated by the progenitor cells (Jasoni and Reh, 1993). Infrog, XASH1 is expressed throughout retinogenesis; however,birthdates of all of the various types of retinal cells roughlyoverlap in Xenopus (Holt et al., 1988). Thus, the hypothesisthat ASHs function to restrict the progenitor population to thegeneration of a subset of retinal phenotypes is consistent withthe observed patterns of ASH expression among the species inwhich they have been identified. XASH1 also differs fromCASH-1 and MASH-1 in that it continues to be expressed, wellafter neurogenesis in central retina is complete (Ferreiro et al.,1992), by cells in the marginal zone. However, the adult frogretina retains a pool of progenitor cells (Wetts et al., 1989) atthe peripheral margin, which are absent from chicken and ratretina.

Lineage studies of developing retina in mammals, chickensand frogs have shown that the progeny of single progenitorcells can be composed of any of the various major retinal cellclasses (Wetts and Fraser, 1988; Turner and Cepko, 1988;Turner et al., 1990). On the other hand, it has been known formany years that the various retinal cell phenotypes aregenerated in a well-defined sequence, shared by most verte-brates (see Reh, 1992b for a review). These two facts have ledto the general hypothesis that a series of cell inductions takesplace during retinal histogenesis, such that the early differen-tiating cell types induce the multipotent progenitor to generatethe later phenotypes. Cell ablation experiments and hete-rochronic co-culture experiments have both provided evidencein favor of this model (Reh and Tully, 1986; Reh, 1987, 1992a;Watanabe and Raff, 1992; Altschuler and Cepko, 1992).However, other lines of evidence have suggested that differ-ences exist among the progenitor population from earlyembryonic retinas and late embryonic and postnatal retinas.First, in an attempt prematurely to induce the differentiation ofprogenitor cells by manipulation of their second messengercascade, we found that while late embryonic and postnatalprogenitor cells could be induced to differentiate in responseto increasing levels of intracellular cyclic AMP, earlyembryonic progenitor cells did not respond to this treatment(Taylor and Reh, 1989). Second, progenitor cells from earlyembryonic retinas are stimulated to proliferate with bFGF, butnot with TGFα or EGF, while late embryonic and postnatalprogenitor cells respond to all of these factors (Anchan et al.,1991; Lillien and Cepko, 1992). Third, while heterochronic co-culture studies have demonstrated that the developing microen-vironment can influence the differentiation of rod photorecep-tors in vitro, the ability of early embryonic cells to generaterods is more limited than postnatal progenitors (Watanabe andRaff, 1990). These studies taken together, support the idea thatintrinsic differences exist between early and late retinal prog-enitors; the expression of CASH-1 appears to follow this func-tional distinction. Early retinal progenitors, competent togenerate ganglion cells, horizontal cells and cone photorecep-tors, do not require ASH-1 expression, while progenitorscompetent to generate later phenotypes express this gene. Atintermediate stages of retinal development in the chicken, thetwo classes of progenitors appear to co-exist.

782

Transcriptional regulation of vertebrate achaete-scute homologsNeither AS-C products (Cabrera et al., 1987; Romani et al.,1987) nor their chicken or mammalian homologs (Lo et al.,1991 and this report) are expressed by cells that are terminallydifferentiated. Furthermore, it appears that AS-C products arenecessary, but not sufficient for progenitor cells to adopt aneuroblast fate. Results of experiments with MASH-1 point toa functional similarity between vertebrate and fly achaete-scuteproteins. In mouse P19 embryonal carcinoma cells, MASH-1expression is upregulated concomitant with differentiationalong a neuronal pathway, in response to treatment withretinoic acid (Johnson et al., 1992) Misexpression of MASH-1in undifferentiated P19 cells, however, fails to promoteneuronal differentiation in the absence of retinoic acid. Addi-tionally, transfection of fibroblasts with a MASH-1-encodingplasmid does not convert these cells to a neuronal phenotype(Johnson et al., 1990). Taken together, these data suggest that,like AS-C members, their vertebrate homologs may benecessary but not sufficient to lead to the acquisition ofneuronal fate. Nevertheless, the high degree of conservation insequence and pattern of expression suggests that these genesplay an important role in neurogenesis. The results presentedin this report show that for the retina, at least, this function islikely to be confined to a particular phase of neurogenesis,when specific neuronal phenotypes are generated.

The authors would like to thank Jennifer Northrup for exquisitetechnical assistance, and Dr Susan Brockerhoff for her critique andcomments on this manuscript. This work was supported by NationalEye Institute predoctoral training grant T32-EY07031 to C. L. J., NSFBNS-911076 and NIH NS28308.

REFERENCES

Altschuler, D. and Cepko, C. (1992). A temporally regulated, diffusibleactivity is required for rod photoreceptor development in vitro. Development114, 947-957.

Alvarez, E., Northwood, I. C., Gonzalez, F. A., Latour, D. A., Seth, A.,Abate, C., Curran, T. and Davis, R. J. (1991). Pro-leu-ser/thr-pro is aconsensus primary sequence for substrate protein phosphorylation.Characterization of the phosphorylation of c-myc and c-jun proteins by anepidermal growth factor receptor threonine 669 protein kinase. J. Biol. Chem.266, 15277-15285.

Anchan, R. M., Reh, T. A., Angello, J., Balliet, A. and Walker, M. (1991).EGF and TGF-α stimulate retinal neuroepithelial cell proliferation in vitro.Neuron 6, 923-936.

Anderson, D. J. (1989). The neural crest cell lineage problem: Neuropoeisis?Neuron 3, 1-12.

Barnstable, C. J. (1980). Monoclonal antibodies which recognize different celltypes in the rat retina. Nature 286, 231-235.

Bennett, G. S. and DiLullo, C. D. (1985). Transient expression of aneurofilament protein by replicating neuroepithelial cells of the embryonicchick brain. Dev. Biol. 107, 107-127.

Benezra, R., Davis, R. L., Lockshon, D., Turner, D. L. and Weintraub, H.(1990). The protein Id: A negative regulator of helix-loop-helix DNAbinding proteins. Cell 61, 49-59.

Cabrera, C. V., Martinez-Arias, A. and Garcia-Bellido, G. (1987). Theexpression of three members of the achaete-scute complex correlates withneuroblast segregation in Drosophila. Cell 50, 425-433.

Campuzano, S. and Modolell, J. (1992). Patterning of the Drosophila nervoussystem: The achaete-scute complex. Trends Genet. 8, 202-208.

Cubas, P., deCelis, J.-F., Campuzano, S. and Modolell, J. (1991).Proneuronal clusters of achaete-scute expression and the generation ofsensory organs in the Drosophila imaginal wing disc. Genes Dev. 5, 996-1008.

Dambly-Chaudiere, C. and Ghysen, A. (1986). The sense organs in theDrosophila larva and their relation to the embryonic pattern of sensoryneurons. Roux’s Arch. Dev. Biol. 195, 222.

de Celis, J. F., Mari-Beffa, M. and Garcia-Bellido, A. (1991). Function oftrans-acting genes of the achaete-scute complex in sensory organ patterningin the mesonotum of Drosophila. Roux’s Arch. Dev. Biol. 200, 64-76.

Ellis, H. M., Spann, D. R. and Posakony, J. W. (1990). extramacrochaetae, anegative regulator of sensory organ development in Drosophila, defines anew class of helix-loop-helix proteins. Cell 61, 27-38.

Ferreiro, B., Skoglund, P., Bailey, A., Dorsky, R. and Harris, W. A. (1992).XASH1, a Xenopus homolog of achaete-scute: a proneural gene in anteriorregions of the vertebrate CNS. Mech. Dev. 40, 25-36.

Garcia-Bustos, J., Heitman, J. and Hall, M. N. (1991). Nuclear proteinlocalization. Biochim. Biophys. Acta 1071, 83-101.

Ghysen, A. and Dambly-Chaudiére, C. (1988). From DNA to form: theachaete-scute complex. Genes Dev. 2, 495-501.

Harland, R. M. (1991). In situ hybridization: An improved whole mountmethod for Xenopus embryos. Meth. Cell. Biol. 36, 685-695.

Holt, C. E., Bertsch, T. W., Ellis, H. M. and Harris, W. A. (1988). Cellulardetermination in the Xenopus retina is independent of lineage and birthdate.Neuron 1, 15-26.

Jasoni, C. L. and Reh, T. A. (1993). Temporal and spatial pattern of MASH-1and CASH-1 in the developing rat and chicken retina. Invest. Ophthal. Vis.Sci., Suppl., Abstract #813.

Jarman, A. P., Grau, Y., Jan, L. Y. and Jan, Y. N. (1993) atonal is aproneural gene that directs chordotonal organ formation in the Drosophilaperipheral nervous sytem. Cell 73, 1307-1321.

Johnson, J. E., Birren, S. J. and Anderson, D. J. (1990). Two rat homologuesof Drosophila achaete-scute specifically expressed in neuronal precursors.Nature 346, 858.

Johnson, J. E., Zimmerman, K., Saito, T. and Anderson, D. J. (1992).Induction and repression of mammalian achaete-scute homolog (MASH)gene expression during neuronal differentiation of P19 embryonal carcinomacells. Development 114, 75-87.

Kozak, M. (1984). Compilation and analysis of sequences upstream from thetranslational start site in eukaryotic mRNAs. Nucleic Acids Res. 12, 857-872.

Lillien, L. and Cepko, C. L. (1992). Control of proliferation in the retina:temporal changes in responsiveness to FGF and TGFa. Development 115,253-266.

Lo, L.-C., Johnson, J. E., Wuenschell, C. W., Saito, T. and Anderson, D. J.(1991). Mammalian achaete-scute homolog 1 is transiently expressed byspatially restricted subsets of early neuroepithelial and neural crest cells.Genes Dev. 5, 1524-37.

Mack, A. F. and Fernald, R. D. (1992). Control of vertebrate retinal cellproduction. Exp. Neurol. 115, 65-68.

Mitchell, P. J. and Tjian, R. (1989). Transcriptional regulation in mammaliancells by sequence-specific DNA binding proteins. Science 245, 371-378.

Murre, C., McCaw, P. S., Vaessin, H., Caudy, M., Jan, L. Y., Jan, Y. N.,Cabrera, C. V., Buskin, J. N., Hauschka, S. D., Lassar, A. B., Weintraub,H. and Baltimore, D. (1989a). Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to commonDNA sequences. Cell 58, 537-544.

Murre, C., McCaw, P. S., and Baltimore, D. (1989b). A new DNA bindingand dimerization motif in immunoglobulin enhancer binding, daughterless,MyoD, and myc proteins. Cell 56, 777-783.

Negishi, K., Kato, S. and Teranishi, T. (1983). Development of retinalmonoamine neurons in larval goldfish: A histofluorescence study. Brain Res.312, 111-116.

Pearson, R. B. and Kemp, B. E. (1991). Protein kinase phosphorylation sitesequences and consensus specificity motifs: Tabulations. Meth. Enzymol.200, 62-81.

Prada, C., Puga, J., Pérez-Méndez, L., Lopez, R. and Ramirez, G. (1991).Spatial and temporal patterns of neurogenesis in the chick retina. Eur. J.Neurosci. 3, 559-569.

Reh, T. A. and Tully, T. (1986). Regulation of tyrosine hydroxylasecontaining amacrine cell number in larval frog retina. Dev. Biol. 114, 463-469.

Reh, T. A. (1987). Cell-specific regulation of neuronal production in the larvalfrog retina. J. Neurosci. 7, 3317-3324.

Reh, T. A. (1992a). Cell interactions determine neuronal phenotypes in rodentretinal cultures. J. Neurobiol. 23, 1067-1083.

Reh, T. A. (1992b). Generation of neuronal diversity in the vertebrate retina. InDeterminants of Neuronal Identity,. (ed. M. Shankland and E. R. Macagno),pp. 433-62. New York: Academic Press.

C. L. Jasoni and others

783CASH in the nervous system

Romani, S., Campuzano, S. and Modolell, J. (1987). The achaete-scutecomplex is expressed in neurogenic regions of Drosophila embryos. EMBOJ. 6, 2085-2092.

Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: aLaboratory Manual. Cold Spring Harbor Laboratory Press.

Sanger, F., Nicklen, S. and Coulson, A. R. (1977). DNA sequencing withchain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5466.

Sidman, R. L. (1961). Histogenesis of mouse retina studied with 3H-thymidine. In The Structure of the Eye (ed. G. Smelser), pp. 487-506. NewYork: Academic Press.

Taylor, M. and Reh, T. A. (1989). Induction of differentiation of rat retinal,germinal, neuroepithelial cells by dbcAMP. J. Neurobiol. 21, 470-481.

Turner, D. L. and Cepko, C. L. (1988). A common progenitor for neurons andglia persists in rat retina late in development. Nature 328, 131-136.

Turner, D. L., Snyder, E. Y. and Cepko, C. L. (1990). Lineage-independentdetermination of cell type in the embryonic mouse retina. Neuron 4, 833-845.

Villares, R. and Cabrera, C. V. (1987). The achaete-scute gene complex of D.melanogaster: Conserved domains in a subset of genes required forneurogenesis and their homology to myc. Cell 50, 415-424.

Wassle, H. and Reiman, H. J. (1978). The mosaic of nerve cells in themammalian retina. Proc. R. Soc. Lond. B. 200, 441-461.

Walsh, C. and Polley, E. H. (1985). The topography of ganglion cellproduction in the cat’s retina. J. Neurosci 5, 751.

Watanabe, T. and Raff, M. C. (1990). Rod photoreceptor development invitro: Intrinsic properties of proliferating neuroepithelial cells change asdevelopment proceeds in the rat retina. Neuron 4, 461-467.

Watanabe, T. and Raff, M. C. (1992). Diffusible rod-promoting signals in thedeveloping rat retina. Development 114, 899-906.

Wetts, R. and Fraser, S. E. (1988). Multipotent precursors can give rise to allmajor cell types of the frog retina. Science 239, 1142.

Wetts, R., Serbedzija, G. N., and Fraser, S. E. (1989). Cell lineage analysisreveals multipotent precursors in the ciliary margin of the frog retina. Dev.Biol. 136, 254-263.

Wikler, K. C. and Rakic, P. (1991). Relation of an array of early-differentiating cones to the photoreceptor mosaic in the primate retina.Nature 351, 397-400.

Zimmerman, R. P., Polley, E. H. and Fortney, R. L. (1988). Cell birthdaysand rate of differentiation of ganglion and horizontal cells of the developingcat’s retina. J. Comp. Neurol. 274, 77-90.

Zimmerman, K., Shih, J., Bars, J., Cellazo, A. and Anderson, D. J. (1993)XASH-3, a novel Xenopus achaete-scute homolog, provides an early markerof planor neural induction and position along the mediolateral axis of theneural plate. Development 119, 221-232

(Accepted 20 December 1993)