Monday 3/13/06

7.013 Quiz 1 Answers

Average is 77.1

A > 88 B > 75 C > 60 D > 50

Regrade requests (with a note attached indicating the problem and part you want reexamined) accepted until Thursday March 23rd 4:30pm, in 68-120.

Question Value Score

1 21

2 17

3 13

4 21

5 28

100

7.013 Spring 2006 Quiz 1 answers 2

Question 1 The following picture depicts a replication fork. a) Fill in the appropriate polarity of the DNA strands in the diagram in each of the six boxes. 3 pts b) True or False. Circle either T or F to indicate the appropriate answer.

The DNA sequence in the leading strand is identical to the DNA sequence in the lagging strand. 1 pt The DNA sequence in the leading strand is identical to the DNA sequence in the lagging strand template. 1 pt

T F

T F

Leading strand

A

B

Okazaki fragments

Lagging Strand

Template

Leading Strand

Template

3’

5’

5’

5’

3’

3’

7.013 Spring 2006 Quiz 1 answers 3

c) What is the main function of the enzyme labeled as A in the diagram? 3 pts

i) unwinds the DNA ii) binds to DNA to prevent degradation iii) adds telomere repeat sequence to the end of chromosomes iv) links the fragments on the lagging strand together v) adds DNA nucleotides to the growing DNA strand

d) What is the main function of the enzyme labeled as B in the diagram? 3 pts

i) unwinds the DNA ii) binds to DNA to prevent degradation iii) adds telomere repeat sequence to the end of chromosomes iv) links the fragments on the lagging strand together v) adds DNA nucleotides to the growing DNA strand

e) What is the function of primase? Circle all that apply. 3pts

i) synthesizes RNA oligonucleotides to start transcription ii) synthesizes DNA oligonucleotides to start transcription iii) synthesizes RNA oligonucleotides to start replication iv) synthesizes DNA oligonucleotides to start replication v) synthesizes RNA oligonucleotides to start translation vi) synthesizes DNA oligonucleotides to start translation

f) If the percentage of cytosine in a double stranded DNA molecule is 20%, then what is the percentage of thymine in this double stranded DNA molecule? 3 pts

0% 10% 20% 30% 40% 80% g) If the percentage of adenine in an mRNA is 20%, then what is the percentage of uracil in this mRNA? 4 pts

0% 10% 20% 30% 40% 80%

Can’t be determined

Can’t be determined

7.013 Spring 2006 Quiz 1 answers 4

Question 2

A scientist, Dr. Who, decides to study a gene, pinballwizard, which is involved in the development of zebrafish. When this gene is mutated, the fish have severe developmental defects, which include deafness and blindness. An internal portion of pinballwizard that is transcribed is shown below:

5’----------------GACGTAATGGGATCCATTCACATGTCA--------3’ 3’----------------CTGCATTACCCTAGGTAAGTGTACAGT-------–5’

a) What will be the first 5 nucleotides of mRNA that is transcribed in the sequence shown above? 3 pts

i) 5’ – CUGCA – 3’ ii) 5’ – UGACA – 3’ iii) 5’ – ACUGU – 3’ iv) 5’ – GACGU – 3’ v) 5’ – AUGUG – 3’ vi) 5’ - AUGGG - 3’ vii) 5’ - UACCC - 3’

Another internal part of the pinballwizard mRNA transcript that is translated is:

5’ – ACAGCAAGCUUUAGGUGCCUCAAC – 3’

b) Starting at the appropriate end of the sequence above, indicate the resulting amino acid sequence that would be translated if the first 3 nucleotides depict an inframe codon. The single-letter code of amino acids is used. 4 pts i) NH3- T - A – R – L – R – C – L – N – COOH ii) NH3- C – M – P – W – S – L – V – P – COOH iii) NH3- H – L – R – G – F – R – T - T – COOH iv) NH3- T – A – S – F – R – C – L – N – COOH v) NH3- C – L – R – W – G – L – V – N – COOH vi) NH3- Q – L – R – G – F – R – T – T – COOH

c) What is the nucleotide sequence of the tRNA anti-codon that would interact with the codon underlined in the sequence below? 4 pts

5’ – ACAGCAAGCUUUAGGUGCCUCAAC – 3’ i) 5’ – UCG – 3’ ii) 5’ – GCU – 3’ iii) 5’ – TCG – 3’ iv) 5’ – AGC – 3’ v) 5’ – CGA – 3’ The mutated form of another translated portion of the mRNA sequence of pinballwizard along with the wildtype sequence, are shown below, in codons separated by spaces.

pinballwizard Promoter

Transcription start

Transcription stop

7.013 Spring 2006 Quiz 1 answers 5

Wild-type: 5' - GCU AGC UGC AAG CCA AUA CGC UGG - 3' Mutant: 5’ - GCU AGC UGA AAG CCA AUA CGC UGG - 3’

d) What is the resulting amino acid sequence derived from the mutant sequence? Write left to right from the N terminus to the C terminus and use the SINGLE letter code. You may leave some boxes blank. 3 pts f) What kind of mutation is this? 3 pts

i) missense ii) nonsense iii) frameshift iv) silent v) no mutation

U C A G

U UUU phe (F) UUC phe (F) UUA leu (L) UUG leu (L)

UCU ser (S) UCC ser (S) UCA ser (S) UCG ser (S)

UAU tyr (Y) UAC tyr (Y) UAA STOP UAG STOP

UGU cys (C) UGC cys (C) UGA STOP UGG trp (W)

U C A G

C CUU leu (L) CUC leu (L) CUA leu (L) CUG leu (L)

CCU pro (P) CCC pro (P) CCA pro (P) CCG pro (P)

CAU his (H) CAC his (H) CAA gln (Q) CAG gln (Q)

CGU arg (R) CGC arg (R) CGA arg (R) CGG arg (R)

U C A G

A AUU ile (I) AUC ile (I) AUA ile (I) AUG met (M)

ACU thr (T) ACC thr (T) ACA thr (T) ACG thr (T)

AAU asn (N) AAC asn (N) AAA lys (K) AAG lys (K)

AGU ser (S) AGC ser (S) AGA arg (R) AGG arg (R)

U C A G

G GUU val (V) GUC val (V) GUA val (V) GUG val (V)

GCU ala (A) GCC ala (A) GCA ala (A) GCG ala (A)

GAU asp (D) GAC asp (D) GAA glu (E) GAG glu (E)

GGU gly (G) GGC gly (G) GGA gly (G) GGG gly (G)

U C A G

A S

6

Question 3

You are a genetic counselor who is advising a couple, Becky and Adam, who are expecting their first child. They are concerned because Becky’s family has a history of stumblism. Three of her uncles have it. Becky is concerned that her child will inherit this condition. You construct the pedigree below based on her information. Assume complete penetrance. Assume people marrying into the family do not carry a disease allele.

a) Circle the most likely mode of inheritance for stumblism. 5 pts

Autosomal Recessive

Autosomal Dominant

X-linked Recessive

X-linked Dominant

Y-linked

b) Circle the genotype of the following individuals. Circle only one answer for each.

i) Individual 1? 1 pts Homozygous

normal Heterozygous

Homozygous mutant

XY

(normal) XmutY XYmut Can’t be

determined

3

7

ii) Individual 2? 1 pt

Homozygous normal

Heterozygous Homozygous

mutant XY

(normal) XmutY XYmut Can’t be

determined

iii) Individual 3? 1 pt

Homozygous normal

Heterozygous Homozygous

mutant XY

(normal) XmutY XYmut Can’t be

determined

c) What are the odds that Becky is a carrier? 2 pt

0% 12.5% 25% 33% 50% 66% 75% 100% Can’t be determined

d) Based on your answer to c) above, what are the odds Becky and Adam will have an affected child? Show your work and write your answer in the box. Express your answer as a fraction. 3 pts ¼ chance Becky carries ½ chance she’ll pass on affected gene ½ chance child will be male ¼ X ½ X ½ = -----------------------------------------

1/16

8

Question 4

You observe some indigenous bird species on a deserted island. One species particularly attracts your attention. In honor of your success in 7.013 you name it Biologius introductus. You bring two varieties of this species home with you for future study: an amber-eyed, black-beaked variety and a white-eyed, orange-beaked variety. Interestingly, you determine that unlike humans with 23 chromosomes pairs, this bird species has only two distinct chromosome pairs. You cross true-breeding birds: an amber-eyed, black-beaked bird with a white-eyed, orange-beaked bird and discover that all the progeny are amber-eyed and orange-beaked.

a) For eye color, E is the allele conferring the dominant phenotype, and e is the allele conferring the recessive phenotype. For beak color, B is corresponds to the dominant allele and b corresponds to the recessive allele. Using this convention, fill in the genotypes below:4 pts

Amber eyes, black beaks EEbb X eeBB White eyes, orange beaks

EeBb Amber eyes, orange beaks

b) You consider mating a bird from the F1 generation to a white-eyed, orange-beaked bird from the parental generation and produce 50 offspring. How many birds would you expect to be: 4 pts

25 Amber eyed birds?

50 Orange beaked birds?

You decide that before you do anything else, you should do a test cross of an F1 bird with a doubly recessive bird. The progeny display the following distribution:

Amber eyes, black beaks 25 Amber eyes, orange beaks 26 White eyes, black beaks 24 White eyes, orange beaks 25

c) Identify any “recombinant” classes. -4 pts.

i) Amber eyes, black beaks ii) Amber eyes, orange beaks iii) White eyes, black beaks iv) White eyes, orange beaks

9

It turns out that another research group is also studying this species. You read in their paper that they have mapped the gene for Toe length (T) to 22 map units away from the eye color gene (E). And they found that T is unlinked to the Beak gene (B). d) Draw three chromosomal arrangements of Biologius introductus for the “eye”, “beak” and “toe” genes in the boxes below. Use E, B, and T for the gene names and include any map distance between them. 9 points

Arrangement 1

Arrangement 2

Arrangement 3

E T B 22 m.u.

E T B 22 m.u.

T E B 22 m.u. 50 m.u.

50 m.u.

On different chromosomes

10

Question 5 Examine the two functionally similar but structurally different macromolecules shown below. Answer the questions on the following pages. Molecule A: Primary Sequence: 5’GGGGUACAUCUGUGUACAACGAAUUUGUAAAACGCAUUCGCUUCAUUUGUGACGUU-3’

Secondary Structure: Molecule B Primary Sequence: MVAGVSEYELPEDPRWELPRDRLVLGKPLGEGAFGQVVLAEAIGLDKDKPNRVTKVAVKMLKSDATEKDLSDLISEMEMMKMIGKHKNIINLLGACTQDGPLYVIVEYASKGNLREYLQARRPPGLEYSYNPSHNPEEQLSSKDLVSCAYQVARGMEYLASKKCIHRDLAARNVLVTEDNVMKIADFGLARDIHHIDYYKKTTNGRLPVKWMAPEALFDRIYTHQSDVWSFGVLLWEIFTLGGSPYPGVPVEELFKLLKEGHRMDKPSNCTNELYMMMRDCWHAVPSQRPTFKQLVEDLDRIVALTSNQE

Tertiary Structure of Macromolecule B:

11

a) Answer the following questions with the correct letter from below in the columns to the right. 1 point each

Macromolecule A

Macromolecule B

i) What is the Monomer of Each Macromolecule? A. Nucleotide B. Phospholipid C. Amino Acid D. Lego Block E. Tubulin

A C

ii) Considering the monomer from question i) directly above, which polymer is formed for each Macromolecule? A. Lipid B. Polypeptide/Protein C. RNA D. DNA E. None of the above.

C B

iii) What is the Bond made between monomers to form polymer? A. Peptide Bond B. Ionic C. Phosphodiester Linkage D. 007 E. None of the above.

C A

iv) Polymerization of each polymer occurs in what direction? A. 3’ 5’ B. 5’ 3’ C. C terminus N terminus D. N terminus – C terminus E. None of the above.

B D

b) In Macromolecule B below, name the circled elements of secondary structure on the adjacent lines. 1 point each.

X c) What type of bond holds together each example of secondary structure. Choose from covalent bond, hydrogen bond, ionic bond, and VDW interaction.

Y

In X. hydrogen In Y. hydrogen

Beta sheet

Alpha helix

12

d) Below are the plots of activity (hydrolysis of ATP). Activity Units (A.U.) vs TIME. 1 point each graph

Normal catalytic activity is measured and graphed below.

Macromolecule A Macromolecule B

i) Sketch what these plots of activity over time would look like with the addition of a protease to the reaction AT T = 5 MINUTES.

Macromolecule A Macromolecule B

ii) Sketch what these plots of activity over time would look like with the addition of a nuclease, to the reaction AT T = 5 MINUTES.

Macromolecule A Macromolecule B

iii) Sketch what these plots of activity over time would look like with the addition of a lipase, which degrades lipids, to the reaction AT T = 5 MINUTES.

Macromolecule A Macromolecule B

Arrows indicate time of addition

of protease.

Arrows indicate time of addition

of nuclease.

Arrows indicate time of addition of lipase, which degrades lipids.

13

e) What is the term used to describe a biological catalyst? 2 points Below is a representation of an internal portion of Macromolecule B. f) What is the strongest interaction between the amino acid side chains at each of the four points? 2 points each. 1. covalent bond hydrogen bond ionic bond 2. covalent bond hydrogen bond ionic bond 3. covalent bond hydrogen bond ionic bond 4. covalent bond hydrogen bond ionic bond

CH2

S

S

CH2

CH2

OH

O

C—O-

CH2

-CH2-C-NH2 O=C-CH2-

O NH2

CH3 CH3 / \

-CH CH- \ /

CH3 CH3

1. 2.

3.

4.

Enzyme

(VDW) van der Waals

interaction (VDW)

van der Waals interaction

(VDW) van der Waals

interaction

(VDW) van der Waals

interaction