-
Proc. Nat!. Acad. Sci. USAVol. 88, pp. 174-178, January
1991Biochemistry
A -1 ribosomal frameshift in a double-stranded RNA virus ofyeast
forms a gag-pol fusion protein
(RNA polymerase/lacZ fusion/L-A virus)
JONATHAN D. DINMAN, TATEO ICHO*, AND REED B. WICKNERSection on
the Genetics of Simple Eukaryotes, Laboratory of Biochemical
Pharmacology, National Institute of Diabetes and Digestive and
Kidney Diseases,National Institutes of Health, Bethesda, MD
20892
Communicated by Herbert Tabor, September 20, 1990 (received for
review August 3, 1990)
ABSTRACT The L-A double-stranded RNA (dsRNA) vi-rus of
Saccharomyces cerevisiae has two open reading frames(ORFs). ORF1
encodes the 80-kDa major coat protein (gag).ORF2, which is
expressed only as a 180-kDa fusion protein withORF1, encodes a
single-stranded RNA-binding domain and hasthe consensus sequence
for RNA-dependent RNA polymerasesof (+)-strand and double-stranded
RNA viruses (pol). We showthat the 180-kDa protein is formed by -1
ribosomal frame-shifting by a mechanism indistinguishable from that
of retro-viruses. Analysis of the "slippery site" suggests that a
lowprobability of unpairing of the aminoacyl-tRNA from the0-frame
codon at the ribosomal A site reduces the efficiency
offrameshifting more than the reluctance of a given tRNA to haveits
wobble base mispaired. Frameshifting of L-A requires apseudoknot
structure just downstream of the shift site. Theefficiency of the
L-A frameshift site is 1.8%, similar to theobserved molar ratio in
viral particles of the 180-kDa fusionprotein to the major coat
protein.
The pol genes of retroviruses are expressed as gag-pol
orgag-pro-pol fusion polyproteins (1) formed either by
in-frameread-through of termination codons (2, 3) or by
ribosomalframeshifting (4-6). Both mechanisms allow for
productionof multiple proteins from a single, unmodified mRNA.
In Rous sarcoma virus (RSV), gag and pol genes overlap,with pol
being in the -1 frame with respect to gag (7). In 5%of
translations, a -1 frameshifting event allows ribosomes tomiss the
gag termination codon and continue to translate thepol gene,
producing a gag-pol fusion protein (8, 9). A -1ribosomal
frameshifting has also been described in corona-viruses [(+)
single-stranded (ss) RNA genomes] (10, 11),phage T7 (12), and in
the dnaX gene of Escherichia coli(13-15). A +1 ribosomal frameshift
is seen in the yeastretrotransposon Tyl (16-18) and in the E. coli
release factor2 (19-21).The signals responsible for -1 ribosomal
frameshifting
include a "slippery site" heptamer, X XXY YYZ (gag readingframe
indicated; X = A, U, or G; Y = A or U; Z = A, U, orC), followed by
a stem-loop structure that can be involved inan RNA pseudoknot (4,
9, 13, 20, 22, 23). A pseudoknot isbase pairing ofthe loop with a
sequence 3' ofa stem-loop (24,25). The "simultaneous slippage"
model of Jacks et al. (4)proposes that the tRNAs bound at the
ribosomal P site toXXY and at theA site to YYZ simultaneously slip
back 1 baseon the mRNA to pair with XXX and YYY,
respectively.Because their nonwobble bases remain properly paired,
thiscan happen at a finite rate (Fig. 1). The stem-loop
structurehas been demonstrated to be essential for efficient
frame-shifting in RSV (4), infectious bronchitis virus (23), and
theE. coli dnaX gene (13) and is predicted to occur following
theslippery site heptamers of a number of other retroviruses
(4,
9, 23). RNA secondary structure downstream of the slipperysite
may slow or stall ribosomes such that they remain in theslippery
site longer, thus promoting frameshifting (4).The L-A genome (Fig.
1A) has two open reading frames
(ORFs). ORF1 encodes the 80-kDa major coat protein (anal-ogous
to retroviral gag). ORF2 has a sequence pattern typicalof the
RNA-dependent RNA polymerases of (+) ssRNAviruses and
double-stranded (ds) RNA viruses (analogous topol) and a ssRNA
binding activity thought to be involved inthe packaging process
(26-30). Fusion of ORF1 and ORF2produces the 180-kDa gag-pol-like
protein. ORF1 and ORF2overlap by 130 base pairs (bp) and ORF2 is in
the -1 framewith respect to ORF1. It has been proposed that a
-1ribosomal frameshifting event at the site in the overlap
regiondiagrammed in Fig. 1B results in production of the
180-kDaviral protein (26).We present strong evidence that -1
ribosomal frameshift-
ing fuses ORF1 and ORF2 and analyze the RNA
sequencesresponsible. Frameshifting of L-A requires the
predictedheptamer and a pseudoknot structure that involves the
pre-dicted stem-loop structure. We suggest that weak mRNA-tRNA
interactions at the ribosomal A site are required
forframeshifting.
MATERIALS AND METHODSStrains. Yeast strain 2907 (MATa his3-d200
1eu2- trpl-d901
ura3-52 ade2-10 K-) was used for transformation (31).Strains
were grown on YPAD broth or complete synthetic trpmedium (H-trp)
(32).Enzymes and Plasmid Constructions. Plasmid construction
(33), use of the Muta-Gene in vitro mutagenesis kit
(Bio-Rad)(34), and sequencing of dsDNA plasmids with modified T7DNA
polymerase (35) (Sequenase V.2.0; United States Bio-chemical) were
by standard procedures.The parent expression plasmid, p375, is
derived from
YEpIPT (36) and was obtained from Genentech. p375 containsthe
following: an ori and the P3-lactamase gene from pBR322,the yeast
TRPI gene, the ori of the 2-,u yeast plasmid, and apolylinker 3' of
the yeast PGKI promoter. p375 was modifiedto include a
translational start site 3' of the PGKI promoterand 5' of the
polylinker to create pTI21. pTI21 was digestedwith Sst I and S1
nuclease and the BamHI lacZ fragment frompMC1790 (37) treated with
T4 DNA polymerase was insertedto produce pTI23. pTIL121 contains
the EcoRI/Pst I fragmentof L-A (bases 1763-2122) including the
region of overlap ofORF1 and ORF2 inserted into the Bluescript SK+
vector(Stratagene) cut with the same enzymes. pTI23 was cleaved
atthe BamHI and Kpn I sites in the polylinker and three sets
ofoligonucleotide linkers were inserted to generate pTI24 (lacZ
Abbreviations: RSV, Rous sarcoma virus; ss, single stranded;
ds,double stranded; ORF, open reading frame; ,3-gal,
B3-galactosidase.*Present address: Tokyo Medical and Dental
University, Tokyo,Japan.
174
The publication costs of this article were defrayed in part by
page chargepayment. This article must therefore be hereby marked
"advertisement"in accordance with 18 U.S.C. §1734 solely to
indicate this fact.
Dow
nloa
ded
by g
uest
on
June
7, 2
021
-
Proc. Natl. Acad. Sci. USA 88 (1991) 175
A Two L-A ORFs Encode Chimeric RNA Polymerase -RNA Binding
Protein with Major Coat Protein Domain
1939
5,
ORF1 = gag
2072 EncapsidationSignal 4546IRE ^\
_ 4579_ | ~~~3,
site forreplication
ORF2 = poi-1 ribosomal
framreshifting site80 kDa
2::;: ........::.. 2: ........... .:.........
major coat protein RNA180 kDa binding
coat proteindomain
RNApolymerase
B %IN
Pseudoknot
...GGGUUUAGG...ILORF1 (gag) ,II IL I...-..pJ
CL-AORF1-ORF2
PGK overlapp
_ reglon2pLacZ Origin TRP1
m
of 5, 11, and 17 codons of the 5' portion of the L-A-derivedcDNA
sequence (Figs. 2 and 3). The pF'8-3D series lacked 32and 38 codons
of L-A cDNA sequence from the 3' end andincluded a termination
codon in the 0 frame downstream ofthe shift site. pF'8-5D17/3D32XS
was constructed frompF'8-5D17 to produce a 32-codon deletion of L-A
cDNAsequence information from the 3' region. Changes made inthe
slippery site of pF'8 are shown in Fig. 4. In the text, thetriplets
are shown with the ORF1 frame indicated by a space.pJD18 had the
complement of the 5' pseudoknot region
(GCCAGC -* CGGUCG), and pJD19 had the complement ofthe 3'
pseudoknot-forming region (GCUGGC -> CGACCG)(Figs. 2 and 3).
pJDRPsi used pJD19 and the mutagenicoligonucleotide used to create
pJD18 to construct the doublemutant.
In pJD20, the U residue 3' of the loop (base 1991) was a C.In
pJD21, the U residue in the bulge of the stem (base 1996of L-A) was
a G. pJD17 incorporated both changes (see Figs.IC and 2).
fi-Galactoside (fl-gal) Activity. Assays of permeabilizedyeast
cells were as described (39). Cells were grown in H-trpmedium to
midlogarithmic phase, and assays were normal-ized to the OD6w of
the culture and to the assay time. Threeindividual isolates of each
mutant were assayed in triplicate.Control experiments with pF8 and
pTI25 showed that theirrelative and absolute ,8-gal activity did
not vary with phase ofthe growth cycle (data not shown).
peR322
AUG 1
f1 orl
FIG. 1. (A) Gene organization of the L-A (+)-strand (from
ref.26). ORF1 encodes the major coat protein. ORF2 overlaps
withORF1 by 130 nucleotides and is expressed as a fusion protein,
the180-kDa minor coat protein. The ORF2 domain has
ssRNA-bindingactivity and an amino acid sequence diagnostic of
viral RNA-dependent RNA polymerases. The encapsidation signal (27)
is pres-ent on the (+)-strand 400 bases away from the 3' end.
Overlappingwith the encapsidation signal is the internal
replication enhancer(IRE) that is necessary for full template
activity of (+)-strands. (B)The essential elements of the L-A
region determining -1 ribosomalframeshifting. The slippery site is
the heptamer G GGU UUA (bases1958-1964). The ORF1 (gag) frame is
shown by the I.I symbols onthe upper row and the ORF2 (pol) frame
is similarly shown in thelower row. The two tRNAs bound on the
ribosomes to the GGUUUA on the mRNA slip back 1 base each to bind
to GGG UUU. Thestem-loop pseudoknot structure just 3' to the
slippery site (bases1969-2004) is also shown. A pseudoknot is a
stem-loop structurewhose loop (bases with spikes) can base pair to
a sequence 3' to thebase of the stem (bases with spikes). (C)
Structure of the frameshiftdetection vector pF'8. Transcripts from
the PGKI promoter aretranslated from the synthetic AUG. Translation
proceeds into theORF1 frame of L-A. Only shifted ribosomes proceed
into LacZ. Thedetailed sequence of pF'8 from the PGK promoter to
the beginningof LacZ is shown in Fig. 2.
in the -1 frame with respect to ORFi), pTI25 (0 readingframe),
and pTI26 (+1 reading frame). pTI24, pTI25, andpTI26 were digested
with BamHI and Sma I and a 218-bpSau3a/Sma I fragment from pTIL121,
containing the entireregion of overlap of ORF1 and ORF2, were
cloned intopTI24-26 to produce pF7, pF8, and pF9, respectively
(seeFigs. 1C and 2). In pF7, pF8, and pF9, lacZ is in the +1,
-1,and 0 frame, respectively, relative to the AUG codon. pF8
wascleaved with Sal I and a 200-bp Sal I fragment from pDM1
(38)containing the fl origin of replication was inserted to
createpF'8 for in vitro mutagenesis. This did not affect the
efficiencyof frameshifting (Fig. 3).
Modification of pF'8. pF'8 was modified by using
syntheticoligonucleotides and all mutations were confirmed by
se-quence analysis. The pF'8-5D mutants had in-frame deletions
RESULTS
Assay for Frameshifting. Into the promoter vector p375
weinserted the phage fl origin, a translational start site,
and,downstream ofthe multiple cloning site, the lacZ gene in eachof
the three possible reading frames (pTI24, -25, and -26).
Inwild-type yeast cells, only pTI25, with ,-gal in the 0 framewith
respect to the AUG, resulted in significant production ofp-gal
(Fig. 3). Fragments inserted between the AUG and lacZwere tested
for fusion of the 0 frame and the lacZ frame bymeasurement of p-gal
activity. Our evidence that this fusionof reading frames is due to
ribosomal frameshifting dependson detailed analysis of the region
responsible for fusion ofthereading frames and comparison of this
with other systems.
Determination of the Region of L-A Responsible for FusingORF1
and ORF2. A 218-bp region from L-A (bases 1905-2122) including the
130-bp region of overlap of ORF1 andORF2 was inserted into pTI24,
pTI25, and pTI26 to makepF7, pF8, and pF9 (Figs. 1C and 2). pF8,
with p-gal in the -1frame with respect to the AUG, showed 1.8% of
the activityofpTI25 (0 frame, no insert control) (Fig. 3). Because
the L-Asequences inserted have stop codons in the other frames,
pF7(+1 frame) and pF9 (0 frame) have no significant activity.The
minimum region of L-A necessary for frameshifting
was delimited by making deletions of pF'8. Deletion of
5(pF'8-5D5), 11 (pF'8-5D11), or 17 (pF'8-5D17) codons of
L-Asequence 5' to the slippery site did not diminish
frameshiftingefficiency. The deletion in pF'8-5D17 removed all 5'
L-Asequence to within 2 bases of the slippery site (Figs. 2 and
3).Elimination of 32 codons of L-A sequence from the 3' end ofthe
insert had no effect on frameshifting, but deletion of 38codons,
removing the 3' pseudoknot region, reduced 8-galactivity 20-fold
(Figs. 2 and 3). A double-deletion mutant,pF'8-5D17/3D32XS,
eliminating 17 and 32 codons from the 5'and 3' ends, respectively,
showed only a minor effect onactivity (Fig. 3). Thus, the region
from the slippery site to the3' pseudoknot is sufficient for
frameshifting.
Structural Requirements for Frameshifting. The
sequencerequirements of the slippery site heptamer were
examined(Fig. 4). Changes in the first triplet (comprising a codon
in the-1 frame, but parts of 2 codons in the 0 frame) that
disruptthe identity of the three bases (G GG -> A GG or G GG
--
30
m 0 - m 0 m m m
Biochemistry: Dinman et al.
Dow
nloa
ded
by g
uest
on
June
7, 2
021
-
Proc. Natl. Acad. Sci. USA 88 (1991)
PGK Dromoter---> aaggaagtaa ttatctactt tttacaacaa atcta
gaattc atacaaa'Start of transcript in this direction -->
< deletedin515 >l deletedin5D1I >l deletedin5D17
>lI--L-A sequence--> -1
atg act tct agg
ATCAATGCGGGCGAACTTAAGAACTACTGGGGTAGTGTGCGTCGTACTCAGCM T S R I N A G
E L K N Y W G S V R R T Q Q 0 frameTranslation Start * C A S Y S A
-1 frame
slippery 5'stem 5'Pseudoknot 3'stem 3'Pseudoknotsite +1 +1
region +1 < deleted in 3Da region
AGGGTTTAGGAGTGGTAGGTCTTACGATGCCAGCTGTAATGCCTACCGGAGAACCTACAGCTGGCGCTG>
---- >
. -1 ---
< ---- < _______-
G L G V V G L T M P A V M P T G E P T A G A A 0 frameG F R S G R
S Y D A S C N A Y R R T Y S W R C -1 frame
< deleted in 3D32CCCACGAAGAGTTGAULGAACAGGC
+1H E E L I E Q A
P R R V D R T G
+1 +1 0 .0D N V L V E * 0 frame ends
G Q C F S R V N V I E P S H G -1 frame
ACCCCGCCCTACAAGGTACATACTGCAG cccggg ggt acc gat ccc gtc gtt ttaP
R P T R Y I L Q SmaI D P V .....1acZ in the
in thepF7 & pF9 have in the1 less & 1 more G
here,respectively
caa cgt+1 frame-1 frame0 frame
in pF7in pF8in pF9
FIG. 2. Partial sequence of the frameshift assay vector pF'8.
L-A sequences start at base 1905 and end at base 2122 of the L-A
sequence.The end points of the deletions used to determine the
extent of the L-A sequences necessary to promote frameshifting are
also indicated. TheL-A sequence is in uppercase letters and the
vector sequences are in lowercase letters.
G AA) each substantially reduces frameshifting, as predictedby
the simultaneous slippage model. Making both of thesechanges at
once to produce A AA leaves frameshifting abilityintact. These
residues are thus important for frameshifting,and their being
identical is important. Substitution of anyidentical 3 nucleotides
in the first triplet (G GG -* A AA, GGG -* C CC, or G GG-+ U UU)
resulted in efficientframeshifting. Interestingly, substitution of
pyrimidines forpurines in this position gave significantly more
frameshiftingthan wild type (2.6 times for C CC and 6.7 times for U
UU)(Fig. 4). Also, although background levels of frameshiftingwere
seen in pJD11 (G GG -* A GG), pJD12 (G GG -G G AA)gave 35%
ofwild-type activity (Fig. 4). This may be explainedby U-G
codon/anticodon base pairing in the first position ofthe codon in
the shifted frame.The sequence requirements of the second triplet
(U UU)
were more stringent. Only triplets of A and U yieldedsubstantial
levels of 8-gal activity, and identity of the threebases was
required (Fig. 4). To examine why pJD16 (C CC)did not frameshift
efficiently, the 7th base was also changedto C (A -* C; pJD26). In
this construct, the shifted tRNA inthe ribosomal A site would not
have its wobble base mis-paired. A 2-fold increase of 8-gal
activity was observed over
pJD16, but this was still only 20o of pF'8 activity.
MutantpJD27, with A AAC in place of U UUA, retained
wild-typeactivity, indicating that the C in the 7th position was
probablynot responsible for the decrease in frameshifting
activity.Likewise, GGG in this position did not frameshift (pJD28).
Toavoid potential stacking problems due to long stretches of
Gresidues, the wild-type heptamer (G GGU UUA) waschanged to U UUG
GGC in pJD28.Making the seventh position of the slippery site U
(pJD29)
or C (pJD27) gave frameshifting with equal or greater
effi-ciency than wild type (A), but aG in this position, as in
pJD30(G GGU UUG) or pJD36 (G GGA AAG), gave only 18% or8%,
respectively, of pF'8 activity.The results obtained with pF'8-3D32
and pF'8-3D38 sug-
gested the requirement for sequence information present inthe
former but lacking in the latter mutant. A stretch of 6nucleotides
in this area (GCUGGC = 3'Psi) can form apseudoknot with 6
nucleotides in the loop of the stem-loopstructure (GCCAGC = 5'Psi)
(Fig. 2). pJD18 contained thecomplement of 5'Psi (GCCAGC -+ CGGUCG)
and pJD19carried the complement of 3' Psi (GCUGGC -) CGACCG),each
thus disrupting the potential for pseudoknot formation.Each showed
a 20-fold decrease in 8-gal activity. pJDRPsi
PLASFpTI24pTI25pTI2(
< .----------L-A sequences---------->1ATG---------
GGGTTTA---5'Psi---3'Psi------LacZ
--ORF1 > LAdL FLI".i -O ORF2 > of
lID rel4-- - ---5---- G---6---- GG---
pF7pF8 (wt)-pF9pF'8 (wt)
pF'8-5D5 ---5D11 ---5D17 ---
._____
.-G----GG---.-G---
3D38 -------3D32 -------5D17/3D32XS
___
RAKE^ LacZto AUG-10
ACTIVITY%of %bf
0 frame pF'8< 0.01 < 0.5100 5500
+1 < 0.03 < 2 FIG. 3. Delimitation of regionnecessary for
frameshifting. The
+1 0.01 0 5 wild-type strain 2907 was trans--1 1.8 100 formed
with the plasmids shown
-1 1.91 1005 and midlogarithmic phase cellswere assayed for
8-gal activity.The main features of the L-A se-
-1 1.6 90 quence and the reading frame be--1 3.0 170 fore and
after the shift are indi--1 2.4 130 cated. Psi, psuedoknot region;
%
-10. 1 of 0 frame, actual efficiency of-1 3.2 170 frameshifting;
% of pF'8, compar-ison to the wild-type level of
-1 1.3 72 frameshifting.
176 Biochemistry: Dinman et al.
---
---
Dow
nloa
ded
by g
uest
on
June
7, 2
021
-
Biochemistry: Dinman et al.
.1ATG----------GGGTTTA----5'Psi----3'Psi
--ORF1 > " U| @2 _0RF2-
PLASMIDS (from pF'8)pF'8
(wt)----------------------------------pJD11-------------AGG----------------------pJD12-------------GAA----------------------pJD13-------------AAA----------------------pJD31-------------CCC-----------------------pJD32-------------TTT-----------------------pJD22----------------ATT-------------------pJD23----------------TAA-------------------pJD24----------------AAA--------------------pJD14----------------CTT--------------------pJD15----------------TCC-------------------pJD16----------------CCC-------------------pJD26----------------CCCC------------------pJD27----------------AAAC------------------pJD28-------------TTTGGGC------------------pJD29-------------------T-------------------pJD30-------------------G-------------------pJD36----------------AAAG------------------
pJD18-----------------------c5'Psi----------pJD19--------------------------------c3'Psi-pJDRPsi---------------------c5'Psi---c3'Psi-
contained the mutations at both sites restoring both
thepotential for pseudoknot formation and the a-gal activity.Thus,
the ability to form a pseudoknot structure was neces-sary for
efficient frameshifting.The pseudoknot structure (Figs. 1B and 2)
could be ex-
tended by 4 bases (UGUA = 5' and UACA = 3') byunwinding the
upper portion of the stem-loop. This may beslightly favored because
a G-U base pair (1 H bond) at the topofthe stem would be replaced
by an A-U base pair (2 H bonds)in the extended pseudoknot. In pJD20
a C replaced the nativeU, favoring the stem. 8-Gal assays of this
mutant showedonly slightly higher frameshifting activity (170%o of
control).The stem also contains a COU bulge (Figs. 1C and 2),
replaced in pJD21 with a C-G pair. This stabilization of thestem
resulted in a 2.5-fold increase in frameshifting effi-ciency. The
double mutant (pJD17), incorporating both mu-tations in pJD20 and
pJD21, was, unexpectedly, normal (97%of control).
DISCUSSIONThe L-A ORF1/ORF2 overlap region contains
sufficientinformation to promote fusion of ORFi and ORF2 in vivo
ata rate consistent with the observed ratio of fusion protein
tomajor coat protein. A 72-nucleotide stretch within this regionis
necessary and sufficient for this process. It contains
thestructures predicted by the simultaneous slippage model ofJacks
and Varmus (8) to be necessary for -1 ribosomalframeshifting
including the slippery site G GGU UUA and theability to form an
mRNA pseudoknot structure downstreamof the slippery sequence. We
show that both features arenecessary in the case of L-A for fusion
of ORFi and ORF2.We conclude that the L-A dsRNA virus uses -1
ribosomalframeshifting to make a 180-kDa fusion protein whose
N-ter-minal (gag) domain is a major coat protein monomer andwhose
C-terminal domain is a ssRNA-binding region with theconsensus
sequence typical of RNA-dependent RNA poly-merases.
Several aspects of our results, and those of others workingon
retroviruses, are not explained by the Jacks and Varmusmodel. In
the first triplet, any 3 identical bases were sufficientto yield
efficient frameshifting. We show that, in addition tothe known
occurrence of G GG, A AA, and U UU in thisposition, C CC is also
consistent with efficient frameshifting.Furthermore, as long as
base pairing was possible in the
%c0 fr
1.0.0.2.4.
12.0.0.5.0.0.0.0.3.0.4.O.:0.,
Proc. Natl. Acad. Sci. USA 88 (1991)
ACTIVITY)f %of:ame pF'891 100,03 1,4 21,2 1207 2610 66711
619009051741451113316
0.050.101.91
177
10 FIG. 4. Effect on frameshifting270 of alterations in the
slippery site
5 and the pseudoknot. For alter-3 ations of the slippery site,
all bases9 of pF'8 that are not shown were
20 left unchanged. pJD18 has, in the150 loop of the stem-loop,
the change
6 (GCCAGC -* CGGUCG), dis-228 rupting the pseudoknot, and
8 pJD19 has the change (GCUGGC-* CGACCG) 3' of the stem with
3 the same result. pJDRPsi has both5 changes so the pseudoknot
can
100 again form.
nonwobble bases, some frameshifting was observed. InpJD12 (G AAU
UUA), the peptidyl-tRNA reading AAUshifts to read GAA, with pairing
of G on the mRNA with Uon the tRNA. Although frameshifting is
decreased 4-fold, thisis still an order of magnitude above
background. This G-Upairing in a nonwobble position of the codon is
also known tooccur in the suppression of amber codons by tRNA fn6
(40,41). The pro-pol overlap of murine mammary tumor viruscontains
a G GAU UUA heptamer (see ref. 4) in which G-Upairing is necessary
in the second (nonwobble) position tofulfill the requirements of
the model.
In the second triplet, only A AA and U UU gave
efficientframeshifting; G GG and C CC did not. This is consistent
withthe known occurrence in retroviruses of only these twotriplets.
That this was not due to the reluctance of the tRNAreading CCA to
read CCC (i.e., to have its wobble basemispaired) is suggested by
our finding that making theseventh base C to give C CCC did not
substantially improveframeshifting. Jacks et al. (4) also showed
that G GGG gavelittle or no frameshifting. These results suggest
that the higherenergy required to unpair the tRNA properly paired
to CCXor GGX makes frameshifting in these cases inefficient, andnot
due to a reluctance to repair in the shifted (-1) frame.Thus, the
requirements at the ribosomal A site are apparentlymuch more
stringent than those operating at the P site. Withinthe slippery
site, one limiting factor in -1 ribosomal frame-shifting is the
probability that a properly paired aminoacyl-tRNA will unpair from
its 0-frame codon.The 7th base was constrained to A, U, or C.
Having a G
residue in this position (G GGU UUG or G GGA AAG)prevented
frameshifting for reasons that are not yet clear.Substituting G in
this position of the RSV heptamer (A AAUUUG) did not affect
frameshifting (4).tRNAs and Frameshifting. Bjork et al. (42) have
shown that
1-methylguanosine in position 37 (next to the anticodon)
oftRNAPr° prevents frameshifting, in this case the suppressionin
Salmonella ofa frameshift mutation. Hatfield and Oroszlan(6)
suggest that hypomodification of bases in the anticodonloop of the
tRNAs in and around the shift site gives greaterflexibility of
movement (including slipping) of the tRNA inthe mRNA/ribosome
context. Indeed, infection with severalretroviruses may be
accompanied by hypomodification ofjust those tRNAs that would be at
the A site of frameshiftingribosomes (43).
Dow
nloa
ded
by g
uest
on
June
7, 2
021
-
Proc. Natl. Acad. Sci. USA 88 (1991)
Examination of the available sequences (44) of P-site or
ofA-site anticodons that, in our experiments, do and do notpromote
frameshifting does not reveal any significant differ-ences in the
degree of modifications seen in the anticodonloops of the two
classes of tRNAs. For example, we find thatthe tRNALYS decoding AAA
is capable of efficient frame-shifting (pJD24; Fig. 4), showing
that A-site "shifty" tRNAsare not limited to the naturally
occurring tRNAASll decodingAAC, the tRNAPhe decoding UUU, and the
tRNALCU readingUUA.
Belcourt and Farabaugh (45) propose that the + 1 frame-shifting
in Tyl occurs when the 0-frame A-site AGG codon isnot filled
because tRNAAG is scarce. The P-site 0 and +1frame leucine codons
CUU and UUA can be recognized bythe same, abundant, tRNAIeU whose
anticodon is UAG. Thetranslational pause allows this tRNALCU at the
P site to slipforward 1 base from CUU to UUA. As applied to L-A the
firstcodon in the 0 frame after the slippery site is GGA, a
rarelyused glycine codon (46). This could produce a
translationpause that could promote -1 ribosomal frameshifting.
How-ever, such a shift would be into the equally rare arginine
AGGcodon in wild-type L-A and into the rare arginine CGG codonin
pJD27 (GGGAAAC). Such a mechanism is also unlikelybecause it
requires the ribosomes to sense the three codonsat once. If the
ribosomes were waiting for the tRNA recog-nizing GGA to arrive at
the A site, the tRNA that hadrecognized GGU would have already been
released, and sothe first triplet (G GG) would not be
important.
Different viruses have different sequences within the
con-straints of the slippery site rules perhaps because each
virushas its own stoichiometric requirements for structural
versusenzymatic proteins. The L-A virion has -120 major coatprotein
molecules per viral particle. The 1.8% frequency offrameshifting
observed here suggests that there are twofusion proteins per
virion. Presumably, L-As with slipperysites with different
frequencies of frameshifting would eitherbe inviable due to
improper virion assembly or would bepresent in lower copy number in
the infected yeast cell.Why Do Viruses Use Frameshifting and
Translational Sup-
pression to Make gag-ol Fusion Proteins? Ribosomal
frame-shifting is utilized by retroviruses to make a gag-pol
fusionprotein in a fixed ratio to the gag protein. One reason
formaking a gag-pol fusion protein is probably that the gagdomain
provides a means to anchor the reverse transcriptaseto the
particle. It has also been suggested (29) that the poldomain may be
involved in recognition, binding, and pack-aging of the genomic RNA
itself, as appears to be the case inthe yeast L-A dsRNA virus.
Retroviruses use ribosomalframeshifting and, in some cases,
translational read-throughof termination codons to join the 5' gag
ORF to the 3' pol (orpro) ORF. It has been suggested (26) that
since retroviruses,dsRNA viruses, and (+)-strand RNA viruses all
package andreplicate their (+)-strands, the use of splicing or
othermodifications of mRNA molecules must be accompanied byexcision
of packaging or replication signals to avoid thegeneration of
mutant genomes. Indeed, retroviruses regularlysplice to form the
env protein (and the tat, rev, and otherminor proteins in human
immunodeficiency virus). Thesesplicing events remove the Psi
packaging site. (+)-StrandRNA viruses and dsRNA viruses apparently
avoid thisproblem by not using splicing. Using ribosomal
frameshiftingor nonsense codon read-through to fuse gag and pol
ORFslikewise prevents generation of mutants.
The authors are grateful to Dolph Hatfield and Luz
Hermida-Rodriguez for useful discussions.
1. Weiss, R., Teich, N., Varmus, H. & Coffin, J. (1982) RNA
TumorViruses (Cold Spring Harbor Lab., Cold Spring Harbor, NY).
2. Shinnick, T. M., Lerner, R. A. & Sutcliffe, J. G. (1981)
Nature(London) 293, 543-548.
3. Yoshinaka, Y., Katoh, I., Copeland, T. D. & Oroszlan, S.
(1985)Proc. Natl. Acad. Sci. USA 82, 1618-1622.
4. Jacks, T., Madhani, H. D., Masiarz, F. R. & Varmus, H. E.
(1988)Cell 55, 447-458.
5. Hatfield, D. L., Lee, B. J., Feng, Y. X., Levin, J. G., Rein,
A. &Oroszlan, S. (1989) Proteases ofRetroviruses (de Gruyter,
Berlin).
6. Hatfield, D. & Oroszlan, S. (1990) Trends Biochem. Sci.
15,186-190.
7. Schwartz, D. E., Tizard, R. & Gilbert, W. (1983) Cell 32,
853-869.8. Jacks, T. & Varmus, H. E. (1985) Science 230,
1237-1242.9. Jacks, T., Power, M. D., Masiarz, F. R., Luciw, P. A.,
Barr, P. J.
& Varmus, H. E. (1988) Nature (London) 331, 280-283.10.
Brierley, I., Boursnell, M. E., Binns, M. M., Bilimoria, B.,
Blok,
V. C., Brown, T. D. K. & Inglis, S. C. (1987) EMBO J. 6,
3779-3785.
11. Bredenbeek, P. J., Pachuk, C. J., Noten, A. F. H., Charite,
J.,Luytjes, W., Weiss, S. & Spaan, W. J. M. (1990) Nucleic
AcidsRes. 18, 1825-1831.
12. Dunn, J. J. & Studier, F. W. (1983) J. Mol. Biol. 166,
477-535.13. Blinkowa, A. L. & Walker, J. R. (1990) Nucleic
Acids Res. 18,
1725-1729.14. Tsuchihashi, Z. & Kornberg, A. (1990) Proc.
Natl. Acad. Sci. USA
87, 2516-2520.15. Flower, A. M. & McHenry, C. S. (1990)
Proc. Natl. Acad. Sci.
USA 87, 3713-3717.16. Clare, J. J. & Farabaugh, P. J. (1985)
Proc. Natl. Acad. Sci. USA
82, 2829-2833.17. Mellor, J., Fulton, S. M., Dobson, M. J.,
Wilson, W., Kingsman,
S. M. & Kingsman, A. J. (1985) Nature (London) 313,
243-246.18. Clare, J. J., Belcourt, M. & Farabaugh, P. J.
(1988) Proc. Natl.
Acad. Sci. USA 85, 6816-6820.19. Craigen, W. J., Cook, R. G.,
Tate, W. P. & Caskey, C. T. (1985)
Proc. Nail. Acad. Sci. USA 82, 3616-3620.20. Weiss, R. B., Dunn,
D. M., Atkins, J. F. & Gesteland, R. F. (1987)
Cold Spring Harbor Symp. Quant. Biol. 52, 687-693.21. Weiss, R.
B., Dunn, D. M., Dahlberg, A. E., Atkins, J. F. &
Gesteland, R. F. (1988) EMBO J. 7, 1503-1507.22. Hizi, A.,
Henderson, L. E., Copeland, T. D., Sowden, R. C.,
Hixson, C. V. & Oroszlan, S. (1987) Proc. Natl. Acad. Sci.
USA 84,7041-7046.
23. Brierley, I., Digard, P. & Inglis, S. (1989) Cell 57,
537-547.24. Pleij, C. W. A., Rietveld, K. & Bosch, L. (1985)
Nucleic Acids Res.
13, 1717-1731.25. Puglisi, J. D., Wyatt, J. R. & Tinoco, 1.
(1988) Nature (London) 331,
283-286.26. Icho, T. & Wickner, R. B. (1989) J. Biol. Chem.
264, 6716-6723.27. Fujimura, T., Esteban, R., Esteban, L. M. &
Wickner, R. B. (1990)
Cell 82, 819-828.28. Sommer, S. S. & Wickner, R. B. (1982)
Cell 31, 429-441.29. Fujimura, T. & Wickner, R. B. (1988) Cell
55, 663-671.30. Wickner, R. B. (1989) FASEB J. 3, 2257-2265.31.
Ito, H., Fukuda, Y., Murata, K. & Kimura, A. (1983) J.
Bacteriol.
153, 163-168.32. Wickner, R. B. (1979) Genetics 92, 803-821.33.
Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982)
Molecular
Cloning: A Laboratory Manual (Cold Spring Harbor Lab.,
ColdSpring Harbor, NY).
34. Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. USA 82,
488-492.35. Tabor, S. & Richardson, C. C. (1987) Proc. Natl.
Acad. Sci. USA
84, 4767-4771.36. Hitzeman, R. A., Leung, D. W., Perry, L. J.,
Kohr, W. J., Levine,
H. L. & Goeddel, D. V. (1983) Science 219, 620-625.37.
Casadaban, M. J., Martinez-Arias, A., Shapiro, S. K. & Chou,
J.
(1983) Methods Enzymol. 100, 293-308.38. Mead, D. A., Skorupa,
E. S. & Kemper, B. (1985) Nucleic Acids
Res. 13, 1103-1118.39. Guarente, L. (1983) Methods Enzymol. 101,
181-191.40. Lin, J. P., Aker, M., Sitney, K. C. & Mortimer, R.
K. (1986) Gene
49, 383-388.41. Weiss, W. A. & Friedberg, E. C. (1986) J.
Mol. Biol. 192, 725-735.42. Bjork, G. R., Wikstrom, P. M. &
Bystrom, A. S. (1989) Science
244, 986-989.43. Hatfield, D., Feng, Y.-X., Lee, B. J., Rein,
A., Levin, J. G. &
Oroszlan, S. (1989) Virology 173, 736-742.44. Sprinzl, M.,
Hartmann, T., Weber, J., Blank, J. & Zeidler, R. (1989)
Nucleic Acids Res. Suppl. 17, 1-172.45. Belcourt, M. F. &
Farabaugh, P. J. (1990) Cell 62, 339-352.46. Ikemura, T. (1982) J.
Mol. Biol. 158, 573-597.
178 Biochemistry: Dinman et al.
Dow
nloa
ded
by g
uest
on
June
7, 2
021
