2 Leptin Resistance - biorxiv.org · 7/14/2020 · maintain normal circulating levels of -/- sOb-R in both lean and obese LCB1 mice (Figure 1A). 10. Similarly, the hepatic gene and

CB1R Regulates Soluble Leptin Receptor Levels via CHOP, Contributing to Hepatic 1

Leptin Resistance 2

3

Adi Drori1, Asaad Gammal1, Shahar Azar1, Liad Hinden1, Rivka Hadar1, Daniel Wesley2, Alina 4

Nemirovski1, Gergő Szanda3, Maayan Salton4, Boaz Tirosh5 and Joseph Tam1 * 5

6

1Obesity and Metabolism Laboratory, Institute for Drug Research, School of Pharmacy, Faculty 7

of Medicine, The Hebrew University of Jerusalem, Israel. 2Laboratory of Physiological Studies, 8

National Institute on Alcohol Abuse & Alcoholism, Bethesda, MD USA. 3MTA-SE Laboratory of 9

Molecular Physiology, Department of Physiology, Semmelweis University, Budapest, Hungary. 10

4Department of Biochemistry and Molecular Biology, The Institute for Medical Research Israel-11

Canada, The Hebrew University of Jerusalem, Israel. 5The Institute for Drug Research, School of 12

Pharmacy, Faculty of Medicine, The Hebrew University of Jerusalem, Israel. 13

14

*Address correspondence to: Joseph Tam, Obesity and Metabolism Laboratory, The Institute for 15

Drug Research, School of Pharmacy, Faculty of Medicine, POB 12065, Jerusalem 91120, Israel. 16

Tel.: +972-2-675-7645, Fax: +972-2-675-7015, E-mail: [email protected] 17

Summary: Here we describe a novel molecular aspect by which the hepatic 18

endocannabinoid/CB1R system contributes to hepatic leptin resistance by regulating soluble 19

leptin receptor levels via CHOP. 20

Running Title: CB1 Regulates sOb-R levels via CHOP 21

1

.CC-BY-NC-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted July 14, 2020. . https://doi.org/10.1101/2020.07.14.202283doi: bioRxiv preprint

mailto:[email protected]

https://doi.org/10.1101/2020.07.14.202283

http://creativecommons.org/licenses/by-nc-nd/4.0/

Abstract 1

The soluble isoform of leptin receptor (sOb-R), secreted by the liver, regulates leptin 2

bioavailability and bioactivity. Its reduced levels in diet-induced obesity (DIO) contributes to 3

hyperleptinemia and leptin resistance, effects that are known to be regulated by the 4

endocannabinoid (eCB)/CB1R system. Here we show that pharmacological activation/blockade as 5

well as genetic overexpression/deletion of hepatic CB1R modulates sOb-R levels and consequently 6

hepatic leptin resistance. Interestingly, peripheral CB1R blockade failed to reverse DIO-induced 7

reduction of sOb-R levels, fat mass, dyslipidemia, and hepatic steatosis in mice lacking C/EBP 8

homologous protein (CHOP), whereas direct activation of CB1R in hepatocytes reduced sOb-R 9

levels in a CHOP-dependent manner. Moreover, CHOP stimulation increased sOb-R expression 10

and release via a direct regulation of its promoter, while CHOP deletion reduced leptin sensitivity. 11

Our findings highlight a novel molecular aspect by which the hepatic eCB/CB1R system involves 12

in the development of hepatic leptin resistance by regulating sOb-R levels via CHOP. 13

14

2


https://doi.org/10.1101/2020.07.14.202283


Introduction 1

Leptin, predominantly produced by and secreted from white adipocytes, conveys information 2

regarding the status of energy storage and availability to the brain, to maintain energy homeostasis. 3

It binds the leptin receptor in hypothalamic neurons to reduce food intake and increase energy 4

expenditure in coordination with other adipokines and gastric peptides (Allison & Myers, 2014; 5

Pan & Myers, 2018). Molecularly, leptin stimulates the secretion of α-melanocortin stimulating 6

hormone (α-MSH) from proopiomelanocortin (POMC) neurons at the arcuate nucleus (ARC), and 7

inhibits the secretion of the orexigenic peptides neuropeptide-Y (NPY) and Agouti-related protein 8

(AgRP) (Flak & Myers, 2016). Genetic leptin deficiency or lack of functional leptin receptor 9

results in morbid obese and insulin resistance phenotypes in animals (ob/ob or db/db mice, 10

respectively) (Tartaglia et al., 1995; Y. Zhang et al., 1994). In humans, congenital leptin 11

deficiencies are rare, leading to hyperphagia and early-onset obesity, which can be reversed with 12

a leptin replacement therapy (Mantzoros, 1999). However, most cases of obesity are characterized 13

by hyperleptinemia, indicating that obesity is a leptin-resistant state, where leptin signaling is 14

impaired. 15

Various mechanisms have been linked to the development of diet-induced obesity (DIO)-16

related leptin resistance, including limited CNS access of leptin due to saturated transport 17

machinery, uncoupling of leptin from its receptor (due to rare genetic mutations or intra-cellular 18

modulators), leptin-induced downregulation of its hypothalamic receptor, and several circulating 19

factors such as the soluble isoform of leptin receptor (sOb-R) [reviewed in (Engin, 2017; Martin, 20

Qasim, & Reilly, 2008)]. Both in humans and mice, the leptin receptor gene (LEPR) encodes 4 21

membrane-anchored isoforms, which differ in the length of their cytoplasmic tail. The long 22

isoform, Ob-Rb, is considered to convey the most robust cellular response to leptin, while the 23

3


https://doi.org/10.1101/2020.07.14.202283


shorter isoforms (Ob-Ra, Ob-Rc, and Ob-Rd) carry a weaker signal. In addition, sOb-R, which 1

lacks the trans-membrane and intra-cellular domains, also exists. In humans, sOb-R is exclusively 2

generated via proteolytic shedding of membrane-anchored isoforms (Maamra et al., 2001), 3

whereas in mice, it is produced by both transcription of a designated isoform (Ob-Re) and 4

ectodomain shedding of Ob-Rb and Ob-Ra (Ge, Huang, Pourbahrami, & Li, 2002; Li, Ioffe, 5

Fidahusein, Connolly, & Friedman, 1998). sOb-R, mainly produced by hepatocytes, is the main 6

leptin-binding protein in human plasma, regulating leptin’s bioavailability and bioactivity 7

(Lammert, Kiess, Bottner, Glasow, & Kratzsch, 2001; G. Yang, Ge, Boucher, Yu, & Li, 2004). In 8

fact, studies have shown that the circulating levels of sOb-R are inversely correlated with body 9

weight and free leptin levels (Ogier, Ziegler, Mejean, Nicolas, & Stricker-Krongrad, 2002). In 10

addition, sOb-R levels are increased following weight loss (Laimer et al., 2002; Reinehr, Kratzsch, 11

Kiess, & Andler, 2005), and its overexpression in mice increases leptin sensitivity (Huang, Wang, 12

& Li, 2001; Lou et al., 2010), supporting the key role of sOb-R in the development as well as the 13

reversal of leptin resistance. 14

The endocannabinoid (eCB) system, a major regulator of energy homeostasis (Fride, 15

Bregman, & Kirkham, 2005; Pagotto, Marsicano, Cota, Lutz, & Pasquali, 2006), evokes various 16

cellular/metabolic pathways via the activation of two G-protein-coupled receptors, cannabinoid 17

type-1 (CB1R) and type-2 (CB2R) receptors, by the main eCBs, N-arachidonoylethanolamine 18

(AEA) and 2-arachidonoylglycerol (2-AG). The eCB/CB1R system is highly overactive during 19

obesity (Engeli, 2008; Engeli et al., 2005), and both central and peripheral stimulations of this 20

system have been suggested to contribute to the development of the metabolic syndrome, including 21

leptin resistance (Engeli et al., 2005; Pagotto, Vicennati, & Pasquali, 2005). Studies have shown 22

that leptin's ability to regulate food intake and peripheral lipid metabolism depends upon 23

4


https://doi.org/10.1101/2020.07.14.202283


hypothalamic CB1Rs (Buettner et al., 2008; Cardinal et al., 2014; Di Marzo et al., 2001; Jo, Chen, 1

Chua, Talmage, & Role, 2005; Malcher-Lopes et al., 2006). Recent evidence demonstrates that 2

peripheral CB1R signalling has the ability to modulate leptin activity too. By using peripherally 3

restricted CB1R blockers, we have recently demonstrated that DIO-related hyperleptinemia is 4

completely reversed by increasing leptin's renal clearance and decreasing its secretion from 5

adipocytes (Tam et al., 2012; Tam et al., 2010). Additionally, we have shown that the reversal of 6

hypothalamic leptin resistance in obese mice treated with the peripherally restricted CB1R blocker, 7

JD5037, is mediated via re-sensitizing the animals to endogenous leptin and re-activating POMC 8

neurons (Tam et al., 2017). However, a direct role for the eCB/CB1R system in the regulation of 9

sOb-R levels and hepatic leptin signaling has never been investigated. 10

11

Results 12

Hepatic CB1R regulates sOb-R levels and leptin signalling. 13

To evaluate the direct contribution of CB1R to the regulation of sOb-R levels, we first utilized a 14

pharmacological inhibition paradigm of CB1R in DIO mice by using the peripherally restricted 15

CB1R inverse agonist JD5037. Similarly to previous findings (Mazor et al., 2018), a significant 16

reduction in serum levels of sOb-R was documented in obese mice; an effect that was ameliorated 17

by JD5037 treatment (Figure 1A). Since sOb-R is mainly produced by the liver (Lammert et al., 18

2001), we also analyzed the content of sOb-R in liver homogenates from these animals and found 19

a similar trend as in serum (Figure 1B). qPCR measurements of the Ob-Re isoform revealed that 20

JD5037 treatment also affected its transcription and protein levels (Figure 1C-E). Moreover, the 21

protein expression of two additional isoforms of LEPR (Ob-Rb and Ob-Ra) in liver homogenates 22

was also decreased in DIO mice, and normalized following JD5037 treatment (Figure 1D-E). 23

5


https://doi.org/10.1101/2020.07.14.202283


To further establish the contribution of hepatic CB1R to the high-fat diet (HFD)-induced 1

decrease in sOb-R levels, we utilized the liver-specific CB1R null (LCB1-/-) mice, a genetic 2

deletion model of mice that lack CB1R specifically in hepatocytes [mouse model generation is 3

described in (Osei-Hyiaman et al., 2008)]. When fed with a HFD, these mice gain similar weight 4

to their wild-type (WT) littermate controls [(Osei-Hyiaman et al., 2008) and Figure 1F]; however, 5

they are less prone to develop liver steatosis, dyslipidemia and leptin resistance (Osei-Hyiaman et 6

al., 2008), making hepatic CB1R a central regulator of obesity-related liver complications. We 7

were therefore not surprised to find that the liver specific deletion of CB1R was sufficient to 8

maintain normal circulating levels of sOb-R in both lean and obese LCB1-/- mice (Figure 1A). 9

Similarly, the hepatic gene and protein expression of sOb-R and the other LEPR isoforms were 10

not affected by the HFD feeding (Figure 1B, C and G, H), suggesting that hepatic CB1R most 11

likely regulates sOb-R levels. 12

To test the functional relevance of our findings to hepatic leptin signalling, we measured 13

the phosphorylation levels of STAT3, the gold-standard measure of leptin signalling [reviewed in 14

(Allison & Myers, 2014)], in mouse livers following exogenous leptin administration in vivo. 15

Whereas both lean WT and LCB1-/- mice showed elevated pSTAT3/STAT3 ratio in response to 16

leptin (Figure 1I, J), only obese LCB1-/- mice remained leptin sensitive (Figure 1K, L). These 17

results are in line with findings from Osei-Hyiaman and colleagues (Osei-Hyiaman et al., 2008), 18

demonstrating that LCB1-/- mice are resistant to obesity-induced hyperleptinemia. 19

Additional support for the regulation of sOb-R by hepatic CB1R derived from another 20

transgenic mouse model (hTgCB1-/-), in which CB1R is expressed only in hepatocytes [mouse 21

model generation is described in (Liu et al., 2012; Tam et al., 2010)]. These mice, despite being 22

resistance to DIO like global CB1R-/- mice [(Liu et al., 2012; Tam et al., 2010) and Figure 1M], 23

6


https://doi.org/10.1101/2020.07.14.202283


demonstrate increased circulating leptin levels when fed a HFD (Liu et al., 2012). In accordance 1

with that, the circulating and hepatic sOb-R levels in these mice were decreased by 50% following 2

14 weeks consumption of a HFD (Figure 1N-Q). Hence, over expression of CB1R in the liver 3

alone recapitulates the HFD-induced downregulation of sOb-R observed in WT mice. 4

Next, we assessed whether a direct activation of CB1R in hepatocytes induces a reduction 5

in sOb-R levels. To test this, we treated cultured hepatocytes with the synthetic CB1R agonist 6

noladin ether (NE) for 24 hrs. We analysed both culture media and cell lysates, and found that, 7

similarly to obesity, direct activation of CB1R also decreased sOb-R levels in the culture media. 8

This was also the case with intra-cellular levels of other LEPR isoforms measured. This CB1R-9

mediated reduction in ObR levels was completely reversed by blocking CB1R using JD5037 10

(Figure 2). 11

12

CHOP contributes to the metabolic response to peripheral CB1R blockade. 13

Several lines of evidence suggest that hypothalamic neurons, including POMC, experience 14

endoplasmic reticulum (ER) stress during DIO, which may contribute to the development of leptin 15

resistance (L. Ozcan et al., 2009; Ramirez & Claret, 2015). We have previously reported that 16

pharmacological inhibition of peripheral CB1Rs (by AM6545) reverses the HFD-induced hepatic 17

elevation in the ER stress marker phospho-eIF2α (Tam et al., 2010). Since ER stress strongly 18

affects protein translation and secretion [reviewed in (Ron & Walter, 2007)], we hypothesized that 19

it could explain the reduced expression/secretion of sOb-R following CB1R activation and/or 20

obesity. We therefore measured the phosphorylation of eIF2α and found the expected elevation in 21

phospho-to-total eIF2α ratio in the liver of HFD fed WT mice. Similar to AM6545, treatment with 22

7


https://doi.org/10.1101/2020.07.14.202283


JD5037 normalized p-eIF2α levels (Supplementary Figure 1A, B), suggesting relived ER stress 1

following CB1R blockade. In agreement with these findings, a comparable ratio of hepatic 2

phospho-to-total eIF2α ratio was documented in lean and obese LCB1-/- mice (Supplementary 3

Figure 1C, D). 4

Measuring the expression levels of the ER stress marker C/EBP homologous protein 5

(CHOP) revealed surprising findings, since both the hepatic mRNA and protein levels of CHOP 6

were downregulated in obese WT mice, despite the suggested ER stress. Its expression levels were 7

even further upregulated by JD5037, and remained comparable between lean and obese LCB1-/- 8

mice (Figure 3A-D). In fact, CHOP levels were positively correlated with the levels of sOb-R in 9

both our experimental paradigms, leading us to hypothesize that CHOP may directly be involved 10

in the regulation of sOb-R. 11

To test our hypothesis, we compared the metabolic efficacy of JD5037 in obese CHOP KO 12

mice and their littermate controls. Whereas JD5037 was almost equieffective in reducing body 13

weight and fat mass in both obese mouse strains (Figure 3E-G), it improved plasma cholesterol 14

levels as well as hepatic steatosis in WT mice only (Figure 3H-J). The reduced ability of 15

peripherally restricted CB1R blockade to improve dyslipidemia and hepatic steatosis in CHOP KO 16

mice led us to measure the hepatic eCB 'tone' in these mice. Strikingly, we found that the basal 17

levels of AEA and 2-AG were markedly higher in CHOP KO mice than in the WT control group. 18

Moreover, the increased eCB levels in CHOP KO mice remained unchanged following a 19

consumption of HFD as well as JD5037 treatment (Supplementary Figure 2A, B). This could be 20

partially explained by the differences documented in the mRNA expression patterns of fatty acid 21

amide hydrolase (FAAH), monoacylglycerol lipase (MGLL), N-acyl phosphatidylethanolamine 22

phospholipase D (NAPE-PLD), and diacylglycerol lipase alpha (DAGLα), the degrading and 23

8


https://doi.org/10.1101/2020.07.14.202283


synthesizing enzymes of both eCBs, respectively (Supplementary Figure 2C-F). Overall, these 1

data indicate that CHOP deficiency alters eCB 'tone', which, in turn, may lead to the reduced 2

response to CB1R blockade mainly in the liver. 3

4

CHOP plays a key role in the regulation of sOB-R by the eCB/CB1R system. 5

Measuring the effect of CHOP deficiency on sOb-R levels revealed comparable circulating levels 6

of sOB-R in lean and obese mice in the two mouse strains. However, JD5037 failed to restore sOb-7

R levels in CHOP KO mice (Figure 4A). The assessment of sOb-R mRNA expression and protein 8

content in the livers of both strains documented reduced baseline levels in CHOP KO mice, 9

compare to WT, which still remained low following HFD consumption and/or JD5037 treatment 10

(Figure 4B, C). A similar trend was observed in the protein level of two more LEPR isoforms 11

(Figure 4D, E). The HFD-induced hyperleptinemia was almost completely normalized by JD5037 12

treatment in WT mice, whereas it was only partially ameliorated by JD5037 in CHOP KO animals 13

(Figure 4F). Taken together, our data suggest that regulation of ObR levels is CHOP-dependent. 14

In addition, CHOP regulation of the soluble isoform levels can consequently affect circulating 15

leptin levels, possibly, in a CB1R-dependent manner. 16

To further investigate this concept, we directly activated CB1R (with NE) in immortalized 17

hepatocytes originated from WT or CHOP KO mice. Similar to a HFD consumption in mice 18

(Figure 3A), a direct activation of CB1R downregulated CHOP mRNA expression (Figure 5A). 19

We validated this by measuring the expression levels of Gadd34, a downstream target of CHOP 20

(Hu, Tian, Ding, & Yu, 2018), and found that its expression was also reduced in NE-treated WT 21

mice, and remained unchanged in CHOP KO cells (Figure 5B), suggesting that CB1R activation 22

9


https://doi.org/10.1101/2020.07.14.202283


in fact leads to reduced CHOP expression and activity. Whereas NE was able to reduce sOb-R 1

levels in WT hepatocytes, it had the opposite effect in CHOP KO hepatocytes, suggesting that 2

CB1R may regulate sObR levels in other mechanisms independently of CHOP (Figure 5C-E). 3

The consistent correlation between CHOP and sOb-R levels implies that CHOP is a 4

positive regulator of Ob-Re. To validate this further, we analysed Ob-Re levels in WT and CHOP 5

KO hepatocytes treated with tunicamycin (TM), a potent inducer of ER stress. Treatment with TM 6

for 6 hrs led to an expected and robust expression of CHOP mRNA and protein in WT cells (Figure 7

6A, B). Importantly, this was accompanied with elevated mRNA expression levels of Ob-Re as 8

well as secreted levels of sOb-R into the culture media in WT, but not CHOP KO hepatocytes 9

(Figure 6C-E). Increased levels of sOb-R in culture media were also documented when we 10

exogenously overexpressed myc-tagged CHOP in WT hepatocytes (Figure 6F, G), supporting a 11

direct role for CHOP in LEPR gene regulation. By using a luciferase reporter assay, in which the 12

-650 to +850 (relative to transcription start site) region of the LEPR promoter was cloned into 13

firefly luciferase expressing vector, we found that CHOP expression and luciferase activity in 14

transfected cells was induced using TM (Figure 6H), while CB1R activation using NE (which 15

downregulates CHOP expression as seen in Figure 5A) had an opposite effect in WT, but not in 16

CHOP KO cells. These data support the involvement of CHOP in CB1R-dependent regulation of 17

sOb-R. 18

To further explore the possibility that CHOP can directly bind the LEPR promoter and 19

control its expression, we preformed several ChIP experiments. In silico analysis of the LEPR 20

promoter region revealed a putative binding site, corresponding to 5 of 6 nucleotides that compose 21

a core sequence for CHOP binding (GRCm38:CM000997.2. Chromosome 4: 101,717,929-22

101,717,934) (Ubeda et al., 1996). As seen in Figure 6I, there was a 2-fold increase in the recovery 23

10


https://doi.org/10.1101/2020.07.14.202283


of the qPCR product amplified with a primer set flunking the putative CHOP binding site, in cells 1

that were treated with TM. A similar enrichment was seen in Gadd34, a well-known target of 2

CHOP. This increase was limited to WT hepatocytes, validating the specificity of CHOP IP. Taken 3

together, our data suggests that CHOP is able to occupy the LEPR promoter and directly regulate 4

sOb-R levels in response to HFD consumption and/or CB1R activation. 5

The molecular signalling pathway(s) by which eCBs/CB1R regulates CHOP levels calls 6

for further investigation. Nevertheless, one putative mechanism may involve Trib3, a 7

multifunctional protein upregulated during ER stress by the PERK-ATF4-CHOP pathway, which 8

mediates cell death. Trib3 represses its own expression by inhibiting the transcription of ATF4 and 9

CHOP (Jousse et al., 2007; Mathur et al., 2014; Ohoka, Yoshii, Hattori, Onozaki, & Hayashi, 10

2005). In addition, many studies describe Trib3 as a key factor in mediating the anti-tumor effect 11

of cannabinoids [reviewed in (Velasco, Sanchez, & Guzman, 2016)]. Our in vivo data indicate that 12

HFD induces the mRNA and protein expression levels of hepatic Trib3, and that treatment with 13

JD5037 restores these levels. This effect is limited to WT mice, while in CHOP KO mice, Trib3 14

levels did not change in response to HFD nor JD5037 treatment. Similarly, a direct activation of 15

CB1R using NE upregulated Trib3 expression in WT, but not in CHOP KO hepatocytes 16

(Supplementary Figure 3A-E), suggesting that Trib3 is indeed induced via CB1R signalling, and 17

negatively regulates CHOP levels. 18

19

20

Discussion 21

Since only free leptin crosses the blood-brain-barrier (BBB) and induces leptin signaling, the 22

soluble isoform of leptin receptor, which sequesters free leptin in the serum and is considered as 23

11


https://doi.org/10.1101/2020.07.14.202283


the main binding protein for leptin in the circulation, practically regulates leptin’s bioavailability 1

and activity and can potentially affect leptin sensitivity/resistance. This is also true for peripheral 2

tissues, where sOb-R/leptin complexes cannot bind to and activate membrane anchored leptin 3

receptors. Many human and animal studies have demonstrated that sOb-R levels are inversely 4

correlated with plasma levels of leptin, BMI and adiposity (Chan et al., 2002; Lahlou et al., 2000; 5

Laimer et al., 2002; Ogier et al., 2002; Reinehr et al., 2005), suggesting that low levels of the 6

soluble isoform contribute to obesity-related hyperleptinemia and subsequently, leptin resistance. 7

In contrast to pathological conditions with a positive energy balance (i.e. obesity), human clinical 8

situations associated with energy deficiency (i.e. starvation and/or anorexia nervosa) are 9

characterized by upregulated circulating levels of sOb-R (Monteleone, Fabrazzo, Tortorella, 10

Fuschino, & Maj, 2002; Reinehr et al., 2005; Stein, Vasquez-Garibay, Kratzsch, Romero-Velarde, 11

& Jahreis, 2006; Zepf et al., 2012). Moreover, individuals carrying a mutated allele of LEPR, 12

which leads to enhanced shedding of the leptin binding domain, have normoleptinemia and they 13

are not obese (Lahlou et al., 2002). For these reasons, the sOb-R most likely plays a key role in 14

the formation of central and peripheral leptin resistance conditions. Yet, only limited knowledge 15

exists about the molecular mechanisms that regulate sOb-R production and secretion. 16

Using multiple cultured cell types, Gan and colleagues have shown that TNFα may induce 17

cell surface expression of Ob-Rb as well as sOb-R levels (Gan et al., 2012). In addition, an in vitro 18

study has demonstrated that increasing concentration of recombinant sOb-R diminishes STAT3 19

phosphorylation in response to leptin stimulation, but pre-incubation of leptin with recombinant 20

sOb-R forms ligand-receptor complexes that do not affect leptin-mediated STAT3 21

phosphorylation (G. Yang et al., 2004). In vivo, it has been described that leptin stimulation as well 22

as food deprivation specifically induce the expression of sOb-R in mouse liver (Cohen et al., 2005). 23

12


https://doi.org/10.1101/2020.07.14.202283


It has been also demonstrated that in contrast to mice, the human sOb-R, exclusively generated 1

through proteolytic cleavage of the extracellular domain of membrane-anchored isoforms 2

(Maamra et al., 2001), is shed into the circulation by two well-known proteolytic enzymes, 3

ADAM10 and ADAM 17, belong to the 'ADAM's family' [review in (Schaab & Kratzsch, 2015)]. 4

As we could not detect significant up/down regulation in the expression levels of these proteins in 5

our experimental paradigms (Supplementary Figure 4), and the fact that we detected all changes 6

in both mRNA and protein levels, we reasoned that the observed alterations in the circulating levels 7

of sOb-R result from altered hepatic expression and secretion of the LEPR gene rather than 8

decreased shedding. In addition, numerous stimuli, such as activation of protein kinase C, an 9

increase in intracellular calcium, lipotoxicity and apoptosis, may contribute to the proteolytic 10

cleavage of the extracellular leptin receptor domain (Maamra et al., 2001; Schaab et al., 2012). 11

However, to our best knowledge, a molecular mechanism responsible for the decreased 12

expression/shedding of sOb-R in obesity was never reported. Here, we describe, for the first time, 13

the involvement of the eCB/CB1R system in regulating sOb-R levels and consequently leptin's 14

activity. 15

The importance of the eCB/CB1R system in regulating normal energy homeostasis as well 16

as mediating obesity-related comorbidities is well acknowledged [review in (Simon & Cota, 17

2017)]. In fact, its pivotal interaction with leptin has been first described in 2001, demonstrating 18

that leptin reduces the content of hypothalamic eCBs (Di Marzo et al., 2001), and attenuates eCB-19

mediated ‘retrograde' neuronal CB1R signaling (Jo et al., 2005; Malcher-Lopes et al., 2006). On 20

the other hand, activating CB1R by eCBs may, in turn, regulate leptin levels and signaling. Indeed, 21

we have previously shown that CB1R activation in adipocytes and pre-junctional sympathetic 22

fibers innervating the adipose tissue stimulates leptin biosynthesis and release, and its activation 23

13


https://doi.org/10.1101/2020.07.14.202283


in the proximal tubules of the kidney inhibits leptin degradation and renal clearance (Tam et al., 1

2012), thus possibly contributing to leptin resistance. In agreement with these findings, peripheral 2

CB1R blockade has been shown to ameliorate obesity-related hyperleptinemia, and subsequently 3

restores leptin sensitivity in obese mice (Tam et al., 2012). By using both pharmacological and 4

genetic approaches that target hepatic CB1R, our findings here suggest another novel mechanism 5

by which the eCB system may regulate hepatic leptin resistance. Specifically, peripheral blockade 6

as well as hepatic deletion/overexpression of CB1R modulate the expression levels of the sOB-R 7

isoform in hepatocytes and its subsequent release into the circulation, reversing the CB1R-8

mediated decrease in sOb-R levels and hepatic leptin resistance during obesity. One should point 9

out that although liver-specific CB1R KO mice retained higher levels of circulating sOB-R when 10

fed a HFD, they were equally susceptible to DIO as their WT controls. Similarly, hepatic-specific 11

CB1R transgenic mice in the CB1R-null background remained resistant to DIO while displayed 12

significantly lower circulating sOB-R levels, as compared to their littermates. These data suggest 13

that while liver CB1R expression is a major contributor to circulating sOB-R levels, their roles in 14

regulating systemic/central energy balance will need to be further validated. Nevertheless, in 15

accordance with our findings, Palomba and colleagues reported that CB1R activation interferes 16

with leptin's activity in hypothalamic ARC neurons (Palomba et al., 2015). On the other hand, 17

opposite findings were reported by Bosier and colleagues, demonstrating that pharmacological or 18

genetic deletion of CB1R in astrocytes downregulates Ob-Rb expression and leptin-mediated 19

functional responses, whereas JZL195 (a dual MAGL and FAAH inhibitor) upregulates these 20

features (Bosier et al., 2013). These differences can be explained by the distinct roles hepatocytes, 21

astrocytes, and neurons play in peripheral and central metabolic regulations, and by cell-specific 22

roles for CB1R in this regulation. As our findings demonstrate a similar effect of hepatic CB1R 23

14


https://doi.org/10.1101/2020.07.14.202283


activation/overexpression or blockade/deletion on the different isoforms of LEPR, it seems equally 1

possible that hepatic CB1R may affect DIO-related hepatic leptin resistance by not only modulating 2

sOB-R levels, which controls leptin’s activity, but also by modulating the expression of Ob-Rb in 3

hepatocytes. Further investigations would allow us to differentiate between these two pathways. 4

Obesity is often characterized by an ER stress and consequently an adaptive unfolded 5

protein response (UPR), operated by three parallel sensors: activating transcription factor 6 6

(ATF6), inositol requiring enzyme 1α (IRE1α), and protein kinase R-like ER kinase (PERK) 7

(Walter & Ron, 2011). The activation of the latter induces the phosphorylation of eIF2α, which, 8

in turn, inhibits transcription and protein synthesis (Ron, 2002). In case of an extreme ER stress 9

conditions, CHOP is activated by the PERK signaling pathway, and executes ER stress-mediated 10

apoptosis (Hu et al., 2018; Zinszner et al., 1998). In fact, ER stress has been shown to contribute 11

to the development of hypothalamic leptin resistance, by impairing the transport of leptin across 12

the BBB and suppressing STAT3 phosphorylation (El-Haschimi, Pierroz, Hileman, Bjorbaek, & 13

Flier, 2000; Hosoi et al., 2008; L. Ozcan et al., 2009; X. Zhang et al., 2008). In addition, under 14

physiological conditions, excess nutrients increases the demand for protein synthesis by the liver, 15

leading to ER stress and UPR activation, which resolves the stress within hours (Oyadomari, 16

Harding, Zhang, Oyadomari, & Ron, 2008). Nevertheless, chronic ER stress in the liver was 17

demonstrated in both obese mice and human (U. Ozcan et al., 2004; Puri et al., 2008). Here, we 18

demonstrate that obese mice had elevated levels of phosphorylated eIF2α, indicating increased ER 19

stress; an effect that was reversed by peripheral CB1R blockade and was absent in LCB1-/-. These 20

findings are in agreement with our previous reports, where we reported that a neutral CB1R 21

antagonist (AM6545) has the ability to reduce the HFD-induced upregulation in hepatic eIF2α 22

(Tam et al., 2010), and that hepatic activation of CB1R induces ER stress and contributes to insulin 23

15


https://doi.org/10.1101/2020.07.14.202283


resistance (Liu et al., 2012). Unexpectedly, we found that the hepatic gene and protein levels of 1

CHOP were significantly decreased in obese mice, and were upregulated by peripheral CB1R 2

blockade. This observation is conceptually in agreement with several previous reports that describe 3

a modulated UPR signaling with altered sensitivity or output that might implicate conditions of 4

persistence/repeated stress (Chambers, Petrova, Tomba, Vendruscolo, & Ron, 2012; Gomez & 5

Rutkowski, 2016; Preissler et al., 2015; L. Yang et al., 2015). 6

Apart from its role in ER stress-mediated apoptosis, CHOP has been implicated in 7

regulating other processes such as inflammation (Endo, Mori, Akira, & Gotoh, 2006; Nakayama 8

et al., 2010), insulin resistance (Maris et al., 2012; Song, Scheuner, Ron, Pennathur, & Kaufman, 9

2008) and adiposity. Specifically in the liver, Chikka and colleagues suggest that CHOP is a 10

suppressor of key regulators of lipid metabolism like Cebpα Pparα and Srebf1 (Chikka, McCabe, 11

Tyra, & Rutkowski, 2013), and demonstrate that CHOP deficient mice tend to develop hepatic 12

steatosis in response to bortezomib-induced ER stress. This is in agreement with an earlier report 13

describing higher body weight and adiposity in female CHOP KO mice compare to WT controls 14

(Ariyama et al., 2007). In contrast, we show that male CHOP KO mice and their WT littermate 15

controls gain comparable amount of weight and have similar body composition following exposure 16

to an HFD for 14 weeks. Nevertheless, we did see a trend toward increased liver triglycerides. 17

An interesting observation was that the eCB ‘tone’ of lean and obese CHOP KO mice was 18

comparable. To our best knowledge, a direct regulation of eCB synthesis or degradation by CHOP 19

has never been described. Thus, our data imply a possible link between the two. Interestingly, 20

JD5037 failed to reverse many of the metabolic abnormalities, such as HDL and LDL content as 21

well as liver triglycerides in DIO CHOP KO mice. It also had much smaller effect on total body 22

fat mass then in WT DIO mice. Whereas basal circulating levels of sOb-R were comparable 23

16


https://doi.org/10.1101/2020.07.14.202283


between WT and CHOP KO mice, its levels were markedly lower in the liver of CHOP KO mice 1

as well as cultured hepatocytes. Moreover, sOb-R remained low in these mice even on HFD, 2

supporting a role for CHOP in regulating the synthesis of sOb-R in the liver. The failure of JD5037 3

to elevate sOb-R levels in obese CHOP KO mice places CHOP downstream of CB1R in this 4

molecular cascade. 5

As mention earlier, the molecular signalling pathway(s) by which eCBs or CB1R regulates 6

CHOP levels is outside the scope of this work. However, two possible mechanisms might be 7

relevant. The first putative mechanism may involve Trib3.Interestingly, it has been shown that Δ9-8

THC as well as synthetic cannabinoid agonists upregulate Trib3 expression (Blazquez et al., 2006; 9

Carracedo et al., 2006; Salazar et al., 2013; Vara et al., 2011) to engage apoptosis in variable cancer 10

models. Moreover, Cinar et al. demonstrated that hepatic CB1R induces ER stress in hepatocytes 11

by increasing de novo synthesis of ceramides (Cinar et al., 2014), which are also involved in Trib3 12

upregulation following ER stress (Carracedo et al., 2006). In line with our observation that Trib3 13

levels are negatively correlated with sObR and are elevated following direct or indirect activation 14

of CB1R, we may suggest Trib3 to be the molecular linker between the two pathways. Second, 15

CHOP is a cAMP responsive protein, so its expression is induced via a cAMP response element 16

(CRE) (Conkright et al., 2003; Pomerance et al., 2003; Ramji & Foka, 2002; Wilson & Roesler, 17

2002). CB1R, a G-protein coupled receptor (GPCR), which upon activation recruits Gi protein, can 18

inhibit the activity of adenylyl cyclase and reduce the levels of cAMP (Turu & Hunyady, 2010). 19

It is therefore plausible that a decline in cAMP following CB1R activation inhibits CHOP 20

transcription. This hypothesis is more appealing if one considers the pivotal role of cAMP in 21

regulating liver metabolism (Wahlang, McClain, Barve, & Gobejishvili, 2019), and takes into 22

account the fact that reduced levels of cAMP were documented in HFD-fed mice (Zingg et al., 23

17


https://doi.org/10.1101/2020.07.14.202283


2017). Yet, further studies will need to explore the specific molecular pathways linking together 1

hepatic eCB/CB1R system and CHOP. 2

In conclusion, we report a new role for the hepatic eCB/CB1R in the development of hepatic 3

leptin resistance, by reducing the expression and/or subsequent release of sOb-R (Figure 7). We 4

show that peripherally restricted CB1R antagonism has the ability to restore sOb-R levels, 5

contributing to the reversal of obesity-induced hyperleptinemia. We also suggest that upon CB1R 6

blockade in hepatocytes, CHOP levels are upregulated via reduced Trib3 expression. CHOP, in 7

turn, directly binds the LEPR promoter and promotes the expression of sOb-R. 8

9

10

Materials and Methods 11

Animals and Experimental Protocol. All animal studies were approved by the Institutional 12

Animal Care and Use Committee of the Hebrew University of Jerusalem (AAALAC accreditation 13

#1285). C57Bl/6 (Envigo, Israel), LCB1-/- and hTgCB1-/- (kindly provided by Dr. George Kunos, 14

NIH) or B6.129S(Cg)-Ddit3tm2.1Dron/J (CHOP KO, The Jackson Laboratory #005530), and their 15

WT littermate controls were used for in vivo experiments. All mice were male, 8-10-week-old at 16

the beginning of each experiment. To generate DIO (body weight > 42g), mice were fed with a 17

standard diet (STD; 14% fat, 24% protein, 62% carbohydrates; NIH-31 rodent diet) or a high-fat 18

diet (HFD; 60% fat, 20% protein and 20% carbohydrates; Research Diet, D12492) for 14 weeks. 19

Treatment with JD5037 (3 mg/kg, ip) or vehicle (1% Tween80, 4% DMSO, 95% Saline) was 20

conducted for 7 days, and 12 hrs following the last dose, the mice were euthanized by a cervical 21

dislocation under anesthesia, and blood and livers were harvested for further analyses. For leptin 22

sensitivity test, mice were fasted for 24 hrs before an ip administration of recombinant mouse 23

18


https://doi.org/10.1101/2020.07.14.202283


leptin (3 mg/kg). 1 hr following leptin administration, mice were euthanized, liver were harvested 1

and processed for phosphorylated STAT3 detection using Western blot. 2

3

Cell Culture. WT or CHOP KO immortalized hepatocytes [described in (Uzi et al., 2013)] were 4

maintained in DMEM (01-100-1A; Biological Industries, Israel) supplemented with 5% FCS, 100 5

mM Glutamine, 100 mM Na-Pyruvate, and Pen/Strep. Cells were cultured at 37°C in a humidified 6

atmosphere of 5% CO2/95% air. To test the effect of CB1R activation, cells were seeded in 6-well 7

plates (25x104 cells/well) for 24 hrs. Then, growth medium was replaced with a serum-free 8

medium (SFM) for an additional 12 hrs. At the morning of the experiment the medium was 9

replaced with fresh SFM containing either vehicle (EtOH), 2.5 µM noladin ether (NE; Cayman 10

Chemicals, Ann Arbor, Michigan) or a combination of 100 nM JD5037 (Haoyuan Chemexpress 11

Co., Ltd) and 2.5 µM NE. 24 hrs later, cells were harvested for further analyses as described below. 12

13

Measurements of sOb-R. Soluble leptin receptor was quantified by an ELISA kit, capable to 14

differentiate the soluble isoform from other isoforms, according to manufacturer’s instructions 15

(E03S0226; Shanghai Bluegene Biotech, China). Briefly, for serum measurements, we diluted 16

serum in saline (1:2) and 100 µL from the diluted samples were analyzed. For hepatic 17

measurements, 50-100 mg tissue samples were homogenized in 300 µL of 1xPBS and centrifuged 18

for 5 min in 5000 rpm. 100 µL of cleared lysates were analyzed. Data were normalized to sample 19

protein content, determined using the Pierce™ BCA Protein Assay Kit (Thermo Scientific, IL). 20

To measure sOb-R protein content in cell culture media, we used trichloroacetic acid 21

(TCA) precipitation protocol. 350 µL of 100% TCA were added to 1.6 mL culture media, vortexed 22

19


https://doi.org/10.1101/2020.07.14.202283


and incubated for 30 min on ice. Samples were then centrifuged to pellet proteins (14000 rpm, 10 1

min, 4ºC). Pellets were washed in 100% acetone, resuspended in 0.1 M NaOH and protein loading 2

dye, and analyzed by Western blot. Ponceau staining of the blots was used as loading control for 3

quantification. 4

5

Validation of LEPR antibody. The specificity of the anti-LEPR antibody was validated in a control 6

experiment (Supplementary Figure 5), where mouse LEPR was overexpressed in kidney cell line 7

by using a viral infection. The viral vector encoded Ad-GFP-mLEPR (ADV-263380, VECTOR 8

BIOSYSTEMS Inc.) was used in a multiplicity of infection of 50, and cells were harvested for 9

Western blot analysis 24 hrs post infection. 10

11

Real-time PCR. For total mRNA isolation, tissue samples or hepatocytes were washed in 1xPBS 12

and harvested using Bio-Tri RNA lysis buffer (Bio-Lab, Israel). Extracted RNA was treated with 13

DNase I (Thermo Scientific, IL), and reverse transcribed using the Iscript cDNA kit (Bio-Rad 14

Laboratories, CA). Quantitative PCR reactions for ObRe, Chop or Gadd34 were performed using 15

iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories, CA), and the CFX connect ST 16

system (Bio-Rad Laboratories, CA). Relative quantity (RQ) values of all tested genes were 17

normalized to Ubc. Primers are listed in Supplementary Table 1. 18

19

Western blot Analysis. Tissue samples or hepatocytes were washed in cold 1xPBS, and harvested 20

in a RIPA buffer (25 mM Tris-HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 21

0.1% SDS), vortexed and incubated for 30 min at 4°C, then centrifuged for 10 min at 14,000 rpm. 22

20


https://doi.org/10.1101/2020.07.14.202283


Protein concentrations were determined using the Pierce™ BCA Protein Assay Kit (Thermo 1

Scientific, IL). Cleared lysates were supplemented with protein sample buffer, resolved by SDS-2

PAGE (4-15% acrylamide, 150V) and transferred to PVDF membranes using the Trans-Blot® 3

Turbo™ Transfer System (Bio-Rad Laboratories, CA). Membranes were incubated for 1 hr in 5% 4

milk (in TBS-T) to block unspecific binding, washed briefly, and incubated overnight at 4°C with 5

the following primary antibodies: LEPR (NB-120-5593, Novus), phosphorylated STAT3 (9145, 6

Cell Signaling), STAT3 (9139, Cell Signaling), phosphorylated eIF2α (9721, Cell Signaling), 7

eIF2α (9722, Cell Signaling), CHOP (2895S, Cell Signaling), Trib3 (ab137526, Abcam) or β-8

Actin (ab49900, Abcam). Anti-rabbit (ab97085, Abcam) or mouse (ab98799, Abcam) horseradish 9

peroxidase (HRP)-conjugated secondary antibodies were used for 1 hr at room temperature, 10

followed by chemiluminescence detection using Clarity™ Western ECL Blotting Substrate (Bio-11

Rad Laboratories, CA). Densitometry was quantified using ImageLab software. Protein RQ was 12

calculated as the ratio between LEPR to total protein signal (ponceau) in culture media 13

supernatants or to β-Actin in cell and tissue lysates. 14

15

Body composition. Total body fat and lean masses were determined by EchoMRI-100H™ (Echo 16

Medical Systems LLC, Houston, TX, USA). 17

18

HDL and LDL measurements were done using the Cobas C-111 chemistry analyzer (Roche, 19

Switzerland). 20

21

21


https://doi.org/10.1101/2020.07.14.202283


Hepatic Triglycerides Measurements. Tissue lipids were extracted as described in (Folch, Lees, 1

& Sloane Stanley, 1957), and quantified using Triglyceride Assay Kit (ab65336; Abcam). Data 2

were normalized to tissue weight. 3

4

Endocannabinoid measurements by LC-MS/MS. eCBs were extracted, purified, and quantified 5

in liver homogenates, as described previously (Drori et al., 2019; Udi et al., 2017). LC-MS/MS 6

was analyzed on an AB Sciex (Framingham, MA, USA) Triple Quad™ 5500 mass spectrometer 7

coupled with a Shimadzu (Kyoto, Japan) UHPLC System. eCBs were detected in a positive ion 8

mode using electron spray ionization (ESI) and the multiple reaction monitoring (MRM) mode of 9

acquisition. The levels of each compound were analyzed by monitoring multiple reactions. The 10

molecular ion and fragment for each compound were measured as follows: m/z 348.3→62.1 11

(quantifier) and 91.1 (qualifier) for AEA, m/z 379.3→287.3 (quantifier) and 91.1 (qualifier) for 2-12

AG. The levels of AEA and 2-AG in samples were measured against standard curves, and 13

normalized to tissue weight. 14

15

Chop Overexpression. WT hepatocytes were transfected with mCHOP-WT-9E10-pCDNA1 16

vector (Addgene plasmid #21913) using Lipofectamin 3000. Cells were harvested 24 hrs post-17

transfection and CHOP expression was validated by Western blot analysis. 18

19

Luciferase Promoter Assay. Mus musculus Ob-R promoter sequence (GRCm38:CM000997.2. 20

Chromosome 4: 101,716,750-101,718,250 forward strand) was cloned into pGL3-basic vector 21

(E1751, Promega). Reporter vector, as well as Renilla luciferase vector, were then co-transfected 22

22


https://doi.org/10.1101/2020.07.14.202283


into WT or CHOP KO hepatocytes using Lipophectamin 3000. 24 hrs post transfection, cells were 1

treated with either vehicle, 2.5 µg/mL tunicamycin (11089-65-9; Holland Moran, Israel) or 2.5 2

µM NE for indicated period. At the end of the experiment, luciferase activity was measured using 3

Dual-Glo® Luciferase Assay System (E2920, Promega). Data are presented as the ratio between 4

Firefly and Renilla luciferase activity. 5

6

Chromatin Immunoprecipitation (ChIP). WT or CHOP KO hepatocytes were seeded in 100 mm 7

plate and left to adhere (5x106 cells per plate; 3 plates for each sample). The next day, cells were 8

treated with either DMSO or 2.5 µg/mL tunicamycin for 6 hrs to induce CHOP expression. At the 9

end of incubation, cells were washed in 1xPBS, fixed with 1% formaldehyde for 10 min, then 10

quenched with 125 mM glycine and harvested from plates. Following centrifugation, cells were 11

re-suspended in a lysis buffer and sonicated for 12 cycles of 30 sec pulse followed by 30 sec rest 12

in 70% amplitude. Sheared DNA was diluted in a ChIP dilution buffer and pre-cleared with 13

magnetic ProteinG-sepharose beads for 4 hrs at 4°C. 10% of the lysate was removed and saved as 14

“Input”. The rest of the lysate was divided and each part was incubated overnight at 4°C with 2.5 15

µg of either anti-H3 (ab1791, Abcam), anti-CHOP (2895S, Cell Signaling) or IgG isotype control. 16

Antibody-chromatin complexes were precipitated with magnetic protein G-Sepharose beads, 17

washed with low salt, high salt, lithium chloride and Tris-EDTA buffers. DNA was then eluted 18

from beads, digested with proteinase K and purified. 1.5 µL of clean DNA was used in a qPCR 19

reaction using specific primers for GAPDH or LEPR promoter region. For a positive control, 20

GADD34 primers were used. For each sample, we calculated the ratio between the RQ (expressed 21

as % of input) of ObR promoter qPCR product in αCHOP IP relative to αH3 IP. This ratio was 22

normalized to the ratio of GAPDH qPCR product to control for non-specific binding. Data are 23

23


https://doi.org/10.1101/2020.07.14.202283


expressed as the fold-change of this ratio in tunicamycin-treated compare to vehicle-treated cells. 1

ChIP primers are listed in Supplementary Table 2. 2

3

Statistics. Data are presented as mean ± SEM. Unpaired two-tailed Student’s t-test was used to 4

determine variations between groups. Results in multiple groups were compared by ANOVA 5

followed by a Bonferroni test (GraphPadPrism v6 for Windows). Significance was set at P < 0.05. 6

7

8

24


https://doi.org/10.1101/2020.07.14.202283


Acknowledgments 1

This study was supported by grants from the Israeli Science Foundation (ISF; 617/14 and 158/18) 2

and The Obesity Society's Early Career Research Award to J.T. 3

4

Author Contributions 5

AD conducted the experiments and analyzed the data. AG, SA, LH and DW assisted with animal 6

care and in vivo experiments. RH and GS provided reagents and technical assistance. AN 7

conducted the LC-MS/MS analysis. MS provided essential knowledge and reagents for ChIP 8

analysis. BT provided CHOP KO mice and cultured hepatocytes. AD and JT designed and 9

supervised the experiments and wrote the manuscript. 10

11

Conflict of Interest: The authors have declared that no conflict of interest exists. 12

13

25


https://doi.org/10.1101/2020.07.14.202283


References 1

Allison, M. B., & Myers, M. G., Jr. (2014). 20 years of leptin: connecting leptin signaling to 2

biological function. J Endocrinol, 223(1), T25-35. doi: 10.1530/JOE-14-0404 3

Ariyama, Y., Shimizu, H., Satoh, T., Tsuchiya, T., Okada, S., Oyadomari, S., . . . Mori, M. (2007). 4

Chop-deficient mice showed increased adiposity but no glucose intolerance. Obesity 5

(Silver Spring), 15(7), 1647-1656. doi: 10.1038/oby.2007.197 6

Blazquez, C., Carracedo, A., Barrado, L., Real, P. J., Fernandez-Luna, J. L., Velasco, G., . . . 7

Guzman, M. (2006). Cannabinoid receptors as novel targets for the treatment of melanoma. 8

Faseb Journal, 20(14), 2633-+. doi: 10.1096/fj.06-6638fje 9

Bosier, B., Bellocchio, L., Metna-Laurent, M., Soria-Gomez, E., Matias, I., Hebert-Chatelain, E., 10

. . . Marsicano, G. (2013). Astroglial CB1 cannabinoid receptors regulate leptin signaling 11

in mouse brain astrocytes. Mol Metab, 2(4), 393-404. doi: 10.1016/j.molmet.2013.08.001 12

Buettner, C., Muse, E. D., Cheng, A., Chen, L., Scherer, T., Pocai, A., . . . Buettner, C. (2008). 13

Leptin controls adipose tissue lipogenesis via central, STAT3-independent mechanisms. 14

Nat Med, 14(6), 667-675. doi: 10.1038/nm1775 15

Cardinal, P., Andre, C., Quarta, C., Bellocchio, L., Clark, S., Elie, M., . . . Cota, D. (2014). CB1 16

cannabinoid receptor in SF1-expressing neurons of the ventromedial hypothalamus 17

determines metabolic responses to diet and leptin. Mol Metab, 3(7), 705-716. doi: 18

10.1016/j.molmet.2014.07.004 19

Carracedo, A., Lorente, M., Egia, A., Blazquez, C., Garcia, S., Giroux, V., . . . Velasco, G. (2006). 20

The stress-regulated protein p8 mediates cannabinoid-induced apoptosis of tumor cells. 21

Cancer Cell, 9(4), 301-312. doi: 10.1016/j.ccr.2006.03.005 22

26


https://doi.org/10.1101/2020.07.14.202283


Chambers, J. E., Petrova, K., Tomba, G., Vendruscolo, M., & Ron, D. (2012). ADP ribosylation 1

adapts an ER chaperone response to short-term fluctuations in unfolded protein load. J Cell 2

Biol, 198(3), 371-385. doi: 10.1083/jcb.201202005 3

Chan, J. L., Bluher, S., Yiannakouris, N., Suchard, M. A., Kratzsch, J., & Mantzoros, C. S. (2002). 4

Regulation of circulating soluble leptin receptor levels by gender, adiposity, sex steroids, 5

and leptin: observational and interventional studies in humans. Diabetes, 51(7), 2105-2112. 6

Chikka, M. R., McCabe, D. D., Tyra, H. M., & Rutkowski, D. T. (2013). C/EBP homologous 7

protein (CHOP) contributes to suppression of metabolic genes during endoplasmic 8

reticulum stress in the liver. J Biol Chem, 288(6), 4405-4415. doi: 9

10.1074/jbc.M112.432344 10

Cinar, R., Godlewski, G., Liu, J., Tam, J., Jourdan, T., Mukhopadhyay, B., . . . Kunos, G. (2014). 11

Hepatic cannabinoid-1 receptors mediate diet-induced insulin resistance by increasing de 12

novo synthesis of long-chain ceramides. Hepatology, 59(1), 143-153. doi: 13

10.1002/hep.26606 14

Cohen, P., Yang, G., Yu, X., Soukas, A. A., Wolfish, C. S., Friedman, J. M., & Li, C. (2005). 15

Induction of leptin receptor expression in the liver by leptin and food deprivation. J Biol 16

Chem, 280(11), 10034-10039. doi: 10.1074/jbc.M413684200 17

Conkright, M. D., Guzman, E., Flechner, L., Su, A. I., Hogenesch, J. B., & Montminy, M. (2003). 18

Genome-wide analysis of CREB target genes reveals a core promoter requirement for 19

cAMP responsiveness. Mol Cell, 11(4), 1101-1108. 20

Di Marzo, V., Goparaju, S. K., Wang, L., Liu, J., Batkai, S., Jarai, Z., . . . Kunos, G. (2001). Leptin-21

regulated endocannabinoids are involved in maintaining food intake. Nature, 410(6830), 22

822-825. doi: 10.1038/35071088 23

27


https://doi.org/10.1101/2020.07.14.202283


Drori, A., Permyakova, A., Hadar, R., Udi, S., Nemirovski, A., & Tam, J. (2019). Cannabinoid-1 1

receptor regulates mitochondrial dynamics and function in renal proximal tubular cells. 2

Diabetes Obes Metab, 21(1), 146-159. doi: 10.1111/dom.13497 3

El-Haschimi, K., Pierroz, D. D., Hileman, S. M., Bjorbaek, C., & Flier, J. S. (2000). Two defects 4

contribute to hypothalamic leptin resistance in mice with diet-induced obesity. J Clin 5

Invest, 105(12), 1827-1832. doi: 10.1172/JCI9842 6

Endo, M., Mori, M., Akira, S., & Gotoh, T. (2006). C/EBP homologous protein (CHOP) is crucial 7

for the induction of caspase-11 and the pathogenesis of lipopolysaccharide-induced 8

inflammation. J Immunol, 176(10), 6245-6253. 9

Engeli, S. (2008). Dysregulation of the endocannabinoid system in obesity. J Neuroendocrinol, 20 10

Suppl 1, 110-115. doi: 10.1111/j.1365-2826.2008.01683.x 11

Engeli, S., Bohnke, J., Feldpausch, M., Gorzelniak, K., Janke, J., Batkai, S., . . . Jordan, J. (2005). 12

Activation of the peripheral endocannabinoid system in human obesity. Diabetes, 54(10), 13

2838-2843. 14

Engin, A. (2017). Diet-Induced Obesity and the Mechanism of Leptin Resistance. Adv Exp Med 15

Biol, 960, 381-397. doi: 10.1007/978-3-319-48382-5_16 16

Flak, J. N., & Myers, M. G., Jr. (2016). Minireview: CNS Mechanisms of Leptin Action. Mol 17

Endocrinol, 30(1), 3-12. doi: 10.1210/me.2015-1232 18

Folch, J., Lees, M., & Sloane Stanley, G. H. (1957). A simple method for the isolation and 19

purification of total lipides from animal tissues. J Biol Chem, 226(1), 497-509. 20

Fride, E., Bregman, T., & Kirkham, T. C. (2005). Endocannabinoids and food intake: newborn 21

suckling and appetite regulation in adulthood. Exp Biol Med (Maywood), 230(4), 225-234. 22

28


https://doi.org/10.1101/2020.07.14.202283


Gan, L., Guo, K., Cremona, M. L., McGraw, T. E., Leibel, R. L., & Zhang, Y. (2012). TNF-alpha 1

up-regulates protein level and cell surface expression of the leptin receptor by stimulating 2

its export via a PKC-dependent mechanism. Endocrinology, 153(12), 5821-5833. doi: 3

10.1210/en.2012-1510 4

Ge, H., Huang, L., Pourbahrami, T., & Li, C. (2002). Generation of soluble leptin receptor by 5

ectodomain shedding of membrane-spanning receptors in vitro and in vivo. J Biol Chem, 6

277(48), 45898-45903. doi: 10.1074/jbc.M205825200 7

Gomez, J. A., & Rutkowski, D. T. (2016). Experimental reconstitution of chronic ER stress in the 8

liver reveals feedback suppression of BiP mRNA expression. Elife, 5. doi: 9

10.7554/eLife.20390 10

Hosoi, T., Sasaki, M., Miyahara, T., Hashimoto, C., Matsuo, S., Yoshii, M., & Ozawa, K. (2008). 11

Endoplasmic reticulum stress induces leptin resistance. Mol Pharmacol, 74(6), 1610-1619. 12

doi: 10.1124/mol.108.050070 13

Hu, H., Tian, M., Ding, C., & Yu, S. (2018). The C/EBP Homologous Protein (CHOP) 14

Transcription Factor Functions in Endoplasmic Reticulum Stress-Induced Apoptosis and 15

Microbial Infection. Front Immunol, 9, 3083. doi: 10.3389/fimmu.2018.03083 16

Huang, L., Wang, Z., & Li, C. (2001). Modulation of circulating leptin levels by its soluble 17

receptor. J Biol Chem, 276(9), 6343-6349. doi: 10.1074/jbc.M009795200 18

Jo, Y. H., Chen, Y. J., Chua, S. C., Jr., Talmage, D. A., & Role, L. W. (2005). Integration of 19

endocannabinoid and leptin signaling in an appetite-related neural circuit. Neuron, 48(6), 20

1055-1066. doi: 10.1016/j.neuron.2005.10.021 21

Jousse, C., Deval, C., Maurin, A. C., Parry, L., Cherasse, Y., Chaveroux, C., . . . Fafournoux, P. 22

(2007). TRB3 inhibits the transcriptional activation of stress-regulated genes by a negative 23

29


https://doi.org/10.1101/2020.07.14.202283


feedback on the ATF4 pathway. J Biol Chem, 282(21), 15851-15861. doi: 1

10.1074/jbc.M611723200 2

Lahlou, N., Clement, K., Carel, J. C., Vaisse, C., Lotton, C., Le Bihan, Y., . . . Guy-Grand, B. 3

(2000). Soluble leptin receptor in serum of subjects with complete resistance to leptin: 4

relation to fat mass. Diabetes, 49(8), 1347-1352. 5

Lahlou, N., Issad, T., Lebouc, Y., Carel, J. C., Camoin, L., Roger, M., & Girard, J. (2002). 6

Mutations in the human leptin and leptin receptor genes as models of serum leptin receptor 7

regulation. Diabetes, 51(6), 1980-1985. 8

Laimer, M., Ebenbichler, C. F., Kaser, S., Sandhofer, A., Weiss, H., Nehoda, H., . . . Patsch, J. R. 9

(2002). Weight loss increases soluble leptin receptor levels and the soluble receptor bound 10

fraction of leptin. Obes Res, 10(7), 597-601. doi: 10.1038/oby.2002.81 11

Lammert, A., Kiess, W., Bottner, A., Glasow, A., & Kratzsch, J. (2001). Soluble leptin receptor 12

represents the main leptin binding activity in human blood. Biochem Biophys Res Commun, 13

283(4), 982-988. doi: 10.1006/bbrc.2001.4885 14

Li, C., Ioffe, E., Fidahusein, N., Connolly, E., & Friedman, J. M. (1998). Absence of soluble leptin 15

receptor in plasma from dbPas/dbPas and other db/db mice. J Biol Chem, 273(16), 10078-16

10082. 17

Liu, J., Zhou, L., Xiong, K., Godlewski, G., Mukhopadhyay, B., Tam, J., . . . Kunos, G. (2012). 18

Hepatic cannabinoid receptor-1 mediates diet-induced insulin resistance via inhibition of 19

insulin signaling and clearance in mice. Gastroenterology, 142(5), 1218-1228 e1211. doi: 20

10.1053/j.gastro.2012.01.032 21

30


https://doi.org/10.1101/2020.07.14.202283


Lou, P. H., Yang, G., Huang, L., Cui, Y., Pourbahrami, T., Radda, G. K., . . . Han, W. (2010). 1

Reduced body weight and increased energy expenditure in transgenic mice over-expressing 2

soluble leptin receptor. PLoS One, 5(7), e11669. doi: 10.1371/journal.pone.0011669 3

Maamra, M., Bidlingmaier, M., Postel-Vinay, M. C., Wu, Z., Strasburger, C. J., & Ross, R. J. 4

(2001). Generation of human soluble leptin receptor by proteolytic cleavage of membrane-5

anchored receptors. Endocrinology, 142(10), 4389-4393. doi: 10.1210/endo.142.10.8442 6

Malcher-Lopes, R., Di, S., Marcheselli, V. S., Weng, F. J., Stuart, C. T., Bazan, N. G., & Tasker, 7

J. G. (2006). Opposing crosstalk between leptin and glucocorticoids rapidly modulates 8

synaptic excitation via endocannabinoid release. J Neurosci, 26(24), 6643-6650. doi: 9

10.1523/JNEUROSCI.5126-05.2006 10

Mantzoros, C. S. (1999). The role of leptin in human obesity and disease: a review of current 11

evidence. Ann Intern Med, 130(8), 671-680. 12

Maris, M., Overbergh, L., Gysemans, C., Waget, A., Cardozo, A. K., Verdrengh, E., . . . Mathieu, 13

C. (2012). Deletion of C/EBP homologous protein (Chop) in C57Bl/6 mice dissociates 14

obesity from insulin resistance. Diabetologia, 55(4), 1167-1178. doi: 10.1007/s00125-011-15

2427-7 16

Martin, S. S., Qasim, A., & Reilly, M. P. (2008). Leptin resistance: a possible interface of 17

inflammation and metabolism in obesity-related cardiovascular disease. J Am Coll Cardiol, 18

52(15), 1201-1210. doi: 10.1016/j.jacc.2008.05.060 19

Mathur, A., Abd Elmageed, Z. Y., Liu, X., Kostochka, M. L., Zhang, H., Abdel-Mageed, A. B., & 20

Mondal, D. (2014). Subverting ER-stress towards apoptosis by nelfinavir and curcumin 21

coexposure augments docetaxel efficacy in castration resistant prostate cancer cells. PLoS 22

One, 9(8), e103109. doi: 10.1371/journal.pone.0103109 23

31


https://doi.org/10.1101/2020.07.14.202283


Mazor, R., Friedmann-Morvinski, D., Alsaigh, T., Kleifeld, O., Kistler, E. B., Rousso-Noori, L., . 1

. . Schmid-Schonbein, G. W. (2018). Cleavage of the leptin receptor by matrix 2

metalloproteinase-2 promotes leptin resistance and obesity in mice. Sci Transl Med, 3

10(455). doi: 10.1126/scitranslmed.aah6324 4

Monteleone, P., Fabrazzo, M., Tortorella, A., Fuschino, A., & Maj, M. (2002). Opposite 5

modifications in circulating leptin and soluble leptin receptor across the eating disorder 6

spectrum. Mol Psychiatry, 7(6), 641-646. doi: 10.1038/sj.mp.4001043 7

Nakayama, Y., Endo, M., Tsukano, H., Mori, M., Oike, Y., & Gotoh, T. (2010). Molecular 8

mechanisms of the LPS-induced non-apoptotic ER stress-CHOP pathway. J Biochem, 9

147(4), 471-483. doi: 10.1093/jb/mvp189 10

Ogier, V., Ziegler, O., Mejean, L., Nicolas, J. P., & Stricker-Krongrad, A. (2002). Obesity is 11

associated with decreasing levels of the circulating soluble leptin receptor in humans. Int J 12

Obes Relat Metab Disord, 26(4), 496-503. 13

Ohoka, N., Yoshii, S., Hattori, T., Onozaki, K., & Hayashi, H. (2005). TRB3, a novel ER stress-14

inducible gene, is induced via ATF4-CHOP pathway and is involved in cell death. EMBO 15

J, 24(6), 1243-1255. doi: 10.1038/sj.emboj.7600596 16

Osei-Hyiaman, D., Liu, J., Zhou, L., Godlewski, G., Harvey-White, J., Jeong, W. I., . . . Kunos, G. 17

(2008). Hepatic CB1 receptor is required for development of diet-induced steatosis, 18

dyslipidemia, and insulin and leptin resistance in mice. J Clin Invest, 118(9), 3160-3169. 19

doi: 10.1172/JCI34827 20

Oyadomari, S., Harding, H. P., Zhang, Y., Oyadomari, M., & Ron, D. (2008). Dephosphorylation 21

of translation initiation factor 2alpha enhances glucose tolerance and attenuates 22

hepatosteatosis in mice. Cell Metab, 7(6), 520-532. doi: 10.1016/j.cmet.2008.04.011 23

32


https://doi.org/10.1101/2020.07.14.202283


Ozcan, L., Ergin, A. S., Lu, A., Chung, J., Sarkar, S., Nie, D., . . . Ozcan, U. (2009). Endoplasmic 1

reticulum stress plays a central role in development of leptin resistance. Cell Metab, 9(1), 2

35-51. doi: 10.1016/j.cmet.2008.12.004 3

Ozcan, U., Cao, Q., Yilmaz, E., Lee, A. H., Iwakoshi, N. N., Ozdelen, E., . . . Hotamisligil, G. S. 4

(2004). Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes. 5

Science, 306(5695), 457-461. doi: 10.1126/science.1103160 6

Pagotto, U., Marsicano, G., Cota, D., Lutz, B., & Pasquali, R. (2006). The emerging role of the 7

endocannabinoid system in endocrine regulation and energy balance. Endocr Rev, 27(1), 8

73-100. doi: 10.1210/er.2005-0009 9

Pagotto, U., Vicennati, V., & Pasquali, R. (2005). The endocannabinoid system and the treatment 10

of obesity. Ann Med, 37(4), 270-275. doi: 10.1080/07853890510037419 11

Palomba, L., Silvestri, C., Imperatore, R., Morello, G., Piscitelli, F., Martella, A., . . . Di Marzo, 12

V. (2015). Negative Regulation of Leptin-induced Reactive Oxygen Species (ROS) 13

Formation by Cannabinoid CB1 Receptor Activation in Hypothalamic Neurons. J Biol 14

Chem, 290(22), 13669-13677. doi: 10.1074/jbc.M115.646885 15

Pan, W. W., & Myers, M. G., Jr. (2018). Leptin and the maintenance of elevated body weight. Nat 16

Rev Neurosci, 19(2), 95-105. doi: 10.1038/nrn.2017.168 17

Pomerance, M., Carapau, D., Chantoux, F., Mockey, M., Correze, C., Francon, J., & Blondeau, J. 18

P. (2003). CCAAT/enhancer-binding protein-homologous protein expression and 19

transcriptional activity are regulated by 3',5'-cyclic adenosine monophosphate in thyroid 20

cells. Mol Endocrinol, 17(11), 2283-2294. doi: 10.1210/me.2002-0400 21

33


https://doi.org/10.1101/2020.07.14.202283


Preissler, S., Rato, C., Chen, R., Antrobus, R., Ding, S., Fearnley, I. M., & Ron, D. (2015). 1

AMPylation matches BiP activity to client protein load in the endoplasmic reticulum. Elife, 2

4, e12621. doi: 10.7554/eLife.12621 3

Puri, P., Mirshahi, F., Cheung, O., Natarajan, R., Maher, J. W., Kellum, J. M., & Sanyal, A. J. 4

(2008). Activation and dysregulation of the unfolded protein response in nonalcoholic fatty 5

liver disease. Gastroenterology, 134(2), 568-576. doi: 10.1053/j.gastro.2007.10.039 6

Ramirez, S., & Claret, M. (2015). Hypothalamic ER stress: A bridge between leptin resistance and 7

obesity. FEBS Lett, 589(14), 1678-1687. doi: 10.1016/j.febslet.2015.04.025 8

Ramji, D. P., & Foka, P. (2002). CCAAT/enhancer-binding proteins: structure, function and 9

regulation. Biochem J, 365(Pt 3), 561-575. doi: 10.1042/BJ20020508 10

Reinehr, T., Kratzsch, J., Kiess, W., & Andler, W. (2005). Circulating soluble leptin receptor, 11

leptin, and insulin resistance before and after weight loss in obese children. Int J Obes 12

(Lond), 29(10), 1230-1235. doi: 10.1038/sj.ijo.0803027 13

Ron, D. (2002). Translational control in the endoplasmic reticulum stress response. J Clin Invest, 14

110(10), 1383-1388. doi: 10.1172/JCI16784 15

Ron, D., & Walter, P. (2007). Signal integration in the endoplasmic reticulum unfolded protein 16

response. Nat Rev Mol Cell Biol, 8(7), 519-529. doi: 10.1038/nrm2199 17

Salazar, M., Lorente, M., Garcia-Taboada, E., Hernandez-Tiedra, S., Davila, D., Francis, S. E., . . 18

. Velasco, G. (2013). The pseudokinase tribbles homologue-3 plays a crucial role in 19

cannabinoid anticancer action. Biochim Biophys Acta, 1831(10), 1573-1578. doi: 20

10.1016/j.bbalip.2013.03.014 21

34


https://doi.org/10.1101/2020.07.14.202283


Schaab, M., Kausch, H., Klammt, J., Nowicki, M., Anderegg, U., Gebhardt, R., . . . Kratzsch, J. 1

(2012). Novel regulatory mechanisms for generation of the soluble leptin receptor: 2

implications for leptin action. PLoS One, 7(4), e34787. doi: 10.1371/journal.pone.0034787 3

Schaab, M., & Kratzsch, J. (2015). The soluble leptin receptor. Best Pract Res Clin Endocrinol 4

Metab, 29(5), 661-670. doi: 10.1016/j.beem.2015.08.002 5

Simon, V., & Cota, D. (2017). MECHANISMS IN ENDOCRINOLOGY: Endocannabinoids and 6

metabolism: past, present and future. Eur J Endocrinol, 176(6), R309-R324. doi: 7

10.1530/EJE-16-1044 8

Song, B., Scheuner, D., Ron, D., Pennathur, S., & Kaufman, R. J. (2008). Chop deletion reduces 9

oxidative stress, improves beta cell function, and promotes cell survival in multiple mouse 10

models of diabetes. J Clin Invest, 118(10), 3378-3389. doi: 10.1172/JCI34587 11

Stein, K., Vasquez-Garibay, E., Kratzsch, J., Romero-Velarde, E., & Jahreis, G. (2006). Influence 12

of nutritional recovery on the leptin axis in severely malnourished children. J Clin 13

Endocrinol Metab, 91(3), 1021-1026. doi: 10.1210/jc.2005-1394 14

Tam, J., Cinar, R., Liu, J., Godlewski, G., Wesley, D., Jourdan, T., . . . Kunos, G. (2012). Peripheral 15

cannabinoid-1 receptor inverse agonism reduces obesity by reversing leptin resistance. Cell 16

Metab, 16(2), 167-179. doi: 10.1016/j.cmet.2012.07.002 17

Tam, J., Szanda, G., Drori, A., Liu, Z., Cinar, R., Kashiwaya, Y., . . . Kunos, G. (2017). Peripheral 18

cannabinoid-1 receptor blockade restores hypothalamic leptin signaling. Mol Metab, 6(10), 19

1113-1125. doi: 10.1016/j.molmet.2017.06.010 20

Tam, J., Vemuri, V. K., Liu, J., Batkai, S., Mukhopadhyay, B., Godlewski, G., . . . Kunos, G. 21

(2010). Peripheral CB1 cannabinoid receptor blockade improves cardiometabolic risk in 22

mouse models of obesity. J Clin Invest, 120(8), 2953-2966. doi: 10.1172/JCI42551 23

35


https://doi.org/10.1101/2020.07.14.202283


Tartaglia, L. A., Dembski, M., Weng, X., Deng, N., Culpepper, J., Devos, R., . . . Tepper, R. I. 1

(1995). Identification and expression cloning of a leptin receptor, OB-R. Cell, 83(7), 1263-2

1271. 3

Turu, G., & Hunyady, L. (2010). Signal transduction of the CB1 cannabinoid receptor. J Mol 4

Endocrinol, 44(2), 75-85. doi: 10.1677/JME-08-0190 5

Ubeda, M., Wang, X. Z., Zinszner, H., Wu, I., Habener, J. F., & Ron, D. (1996). Stress-induced 6

binding of the transcriptional factor CHOP to a novel DNA control element. Mol Cell Biol, 7

16(4), 1479-1489. 8

Udi, S., Hinden, L., Earley, B., Drori, A., Reuveni, N., Hadar, R., . . . Tam, J. (2017). Proximal 9

Tubular Cannabinoid-1 Receptor Regulates Obesity-Induced CKD. J Am Soc Nephrol, 10

28(12), 3518-3532. doi: 10.1681/ASN.2016101085 11

Uzi, D., Barda, L., Scaiewicz, V., Mills, M., Mueller, T., Gonzalez-Rodriguez, A., . . . Shibolet, 12

O. (2013). CHOP is a critical regulator of acetaminophen-induced hepatotoxicity. J 13

Hepatol, 59(3), 495-503. doi: 10.1016/j.jhep.2013.04.024 14

Vara, D., Salazar, M., Olea-Herrero, N., Guzman, M., Velasco, G., & Diaz-Laviada, I. (2011). 15

Anti-tumoral action of cannabinoids on hepatocellular carcinoma: role of AMPK-16

dependent activation of autophagy. Cell Death Differ, 18(7), 1099-1111. doi: 17

10.1038/cdd.2011.32 18

Velasco, G., Sanchez, C., & Guzman, M. (2016). Anticancer mechanisms of cannabinoids. Curr 19

Oncol, 23(2), S23-32. doi: 10.3747/co.23.3080 20

Wahlang, B., McClain, C., Barve, S., & Gobejishvili, L. (2019). Corrigendum to 'Role of cAMP 21

and phosphodiesterase signaling in liver health and disease' [Cell. Signal. 49 (2018)105-22

115]. Cell Signal, 53, 414. doi: 10.1016/j.cellsig.2018.06.014 23

36


https://doi.org/10.1101/2020.07.14.202283


Walter, P., & Ron, D. (2011). The unfolded protein response: from stress pathway to homeostatic 1

regulation. Science, 334(6059), 1081-1086. doi: 10.1126/science.1209038 2

Wilson, H. L., & Roesler, W. J. (2002). CCAAT/enhancer binding proteins: do they possess 3

intrinsic cAMP-inducible activity? Mol Cell Endocrinol, 188(1-2), 15-20. 4

Yang, G., Ge, H., Boucher, A., Yu, X., & Li, C. (2004). Modulation of direct leptin signaling by 5

soluble leptin receptor. Mol Endocrinol, 18(6), 1354-1362. doi: 10.1210/me.2004-0027 6

Yang, L., Calay, E. S., Fan, J., Arduini, A., Kunz, R. C., Gygi, S. P., . . . Hotamisligil, G. S. (2015). 7

METABOLISM. S-Nitrosylation links obesity-associated inflammation to endoplasmic 8

reticulum dysfunction. Science, 349(6247), 500-506. doi: 10.1126/science.aaa0079 9

Zepf, F. D., Sungurtekin, I., Glass, F., Elstrodt, L., Peetz, D., Hintereder, G., . . . Wockel, L. (2012). 10

Differences in zinc status and the leptin axis in anorexic and recovered adolescents and 11

young adults: a pilot study. Food Nutr Res, 56. doi: 10.3402/fnr.v56i0.10941 12

Zhang, X., Zhang, G., Zhang, H., Karin, M., Bai, H., & Cai, D. (2008). Hypothalamic IKKbeta/NF-13

kappaB and ER stress link overnutrition to energy imbalance and obesity. Cell, 135(1), 61-14

73. doi: 10.1016/j.cell.2008.07.043 15

Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., & Friedman, J. M. (1994). Positional 16

cloning of the mouse obese gene and its human homologue. Nature, 372(6505), 425-432. 17

doi: 10.1038/372425a0 18

Zingg, J. M., Hasan, S. T., Nakagawa, K., Canepa, E., Ricciarelli, R., Villacorta, L., . . . Meydani, 19

M. (2017). Modulation of cAMP levels by high-fat diet and curcumin and regulatory 20

effects on CD36/FAT scavenger receptor/fatty acids transporter gene expression. 21

Biofactors, 43(1), 42-53. doi: 10.1002/biof.1307 22

37


https://doi.org/10.1101/2020.07.14.202283


Zinszner, H., Kuroda, M., Wang, X., Batchvarova, N., Lightfoot, R. T., Remotti, H., . . . Ron, D. 1

(1998). CHOP is implicated in programmed cell death in response to impaired function of 2

the endoplasmic reticulum. Genes Dev, 12(7), 982-995. 3

4

38


https://doi.org/10.1101/2020.07.14.202283


1

39


https://doi.org/10.1101/2020.07.14.202283


Figure 1. Hepatic CB1R regulates sOb-R levels and leptin signaling in DIO. Serum (A, n=10-1

21) and liver (B, n=7-10) levels of sOb-R are reduced following a 14-weeks consumption of HFD 2

in WT, but not LCB1-/- mice. JD5037 (3 mg/kg, for 7 days) reverses the reduction in WT mice. 3

The same trend observed in hepatic mRNA levels of Ob-Re (C, n=10-12) as well as protein level 4

of Ob-Rb, Ob-Ra and Ob-Re (D-E, n=6-10; G-H, n=8-10). Despite a comparable weight gain 5

following HFD consumption in WT and LCB1-/- mice (F, n=12-18), obese mice that lack CB1R in 6

hepatocytes remain leptin sensitive indicated by increased pSTAT3 levels (I-L, n=5). Transgenic 7

mice, expressing CB1R only in hepatocytes, are protected from DIO (M, n=4-5). An exclusive 8

hepatic expression of CB1R is sufficient for HFD feeding to induce reduction in serum, liver 9

mRNA and protein levels of sOb-R (N-Q, n=4-5). Data represent mean ± SEM of indicated 10

number of replicates in each panel. *P<0.05 relative to STD fed animals from the same strain. 11

#P<0.05 relative to HFD fed mice from the same strain. ^P<0.05 relative to the same treatment 12

group of WT mice. 13

14

15

40


https://doi.org/10.1101/2020.07.14.202283


Figure 2. CB1R directly regulates sOb-R levels in hepatocytes. 24h treatment with synthetic 1

CB1R agonist noladin ether (NE, 2.5 μM) induced reduction in sOb-R levels in the culture media 2

of immortalized hepatocytes (blot was quantified using Ponceau staining as a loading control). 3

This was completely ameliorated by 1 hr pre-treatment with 100 nM JD5037 (A-B). Similar results 4

were observed in both mRNA (C) and protein (D-E) levels in hepatocytes lysate (for ObRb, the 5

lower band was quantified). Data represent mean ± SEM of 12-15 replicates from at least 3 6

independent experiments. Blots are representative. *P<0.05 relative to vehicle treated cells. 7

#P<0.05 relative to NE-treated cells. 8

41


https://doi.org/10.1101/2020.07.14.202283


1

Figure 3. CHOP contributes to the metabolic benefits of peripheral CB1R blockade. mRNA 2

(A, n=8-17) and protein (B-D, n=5-6) levels of CHOP show reduced expression following 14 3

weeks on HFD in WT, but not LCB1-/- mice. JD5037 (3 mg/kg, for 7 days) treatment reverses the 4

HFD-induced reduction in CHOP levels. Metabolic assessment of mice revealed diminished effect 5

42


https://doi.org/10.1101/2020.07.14.202283


of JD5037 in CHOP KO mice. Weight (E, n=15-20), fat and lean mass (F & G, n=8-20), serum 1

HDL, LDL as well as hepatic triglycerides (TG) (H-J, n=15-20) were comparable in lean and 2

obese WT and CHOP KO mice. JD5037 treatment was significantly more efficient in reducing 3

weight, fat mass, LDL and TG in WT mice. Data represent mean ± SEM of indicated number of 4

replicates in each panel. *P<0.05 relative to STD fed animals from the same strain. #P<0.05 5

relative to HFD fed mice from the same strain. ^P<0.05 relative to the same treatment group of 6

WT mice. 7

8

9

43


https://doi.org/10.1101/2020.07.14.202283


Figure 4. CHOP plays a key role in regulating sOB-R by the eCB/CB1R System. Serum (A, 1

n=9-15) levels of sOb-R were reduced following a 14-weeks consumption of HFD. JD5037 (3 2

mg/kg, for 7 days) reversed the reduction in WT, but not CHOP KO mice. Basal hepatic levels of 3

sOb-R were lower in CHOP KO and did not change following HFD or JD5037 treatment (B, n=7-4

10). A similar trend was observed in hepatic mRNA levels (C, n=9-16) and protein level of Ob-5

Rb, Ob-Ra and Ob-Re (D & E, n=5-6). Whereas DIO-related hyperleptinemia was comparable 6

between WT and CHOP KO mice, JD5037 was more efficacious in reducing it in WT mice (F, 7

n=9-16). Western blots are representative. Data represent mean ± SEM of indicated number of 8

replicates in each panel. *P<0.05 relative to STD fed animals from the same strain. #P<0.05 9

relative to HFD fed mice from the same strain. ^P<0.05 relative to the same treatment group of 10

WT mice. 11

44


https://doi.org/10.1101/2020.07.14.202283


1

Figure 5. CHOP regulates LEPR expression in hepatocytes. In vitro, 24h treatment with 2

noladin ether (NE; 2.5 μM) induced reduction in mRNA levels of Chop. (ND- Not Detected) (A), 3

Gadd34 (B), and Ob-Re (C) in WT, but not CHOP KO hepatocytes. A similar trend was observed 4

in sOb-R protein levels secreted into the culture media of hepatocytes (blot was quantified using 5

Ponceau staining as a loading control) (D, E). Data represent mean ± SEM of 12-15 replicates 6

from at least 3 independent experiments. Blots are representative. *P<0.05 relative to vehicle 7

treated cells in the same genotype. ^P<0.05 relative to same treatment paradigm in WT. 8

9

45


https://doi.org/10.1101/2020.07.14.202283


1 46


https://doi.org/10.1101/2020.07.14.202283


Figure 6. CHOP is a positive regulator of LEPR Promoter. Induction of CHOP mRNA (A, 1

n=15) and protein (B, n=6) expression using a 6-hrs treatment with tunicamycin (TM; 2.5 µG/mL) 2

was accompanied by elevated sOb-R levels in the culture media (blot was quantified using 3

Ponceau staining as a loading control) (C & D, n=6) as well as mRNA levels (E, n=9-15) of WT 4

hepatocytes. A transient CHOP overexpression induced elevation in sOb-R levels in the culture 5

media of WT hepatocytes (F & G, n=3). Luciferase reporter assay (H, n=16) and Chromatin 6

immunopecipitation (ChIP) (I) show increased LEPR promoter activity and CHOP binding to this 7

promoter in WT hepatocytes treated with TM. Data represent mean ± SEM of indicated number 8

of replicates in each panel from at least 2 independent experiments (and 3 independent ChIP 9

assays). Blots are representative. *P<0.05 relative to vehicle treated cells. ^P<0.05 relative to the 10

same treatment group of WT hepatocytes. 11

12

47


https://doi.org/10.1101/2020.07.14.202283


1

Figure 7. An illustration that describes the suggested molecular mechanism involving CB1R 2

and CHOP in the regulation of sOb-R levels. (Left) When activated by eCBs upregulated during 3

diet-induced obesity (DIO) or synthetic cannabinoids, such as noladin ether (NE, green squares), 4

CB1R attenuates cAMP (pink circles) production by inhibiting adenylate cyclase (AC), as well as 5

upregulates Trib3 expression. As a consequence, CHOP levels are reduced, transcribing less 6

LEPR. (Right) Blocking CB1R in hepatocytes reverses these changes, leading to the activation 7

and translocation of CHOP to the nucleus, which, in turn, directly binds the LEPR promoter and 8

promotes the expression of sOb-R. Red arrows represent downregulation, whereas green arrows 9

represent upregulation. Coloured triangles represent activation. 10

11

12

48


https://doi.org/10.1101/2020.07.14.202283


CB1R Regulates Soluble Leptin Receptor Levels via CHOP, Contributing to Hepatic 1

Leptin Resistance 2

3

Adi Drori, Asaad Gammal, Shahar Azar, Liad Hinden, Rivka Hadar, Daniel Wesley, Alina 4

Nemirovski, Gergő Szanda, Maayan Salton, Boaz Tirosh, and Joseph Tam 5

6

Inventory of Supplemental Material: 7

The following Supplemental Figures and Tables provide additional information supporting the 8

role of hepatic CB1R in regulating sOb-R levels via CHOP: 9

Supplementary Figure 1. HFD induces eIF2α phosphorylation in WT mice. 10

Supplementary Figure 2. An altered endocannabinoid 'tone' in CHOP deficient mice. 11

Supplementary Figure 3. Trib3 as a possible link between CB1R and CHOP. 12

Supplementary Figure 4. Hepatic expression of ADAM10 and ADAM17. 13

Supplementary Figure 5. LEPR antibody detects isoforms of 75, 100 and 150 kDa. 14

Supplementary Table 1. mRNA Primers 15

Supplementary Table 2. ChIP primers 16

17

18

1


https://doi.org/10.1101/2020.07.14.202283


1

2

3

4

5

Supplementary Figure 1. HFD induces eIF2α phosphorylation in WT mice. Western blot 6 analysis (A, C) and quantification (B, D) shows increased hepatic ratio between phosphorylated 7 and total eIF2α in WT, but not LCB1-/- mice. Data represent mean ± SEM of 5-6 samples in each 8 group. *P<0.05 relative to STD fed animals from the same strain. Blots are representative. 9

10

11

12

13

14

15

16

2


https://doi.org/10.1101/2020.07.14.202283


1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

Supplementary Figure 2. An altered endocannabinoid 'tone' in CHOP deficient mice. 19 Measurements of hepatic AEA (A, n=6-12) and 2-AG (B, n=6-12) levels in mice demonstrate an 20 expected elevation of eCB levels in obese mice, and decreased levels following JD5037 treatment 21 (3 mg/kg, for 7 days) in WT, but not CHOP KO mice. This observation is partly explained by the 22 changes measured in the mRNA expression levels of their synthesis and degradating enzymes (C-23 F, n=6-15). Data represents mean ± SEM of indicated number of replicates in each panel. *P<0.05 24 relative to STD fed animals from the same strain. #P<0.05 relative to HFD fed mice from the same 25 strain. ^P<0.05 relative to the same treatment group of WT mice. 26

27

28

29

30

31

3


https://doi.org/10.1101/2020.07.14.202283


1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

Supplementary Figure 3. Trib3 as a possible link between CB1R and CHOP. Western blot 19 analysis and quantification (A-C, n=5) and mRNA of hepatic Trib3 expression levels (D, n=5) in 20 WT and CHOP KO mice show increased expression in obese WT, but not LCB1-/- mice. A direct 21 activation of CB1R by using noladin ether (NE) upregulated the mRNA expression of Trib3 in 22 WT, but not in CHOP KO hepatocytes. In vivo: Data represent mean ± SEM of indicated number 23 of replicates in each panel. Western blots are representative. *P<0.05 relative to STD fed animals 24 from the same strain. #P<0.05 relative to HFD fed mice from the same strain. ^P<0.05 relative to 25 the same treatment group of WT mice. In vitro: Data represent mean ± SEM of 12-15 replicates 26 from at least 3 independent experiments. *P<0.05 relative to vehicle treated cells in the same 27 genotype. ^P<0.05 relative to same treatment paradigm in WT. 28

29

4


https://doi.org/10.1101/2020.07.14.202283


1

2

3

4

5

6

7

8

9

10

11

Supplementary Figure 4. Hepatic expression of ADAM10 and ADAM17. Hepatic mRNA 12 expression levels of ADAM10 (A) and ADAM17 (B) in WT mice fed with STD or HFD for 14 13 weeks and treated with JD5037 (3 mg/kg, for 7 days) as well as in LCB1-/- mice fed either STD or 14 HFD for the same period. Data represent mean ± SEM of 5-6 animals per group. 15 16

5


https://doi.org/10.1101/2020.07.14.202283


Supplementary Figure 4. LEPR antibody detects isoforms of 75, 100 and 150 kDa. Western 1 blot analysis and quantification (A-B, n=3) of LEPR expression levels in HK-2 cell line, infected 2 with either empty vector or mouse LEPR expressing AAV. Vector also expressed eGFP and 3 infection efficiency was approximately 30 percent, as assessed by fluorescent microscopy (not 4 shown). Data represent mean ± SEM of indicated number of replicates in each panel. *P<0.05 5 relative to control cells. 6

7

8

6


https://doi.org/10.1101/2020.07.14.202283


Supplementary Table 1. mRNA Primers 1

2

3

4

Gene (mus musculus)

Forward Reverse

ObRe TAATGAAGATGATGGAATGAAG ATTGCCAGTCTACAGTGTCA Ddit3 (CHOP) CTGGAAGCCTGGTATGAGGAT CAGGGTCAAGAGTAGTGAAGGT Gadd34 TGAGTACAATGCAAAGCCAGGA CCCTCTTCTCTAGCCACCACCT Ubc GCCCAGTGTTACCACCAAGA CCCATCACACCCAAGAACA Adam10 TGGAGTAGAGGAAGGAGCCC CTTTCAGCCAGAGTTGTGCG Adam17 GTGCTGGGAAGATCACCTCC CACCACCTCTCTGGGAAACC

7


https://doi.org/10.1101/2020.07.14.202283


Supplementary Table 2. ChIP primers 1

2

3

4

5

6

Gene (mus musculus)

Forward Reverse

Gapdh ACCAGGGAGGGCTGCAGTCC TCAGTTCGGAGCCCACACGC Gadd34 GTTGGCGCAGATTGAGTCAG GGTTCATGTCGCCCTCAG Ob-R promoter ATCTAAGGCACTGGGTGTC TCTGGGTCCGGAGCGCTG

8


https://doi.org/10.1101/2020.07.14.202283


Documents

2 Leptin Resistance - biorxiv.org · 7/14/2020 · maintain normal circulating levels of -/- sOb-R in both lean and obese LCB1 mice (Figure 1A). 10. Similarly, the hepatic gene and