1

Cholesterol and cholate components of an atherogenic diet induce distinct

stages of hepatic inflammatory gene expression

Laurent Vergnes 1,2, Jack Phan 1,2, Merav Strauss, Sherrie Tafuri 3, and Karen

Reue 1,2

1Departments of Medicine and Human Genetics, University of California, Los Angeles,

CA; 2Veterans Administration Greater Los Angeles Healthcare System, Los Angeles,

CA 90073; 3Pfizer Global Research and Development, Ann Arbor Laboratories, Ann

Arbor, Michigan 48105.

Correspondence to Karen Reue, 11301 Wilshire Blvd., Building 113 Room 312, Los

Angeles, CA 90073. Email Reuek@ucla.edu Phone (310) 478-3711 x42171 Fax (310)

268-4981.

JBC Papers in Press. Published on August 15, 2003 as Manuscript M306022200 by guest on M

arch 13, 2020http://w

ww

.jbc.org/D

ownloaded from

2

SUMMARY

Atherosclerosis in inbred mouse strains has been widely studied using an

atherogenic (Ath) diet containing cholesterol, cholic acid, and fat, but the effect of these

components on gene expression has not been systematically examined. We employed

DNA microarrays to interrogate gene expression levels in liver of C57BL/6J mice fed

five diets: mouse chow, the Ath diet, or modified versions of the Ath diet in which either

cholesterol, cholate, or fat were omitted. Dietary cholesterol and cholate produced

discrete gene expression patterns. Cholesterol was required for induction of genes

involved in acute inflammation, including three genes of the serum amyloid A family,

three major histocompatibility class II antigen genes, and various cytokine-related

genes. In contrast, cholate induced expression of genes involved in extracellular matrix

deposition in hepatic fibrosis, including five collagen family members, collagen

interacting proteins, and connective tissue growth factor. The gene expression findings

were confirmed by biochemical measurements showing that cholesterol was required

for elevation of circulating serum amyloid A, and cholate was required for accumulation

of collagen in the liver. The possibility that these gene expression changes are relevant

to atherogenesis in C57BL/6J mice was supported by the observation that the closely

related, yet atherosclerosis resistant, C57BL/6ByJ strain was largely resistant to dietary

induction of the inflammatory and fibrotic response genes. These results establish that

cholesterol and cholate components of the Ath diet have distinct proatherogenic effects

on gene expression, and suggest a strategy to study the contribution of acute

inflammatory response and fibrogenesis independently through dietary manipulation.

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

3

INTRODUCTION

The mouse has become established as a key animal model for studies of lipid

metabolism and atherosclerosis, due to the development of techniques for genetic

manipulation and tools for gene discovery in this species (reviewed in (1-4)). The first

studies to demonstrate that the mouse might provide a useful model for characterization

of genetic factors affecting atherosclerosis susceptibility appeared more than 30 years

ago. These studies surveyed several inbred laboratory mouse strains and

demonstrated that some strains develop early atheromatous lesions when fed

experimental diets. These diets contained high concentrations of cholesterol (5%) and

fat (30%) supplemented either with cholic acid (2%) (5), or fed in combination with

irradiation treatments (6). These early diets produced high mortality, and were

subsequently modified to reduce the concentrations of cholesterol (1.25%), fat (15%),

and cholate (0.5%). Using this modified atherogenic (Ath) diet, Paigen and others

demonstrated that fatty streak lesion formation is reproducible within a strain, and that

strains differ in their susceptibility (7,8). The C57BL/6J strain was among the most

susceptible, and has been extensively used as a model for diet-induced atherosclerosis.

Although the Ath diet has been widely used to study atherogenesis in C57BL/6J

and other mouse strains, the effects of the individual dietary components have not been

well characterized. In susceptible mouse strains, the Ath diet produces an atherogenic

lipoprotein profile and induces inflammatory gene expression in the liver. For example,

C57BL/6J mice fed the Ath diet exhibit dramatically elevated low density/very low

density lipoprotein (LDL/VLDL) and reduced high density lipoprotein (HDL) cholesterol

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

4

levels (8,9). In this strain, the Ath diet also induces inflammatory and oxidative stress

genes such as serum amyloid A, monocyte chemotactic protein-1, colony-stimulating

factors, and heme oxygenase (10). It is unclear at present which component(s) of the

atherogenic diet produce the observed effects on lipoproteins and inflammation.

Furthermore, previous work indicates that reduction in the concentration of either

cholesterol or cholate in the Ath diet decreases the rate of aortic lesion formation, and

that the two components differentially affect gallstone formation and lipid accumulation

in liver (11,12). This suggests that cholesterol and cholate may have independent pro-

atherogenic effects.

To test this hypothesis, we undertook a systematic analysis of plasma lipid and

gene expression changes that occur in response to the cholesterol, cholate, and fat

components of the Ath diet. C57BL/6J mice were fed one of five diets: mouse chow,

the Ath diet, or modified versions of the Ath diet in which either cholesterol, cholate, or

fat were omitted. We examined plasma lipid profiles and used DNA microarrays to

screen the response of more than 11,000 mouse genes and expressed sequence tags

(ESTs). A comparison of gene expression levels across all five diets allowed the

identification of genes that were activated or repressed specifically by dietary

cholesterol, cholate, or fat. We identified more than 300 genes that were activated or

repressed by one of the three diet components, with more than a quarter of those

(89/316) exhibiting at least a 10-fold response to either cholesterol, cholate, or fat.

Cholesterol and cholate were found to induce expression of genes involved in different

aspects of the inflammatory response, with cholesterol being required for the acute

inflammatory response while cholate was responsible for activating genes associated

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

5

with hepatic fibrosis. Biochemical measurements of representative proteins from the

acute inflammatory and fibrotic responses confirmed the gene expression data. We

further investigated the potential role of these gene expression changes in

atherogenesis by examining their expression in an atherosclerosis-resistant substrain of

C57BL/6 mice. The activation of both the inflammatory and fibrotic genes was

dramatically attenuated in the resistant mice, suggesting that their response to the Ath

diet at the level of gene transcription may be one mechanism contributing to their

resistance to diet-induced atherosclerosis. Overall, our results establish that that

cholesterol and cholate components of the Ath diet have distinct proatherogenic effects

on gene expression, which correlate with genetic differences in atherosclerosis

susceptibility in two closely related C57BL/6 mouse strains.

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

6

EXPERIMENTAL PROCEDURES

Mice and diets—Male C57BL/6J and C57BL/6ByJ mice were obtained from The

Jackson Laboratory (Bar Harbor, ME). Mice were fed ad libitum Purina Mouse Chow

5001, or one of four experimental diets (Teklad Research Diets, Madison, WI)

containing various combinations of cholesterol, sodium cholate, and fat (in the form of

cocoa butter). The Ath diet (Teklad TD90221) contained (by weight) 75% Purina Mouse

Chow, 7.5% cocoa butter, 1.25% cholesterol and 0.5% sodium cholate. The other three

diets were equivalent to the Ath diet, with the omission of cholesterol (TD 98232),

cholate (TD 94059), or fat (TD 98233). At 3 months of age, mice were housed

individually and fed the specified diet for 3 weeks before harvesting tissue and blood.

The care of the mice and all procedures used in this study were conducted in

accordance with the NIH animal care guidelines.

Lipid determinations—Blood was obtained after a 16-h fast. Enzymatic assays for

total cholesterol, HDL cholesterol, unesterified cholesterol, triglyceride, and free fatty

acids were performed using enzymatic assays (13). LDL/VLDL cholesterol levels were

determined as the difference between total and HDL cholesterol levels. For hepatic

cholesterol and triglyceride determinations, lipids were extracted from 100 mg tissue as

described (14).

Oligonucleotide microarray hybridization—Liver samples comprising the identical

lobe were harvested from each mouse and flash frozen in liquid nitrogen. Total RNA

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

7

was prepared from mouse liver using Trizol reagent (Life Technologies, Gaithersburg,

MD). Each microarray hybridization was performed using 10 µg of total liver RNA

pooled from four mice. Oligonucleotide microarrays (MU11K) were from Affymetix

(Santa Clara, CA) and contained representations of more than 11,000 full-length mouse

genes and EST clusters. cRNA synthesis, hybridization, washing, and scanning were

performed according to standard Affymetrix protocols. Fluorometric data were

generated by Affymetrix Software and the gene chips were globally scaled to all the

probe sets with an identical target intensity value. Transformation of the fluorescent

signals into numerical values and filtering of the data was accomplished as described

(15). Only genes with an absolute expression level (expressed as average difference,

or Avg Diff, value from Affymetrix software output) above a threshold of 30 were

analyzed. Identification of genes that are activated or repressed by specific diet

components was accomplished using Microsoft EXCEL. The full set of microarrray data

is available in Supplementary Table 1.

mRNA quantitation—Confirmation of mRNA expression differences observed on

microarrays was performed by Northern blot and RT-PCR. Total liver RNA was isolated

using Trizol reagent (Invitrogen). Poly(A)+ RNA was prepared from total RNA using the

Poly(A)Tract mRNA isolation system (Promega, Madison, WI), and 2 µg loaded per lane

for Northern analysis. Hybridizations were performed as described (16) with cDNA

probes generated by RT-PCR. RT-PCR was performed using 2 µg total liver RNA

(cDNA Cycle Kit, Invitrogen). Primer sequences for examples shown in Fig. 2 were as

follows: Saa3-f, agagacatgtggcgagcctac , Saa3-r, cagcacattgggatgtttagg, W34845-f,

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

8

gccaggccttcacctttcag, W34845-r, acagttcagtcacccttacaag, Col3a1-f,

cccatgactgtcccacgtaag, Col3a1-r, cagggccaatgtccacaccaa, Mup1-f,

ggcatactattatcctggcctc, Mup1-r, gatggtggagtcctggtgaga, Igfbp-f, ttctcatctctctcgtacatg,

Igfbp-r, acgcagctttccacgttcag, Gck-f, gtggccacaatgatctcctgc, Gck-r,

tcggcgacagagggtcgaaggc.

Expression levels for activated hepatic stellate cell transcripts were examined by

RT-PCR using previously published primer sets for platelet-derived growth factor

receptor β (Pdgfrb) transforming growth factor β1 (Tgfb1), collagen 1α1 (Col1a1), tissue

inhibitor of metalloproteinases-1 (Timp1), and α-smooth muscle actin (17), and TATA

box binding protein (Tbp) (18). Total RNA was treated with DNase (Ambion, Austin, TX)

to remove contaminating genomic DNA, and cDNA was prepared from 2 µg total liver

RNA. 5% of the resulting cDNA sample was amplified for 32 cycles using a Touchdown

protocol with a beginning annealing temperature of 63°C and a final annealing

temperature of 53°C (18). PCR products were analyzed by electrophoresis in agarose,

and quantitation of digital images was performed using 1D Image Analysis software

(Eastman Kodak Company, Rochester, NY).

Serum amyloid A and collagen quantitation—Serum amyloid A levels in mouse

plasma were determined by ELISA (BioSource International, Camarillo, CA). Collagen

concentration in liver was determined using the Sircol collagen assay (Accurate

Chemical & Science Corporation,Westbury, NY). Briefly, 50 mg of liver was

homogenized and total acid pepsin-soluble collagens were extracted overnight using 5

mg/ml pepsin in 500 µl 0.5 M acetic acid. One ml Sircol dye reagent was added to 100

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

9

µl of each sample, in duplicate and incubated at 25°C for 30 min. After centrifugation,

the pellet was suspended in 1 ml alkalai reagent and absorbance read at 540 nm.

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

10

RESULTS

Effects of Ath diet components on circulating lipid levels

To investigate the effect of specific components of the Ath diet on circulating lipid

levels, C57BL/6J mice were fed a chow diet, the Ath diet, or one of three modified Ath

diets in which either cholesterol, cholate, or fat was omitted (Table 1). Compared to

chow, the Ath diet produced more than a two-fold increase in plasma cholesterol levels,

due to an increase of more than 100 mg/dL in LDL/VLDL cholesterol (Fig. 1), as

observed previously (9). In contrast to previous reports, HDL cholesterol levels were

not significantly reduced on the Ath diet. This may be a result of using male, as

opposed to female mice, and/or the shorter (3 week) duration of the diet compared to

some previous studies. The amount of unesterified cholesterol more than doubled on

the Ath diet, whereas triglyceride levels were reduced ~50%, and free fatty acid levels

were unchanged.

The diets lacking cholesterol, cholate and fat components each produced distinct

plasma lipid profiles (see Fig. 1). The omission of fat from the Ath diet did not alter

plasma cholesterol, triglyceride, or fatty acid levels compared to the complete Ath diet,

indicating that the fat added to this diet has little effect on the circulating lipid levels. In

contrast, omission of cholesterol prevented any significant increase in total cholesterol

or unesterified cholesterol above the levels on a chow diet. The cholate-free diet

produced elevated cholesterol levels that were intermediate between values on the

chow and Ath diets, and were significantly higher than the chow values. Although total

cholesterol levels were not statistically different between Ath and No Cholate diets, the

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

11

distribution of cholesterol among LDL/VLDL and HDL fractions was dramatically

affected by dietary cholate. LDL/VLDL cholesterol increased 10-fold on the Ath diet, but

only 2-fold on the cholate-free diet, whereas HDL cholesterol was at it highest on the

cholate-free diet. The omission of cholesterol from the Ath diet also blunted the

increase in LDL/VLDL cholesterol levels seen with the complete diet, indicating that

cholesterol and cholate act synergistically to elicit the large increase in LDL/VLDL

cholesterol that occurs on the Ath diet. A similar diet effect was observed with hepatic

cholesterol levels. Thus, while hepatic cholesterol levels increased 6-fold on the Ath

diet, this required the inclusion of both cholesterol and cholate.

Triglyceride levels were suppressed about 2-fold on the Ath diet (Fig. 1).

Omission of either cholate or cholesterol from the Ath diet produced a significant

elevation in triglyceride levels above those seen on either chow or Ath diets, suggesting

that the two components act together to effect the reduced triglyceride levels observed

with the Ath diet. Hepatic triglyceride levels were also repressed on the Ath diet, but

omission of cholate prevented this repression. Free fatty acid levels were not

significantly affected by the Ath diet components. Thus, cholesterol and cholate

components appear to have both independent effects and synergistic effects on plasma

and hepatic lipid levels.

Cholesterol and cholate induce distinct sets of inflammatory genes

To investigate gene expression changes underlying the diet-induced alterations

in lipid levels, we performed microarray hybridization studies. Liver RNA from mice fed

each of the five diets was hybridized to Affymetrix MU11K oligonucleotide microarrays

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

12

to assess the relative expression levels of thousands of mouse genes and ESTs. Data

were filtered to exclude signals below a defined threshold of absolute expression level

and to insure specificity of hybridization for perfect match vs. mismatch oligonucleotides

(see Methods) (15). Using these criteria, 7200 of the 13,104 DNA elements on the

array were scored as present in at least one diet sample. Comparison of gene

expression profiles for the two most extreme diets, chow and Ath, revealed that the

combination of cholesterol, cholate, and fat produces widespread changes in hepatic

gene expression levels. 839 genes were activated and 454 genes repressed by at least

3-fold on the Ath diet compared to basal levels on the chow diet.

A systematic comparison of expression levels among all five diets allowed the

identification of genes that are regulated by specific dietary components. Approximately

1.4% of genes represented on the array exhibited altered expression specifically in

response to cholesterol, cholate, or fat. By comparing the expression levels of genes

across all five diets, we defined six gene expression patterns with respect to regulation

by specific diet components: cholesterol activated, cholesterol repressed, cholate

activated, cholate repressed, fat activated, and fat repressed. For example,

“cholesterol activated genes” were those having at least 2-fold higher levels on all three

diets containing cholesterol (Ath, No Cholate, and No Fat diets) than on the two diets

lacking cholesterol (Chow and No Cholesterol diets). Representative expression

profiles for each of the six groups are shown in Fig. 2. A full list of genes activated or

repressed by cholesterol, cholate, or fat is given in Table 2, and a summary of each

group is given below.

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

13

Cholesterol regulated genes—Expression of 38 of the genes assayed was

altered by presence of dietary cholesterol, including 25 genes that were activated and

13 repressed by cholesterol (Table 2). The magnitude of activation by cholesterol was

striking, with 30% of the cholesterol-activated genes showing more than 10-fold

induction in response to cholesterol. An example of a cholesterol activated gene, serum

amyloid A3 (Saa3), showed equivalent high levels of expression on the complete Ath

diet and the No Fat diet, and lowest levels on the No Cholesterol diet (Fig. 2a). The

nearly identical expression levels on the Ath and No Fat diets indicates that fat had little

effect on expression of this group of genes, and also illustrates the consistency of gene

expression measurements across individual microarray hybridizations. Most of these

genes had expression levels on the No Cholate diet that were intermediate between

those on Ath and the No Cholesterol diets. This suggests that while cholesterol has the

strongest effect on expression of these genes, cholate plays an additive role with

cholesterol to achieve the peak expression levels.

Notable among the cholesterol-activated genes were 12 genes known to be

involved in acute inflammation and the immune response: genes of the serum amyloid

A (SAA) family (Saa2, Saa3, and Saa4), histocompatibility antigens (H2-1A-alpha, H2-

1A-beta, H2-E-beta, Ia-associated invariant chain), and additional inflammation

/immune associated genes including interleukin-2 receptor gamma (Il2rg), small

inducible cytokine B9 (Scyb9), SAM domain and HD domain 1 (Samhd1), paired-Ig-like

receptor A5 (Pira5), and galectin-3 (Lgals3) (Table 2). SAA gene expression was

induced from 7-8-fold (Saa2 and Saa4) to 37-fold (Saa3) on the Ath diet. While

omission of cholate from the diet diminished the response, cholesterol was absolutely

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

14

critical for activation of SAA gene expression (Fig. 2a). Similar cholesterol requirements

were observed for the other inflammation-related genes shown in Fig. 2a, although

magnitude of expression was lower.

Genes that were repressed by dietary cholesterol included aquaporin-8, which

has been implicated in canalicular bile secretion in liver (19), Cyp17a1, a key enzyme in

C-21 steroid biosynthesis, and apolipoprotein A-IV, a component of high density

lipoproteins which has previously been shown to be repressed by the Ath diet (20). An

additional 7 novel ESTs of unknown function were also repressed by cholesterol (see

for example Fig. 2b).

Cholate regulated genes— Of the three Ath diet components examined here,

cholate affected expression levels of the greatest number of genes, with 81 genes

induced and 23 repressed by cholate (Table 2; see examples in Fig. 2c and d). Most

striking was the induction of numerous genes encoding collagen and non-collagen

extracellular matrix components. The expression and excretion of extracellular matrix

proteins is indicative of fibrogenesis, a wound healing process that occurs in response

to inflammation induced by infectious or metabolic agents (21). Five collagen genes

were activated up to 70-fold by the Ath diet: Col1a1 and Col1a2 (which encode

procollagen, type I, subunits alpha 1 and alpha 2), Col3a1 (procollagen, type III, alpha

1), Col4a1 (procollagen, type IV, alpha 1), Col6a1 (procollagen, type VI, alpha 1), and

nidogen (a glycoprotein that binds type IV collagen). Omission of cholesterol from the

diet had little effect on collagen gene expression, but omission of cholate prevented

induction (Fig. 2c). Additional cholate-activated genes involved in extracellular matrix

synthesis included nidogen and lumican, two proteins that have direct interactions with

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

15

extracellular collagens, as well as vimentin, a cytoskeletal intermediate filament protein,

and Ctgf (connective tissue growth factor), which modulates extracellular matrix

secretion. Thus, dietary cholate appears to have a specific effect on activation of genes

involved in the response to chronic inflammation.

Several additional genes induced by cholate have recognized roles in lipid

metabolism. For example, cholate induced phospholipid transfer protein (Pltp), which is

involved in lipoprotein remodeling and has recently been shown to be regulated by bile

acids through the farnesoid X-activated nuclear hormone receptor (FXR) (22), Also

induced by cholate was LXRβ, an oxysterol binding nuclear hormone receptor that

activates several genes involved in cellular cholesterol efflux. Dietary cholate also

induced choline kinase and lipocalin 2, genes involved in phospholipid synthesis and

intracellular lipid transport, respectively. The list of genes repressed by cholate was less

extensive than those activated by this component (Table 2). These included chemokine

orphan receptor 1, a choline/ethanolamine kinase (Chk1), a gene implicated in very long

chain fatty acid elongation (Elovl3), and cytochrome P450, 7b1 (Cyp7b), a key enzyme

in the alternate pathway of bile acid synthesis.

Fat regulated genes—Of the Ath diet components, fat affected expression of the

fewest genes, with 6 fat-activated and 9 fat-repressed genes identified by our criteria of

at least 2-fold effects in response to fat fat across all five diets (Table 2). The

magnitude of expression of most of these genes was quite modest. A notable exception

was insulin growth factor-like binding protein-1 (Igfbp1), which was expressed at high

levels on the chow and no fat diets, but repressed on all diets containing fat (Fig. 2f).

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

16

Confirmation of independent cholesterol and cholate effects on SAA and

fibrogenic gene expression

The data above demonstrated that cholesterol was required for the large

induction of SAA gene expression, whereas cholate was required for induction of

collagen gene expression. To confirm that these gene expression changes resulted in

corresponding increases in protein levels, we quantitated SAA protein levels in blood

and collagen levels in liver under the various diet conditions. In agreement with the

mRNA expression results, SAA protein levels in the circulation increased about 30-fold

on Ath compared to a chow diet. The same high SAA levels were present when cholate

was omitted from the Ath diet, but omission of cholesterol prevented any increase

above chow values (Fig. 3a). Analogously, hepatic collagen levels were elevated

specifically in diets containing cholate, regardless of the other components (Fig. 3b).

These results establish that the cholesterol and cholate-specific changes in SAA and

collagen gene expression give rise to altered protein levels as well.

Additional confirmation that the fibrotic process is activated by dietary cholate

was obtained by examining additional markers of fibrotic gene expression. The major

source of collagen and other extracellular matrix proteins in liver fibrosis is hepatic

stellate cells, a population of perisinusoidal cells comprising 15% of the resident liver

cells (23, 24). Hepatic stellate cells typically exist in a quiescent state, serving as the

principal storage site for retinoids. In response to stimuli such as bacterial infection or

inflammation, the stellate cells become activated and transform into proliferative,

fibrogenic cells. To further characterize the fibrogenic response to dietary cholate,

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

17

we examined established markers of activated stellate cells via RT-PCR (17). The Ath

diet increased expression of several hepatic stellate cell markers including platelet-

derived growth factor β-receptor (Pdgfrb), tissue inhibitor of metalloproteinases-1

(Timp1), transforming growth factor β1 (Tgfb1) (see Fig. 4), and α-smooth muscle actin

(not shown). The induction of hepatic stellate cell genes was attenuated when cholate

was omitted from the diet, consistent with the observed induction of collagen and other

fibrotic genes specifically by cholate.

Attenuated response to cholesterol and cholate in an atherosclerosis resistant

C57BL/6 substrain

As described above, the Ath diet induces expression of several inflammatory

genes in C57BL/6J mice, primarily through the cholesterol and cholate components.

This raises the possibility that induction of these genes contributes to the pro-

atherogenic effect of this diet. To address this issue, we investigated whether the same

gene expression patterns occur in an atherosclerosis-resistant, but otherwise

genetically similar, mouse strain, C57BL/6ByJ. C57BL/6ByJ mice were derived from

the same original progenitor as C57BL/6J, but have been bred independently for many

years (25). Although very few DNA polymorphisms have been detected between the

two C57BL/6 substrains, the C57BL/6ByJ strain is resistant to hypercholesterolemia and

aortic lesion formation in response to the Ath diet (26). To determine whether this strain

also differs in gene expression response to cholesterol and cholate, C57BL/6ByJ mice

were fed the five diets described earlier, and expression levels of inflammatory genes

induced by cholesterol and cholate were compared with those seen for C57BL/6J.

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

18

C57BL/6ByJ mice were found to differ dramatically from C57BL/6J mice in gene

expression response to cholesterol. The inflammatory genes activated by cholesterol in

C57BL/6J mice were expressed at similar levels on the chow diet, but were not induced

significantly in C57BL/6ByJ by the Ath diet or other diets (Fig. 5a and b). Whereas the

SAA genes were induced 7- to 37-fold in C57BL/6J, Saa2 and Saa4 were induced only

2- to 3-fold and Saa3 was not induced at all in C57BL/6ByJ. Many other cholesterol

responsive inflammatory genes showed either no induction at all (Scyb9, Samhd1,

Pira5, Lgals, Ly6), or increased expression slightly on cholesterol-containing diets (H2-

Aa, H2-Ab1, H2-Ebi, Ii, Il2rg) (Fig. 5b). The induction of fibrosis-related gene

expression in C57BL/6ByJ was also attenuated compared to C57BL/6J, but less

dramatically than the cholesterol-responsive genes (Fig. 5c and d). Whereas nidogen,

lumican, vimentin, and Ctgf were similarly activated by cholate in both strains, most

collagen genes were either not activated at all (Col6a1, Col1a2), or activated at 25-50%

the levels seen in C57BL/6J (Col1a1, Col3a1). Thus, the two C57BL/6 substrains differ

substantially in their gene expression response to dietary cholesterol, and C57BL/6ByJ

mice also fail to induce collagen family members to the levels seen in C57BL/6J mice in

response to cholate.

The gene expression differences between C57BL/6J and C57Bl/6ByJ in SAA and

collagen were confirmed by biochemical measurements. Circulating SAA levels in

C57BL/6J mice fed the Ath diet were 5- to 8-fold higher than in C57BL/6ByJ mice (Fig.

6a). Hepatic collagen levels also remained significantly lower in the C57BL/6ByJ mice

in response to the Ath diet (Fig. 6b), consistent with the gene expression data. Thus,

the closely related C57BL/6 substrains exhibit clearly different responses to the

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

19

cholesterol and cholate components of the Ath diet, at both the transcriptional and

protein levels. These findings are consistent with the possibility that attenuated

inflammatory and fibrotic gene expression contributes to the atherosclerosis resistance

in C57BL/6ByJ compared to C57BL/6J mice.

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

20

DISCUSSION

The atherogenic diet containing cholesterol, cholate, and fat has been used for

more than 25 years by several investigators to study the pathology and genetics of

atherosclerosis in inbred mouse strains. And while it has been shown that both

cholesterol and cholate are required to produce aortic lesions in susceptible mouse

strains in a practical period of time (12), it is not clear what effect each component

produces. To begin to address this issue, we have used microarrays to quantitate gene

expression levels in response to Ath diet components. By comparing expression

patterns on the Ath diet with those on diets in which one component was omitted, we

identified groups of genes that are activated or repressed specifically by cholesterol,

cholate, or fat. Although some genes were regulated by more than one component,

many genes were strongly induced or repressed primarily by a single dietary

component. Two key groups of genes that are likely to play a role in atherogenesis

were found to be induced by the Ath diet: (1) more than 20 genes involved in acute

inflammation/immune response, and (2) extracellular matrix proteins, characteristic of

hepatic fibrosis in response to chronic injury.

Inflammatory gene activation was dependent on the presence of cholesterol in

the diet, whereas the collagen gene family members were induced specifically by

cholate. These results extend previous observations showing that the Ath diet induces

SAA genes in C57BL/6J liver (27) by demonstrating that activation of SAA and other

acute inflammatory genes occurs largely in response to cholesterol. Furthermore, the

fact that SAA levels were elevated on the cholate-free diet demonstrates that the

dramatic elevation in LDL/VLDL seen on the Ath diet is not required to activate SAA

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

21

gene expression, nor do elevated HDL levels protect against it (see Fig. 1). Likewise,

fibrotic gene expression was induced even when cholesterol was omitted from the Ath

diet, indicating that fibrosis is not dependent on elevated plasma or hepatic cholesterol

levels (Fig. 1). These results indicate that the cholesterol and cholate components of the

Ath diet have distinct proatherogenic effects, and suggest a strategy to study the

contribution of the acute inflammatory response and fibrogenesis independently through

dietary manipulation.

To evaluate the potential relationship between the Ath diet-induced expression of

inflammatory and fibrogenic genes and susceptibility to atherosclerosis, we compared

gene expression in two substrains of C57BL/6 mice, one susceptible and the other

resistant to atherosclerosis. We previously determined that C57BL/6ByJ mice fed the

Ath diet maintain lower plasma LDL/VLDL cholesterol levels than C57BL/6J (26). Here

we show that an important consequence of this may be attenuated expression in

C57BL/6ByJ of cholesterol-responsive inflammatory genes in the liver, resulting in

reduced levels of SAA in the circulation. We also observed reduced collagen gene

activation in C57BL/6ByJ. This is intriguing in light of our finding that C57BL/6ByJ mice

exhibit increased bile acid excretion compared to C57BL/6J mice (28). Thus, reduced

bile acid accumulation in B6By mice may protect these animals from fibrosis via

reduced bile acid-induced stellate cell activation and/or apoptosis (29, 30). Inhibition of

stellate cell activation has been suggested as a strategy for treatment of conditions

characterized by hepatic inflammation and fibrosis, including chronic viral hepatitis,

alcoholic liver disease, and other causes of liver cirrhosis (23,31-35). Since

C57BL/6ByJ mice are resistant to atherosclerosis and exhibit reduced hepatic fibrosis,

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

22

they may provide a valuable model to establish whether inhibition of stellate cell

activation is a useful strategy for treatment of chronic viral hepatitis, alcoholic liver

disease, and other causes of liver cirrhosis.

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

23

REFERENCES

1. Knowles, J. W., and Maeda, N. (2000) Arterioscler. Thromb. Vasc. Biol. 20,

2336-2345 2. Fazio, S., and Linton, M. F. (2001) Front. Biosci. 6, D515-525 3. Reardon, C. A., and Getz, G. S. (2001) Curr. Opin. Lipidol. 12, 167-173 4. Sheth, S. S., Deluna, A., Allayee, H., and Lusis, A. J. (2002) Curr. Opin. Lipidol.

13, 181-189 5. Thompson, J. S. (1969) J. Atheroscler. Res. 10, 113-122 6. Vesselinovitch, D., and Wissler, R. W. (1968) J. Atheroscler. Res. 8, 497-523 7. Paigen, B., Morrow, A., Brandon, C., Mitchell, D., and Holmes, P. (1985)

Atherosclerosis 57, 65-73 8. Paigen, B., Mitchell, D., Reue, K., Morrow, A., Lusis, A. J., and LeBoeuf, R. C.

(1987) Proc. Natl. Acad. Sci. USA 84, 3763-3767 9. LeBoeuf, R. C., Doolittle, M. H., Montcalm, A., Martin, D. C., Reue, K., and Lusis,

A. J. (1990) J. Lipid Res. 31, 91-101 10. Liao, F., Andalibi, A., deBeer, F. C., Fogelman, A. M., and Lusis, A. J. (1993) J.

Clin. Invest. 91, 2572-2579 11. Nishina, P. M., Verstuyft, J., and Paigen, B. (1990) J. Lipid Res. 31, 859-869 12. Nishina, P. M., Lowe, S., Verstuyft, J., Naggert, J. K., Kuypers, F. A., and Paigen,

B. (1993) J. Lipid Res. 34, 1413-1422 13. Hedrick, C. C., Castellani, L. W., Warden, C. H., Puppione, D. L., and Lusis, A. J.

(1993) J. Biol. Chem. 268, 20676-20682 14. Carr, T.P., Andresen, C.J., and Rudel, L.L. (1993) Clin. Biochem. 26, 39-42. 15. Kersten, S., Mandard, S., Escher, P., Gonzalez, F. J., Tafuri, S., Desvergne, B.,

and Wahli, W. (2001) FASEB J 15, 1971-1978 16. Cohen, R. D., Castellani, L. W., Qiao, J.-H., Van Lenten, B. J., Lusis, A. J., and

Reue, K. (1997) J. Clin. Invest. 99, 1906-1916

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

24

17. Canbay, A., Higuchi, H., Bronk, S. F., Taniai, M., Sebo, T. J., and Gores, G. J. (2002) Gastroenterol. 123, 1323-1330

18. Vergnes, L., Phan, J., Stolz, A., and Reue, K. (2003) J. Lipid Res. 44, 503-511. 19. Huebert, R. C., Splinter, P. L., Garcia, F., Marinelli, R. A., and LaRusso, N. F.

(2002) J. Biol. Chem. 277, 22710-22717 20. Baroukh, N., Ostos, M. A., Vergnes, L., Recalde, D., Staels, B., Fruchart, J.,

Ochoa, A., Castro, G., and Zakin, M. M. (2001) FEBS Lett. 502, 16-20 21. Neubauer, K., Saile, B., and Ramadori, G. (2001) Can. J. Gastroenterol. 15, 187-

193 22. Urizar, N. L., Dowhan, D. H., and Moore, D. D. (2000) J. Biol. Chem. 275, 39313-

39317 23. Kmiec, Z. (2001) Adv. Anat. Embryol. Cell Biol. 161, 1-151 24. Friedman, S. L. (2000) J. Biol. Chem. 275, 2247-2250 25. Bailey, D.W. (1978) In Origins of Inbred Mice. Morse, H.C.T., ed. New York:

Academic Press, pp. 197-215. 26. Mouzeyan, A., Choi, J.-H., Allayee, H., X., W., Sinsheimer, J., Phan, J.,

Castellani, L., Reue, K., Lusis, A. J., and Davis, R. C. (2000) J. Lipid Res. 41, 573-582

27. Liao, F., Andalibi, A., Qiao, J. H., Allayee, H., Fogelman, A. M., and Lusis, A. J.

(1994) J. Clin. Invest. 94, 877-884 28. Phan, J., Psearan, T., Davis, R. C., and Reue, K. (2002) J. Biol. Chem. 277, 469-

477 29. Brady, L. M., Beno, D. W. A., and Davis, B. H. (1996) Biochem. J. 316, 765-769 30. Higuchi, H., and Gores, G.J. (2003) Am. J. Physiol. Gastrointest. Liver Physiol.

284, G734-G738. 31. Bissell, D. M. (1998) J. Gastroenterol. Hepatol. 33, 295-302 32. Li, D., and Friedman, S. L. (1999) J. Gastroenterol. Hepatol. 14, 618-633 33. Marra, F. (1999) J. Hepatol. 31, 1120-1130 34. Tsukamoto, H., and Lu, S. C. (2001) FASEB J. 15, 1335-1349

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

25

35. Knolle, P., Lohr, H., Treichel, U., Dienes, H. P., Lohse, A., and Gerken, G. (1995)

Z. Gastroenterol. 33, 613-620

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

26

FIGURE LEGENDS

Figure 1. C57BL/6J mouse plasma and hepatic lipid levels on 5 diets. Plasma and

hepatic lipid determinations were performed after 3 weeks feeding on each of five

diets—Chow, Ath, No Cholate, No Cholesterol, and No Fat. Plasma lipid values are

given as mg/dL, and hepatic lipid values as µg/mg tissue. Values represent the average

of 5 mice (plasma lipids) or 4 mice (hepatic lipids) on each diet. Error bars indicate

standard deviation. Significantly different than Chow value: *, p<0.05; **, p<0.01.

Significantly different than Ath value: +, p<0.05; ++, p<0.01.

Figure 2. Expression levels of genes activated or repressed by dietary cholesterol,

cholate, or fat. Expression levels are taken from microarrays probed with RNA samples

pooled from 5 C57BL/6J mice on each diet. Genes were classified based on activation

or repression of at least 2-fold by cholesterol, cholate or fat across all five diets. The list

of genes in each panel is given under the corresponding heading in Table 2.

Representative Northern blots are shown below each graph, with liver samples from two

mice on each diet analyzed for the gene indicated. Fat activated genes were expressed

at a lower magnitude, so RT-PCR was used instead of Northern blot to confirm

expression levels. (a) Genes activated by cholesterol component of the diet. (b) Genes

repressed by cholesterol. (c) Genes activated by cholate. (d) Genes repressed by

cholate. (e) Genes activated by fat. (f) Genes repressed by fat. Saa3, serum amyloid

A3; W34845, mouse EST; Col3a1, procollagen, type III, alpha 1; Mup1, major urinary

protein 1; Gck, glucokinase; Igfbp1, insulin-like growth factor binding protein 1.

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

27

Figure 3. Circulating serum amyloid A and hepatic collagen levels in response to diet

components. (a) Plasma SAA levels (µg SAA/mL plasma) were determined by ELISA

for C57BL/6J mice fed the diets indicated for 3 weeks. *, significantly different than

Chow, p<0.05; +, significantly different than No Cholate diet, p<0.05. (b) Total acid-

pepsin soluble collagens (mg collagen/mg tissue) were quantitated in liver homogenates

of C57BL/6J mice fed the diets indicated for 3 weeks. +, significantly different than No

Cholate diet, p<0.05. For (a) and (b), values represent the mean and error bars indicate

standard deviation for 3-4 mice on each diet.

Figure 4. Hepatic stellate cell markers in C57BL/6J mice are activated in response to

dietary cholate. Hepatic stellate cell marker expression was evaluated via RT-PCR (16)

for mice on the Chow, Ath, and No Cholate diets. Expression levels of Pdgfrb (platelet

derived growth factor receptor β), Tgfb1 (transforming growth factor β1), Col1a1

(Procollagen, type I, α1), and Timp1 (Tissue inhibitor of metalloproeinases-1) were

elevated on Ath compared to the Chow diet, but activation was attenuated when cholate

was omitted from the diet. Shown are samples from two mice on each diet. Tbp (TATA

box binding protein) was amplified as a normalization control that is unaffected by strain

or diet.

Figure 5. Attenuated gene expression response to cholesterol and cholate in the

atherosclerosis-resistant C57BL/6ByJ strain. C57BL/6J and C57BL/6ByJ mice were fed

the 5 diets indicated for 3 weeks and mRNA expression levels determined by

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

28

microarray hybridizations. Expression values are taken from microarrays probed with

RNA samples pooled from 5 mice of each strain on each diet. (a) Expression profile of

cholesterol-activated inflammatory genes in C57BL/6J. (b) Profile of genes shown in (a)

for the C57BL/6ByJ strain. (c) Expression profile of cholate-activated fibrotic genes in

C57BL/6J. (d) Profile of genes shown in (c) for the C57BL/6ByJ strain. Full gene

names are given in Table 2.

Figure 6. Reduced induction of serum amyloid A and hepatic collagen levels in Ath fed

C57BL/6ByJ mice. (a) Circulating SAA levels (µg SAA/mL plasma) in C57BL/6J

compared to C57BL/6ByJ mice fed the Ath diet for 3 or 16 weeks. *, strains differ

significantly, p<0.01. (b) Hepatic collagen levels (mg collagen/mg tissue) in C57BL/6J

compared to C57BL/6ByJ mice fed the Ath diet for 3 or 7 weeks. *, strains differ

significantly, p<0.05.

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

29

ACKNOWLEDGMENTS

We thank Ping Xu for excellent technical assistance. This work was supported by

National Institutes of Health grants HL58627 and HL28481 (K.R.) and the Philippe

Foundation, Inc. (L.V.)..

ABBREVIATIONS

The abbreviations used are: Ath, atherogenic diet; LDL/VLDL, low density/very low

density lipoprotein; HDL, high density lipoprotein; EST, expressed sequence tag; SAA,

serum amyloid A.

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

30

Table 1. Composition of the five diets.

Chow Ath No Cholate No Cholesterol No Fat Cholate - + - + + Cholesterol - + + - + Fat - + + + -

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

31

TABLE 2 Genbank Name Symbol Gene Ontology Chow Ath No Cholate No Cholest. No Fat

Cholesterol Activated

AA013615 Lectin, galactose binding, soluble 3 Lgals3 Lectin/plasma membrane 0 266 104 44 318

AA027619 Lymphocyte antigen 6 complex, locus C Ly6c glycoprotein receptor 0 664 431 156 714

AA097051 Lymphocyte antigen 6 complex Ly6 glycoprotein receptor 165 935 1212 408 1025

AA097202 EST 159 420 325 147 459

AA163876 EST 1183 4509 3242 1582 4452

AA165803 EST 43 210 205 44 120

AA174982 Coronin, actin binding protein 1A Coro1a actin cytoskeleton 41 316 108 9 353

AA288442 Guanylate nucleotide binding protein 2 Gbp2 GTPase 26 375 235 28 293

AF027865 histocompatibility 2, class II antigen A, alpha H2-Aa immune response 711 16292 5399 1696 14206

ET62843 paired-Ig-like receptor A5 Pira5 defense/immunity protein 0 527 143 32 854

ET63206 fructose bisphosphatase 1 Fbp1 fructose metabolism 90 238 380 69 224

L38444 T-cell specific GTPase Tgtp GTPase 78 742 1588 158 663

M17790 serum amyloid A 4 Saa4 high-density lipoprotein 653 5298 2322 322 10641

M34815 small inducible cytokine B subfamily (Cys-X-Cys), member 9

Scyb9 immune response/inflammation response 19 933 690 11 692

U15635 SAM domain and HD domain, 1 Samhd1 immune response 144 399 324 152 412

U21795 interleukin 2 receptor, gamma chain Il2rg interleukin receptor 0 210 143 68 248

U60438 serum amyloid A 2 Saa2 immune response 1461 10031 4508 1326 14666

V01527 histocompatibility 2, class II antigen A, beta 1 H2-Ab1 immune response 0 12514 3506 560 10538

W55014 EST 0 188 194 91 183

X00496 Ia-associated invariant chain Ii defense response 879 24550 7557 2251 21398

X00958 histocompatibility 2, class II antigen E beta H2-Eb1 immune response 873 11722 3385 1284 8703

X03479 serum amyloid A 3 Saa3 immune response 215 7940 2194 127 7510

X73960 tyrosine kinase receptor 1 Tie1 protein tyrosine kinase 0 236 216 0 556

Z11886 Notch gene homolog 1, (Drosophila) Notch1 neurogenesis 74 355 381 155 353

Z19543 Calponin 2 Cnn2 actin binding 168 978 1013 289 667

Cholesterol repressed

AA039197 Protocadherin 13 Pcdh13 calcium binding 607 172 0 384 0

AA267683 Isopentenyl-diphosphate delta isomerase Idi1 cholesterol biosynthesis 250 90 123 399 119

AA415990 EST 243 52 60 196 63

AA684083 EST 145 2 0 144 28

AA717238 EST 509 147 181 436 216

AF018952 aquaporin-8 Aqp8 integral plasma membrane protein 224 98 47 258 0

M64250 apolipoprotein A-IV Apoa4 high-density lipoprotein 686 0 0 274 0

M64863 Cytochrome P450, 17 Cyp17a1 C21-steroid hormone biosynthesis 1313 39 0 375 0

U37438 CRP-ductin Crpd integral membrane protein 130 0 0 305 15

U91511 ectonucleoside triphosphate diphosphohydrolase 2 Entpd2 integral membrane protein 254 0 0 153 0

W13498 EST 567 84 79 262 92

W13697 EST 236 28 39 131 1

W34845 EST 1223 494 490 991 470

Cholate activated

AA003990 EST 5 206 0 332 130

AA011784 EST 0 228 65 521 388

AA023107 SEC22 vesicle trafficking protein-like 1 (S. cerevisiae) Sec2211 vesicle-mediated transport 0 248 46 259 129

AA024049 Vimentin Vim intermediate filament 281 1214 518 1416 1270

AA031158 EST 0 418 104 274 604

AA098332 Hemoglobin Y, beta-like embryonic chain Hbb-y oxygen transport 0 300 0 117 115

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

32

Genbank Name Symbol Gene Ontology Chow Ath No Cholate No Cholest. No Fat

AA111209 Lxrb Nr1h2 transcription regulation 0 124 25 190 106

AA117100 Leukemia-associated gene Lag intracellular signaling cascade 0 189 25 702 283

AA117701 Actin, alpha, cardiac Actc1 actin cytoskeleton 186 1303 448 1101 1484

AA123395 Secreted phosphoprotein 1 Spp1 ossification 125 505 126 388 420

AA144136 Choline kinase Chk lipid metabolism 23 291 45 311 142

AA152678 Basigin Bsg integral membrane protein 0 2176 863 2347 1949

AA163805 EST 43 190 43 154 212

AA169054 Rho, GDP dissociation inhibitor (GDI) beta Arhgdib GTPase activator 0 198 0 688 731

AA182195 EST 60 385 99 282 318

AA183642 EST 34 184 13 123 230

AA185385 EST 56 140 67 137 138

AA185911 Lymphocyte antigen 68 Ly68 defense response 140 439 131 293 744

AA265119 EST 50 115 0 264 105

AA265357 Cleavage stimulation factor, 3' pre-RNA, subunit 3 Cstf3 mRNA cleavage 0 232 57 151 134

AA271049 EST 47 199 0 161 122

AA288280 Cathepsin C Ctsc proteolysis and peptidolysis 172 347 87 367 510

AA426917 Cyclin B1, related sequence 1 Ccnb1-rs1 - 14 123 44 245 143

AA666918 IQ motif containing GTPase activating protein 1 Iqgap1 RAS GTPase activator 0 256 60 202 357

AA672846 EST 53 148 35 257 353

AF013262 lumican Lum extracellular matrix 50 176 75 197 195

AF020313 amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein

Apbb1ip-pending

- 14 237 34 128 254

AF026072 sulfotransferase family, cytosolic, 2B, member 1 Sult2b1 Sulfotransferase protein 0 526 211 475 507

C80730 CD9 antigen Cd9 integral membrane protein 72 146 51 288 246

D10024 Annexin A2 Anxa2 calcium binding 162 1332 315 2506 868

D12907 serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1

Serpinh1 heat shock protein 117 289 122 255 345

D13664 osteoblast specific factor 2 osf2-pending skeletal development 0 215 37 289 256

D16432 Cd63 antigen Cd63 integral membrane protein 242 1878 311 1561 1739

ET63194 coxsackievirus and adenovirus receptor Cxadr integral membrane protein 0 183 59 280 212

J03857 immunoglobulin-associated beta Igb humoral immune response 70 168 60 170 253

J04694 Procollagen, type IV, alpha 1 Col4a1 basement membrane 355 975 320 776 837

J04953 gelsolin Gsn cytoskeleton 158 636 175 500 414

J05663 aldo-keto reductase family 1, member B7 Akr1b7 aldehyde reductase 22 215 0 732 557

M31885 inhibitor of DNA binding 1 Idb1 DNA binding protein 74 500 85 418 422

M38337 milk fat globule-EGF factor 8 protein Mfge8 cell adhesion molecule 804 1849 744 1975 1948

M58004 Small inducible cytokine A6 Scya6 immune response 0 456 5 113 585

M58566 zinc finger protein 36, C3H type-like 1 Zfp36l1 DNA binding protein 85 363 106 276 233

M70642 connective tissue growth factor Ctgf extracellular matrix 0 293 0 115 379

U08020 procollagen, type I, alpha 1 Col1a1 collagen 85 995 115 541 693

U12785 aldehyde dehydrogenase family 3, subfamily A1 Aldh3a1 oxidoreductase 0 558 0 142 621

U19482 small inducible cytokine A9 Scya9 immune response 936 2175 493 2447 2103

U20365 actin, gamma 2, smooth muscle, enteric Actg2 actin cytoskeleton 211 1087 521 1351 1461

U27315 Solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4

Slc25a4 integral membrane protein 74 224 88 198 298

U29396 Annexin A5 Anxa5 calcium binding 672 2256 931 2875 2315

U37226 Phospholipid transfer protein Pltp lipid metabolism 167 503 123 444 1245

U41341 S100 calcium binding protein A11 (calizzarin) S100a11 calcium binding 80 610 154 1230 497

U47543 Ngfi-A binding protein 2 Nab2 transcription regulation 0 236 0 143 151

U59761 ATPase, Na+/K+ transporting, beta 3 polypeptide Atp1b3 integral membrane protein 0 1024 109 254 913

U59807 cystatin B Cstb cysteine protease inhibitor 461 1576 631 1425 1400

U69488 G7e protein G7e - 40 203 51 586 194

U91511 ectonucleoside triphosphate diphosphohydrolase 2 Entpd2 integral membrane protein 39 819 0 328 365

W08016 cyclin D1 Ccnd1 - 458 1348 295 3464 1295

W08322 EST 782 2133 646 1985 2144

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

33

Genbank Name Symbol Gene Ontology Chow Ath No Cholate No Cholest. No Fat

W10606 ATPase inhibitor Atpi mitochondrion 0 424 112 701 407

W12140 EST 0 526 0 621 486

W13166 Lipocalin 2 Lcn2 transport 21 5968 442 1420 15733

W29265 Glutathione S-transferase, alpha 1 (Ya) Gsta1 Glutathione metabolism 1871 5174 1807 5864 5903

W30069 Myocyte-enriched calcineurin interactin protein 1 Mcip1 central nervous system development 91 223 30 218 276

W35967 D2Wsu127e - 68 307 100 254 424

W41301 syntaxin 8 Stx8 non-selective vesicle transport 0 346 114 531 425

W48388 EST 0 292 0 270 223

W75846 EST 102 253 59 479 542

W83347 IQ motif containing GTPase activating protein 1 Iqgap1 RAS GTPase activator 159 613 205 424 883

W90871 EST 89 220 46 382 242

X14194 nidogen-1 Nid1 basement membrane 4 666 36 773 548

X16834 lectin, galactose binding, soluble 3 Lgals3 629 5165 630 2102 3975

X52046 procollagen, type III, alpha 1 Col3a1 collagen 0 3940 193 2211 2738

X54966 Cathepsin B ctsB proteolysis and peptidolysis 0 228 49 186 195

X58251 Procollagen, type I, alpha 2 Col1a2 collagen 0 1403 0 426 380

X63782 lymphocyte antigen 6 complex, locus D Ly6d defense response 476 3410 666 6072 2857

X66405 procollagen, type VI, alpha 1 Col6a1 collagen 0 340 105 459 502

X67783 Vascular cell adhesion molecule 1 Vcam1 cell adhesion molecule 0 4067 333 985 3460

X97227 CD53 antigen CD53 integral membrane protein 4 246 61 176 496

Y08026 Immunity-associated protein, 38 kDa Imap38 - 0 170 59 131 159

Z11997 high mobility group box 1 Hmg1 transcription regulation 651 2018 746 1764 1535

Z31065 EST 0 220 23 352 271

Cholate repressed

AA016545 Calbindin-D9K Calb3 calcium binding 140 0 143 9 58

AA064024 Choline kinase -like Chkl Choline/ethanolamine kinase 328 116 464 55 130

AA104822 EST 388 0 314 16 79

AA124170 Activating transcription factor 4 Atf4 transcription regulation 517 64 243 88 66

AA139256 EST 773 0 246 0 0

AA168485 chemokine orphan receptor 1 Cmkor1 chemokine receptor 926 232 485 55 121

AA197627 EST 405 0 424 0 0

AA238367 EST 1073 438 1721 526 490

AA277739 EST 489 196 456 210 138

AA590086 EST 1669 225 836 162 0

D13903 protein tyrosine phosphatase, receptor type, D Ptprd protein tyrosine phosphatase 157 43 291 0 0

J04847 DNA segment, Chr 1, Pasteur Institute 1 D1Pas1 829 83 262 62 80

M27796 carbonic anhydrase 3 Car3 carbonate dehydratase 1481 686 4374 448 278

U14390 aldehyde dehydrogenase family 3, subfamily A2 Aldh3a2 aldehyde dehydrogenase (NAD+) 319 80 629 118 0

U36993 cytochrome P450, 7b1 Cyp7b1 steroid biosynthesis 3660 425 5777 224 231

U49861 deiodinase, iodothyronine, type I Dio1 thyroxine deiodinase 1410 349 1808 275 225

U60330 proteaseome (prosome, macropain) 28 subunit, 3 Psme3 proteasome activator complex 375 81 243 70 92

U97107 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3

Elovl3 - 1284 576 1224 191 261

W29533 histidine rich calcium binding protein Hrc smooth endoplasmic reticulum 364 82 275 73 17

W85336 EST 369 91 229 94 70

W90866 eukaryotic translation elongation factor 2 Eef2 protein biosynthesis 376 0 199 0 0

X03208 Major urinary protein 1 Mup1 defense response 6699 1626 13823 1636 627

Z37988 protein tyrosine phosphatase, receptor-type, F Ptprf protein tyrosine phosphatase 368 56 383 130 46

fat activated

C79929 Jumonji jmj central nervous system development 134 374 338 297 120

D17892 EST - 44 132 242 288 65

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

34

Genbank Name Symbol Gene Ontology Chow Ath No Cholate No Cholest. No Fat

L38990 Glucokinase activity Gck Glucokinase 0 129 157 151 44

U47008 Ngfi-A binding protein 1 Nab1 transcription regulation 41 331 279 154 0

X15373 inositol 1,4,5-triphosphate receptor 1 Itpr1 signal transduction 55 298 227 167 66

X81464 Translin Tsn DNA-binding protein 2 536 869 274 58

Fat

repressed

AA270743 EST 403 92 0 0 358

AA407018 thymine DNA glycosylase Tdg DNA repair enzyme 235 34 10 17 130

AA414903 EST 141 30 0 16 119

C78586 EST 117 38 35 43 155

M31314 Fc receptor, IgG, high affinity I Fcgr1 CD64 defense response 199 64 0 0 143

U27398 Xeroderma pigmentosum Group C Xpc DNA repair protein 760 95 260 188 619

U70622 endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2

Edg2 integral plasma membrane protein 212 32 85 74 203

W29468 myosin light chain, phosphorylatable, fast skeletal muscle Mylpf muscle development 141 6 22 51 111

X67493 insulin-like growth factor binding protein 1 Igfbp1 regulation of cell growth 15922 7132 5719 4547 14964

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Laurent Vergnes, Jack Phan, Merav Strauss, Sherrie Tafuri and Karen Reuehepatic inflammatory gene expression

Cholesterol and cholate components of an atherogenic diet induce distinct stages of

published online August 15, 2003J. Biol. Chem. 

  10.1074/jbc.M306022200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

  http://www.jbc.org/content/suppl/2003/09/15/M306022200.DC1

by guest on March 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from