Embed Size (px)
Citation preview
1
Technology that Teaches: Games in Education
MERLOT 2005
Stefan Gunther, Federation of American Scientists
2
Simulations and Exploration Environments: Key Research Needs• Interoperability for integrating simulation
– ontology, geometry, and message passing
• Reuse, updating, and maintenance of simulations
– open architectures, certification, management techniques
• Adapting simulation to learning environments
– Learner modeling and assessment, fidelity, distance learning, and collaboration
• Improved navigation techniques in virtual environments
– presence, viewing, manipulation, movement, and haptics
– tools to provide control for teachers and instructors to run demonstrations, manipulate parameters
3
Some Current Examples:
Simulations: learning by doing, virtual environments, practice opportunities
4
Games support: Active learning Experiential learning Problem-based learning Immediate feedback Learner-centered learning
Gaming environments include: Problem-solving in complex systems Creative expression Social relationships Peer assessment
Characteristics of Games & the Potential for Learning
5
We Know That Games Are Engaging An 8th grader plays video games an average of 5 hours
/week
By high school, 77% of students have played games; by college nearly all have
60% of college students are regular game players
Game sales nearly $10B in 2004
US Army’s America’s Army (as of April 2005):
• >5M registered users
• >3M completed basic training
6
About > AllExperts > Experts
Search
Topic: Biology Expert:walter hintz Question: I am a 26 year old who is taking this bio 30 distance ed, and my teacher gives me a page number to read and all the reading did not help, i still do not understand I hope you can help me. Assume that the production of an important hormone depends on a simple enzyme, and cells require a particular DNA sequence to control production of the enzyme. As a protein, let the enzyme consist of ten amino acid sequences leucine-alanine-cysteine-glycine-leucine-proline-leucine-valine-lysine find the correct DNA code of the following mutated sequence, so the enzymes abo ve can be properly produced. Show the steps necessary to sol ve this problem. DNA sequence : TACAATCGACGGACACCTGATATTAATCAATTTATT Answer: There is a problem here because in order to solve this problem you need the mRNA codons. If you do not have this go to http://www.accessexcellance.org/AB/GG.html Here is the solution to the problem given. AA sequence leu ala cys gly leu pro leu val lys codons CUU GCU UGU GGU CUU CCU CUU GUA AAA DNA GAA CGA ACA CCA GAA GGA GAA CAT TTT For some reason there are only nine amino acids given instead of ten. How do you do this. Do you know the base pairing rules? DNA RNA A ----U T------A C------G G------C Notice this in the problem above that I did; Opposite the CUU was a Caa and opposite the GCU was a CGA etc. Is the DNA sequence a separate problem? If so then find the RNA using the base pairing rule, then the codon sheet and find the Amino acids. If you are still having problems get back to me.
A typical student asks .17 question per hour in a conventional classroom
27 questions per hour in one-on-
one human tutoring
Help
DeskFAQ
Contact our experts
Question Asking & Answering: stimulating questions; providing instructionally sound answers; connecting learners and teachers to experts
7
The cookies on your daughter’s
computer probably know
more about what interests her than
her teacher
(recommender systems, personalizing shopping)
Individualized Instruction: user modeling for personalized learning, context sensitive answers, better assessments
8
Assessment: accountability to the learner, teacher, parent, employer, system
Demonstrate (simulation)
vs.
9
Federation of American Scientists: Educational Games Project Overview
Kay Howell, [email protected] Roper, [email protected]
Stefan Gunther, [email protected] Schleicher, [email protected]
10
Immune Attack• Game Features:
– Teach immunology concepts, using biologically correct simulations and “characters”
– Demonstrate players of the game are more engaged in the subject; more positive attitude towards science
• Target audience: senior high school students
• Funding: NSF Information Technology Research Grant --$1.3M, over 3 years
11
Immune Attack• Grant Collaborators:
– Brown University• Andries van Dam, Co-Principal Investigator for grant• Subject matter expertise, Prof. Christine Biron• Visualizations for the game, in collaboration with game development
team– FAS
• Henry Kelly Co-PI for grant• Learning content, including oversight of Ed Adv Panel• Game design and development; learning tools integration into game• Implementation and evaluation of the game in 2 high schools
– Game development team• Team of consultants with commercial development experience,
managed by FAS; using OGRE game engine
12
Immune Attack• Immune Attack© combines 3D depiction of biological
structure and function with advanced educational technologies to provide an introduction to basic concepts in immunology for high school and college students
• Students are motivated with a series of progressively more difficult challenges in a compelling gaming environment in which success depends on increasingly sophisticated grasp of concepts in immunology
• Game features include:– scientifically accurate simulations of the immune system
– context-sensitive question answering and dialogue– continuous assessment techniques to determine when the
learner is ready to move to a new level
13
Game Play• Player configures and programs the behavior of a
particular cell, such as choice of cell surface receptors• Other similar cells are automatically created that exhibit
the same kind of behaviors, be they sequestration, following specific cytokine paths, or engorging on enemy cells.
• Various puzzles have to be solved as the game progresses. Thus, although transparent to the player, the student learns basic principles of immunology through playing the game.
14
Goals for the Game• Demonstrate that games can may learning more engaging - the
game does not replace the teacher; however, students who play the game will be more motivated to learn because they will: 1) have a better understanding of the complex material, and 2) will be motivated to learn more in order to win the game
• Help teach young adults to choose better life-style behaviors to protect themselves from infection – they will experience first-hand how difficult it is for the immune system to defend against many viruses and bacteria.
• Expose young adults to the exciting fields of healthcare and biosciences. With Immune Attack©, students will experience the challenges of defending the human body against invading antigens and the potential for healing and saving lives. At this critical age when which many young adults must make decisions about college and careers, this exposure may attract more students to careers in bioscience research, medicine and other healthcare professions.
15
Immune Attack• Milestones
– Grant awarded: October 2004– 1st Prototype: August 2005– Full Game level 1, Scene 1 : October 2005– Subsequent Scenes : every 2 months– Full prototype: March 2006– Distribution & Evaluation: March-May 2006– Final Grant Report: August 2006
16
Immune Attack• Other Notes:
– Credits of project team• Peter Chan (conceptual artwork)• Darrin Stephens (2D illustrations)• Donovan Webb (3D visualizations)• Christine Biron, David Scott, Jeremy Ahouse (immunology
expertise)• John Bransford (learning science expertise)• High schools (Pittsford; Montgomery Blair)
– Additional implementation sites• Washington, DC Community Technology Centers• Other high schools being considered
17
Discover Babylon
18
Project ObjectivesUse simulation-based learning to...
• Increase institutional capabilities
• Promote cultural diplomacy
• Explore opportunity for ‘digital’ repatriation
• Encourage audience to interact with museum and library holdings in fundamentally new way
19
Discover Babylon• Game Features:
– realistic historical simulations and digitized museum artifacts with compelling story line that captivates the learner with challenges and mysteries
– encourage the learner to appreciate Mesopotamia’s diverse contributions to writing, mathematics, literature and law
• Target audience: middle school students ages 12-16
• Funding: Institute of Museum and Library Services National Leadership Grant
20
Collaborators– UCLA
• Principal Investigator/ subject matter expertise• Digitizing content and ensuring standards are met
– FAS• Learning content• Visualizations for the virtual environment• Game design and development
– Walters Art Museum, Baltimore• Provides objects for digitization• Assisting with learning objectives• Provides subject matter expertise• Hosts game kiosk, participates in evaluation and distributes game
– Library of Congress• Provides objects for digitization
– Berlin Max Planck Society• subject matter expertise• European mirror for source data
21
Game development company & approach:
– 1st prototype - CMU Entertainment Technology Center (Kiosk version - 5 mins of gameplay)
– Final game – Independent Contractor with Univ of Central Florida script-writer (20 mins. Game play)
22
Milestones– Grant awarded: October 2004– Kiosk game: May 2005– Full prototype: March 2006– Distribution & Evaluation: March-Aug 2006– Final Grant Report: Sept 2006
23
24
25
26
27
28
29
Mass Casualty Incident Response
• Issue: Prepare 1,096,900 firefighters working
in 30,542 fire departments – Incident Command and the practical implementation of
national first responder policy
– Rapid cycle time and practical cost
– Repeatable as needed by the security situation
• Current methods:– TOPOFF exercises (Every 2 years, $16 million-$50 million,
10k people, 200 groups)
– Advanced Simulations (100 people, $40K)
– Traditional classes (time off job, travel, groups of 20, $60 - $1,200 per student)
– “e-learning” (free to $200, same as reading a book, some testing)
• Four years after 9/11 most are not trained and are not ready
30
Mass Casualty Incident Response continued
FAS Project:• Desktop computer w/ internet distribution
– Scaleable national distribution capability like e-learning
• Good learning Science Applied– High fidelity simulation, interactive discovery capability– Adaptive to learner’s adult experience– Built-in assessment and feedback– Combines learning science for knowledge acquisition
and simulation for application practice
• Maintainable with rapid changes– Central database and update capability gives instant
national accessibility to new or changed content
• Local Customization– Open editing system
31
Mass Casualty Incident Response continued
FAS Project:• FDNY team of Subject Matter Experts and
testers• Wisconsin team for local customization and
portability testing• Development supplier selected
– Open software environment• Independent evaluator• Multiple scenarios:
– High rise firefighting 1st
– Subway with HAZMAT 2nd
– Further development dependent on additional funding
32
Prototype Interface Panel
33
Stand Alone Training Mode
BEGIN Scene 1Training Mode?
No
Training Content
Yes
Training Mode?
Action Scene 2No
Evaluate Action
Yes
Reinforce - Content
Correct
Instruction Content
Incorrect Choice
34
Local Customization Interface
35
Interface with Navigation
36
Institutionalization (Immune Attack© )
• Goal: get broad market adoption in educational markets, including high schools and undergraduate colleges and universities
• Primary vehicle: Co-bundle and co-market the game with a textbook.
37
