01:22:03 NIDDK K08 Targeting p27kip1 to Improve Hepatocyte Transplantation (Doc 154-6:3:09 Exhibit 1.2)

'.

Form ,D;pproved Through 0512004 OMB No. 0925-0001

Department of Health and Human Services Public Health Service

Grant Application Do not exceed 56-character length restrictions, including spaces.

LEAVE BLANK·FOR PHS USE ONLY.

Type IActivity Number Review Group Formerly

Council/Board (Month, Year) Date Received

1. TITLE OF PROJECT

Targeting p27kip1 to Improve Hepatocyte Transplantation 2. RESPONSE TO SPECIFIC REQUEST FOR APPLICATIONS OR PROGRAM ANNOUNCEMENT OR SOLICiTATION U NO lx.J YES

(If ·Yes, • state number and title) .. Number: K08 Title: Mentored Clinical Scientist Development Award

New Investigator

3b. DEGREE(S)

MD

E-MAIL ADDRESS:

5. VERTEBRATE ANI

Yes

Sa. If "Yes," IACUC appr

pendino

oval Date

MALS

3. PRINCIPAL INVESTIGATOR/PROGRAM DIRECTOR

3a. NAME (Last, first,middle)

Ochoa, Erin R. 3c. POSITION TITLE 3d. MAILING ADDRESS (Street, city, state, zip code)

Assistant Professor Department of Pathology 3e. DEPARTMENT, SERVICE, LABORATORY, OR EQUIVALENT Montefiore Medical Center

111 East 21 Oth Street 3f. MAJOR SUBDIVISION

Pathology Bronx, NY 10467-2490

Anatomic Patholooy 39. TELEPHONE AND FAX (Area code, number and extension)

TEL: 718-920-5075 I FAX: 718-920-7611 4a. Research Exempt D No D Yes

SUBJECTS RESEARCH If "Yes," Exemption no.

4. HUMAN

4c. NIH-defined Phase III Assurance No. 4b. Human Subjects[X] No

Clinical Trial

DYes NoD D 7. COSTS REQUESTED FOR INITIAL6. DATES OF PROPOSED PERIOD OF

SUPPORT (month, day, y'ear-MMlDDIYY)

From I Through

BUDGET PERIOD

7a. Direct Costs ($)

12/01 /03 11/30/08 115,000 9. APPLICANT ORGANIZATION Name Montefiore Medical Center Address 111 E. 210th Street

Bronx, NY 10467-2490

Institutional Profile Number (if known) 5451101 12. ADMINISTRATIVE OFFICIAL TO BE NOTIFIED IF AWARD IS MADE

Name Title

Address'

Telephone

E-mail

Eileen Callinan Assistant Director Montefiore Medical Center 111 E. 21 Oth Street Bronx, NY 10467-2490

718-920-4151 ext.7 Fax 718-547-5217 [email protected] '

14. PRINCIPAL INVESTIGATOR/PROGRAM DIRECTOR ASSURANCE: I certify that the statements herein are true, complete and accurate to the best of my knowledge. I am aware that any false, fictitious. or fraudulent staiements or claims may subject me to criminal, civil, or administrative penalties. I agree to accept responsibility for the scientific conduct of the project and to provide the required progress reports if a grant is awarded as a result of this aoolication.

15. APPLICANT ORGANIZATION CERTIFICATION AND ACCEPTANCE: I certify that the statements herein are true, complete and accurate to the best of my knowledge, and accept the obligation to comply with Public Health Services terms and conditions if a grant is awarded as a result of this application. I am aware that any false, fictitious, or fraudulent statements or daims may subject me to criminal, civil, or administrative penalties.

DNo [X] Yes ····r·',........:'~.' , .~,', ~ ~/ ..~'" _>'~i.

-' ".': .~'

eocho,:,@montefiore.org

o No [X] Yes

5b. Animal welfare assurance no.

, A3761-01

8. COSTS REQUESTED FOR PROPOSED PERIOD OF SUPPORT

8a. Direct costs ($) 18b. Total costs ($)7b. Total Costs ($)

575,000 621,000124,200 10. TYPE OF ORGANIZATION

Public ~ D Federal g State D Local Private ~ aPrivate Nonpro It . For-profit ~ General D Small Business

D Woman-owned D Socially and Economically Disadvantaged

12. ENTITY IDENTIFICATION NUMBER

t 131740114A1 DUNS NO. (if available)

041581026 Congressional District 17th

13. OFFICIAL SIGNING FOR APPLICANT ORGANIZATION

Name Victor B. Hatcher, PhD Title Research Director Addresl Montefiore Medical Center

111 E. 21 Oth Street Bronx, NY 10467-2490

Telephc 718-920-4151 ext.8 E-mail [email protected]

Fax 718-547-5217

SIGNATURE OF PI/PO NAMED IN 3a. DATE (In inK, "fJer' slgnarure nor accepraDle.)

k A ~ O~Ol I {221Q3 ~;NAMEDIN 13.

DATE

rm m, ~ er$gn~,:;o=P,"O'"1

~~:r rPHS 398 (Rev 05/01 ) .. . /1 V

~

" 'iF Form Page 1Face Page

mailto:[email protected]

Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R

DESCRIPTION; State the application's broad, long-term objectives and specific aims, making reference to the health relatedness of the project. Describe concisely the research design and methods for achieving these goals. Avoid summaries of past accomplishments and the use of the first person. This abstract is meant to serve as a succinct and accurate description of the proposed work when separated from the application. If the application is funded, this description, as is, become public information. Therefore, do not include proprietary/confidential information. DO NOT EXCEED THE SPACE PROVIDED.

In characterizing the cell-cycle regulatory role of the cyclin-dependent kinase inhibitor, p27kip I, it was discovered that p27 knockout mice exhibit pronounced multi-organomegaly with no increased spontaneous carcinogenesis in the liver. This suggested that p27 manipulation could improve the success ofhepatocyte transplantation. It was then shown that donor hepatocytes from p27 knockout mice more actively proliferate and rescue liver failure in the FAH mouse modeL These results were limited by the fact that p27 was suppressed throughout the donor animal from early embryogenesis and the risk ofcarcinogenesis due to long-term p27 absence was not determined. In this proposal we develop three new techniques for targeting p27 in the mouse liver. Mxl-Cre transgenic mice will allow us to knockout p27 in the liver alone at controlled timepoints of hepatogenesis. The tetracycline-controlled overexpression of the F-box protein Skp2 will allow us to lower p27 protein abundance in the hepatocytes for desired periods of time. Finally, the tetracycline-controlled expression short hairpin RNA structures (shRNAs) will allow us to knockdown p27 in the hepatocytes. Skp2 and p27 shRNA expression will also be delivered to wild type primary hepatocytes in culture by an advanced lentivirus vector, which can be directly applicable to human hepatocytes. With these new appr<?aches ofp27 inactivation, we will determine the role ofp27 in hepatocyte transplantation and hepatocellular carcinogenesis in more clinically relevant settings. The results will give us a clear assessment of the potential benefits ofp27 suppression in the treatment of human liver failure.

PERFORMANCE SITE(S) (organization, city, state)

Albert Einstein College of Medicine 1300 Morris Park Avenue Bronx, NY 10461

KEY PERSONNEL. See instructions. Use continuation pages as needed to provide the required information in the format shown below. ~tart Wltn t-'nnClpal InvestIgator. List all otner J<;ey personnel In alphabetical oraer, last name hrst.

Name Organization Role on Project

Erin Rubin Ochoa. MD Montefiore Medical Center Principal Investigator

Liang Zhu, MD. PhD Albert Einstein College of Medicine Sponsor David Shafritz, MD AI~ert Einstein College of Medicine Co-Sponsor

Disclosure Permission Statement. Applicable to SBIRISTTR Only. See Instructions Form Page 2

PHS 398 (Rev. 05/01) Page ~

Number pages consecutively at the bottom throughout the application. Do not use suffIXes such as 3a, 3b.

------

RCA TOC Substitute Page Candidate (Last. first, middle): Ochoa, Erin R. Use this substitute page for the Table of Contents of Research Career Awards. The nam-e-o-;"f"";";th-e"":'c-a-n-d";7id7a":"te-m-u-s"7t7b-e-p-r-o--:vi:-':d-ed-;--a-:-t:7th-e--:t-opof each printed page and each continuation page.

RESEARCH CAREER AWARD

TABLE OF CONTENTS

(SUbstitute Page) Page Numbers

Section J: Basic Administrative Data

1-3. Face Page, Description and Key Personnel, Table of Contents (Form pages 1, 2, and this substitute page) . 1- 3 4. Budget for Entire Proposed Period of Support (Form page 5) . 4 5. Biographical Sketches (Candidate and Sponsor[s]*-Biographical Sketch Format page) (Not to exceed four pages) 5-10 6. Other Support Pages for the Mentor (not the candidate) . 11-12 7. Resources (Resources Format page) . 13

Section II: Specialized Information

1. Introduction to Revised Application (Not to exceed 3 pages) . 2. Letters of Reference (Altach to Face Page)"

3. The Candidate

A. Candidate's Background

B. Career Goals and Objectives: Scientific Biography.....

C. Career Development Activities during Award Period

}

.. (Items A-C included in 25 page limit) .. { 14 14 14 16

4. Statements by Sponsor(s), Consultant(s)·, and Collaborator(s)· 17 5. Environment and Institutional Commitment to Candidate 25

A. Description of Institutional Environment.. . 25 B. Institutional Commitment to Candidate's Research Career Development . 25

6. Research Plan

A. Statement of Hypothesis and Specific Aims

B. Background, Significance, and Rationale

C. Preliminary Studies and Any Results

D. Research Design and Methods

}

..

(Items A-D included in 25 page limit) ..

..

..

.

{ 27 28 31 38

E. Human Subjects· . 48 List appropriate grants with IRB approval dates or exemption designation ..

F. Vertebrate Anima(s· . 48 List appropriate grants with IACUC approval dates or exemption designation .

G. Literature Cited .. 49 H. ConsortiumlContractual Arrangements· .

I. Consultants· .

7. Checklist

B. Appendix (Five collated sets. No page numbering necessary) ~ Check if Appendix is included

Number of publications and manuscripts accepted for publication (not to exceedS) 1 List of Key Items:

Note: Type density and size must conform to limits proviqed in the Specific Instructions.

·Include these items only when applicable.

CITIZENSHIIP

[gI U.S. dtizen or noncitizen national . o Permanent resident of U.S. ( If a perman~nt re~gent of the U.S., a notarized statement must be provided by the time of award.

" Page~ RCA Substitute Form Page 3 PHS 398 (Rev. 05/01)

Principallnvestigator/Program Director (Last. first, middle): Ochoa, Erin R.

BUDGET FOR ENTIRE PROPOSED PROJECT PERIOD DIRECT COSTS ONLY

INITIAL BUDGET

BUDGET CATEGORY PERIOD ADDITIONAL YEARS OF SUPPORT REQUESTED TOTALS (from Form "aae 4) 2nd 3rd 4th 5th

PERSONNEL: Salary and fringe benefits

Appficant organization only

CONSULTANT COSTS

EQUIPMENT

SUPPLIES

TRAVEL

PATIENT INPATIENT

CARE

COSTS OUTPATIENT

ALTERATIONS AND RENOVATIONS

OTHER EXPENSES

SUBTOTAL DIRECT COSTS

CONSORTIUM! DIRECT

CONTRACTUAL COSTS F&A

115,000115,000 115,000 115,000 115,000TOTAL DIRECT COSTS

TOTAL DIRECT COSTS FOR ENTIRE PROPOSED PERIOD (Item 8a, Face Page) -. $575,000 I SBIRISTTR Only Fee Requested JUSTIFICATION. Follow the budget justification instructions exactly. Use continuation pages as needed.

Erin Rubin Ochoa, MD (Principal Investigator): Dr. Ochoa is an Assistant Professor of the Department of Pathology at the Albert Einstein College of Medicine and Assistant Professor of the Department of Pathology at the Montefiore Medical Center. She has extensive experience in liver pathology, regeneration and growth. Dr. Ochoa will devote 75% ofher effort to the studies outline in this proposal. Dr. Ochoa will plan and

conduct all the experiments.

Liang Zhu, MD, PhD, (Sponsor): Dr. Zhu is an Associate Professor of the Department ofDevelopmental & Molecular Biology, Assistant Professor ofthe Department ofMedicine at the Albert Einstein College of Medicine. Dr. Zhu has extensive experience in tumor suppressor pathways and cellular proliferation and regulation. He will provide Dr. Ochoa with guidance, advice and support during the course of this proposed study. .

David Shafritz, MD (Co-Sponsor): Dr. Shafritz is a Professor in the Department of Medicine, Professor in the Department of Cell Biology, Professor in theDepartrnent of Pathology, Herman Lopata Professor of Liver Disease Research, and Director of the Marion Bessin Liver Research Center at Albert Einstein College of Medicine. Dr. Shafritz is an expert in the u~e ofliver progenitor cells for transplantation and gene therapy. As a Co-sponsor, Dr. Shafritz will provide guidance and advice to Dr. Ochoa during this study.

,"

Page1 Form Page 5 PHS 398 (Rev. 5/01)

u.._...~. M"'er ",,,,,,,,,,,..ttJiVAl,, ~ tM hottom throuohout the application. Do not use suffixes such as 3a, 3b.

Principal InvestigatorlProgram Director (Last, first, middle): Ochoa, Erin R.

BIOGRAPHICAL SKETCH Provide the following information for the key personnel in the order listed for Form Page 2.

Follow the sample format for each person. DO NOT EXCeeD FOUR PAGES.

NAME POSITION TITLE

Erin Rubin Ochoa, MD, FCAP Assistant Professor

EDUCATIONITRAINING (Begin with baccalaureate or other initial professional education, such as nursing, and include postdoctoral training.)

INSTITUTION AND LOCATION DEGREE (if applicable)

AA B.A/B.A

M.D. Board Certification

YEAR(s} FIELD OF STUDY

Oxford College of Emory University, Oxford, GA Emory University, Atlanta, GA

Emory University School of Medicine, Atlanta, GA Massachusetts General Hospital, Boston, MA

1989 1990

1996 1996-2000 '

Associate of Arts Biology and Anthropology Doctor of Medicine Anatomic and Clinical Pathology

Employment . 1991-1996 Medical Student. Emory University School of Medicine. Atlanta, GA 1993-1994 Post-sophomore Year Fellow in Pathology. Department of Pathology.

Tulane University School of Medicine, New Orleans, LA 1996-2000 Clinical Fellow in Pathology, Department of Pathology, Massachusetts General

Hospital, Harvard Medical School, Boston, MA 1999-2001 Research Fellow, Department of Surgery, Massachusetts General Hospital,

Harvard Medical School, Boston, MA 2000-2001 Graduate Assistant in Pathology, Department of Pathology, Massachusetts

General Hospital, Harvard Medical School, Boston, MA 2002-Present Assistant Professor in Pathology, Department of Pathology, Montefiore Medical

Center, Albert Einstein College of Medicine, Bronx, NY

Honors 1994 Award for Academic Excellence and Achievement, American Society of Clinical

Pathologists 2000,2001 Partners in Excellence Award, Tissue Engineering and Organ Fabrication

Laboratory, Massachusetts General Hospital, Boston, MA 2001 Young Pathologists Spokesperson Training Program, College of American

Pathologists, Chicago, IL

Professional Societies 1993-1994 Greater New Orleans Pathology Society 1991-2001 American Medical Association 1993-Present College 'of American Pathologists 1993-Present American Society,of Clinical Pathologists 1996-2002 Massachusetts Medical Society 1998-Present Academy of Clinical Laboratory Physicians and Scientists 2000 ' 2000 2002

Tissue Engineering Society Materials Research Society Gastrointestinal Pathology Society

"

Biographical Sketch Format PagePage§PHS 39812590 (Rev. 05/01)

Principallnvestigator/Program Director (Last, first, middle): Ochoa, Erin R. Publications ORIGINAL RESEARCH

Rubin, E.M., DeRose, P.B., Cohen, C. (1994): Comparative image cytometric DNA ploidy of liver cell dysplasia and hepatocellular carcinoma. Modern Pathology 7(6):677.

Rubin, E.M., Martin, AA, Thung, S.N., Gerber, M.A (1995) Morphometric and immunohistochemical characterization of human liver regeneration. American Journal of Pathology, 147(2):397-404.

Kairhara, S., Borenstein, J., Koka, R., Lalan, S., Ochoa, E.R., Ravens, M., Pien, M., Cunningham, B., Vacanti, J.P. (2000) Silicon micromachining to tissue engineer branched vascular channels for liver fabrication. Tissue Engineering 6(2):105-117.

Griksheit, T.C., Ochoa, E.R., Ramsanahie, A, Whang, E.E., Vacanti, J.P. (2001). Tissue engineered colon: characterization and comparison to native colon. Current Surgery 58(6):560. Mullins, M.E, Chao, S., Ochoa, E.R., Sianetz, P.J. (2001) Ovarian Carcinoma. AJR Am J Roentgenol 177(1 ):130. Ochoa, E.R., Harris, N.L., Pilch, B.Z. (2001) Marginal zone B-celilyrnphoma of the salivary gland

arising in chronic sclerosing sialadenitis (KQttner tumor). The American Journal of Surgical Pathology 25(12): 1546-1550.

Kairhara, S., Ogawa, K., Koka, R, Lalan, S., Ochoa, E.R., Alsberg, E., M90ney, D.J., Tanaka, K., Ravens, M., Vacanti, J.P. (SUbmitted for publication) In vitro neomorphogenesis of liver tissue on biodegradable polymer scaffolds under dynamic flow culture conditions. Gastroenterology. Terai, H., Hannouche, D., Ochoa, E.R., Yamano, Y., Vacanti, J.P. (2002) In vitro engineering of

bone using a rotational oxygen-permeable bioreactor system. Materials Science and Engineering 20(1-2):3-8.

Fuchs, J.R., Terada, S., Ochoa, E.R., Vacanti, ,J.P., Fauza, D.O. (2002) Fetal tissue engineering: in utero tracheal augmentation in an ovine model. J Pediatr Surg 37(7):1000-6; discussion 1000-6.

Grikscheit, T.C., Ogilvie, J.B., Ochoa, E.R., Alsberg, E., Mooney, D., Vacanti, J.P. (2002) Tissueengineered colon exhibits function in vivo. Surgery 132(2):200-4.

Campo-Ruiz, V., Ochoa, ER, Lauwers, G.Y., Gonzalez, S. (2002) Evaluation of hepatic histology by near-infrared confocal microscopy: a pilot study. Hum Pathol 33(10):975-82.

Fuchs, J.R, Terada, S., Hannouche, D., Ochoa, E.R., Vacanti, J.P., Fauza, D.O. (2002) Engineered fetal cartilage: Structural and functional analysis in vitro. J Pediatr Surg 37(12): 1720-5.

Ochoa, ER., Vacanti, J.P. (2002) An overview of pathology and approaches to tissue engineering. New York Academy of Sciences 979:10-27. Grikscheit, T.C., Ochoa, E.R., Ramsanahie, A, Alsberg, E., Mooney, D., Whang, E.E., Vacanti, J.P.

(In press 2003) Tissue engineered large intestine resembles native colon with appropriate in vitro physiology and architecture. Annals of Surgery.

Nasseri, B.A, Pomerantseva, I., Kaazempur-Mofrad, M., Sutherland, F.W.H., Perry, T., Ochoa, E., Thompson, C.A., Mayer, J.E., Oesterle, S.N., Vacanti, J.P. (In press 2003) A dynamic rotational seeding and cell culture system for vascular tube formation. Tissue Engineering.

Grikscheit, T., Ochoa, E., Srinivasan, A, Gaissert, H., Vacanti, J.P. (In press 2003) Tissueengineered esophagus: substitution by onlay patch or interposition. Journal of Thoracic and Cardiovascular Surgery. " NON-EXPERIMENTAL ARTICLES "

Ochoa, E.R.,. Lewandrowski, K. (20011) Bilirubin, serum enzymes, albumin and the prothrombin time:

their role in the identification of hepatobiliary disorders. Turnaround Times: Clinical Laboratory Reviews 7(2):1-5.

Ochoa, E.R., Vacanti, J.P. (2001) Developing a core platform for the tissue engineering of vital organs. Transplantation Reviews 15(4):184-99.

Ochoa, E.R., Vacanti, J.P. (accepted for 2003) An overview of the pathology and approaches to tissue engineering. New York Academy of Sciences. .'

BiographIcal Sketch Format Page Cc PHS 39812590 (Rev. 05/01) Page 6

Principallnvestigator/Program Director (Last, first, middle): Ochoa, Erin R.


Follow the sample format for each person. DO NOT EXCEED FOUR PAGES.

NAME POSITION TITLE

Erin Rubin Ochoa, MD, FCAP Assistant Professor

EDUCATIONITRAINING (Begin with baccalaureate or other initial professional education, such as nursing, and include postdoctoral training.)

INSTITUTION AND LOCATION DEGREE (if applicable)

A.A. B.A.lB.A.

M.D. Board Certification

YEAR(s) FIELD OF STUDY

Oxford College of Emory University, Oxford, GA Emory University, Atlanta, GA

Emory University School of Medicine, Atlanta. GA Massachusetts General Hospital, Boston, MA

1989 1990

1996 1996-2000 '

Associate of Arts Biology and Anthropology Doctor of Medicine Anatomic and Clinical Pathology

Employment . 1991-1996 Medical Student. Emory University School of Medicine. Atlanta, GA 1993-1994 Post-sophomore Year Fellow in Pathology. Department of Pathology.

Tulane University School of Medicine, New Orleans, LA 1996-2000 Clinical Fellow in Pathology, Department of Pathology, Massachusetts General

Hospital, Harvard Medical School, Boston, MA 1999-2001 Research Fellow, Department of Surgery, Massachusetts General Hospital,

Harvard Medical School, Boston, MA 2000-2001 Graduate Assistant in Pathology, Department of Pathology, Massachusetts

General Hospital, Harvard Medical School, Boston, MA 2002-Present Assistant Professor in Pathology, Department of Pathology, Montefiore Medical

Center, Albert Einstein College of Medicine, Bronx, NY

Honors 1994 Award for Academic Excellence and AcI,ievement, American Society of Clinical

Pathologists 2000,2001 Partners in Excellence Award, Tissue Engineering and Organ Fabrication

Laboratory, Massachusetts General Hospital, Boston, MA 2001 Young Pathologists Spokesperson Training Program, College of American

Pathologists, Chicago, IL

Professional Societies 1993-1994 Greater New Orleans Pathology Society 1991-2001 American Medical Association 1993-Present College of American Pathologists 1993-Present American Society, of Clinical Pathologists 1996-2002 Massachusetts Medical Society 1998-Present Academy of Clinical Laboratory Physicians and Scientists 2000 Tissue Engineering Society 2000 Materials Research Society 2002 Gastrointestinal Pathology Society

"

Biographical Sketch Format PagePage§PHS 398/2590 (Rev. 05/01)

Principallnvestigalor/Program Director (Last. first, middle): Ochoa, Erin R.


Follow the sample format on preceding page for each person. DO NOT EXCEED FOUR PAGES.

NAME POSITION TITLE

Liang Zhu Associate Professor EDUCATIONrrRAINING (Begin with baccalaureate or other initial professional education. such as nursing, and include postdoctoral training.)

INSTITUTION AND LOCATION DEGREE (if appHcable)

M.D. Ph.D.

YEAR(s) FIELD OF STUDY

Shanghai Second Medical College. Shanghai, China Univ. of Connecticut Health Center, Farmington, CT

1982 1991

Medicine Mol. BioI. & Virology

A. Positions and Honors:

1983 - 1985 Lecturer in the Department of Biochemistry, Shanghai Second Medical College

1985 - 1991 Graduate Assistant in the Department of Microbiology, University of Connecticut Health Center

1991 - 1996 Research Fellow in Medicine, Harvard Medical School and Massachusetts General *Hospital Cancer Center

1996 - 2001 Assistant Professor of Developmental and Molecular Biology, Albert Einstein College of Medicine

2001 - present Associate Professor of Developmental and Molecular Biology, Albert Einstein College of Medicine

Fellowship/Scholarship Awards:

1982 Shanghai Second Medical College Excellent Student Award

1985 - 1991 University of Connecticut Health Center Graduate Fellowship Award

1993 - 1996 Leukemia Society of America Fellowship Award

1999 - 2004 Leukemia & Lymphoma Society Scholarship Award

B. Publications: 1. Zhu, L. and Weller, S.K. (1988) UL5, A protein required for HSV DNA synthesis: genetic analysis,

overexpression in Escherichia Coli, and generation of polyclonal antibodies. Virology 166:366-378. 2. Weller, S.K., Carmichael, E.P., Goldstein, D.J. and Zhu, L. (1988) Use of host range mutants to identify

genes involved in DNA replication of herpes simplex virus. CANCER CELLS 6/ Eucaryotic DNA Replication. Cold Spring Harbor Laboratory Press, New York.

3. Crute, J.J., Tsurumi, T., Zhu, L., Weller, S.K., Olivo, P.O., Challberg, M.D., Mocarski, E.S., and Lehman, I.R. (1989) Herpes simplex virus 1 helicase-primase: A complex of three herpes-encoded gene products. Proc. Natl. Aca'd. Sci. USA 86:2186-2189.

4. Zm~, L. and Weller, S.K. (1992) The UL5 gene of herpes simplex virus type 1: Isolation of a LacZ insertion mutant and association of th'e UL5 gene product with other members of the helicase-primase

'. complex. J. Virology 66:458-468. 5. Zhu, L. and Weller, S.K. (1992) The six conserved helicase motifs of the UL5 gene product, a

component of the herpes simplex virus type 1 helicase-primase, are essential for its function. J. Virology 66:469-479.

6. Zhu, L., van den Heuvel, S., Helin, K., Fattaey, A., Ewen, M., Livingston, D., Dyson, N., and Harlow, E. (1993) Inhibition of cell proliferation by p107, a relative of the retinoblastoma protein. Genes Dev. . 7:1111-1125.

7

------

Ochoa, Erin, R. 7. Schneider, J.W., Gu, W., Zhu, L., Mahdavi, V., and Nadal-Ginard, B. (1994) Reversal of terminal

differentiation mediated by p107 in Rb-/- muscle cells. Science 264:1467-1471. 8. Beijersbergen, A.L., Hijmans, EM., Zhu, L. and Bernards, A. (1994) Interaction of c-Myc with the pRb

related protein p107 results in inhibition of c-Myc-mediated transactivation. EMBO J. 13:4080-4086. 9. Beijersbergen, A.L., Kerkhoven, A.M., Zhu, L., Carlee, L., Voorhoeve, P.M. and Bernards, R. (1994)

E2F-4, a new member of the E2F gene family, has oncogenic activity and associates with p1 07 in vivo. Genes Dev. 8:2680-2690.

10. Zhu, L., Enders, G.H., Wu, C-L., Starz, M.A, Moberg, K.H., Lees, J.A., Dyson, N. and Harlow, E (1994) Growth suppression by members of the retinoblastoma protein family. Cold Spring Harbor Symposia on Quantitative Biology 59:75-84.

11. Dagnino, L., Zhu, L., Skorecki, K.L. and Moses, H.L. (1995) E2F-independent transcriptional repression by p107, a member of the retinoblastoma family of proteins. Cell Growth & Diff. 6:191-198.

12. Zhu, L., Enders, G.H., Lees, J.A., Beijersbergen, A.L., Bernards, A. and Harlow, E (1995) The pRBrelated protein p107 contains two growth suppression domains: Independent interactions with E2F and cyclin/cdk complexes. EMBO J. 14:1904-1913.

13. Zhu, L., Harlow, E, and Dynlacht, B.D. (1995) p107 uses a p21 CI P1-related domain to bind cyclin/cdk2 and regulate interactions with E2F. Genes Dev. 9:1740-1752

14. Poma, E.E, Kowalik, T.F., Zhu, L., Sinclair, J.H., and Huang, E-S. (1996) The human cytomegalovirus IE1-72 protein interacts with the cellular p1 07 protein and relieves p1 07-mediated transcriptional repression of an E2F-responsive promoter. J. Virol. 70:7867-7877

15. Dynlacht, B.D., Moberg, K., Lees, J.A, Harlow, E, and Zhu, L. (1997) Specific regulation of E2F family members by cyclin-dependent kinases. Mol. Cell. BioI. 17:3867-3875.

16. Jiang, H., Chou, H., and Zhu, L. (1998) Requirement of cyclin E1Cdk2 inhibition in p16,nk4a-mediated growth suppression. Mol. Cell. BioI. 18:5284-5290

17. Johnson, A.A., Yurochko, A.D., Poma, EE, Zhu, L., Huang, ES. (1999) Domain mapping of the human cytomegalovirus IE1-72 and cellular p107 protein-protein interaction and the possible functional consequences. J. Gen. Virol. 80:1293-1303

18. Guida, P., and Zhu, L. (1999) DP1 phosphorylation in multimeric complexes: weaker interaction with cyclin A through the E2F cyclin A binding domain leads to more efficient phosphorylation than stronger interaction through the p1 07 cyclin A binding domain. Biochem. Biophys. Res. Commun. 258:596-604

19. Oren, R., Dabeva, M.D., Kamezis, AN., Petkov, P.M., Rosencrantz, R., Sandhu, J.P., Moss, S.F., Wang, S., Hurston, E, Laconi, E, Holt, P.R., Thung, S.N., Zhu, L., and Shafritz, D.A. (1999) Role of thyroid hormone in stimUlating liver repopluation in the rat by transplanted hepatocytes. Hepatology 30:903-913.

20. Jiang, H., Karnezis, AN., Tao, M., Guida, P., and Zhu, L. (2000) pRB and p107 have distinct effects when expressed in pRB-deficient tumor cells at physiologically relevant levels. Oncogene 19:38783887.

21. Razani, B., Altschuler, Y., Zhu, L., Pestell, A.G., Mostov, K.E, and Lisanti, M.P. (2000) Caveolin-1 expression is down-regulated in cells transformed by the human papilloma virus in a p53-cfependent manner: Replacement of caveolin-1 expression suppresses HPV-mediated cell transformation. Biochemistry, 39:13916-13924.

22. Zhu, L., and Skoultchi, AI. (2001) Coordinating Cell Proliferation And Differentiation. Curro Opinion in Genetics & Development. 11 :91-97.

23. Karnezis, AN., Dorokhov, M., Grompe, M. and Zhu, L. (2001) Loss of p27Kip1 enhances the transplantation efficiency of hepatocytes transferred into diseased livers. J. Clin. Invest. 108:383-390. (See Commentary on pages 367-369, Advances in hepatocyte transplantation: a myth becomes reality.)

24. Galbiati, F., Volonte, D., Liu, J., C~pozza, F., Frank, P.G., Zhu, L., Pestell, R.G., Lisanti, M.P. (200' Caveolin-1 expression negatively 'regulates cell cycle progression by inducing GO/G1 arrest via p53/p21wAF1lCiPl-dependent mechanism. Mol. BioI. Cell 12:2.229-2244.

25. Zhang, Z.-K., Davies, K.P., Allen, J., Zhu, L., Pestell, RG., Zagzag, D., and Kalpana, G.V. Cell cycle arre and repression of cyclin D1 transcription by INI1/hSNF5. Mol. Cell. BioI. 22:5975-5988 (2002)

,"

8 ------~-~-

Principallnvestigator/Program Director (Last, first, middle):Ochoa, Erin R.


Follow the sample format for each person. DO NOT EXCEED FOUR PAGES.

NOTE: The BIOgraphIcal Sketch may not exceed four pages. Items A and B may not exceed 2 of the 4-page limit.

NAME POSITION TITLE David A. Shafritz Professor of Medicine, Cell Biology and Pathology

EDUCATIONITRAINING (Begin with baccafaureate or other initiaf professionaf education, such as nursing, and incfude postdoctoral training.)

INSTITUTION AND LOCATION DEGREE YEAR(s) FIELD OF STUDY (if applicable)

University of Pennsylvania A.B. 62 Chemistry (Honors) University of Pennsylvania School of Medicine M.D. 66 Medicine

University of Pennsylvania Graduate School 62-64 Molecular Biology

. . A. Positions and Honors. List in chronological order previous positions, concluding with your present position. List any honors. Include present membership on any Federal Government public advisory committee. RESEARCH AND PROFESSIONAL EXPERIENCE: 1966 - 1968 Intern, Resident in Internal Medicine, University ofMaryland Hospital, Baltimore, MD 1968 - 1969 Research Associate, Nlli NHI Laboratory of Clinical Biochemistry 1969 - 1971 Research Associate, Nlli NHLI, Molecular Disease Branch 1971 - 1973 Instructor in Medicine, Harvard Medical School, Boston, MA 1971 - 1973 Clinical and Research Fellow in Medicine, Massachusetts General Hospital, Boston, MA 1973 - .Assistant Professor ofMedicine, Harvard Medical School, Boston, MA 1973 - 1976 Assistant Professor of Medicine, Albert Einstein College of Medicine, Bronx, NY 1976 - 1981 Associate Professor ofMedicine and Cell Biology, Albert Einstein College of Medicine, Bronx, NY 6/77 - 9/77 Visiting Scientist, Dept. ofVirology, The Weizmann Institute, Rehovot, Israel 7/81' - Pres.· Professor ofMedicine and Cell Biology, Albert Einstein College ofMedicine, Bronx, NY 7/82 - Pres. Chief, Molecular Hepatology Unit, Albert Einstein College ofMedicine, Bronx, NY 1/85 - Pres. Director, Marion Bessin Liver Research Center, Albert Einstein College ofMedicine, Bronx, NY 1993 - 1994 Visiting Professor, Dept. of Genetics, University ofPennsylvania, Philadelphia, PA 9/96 - Pres. Professor of Medicine, Cell Biology and Pathology, Albert Einstein College ofMedicine, Bronx, NY HONORS AND AWARDS: Phi Beta Kappa (1961); Distinction, University of Pennsylvania (1959,1961,1962); Merck Award in Chemistry (1962); Morton McClutcheon Memorial Research Prize, Univ. of Pennsylvania School of Medicine (1966); NIAMDD Special Research Fellowship AM-46865 (1971-1973); Nlli, RCDA (1975-1980); Irma T. HirschI Scientist Award (1974-1979); AASLD Merrill Lecturer, 1978; Showcase of Clinical Research and National Health Policy Forum (1980); Julius Friedenwald Memorial Lecture, University of Maryland, 1983. Lecturer, Frontiers in Cancer Research, American Cancer Society Series honoring Mary Lasker, 1984; Visiting Prof., Univ. of Michigan, 1985; Grace Kimball Memorial Lecture, Wilkes College, 1987; James Gibson Lecture, Centennial Celebration, Univ. of Hong Kong, 1987; Herman Lopata Prof. of Liver Dis. Res, (Endowed Chair), Albert Einstein College of Medicine, 1992; ,NIDDK Merit Award, 1994; Isador Held Memorial Lecture, Beth Israel Medical Center, New York, 1999; President, Interurban Clinical Club, 1999-2000; American Liver Foundation Distinguished Scientific Achievement Award, 2000. B. Selected peer-reViewed publications (in chronological order). Do not include publications submitted or in preparation. (Selected from 176 publications, reviews and book chapters) 1. Shafritz, D.A. and Kew, M. Identification of integrated hepatitis B virus DNA sequences in human hepatocellular

carcinomas. Hepatology 1: 1-8, 1981. 2. Ruiz-Opazo, N" Chakraborty, P.R and Shafritz, D.A Evidence for supercoiled hepatitis B virus DNA molecules in

chimpanzee liver and in concentrated serum Dane particles: Possible implications in persistent HBV infection. Cell 29:129-138, 1982.

3. RogIer, C.E., Sherman, M., Shafritz, D.A, Summers, J., Kew, M.C., Henderson, A and Shows, T.R: Deletion of cellular DNA sequences at chromosome llp13-11pI4 associated with HBV integration: Science 230:319-~2~, 1985. .

4. Panduro-Cerda, A, Shalaby, F., Weiner, F.R, Biempica, L., Zern, M.A and Shafritz, D.A: TranscnptlOnal SWItch from albumin to alpha-fetoprotein and changes in transcription of other genes during carbon tetrachloride induced liver regeneration. Biochemistry 25:1414-1420, 1986.

5. Tur-Kaspa, R., Burk, RD., Shaul, Y. and Shafritz, D.A: Hepatitis B Virus DNA contains a glucocorticoid responsive enhancer element. PNAS 83:1627-1631, 1986.

6. Tur-Kaspa, R., Teicher, ~ Levine, Rl, Skoultchi, AI. and Shafritz, D.A: Use of electroporation to introduce biologically active foreign genes into primary rat hepatocytes. Molec. Cell..B~o1. 2.:716-718, 1986.. .

7. Panduro, A, Shalaby, F. and Shafritz, D.A.: Changing patterns of transcnptlOnal and post-transcnptlOnal control of liver-specific gene expression during rat development. Genes and Development 1:1172-1182, 1987.

PHS 39812590 (Rev. 05/01) Page ~ "" ••_1.. .0 ~.h.-t~ o' tl.. I.nttnTTt tl.mllohnllt t~ gnnlir."tin~ On nntuse..suffixes such as 3a•.3b.

---------

Principallnvestigalor/Program Director (Last, first, middle):Ochoa, Erin R. 8. Saber, M.A, Novikoff, P.M. and Shafritz, D.A: Albumin and collagen mRNA expression in normal and

analbuminemic rodent liver: Analysis by in situ hybridization using biotinylated probes. J. Histochem. Cytoi. 38:199-207, 1990.

9. Shalaby, F. and Shafritz, D.A. Exon skipping during splicing of albumin rnRNA precursors in Nagase analbuminemic rats. PNAS (USA) 87:2652-2656, 1990.

10. Gupta, S., Chowdhury, N.R, Jagtiani, R, Gustin, K., Aragona, E., Shafritz, D.A., Chowdhury, lR. and Burk, RD. A novel system for transplantation of isolated hepatocytes utilizing HBsAg producing transgenic donor cells. Transplantation 50:472-475, 1990.

11. Wu, G.Y., Wilson, J.M., Shalaby, F., Grossman, M., Shafritz, D.A and Wu, C.H.: Receptor-mediated gene delivery in vivo: Partial correction of analbuminemia in Nagase rats. J. BioI. Chern. 266:14338-14342, 1991.

12. Gupta, S., LaBrecque, D.R and Shafritz, D.A: Mitogenic effects of hepatic stimulator substance on cultured nonparenchymalliver epithelial cells. Hepatology 1.1:485-491, 1992.

13. Pietrangelo, A, Panduro, A, Roy Chowdhury, J. and Shafritz, D.A: Albumin gene expression is down-regulated by albumin or macromolecule infusion in the rat. J. Clint Invest. 89: 1755-1760, 1992.

14. Alpini, G., Aragona, E., Dabeva, M., Salvi, R, Shafritz, D.A and Tavoloni, N. Distribution of albumin and alphafetoprotein mRNAs in normal, hyperplastic and preneoplastic rat liver. Am. 1. Path. 141 :623-632, 1992.

15. Gupta, S., Vemuru, R.P., Yemeni, P.R., Roy Chowdhury, N., Jagtiani, RK., Shafritz, D.A, Burk, RD. and Roy Chowdhury, J. Hepatocyte transplantation: Prolonged survival following ex vivo manipulation and release from culture matrix components. Transplantation Proceedings 2:21-32, 1993.

16. Dabeva, M.D. and Shafritz, D.A. Activation, proliferation and differentiation of progenitor cells into hepatocytes in the D-galactosamine model ofliver regeneration. Am. 1. Pathoi. 143:1606-1620, 1993.

17. Dabeva, M.D., Alpini, G., Hurston, E. and Shafritz, D.A Models for hepatic progenitor cell activation. Proc. Soc. Exp. BioI. and Med. 204:242-252, 1993.

18. Pietrangelo, A and Shafritz, D.A. Homeostatic regulation of hepatocyte transcription factor (HNF-l) expression in cultured hepatoma cells. Proc. Nati. Acad. ScL, USA, 91:182-186, 1994.

19. Gupta, S., Alpini, G., Vemuru, R.P., Hurston, E. and Shafritz, D.A Butyrate synchronization of hepatocytes: Modulation of cycling and cell cycle regulated gene expression. Growth Factors 10:171-180, 1994.

20. Burk, RD., Hwang, L.-Y., Ho, G.Y.F., Shafritz, D.A and Beasley, R.P. Outcome of perinatal hepatitis B virus exposure is dependent on maternal viral load. 1. Inf. Dis. 170:1418-1423, 1994.

21. Dabeva, M.D., Hurston, E. and Shafritz, D.A Transcription factor and liver-specific rnRNA expression in facultative progenitor cells ofliver and pancreas. Am. 1. PathoI., 147:1633-1648, 1995.

22. Aragona, E., Burk, RD., Ott, M., Shafritz, D.A and Gupta, S. Cell-type specific mechanisms regulate hepatitis B virus transgene expression in liver and other organs. J. Pathoi. 180:441-449, 1996.

23. Dabeva, M.D., Hwang, S-G., Vasa, S.R.G., Hurston, E., Novikoff, P.M., Hixson, D.C., Gupta, S. and Shafritz, D.A -Differentiation of pancreatic epithelial progenitor cells into hepatocytes following transplantati<.>n into rat liver. Proc. Nati. Acad. Sci. USA 94:7356-7361, 1997.

24. Laconi, E., Oren, R, Mukhopadhyay, D.K., Hurston, E., Laconi, S., Pani, P., Dabeva, M.D. and Shafritz, D.A Long term, near total liver replacement by transplantation of isolated hepatocytes in rats treated with retrorsine. Am. J. Pathol. 153:319-329, 1998.

25. Dabeva, M.D., Laconi, E., Oren, R., Petkov, P.M., Hurston, E. and Shafritz, D.A Liver regeneration and 0.

fetoprotein mRNA expression in the retrorsine model for hepatocyte transplantation. Cancer Res. 58:5825-5834, 1998. .

26. Oren, R, Dabeva, M.D., Petkov, P.M., Hurston, E., Laconi, E. and Shafritz, D.A Restoration of serum albumin levels in nagase analbuminemic rats by hepatocyte transplantation. Hepatology 29:75-81, 1999.

27. Ott, M., Rajvanshi, P., Sokhi, R.P., Alpini, G., Aragona, E., Dabeva, M., Shafritz, D.A and Gupta, S. Differentiationspecific regulation of transgene expression in a .diploid epithelial cell line derived from the normal F344 rat liver. J. Pathol. 187:365-373, 1999.

28. Laconi, E., Laconi, S., Pillai, S., Scintu, F., Curreli, F., Shafritz, D.A and Pani, P. Direct hyperplasia does not enhance liver repopulation in a new model of hepatocyte transplantation in the rat. J. Hepatoi. Jl:354-359, 1999.

29. Oren, R, Dabeva, M.D., Kamezis, AN., Petkov, P.M., Rosencrantz, R., Sandhu, J.P., Moss, S.F., Wang, S., Hurston, E., Laconi, E., Holt, P.R, Thung, S.N., Zhu, L. and Shafritz, D.A Role of thyroid hormone in stimulating liver repopulation by transplanted hepatocytes. Hepatology 30:903-913, 1999.

30. Dabeva, M.D., Petkov, P.M., SandhU, J., Oren, R., Laconi, E., Hurston, E. and Shafritz, D.A Proliferation and differentiation of fetal liver epithelial progenitor cells after transplantation into adult rat liver. Am. J. Pathoi. 156:2017-2031,2000. '.

31. Petkov, P.M., Kim, K., Sandhu, J., Shafritz, D.A and Dabeva, M.D. Identification of differentially expressed genes in fetal rat liver. Genornics 68:197-209, 2000.

32. Laconi, S., Pillai, S., Porcu, P.P., Shafritz, D.A, Pani, P. and Laconi, E. Massive liver replacement by transplanted hepatocytes in the absence of exogenous growth stimuli in rats treated with retrorsine. Am. J. Pathoi. 158:771-777, 2001. .

33. SandhU, 1.S., Petkov, P.M., Dabeva, M.D. and Shafritz, D.A Stem cell properties and repopulation of the rat lIver by fetal liver epithelial progenitor cells. Am. 1. Pathol. 159:1323-1334,2001. . .. . .

34. Shafritz, D.A and Dabeva, M.D. Liver stem cells and model systems for liver repopulation. InVlted ReVlew, J. Hepatol. 36:552-564, 2002.

PHS 398/2590 (Rev. 05/01) Page 10 ...1.._10- .......... "n=N'~ItiVl'jvat the bottom throughout the application.-.J)o not use sufl'ix_es ~uch as 3a,3b.

Principallnvestigator/Program Director (Last, first, middle):Ochoa, Erin R.

OTHER SUPPORT

SHAFRITZ, DAYID A.

ACTNE

5 ROl DK 56496-04(Shafritz) 9/1/99 - 6/30/04 16% NIH, NIDDK $205,728 A New Model For Somatic Gene Therapy Using the Liver

This grant will transduce primary hepatocytes, hepatocyte progenitor cells and fetal hepatoblasts in culture and then transplant the transduced cells into various rat models to achieve ex vivo gene therapy. Studies will be conducted with both demonstration marker genes, GFP and B-gal, and the Wilson's Disease gene ATP7B.

5 P30 DK 41296-14 (Shamtz) 8/1/99 - 5/31/04 25% NIH, NIDDK $598,653 Liver Pathobiology and Gene Therapy Research Core Center

A Digestive Diseases Liver Research Core Center grant, which supports and assists 38 Liver Center Investigators to conduct collaborative, interdisciplinary research projects related to Liver Drs'eases'. _.. . .,-. -

2 ROI DK17609-29 (Shamtz) 12/1/02-11/30/07 35% NllI, NIDDK $275,173 Protein Synthesis in Nonnal and Regenerating Liver

The goal of this project is to study molecular mechanisms regulating gene expression in the liver.

I ROl DK5932l-01A1 (Dabeva) 9/1/02-6/30/07 10% NlliINIDDK $221,625 Gene Expression Pattern of Liver Stem/Progenitor Cells

The goal of this project is to study the gene expression profile of liver stem/progenitor cells from fetal rat liver using cDNA microarray technology. Markers specific for these cells will be isolated and used for identification of liver stem/progenitor cells. The function ofspecific growth factors/cytokines and extracellular matrix proteins induced in early fetal liver will be studied.

, PENDING \

\NONE

OVERLAP NONE

PHS 39812590 (Rev. 05/01) Page 11


RESOURCES FACILITIES: Specify the facilities to be used for the conduct of the proposed research. Indicate the performance sites and describe capacities, pertinent capabilities, relative proximity, and extent of availability to the project. Under Other, identify support services such as machine shop, electronics shop, and specify the extent to which they will be available to the project Use continuation pages if necessary.

Laboratory:

The PI's laboratory is newly renovated and has seven full-size work benches with attached desks, and common benches for electrophoresis and common equipment. We have a separate tissue culture room adjoining the main lab. Big-item equipment and support personnel are located either on the same floor or one floor above us.

Clinical:

N/A

Animal:

A centrally administered animal facility is proximal to our lab. All animal care and services are provided by a trained and experienced staff including 3 full-time veterinarians. The animal care and use program is ccredited by AAALAC, has been approved by NIH-OPRR, and is inspected by USDA-APHIS.

Computer:

We have three personal computers in the lab with two attached printers. All computers are connected to the School Alnet system from which we have access to a variety of information sources inclUding the internet, Medline, and Protein and DNA data bases.

Office:

The PI has a office in the Department of Pathology with computer and access to the school network.

Other:

The Department has a on-site machine and electronics shop managed by a full time technician. This ensures that all the equipment is operational at all the time. The library is conveniently located and carries all pertinent journals. Several organized scientific meetings and journal clubs provide a stimulating opportunity to discuss ongoing projects with others and to review the current literature.

MAJOR EQUIPMENT: List the most important equipment items already available for this project, noting the location and pertinent capabilities of each.'

Tissue culture hoods and incubators (both main laboratory and animal facility). Beckman centrifuge in the main laboratory. Thermocycler, Electroporation, Zeiss inverted microscope in the main laboratory.

, \,

+ Pr.!S398 (Rev. 05/01L __ Page 13 Resources Format Page +---'--"""'-=""'== -----

Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R.

3. The Candidate

a. The Candidate's Background I am a graduate of Emory University and the Emory University School ofMedicine in Atlanta, Georgia.

After medical school I entered the Pathology residency training program at the Massachusetts General Hospital in Boston. For five years I trained in all areas of Clinical and Anatomic Pathology, with an emphasis on gastrointestinal and hepatopathology. My mentors at MGH I included: Dr. Robert Colvin, Chainnan of the Dept. of Pathology and Principal Investigator in renal pathology; Dr. Atul Bhan, Professor of Surgical Pathology and PI in hepatopathology; and Dr. Carolyn Compton, Professor and Director of gastro-intestinal pathology. After completing my residency training, I remained at MGH as a graduate assistant in Pathology and research fellow in the Department of Surgery.

I am now board certified in Anatomic and Clinical Pathology and an Assistant Professor ofPathology at the Albert Einstein School ofMedicine, with full staff salary and 25% clinical responsibilities at Montefiore Medical Center in the Bronx. I was hired in January 2002 with the condition that I would be given 75% protected time to carry out a research project under my choice ofPrincipal Investigators at the Marion Bessin Liver Research Center. After careful consideration, I decided that Dr. Liang Zhu, Associate Professor of Developmental and Molecular Biology at ABCOM, would be the best mentor for me. Doctor Zhu trained under Professor Ed Harlow at MGH (although we did not meet when I was there). He has extensive experience studying regulators of eukaryotic cell cycle, including the retinoblastoma protein family, the cyclin-dependent kinase inhibitor p16ink4, and p27kipl. Given his intense, hands-on oversight, and strong emphasis on rigorous basic science, I have designed this project to deepen my understanding of the biochemical processes underlying hepatocyte proliferation. With the full backing and confidence ofmy Institution, Dr. Zhu will transform me from an experienced gastro-intestinal pathologist into an independent researcher.

b. Career Goals and Objectives: Scientific Biography I distinguish three complimentary aspects ofmy scientific career: clinical work, research, and teaching.

All three ofthese activities are focused upon deepening my understanding of the processes underlying hepatocyte proliferation, and translating that understanding into clinical benefits.

Clinical experience. My clinical responsibilities at Montefiore now occupy 25% ofmy time. I spend approximately one day

per week signing out gastrointestinal, pancreatic and hepatic surgical specimens. Montefiore is a teaching hospital with a medium specimen load, giving me ample time to thoroughly study my cases. In the past year I have signed out approximately 4000 surgical specimens and 6 autopsies. My time at MGH was considerably more intense. During residency training I examined over 17,000 surgical specimens performed 61 autopsies, and rotated through all Clinical Pathology labs. As a result, I now have a highly trained eye for tissue morphology and thorough understanding of the pathological basis ofdisease, which can only come from years of high volume specimen analysis under the guidance of some of the best pathologists in the world.

Research experience. My research has been directed toward a multi-faceted understanding ofhepatocyte proliferation and

hepatogenesis. I took a post-sophomore year fellowship at the Dept. ofPathology at Tulane University in 1995. Under Dr. Michael Gerber, I performed a morphometric and immunohistochemical characterization ofhuman liver regeneration, which I presented to a plenary session of the American AssoCiation for the Study ofLiver Disease, and published in the American Journal ofPathology.

At MGH, I perfonned in situ and whole mount mouse liver hybridization studies, investigated clinical applications ofconfocal reflectance microscopy to the rapid inter-operative diagnosis ofliver specimens, and spent two years stUdying the morphology of a range of tissue engineered constructs, including liver, intestine, - _. -,:~

Continuation Format Page ...PHS 39812590 (Rev. 05101) Page 14


and cartilage. My experience in Tissue Engineering led to numerous middle author publications and several review articles. I gave hepatopathology poster presentations at meetings of the Materials Research Society, the AASLD, and the Nlli-sponsored Lymphatic Continuum

Most importantly, my experience in the field ofTissue Engineering made me realize that to pursue my research interests I would have to begin again at a much more basic level, studying the molecular biology of the liver and basic research techniques with an experienced investigator. My principle reason for taking my current position at Albert Einstein was that I would be given protected time to develop just such a project under my choice ofmentors at the Lever Center.

Teaching experience. I take a broad interpretation ofmy vocation as a medical educator. To begin with, I have a great deal of

traditional experience in teaching both undergraduates and graduate students in the sciences. While at MGH I trained a series of 4 MIT and Harvard Medical School students in laboratory techniques. I take some credit for directing one ofmy trainees to the Pathology residency program at Brigham and Women's Hospital, and another to an interterdisciplinary bio-medical engineering graduate program at U.C. Berkeley.

For four years I lectured at the Harvard Medical School and Northeastern Uhiversity, as well as acted as director of the Pathology core course at HMS. Course lecture topics included: Clinical Pathology; Gastrointestinal, Pancreatic, and Hepatobiliary Pathophysiology; Endocrine Pathophysiology; and Cellular and Molecular Pathology and Immunopathology.

MGH placed a strong emphasis on residents and fellows teaching each other through one-on-one interaction, as well as frequent s~minar presentations. As a resident and fellow I gave invited presentations at the Molecular Pathology Joumal Club, MGH Surgical Grand Rounds, CIMIT (Center for Innovative Minimally Invasive Therapy), Medical Gastroenterology Fellow Seminar, Medical Hepatology Fellow Seminar, and the Surgical Pathology Slide Conference, and the Laboratory Medicine Conference. I am involved in similar residency training in my new position at Montefiore and AECOM.

Less traditionally, I recognize a responsibility to educate lay people and also to take serious the institutional aspects of scientific training. At MGH I was compelled to advocate the Women's Breastfeeding Center, and provide medical advice through an on-line women's resource center. At Monteflore, I have begun a popular weight loss and obesity awareness program based upon USDA and CDC reports. For the last two years I have served on a committee for the College of American Pathologists, whose main product is a series of teleconference seminars dealing with laboratory management issues. Also through the CAP, I have been a radio spokesperson, and am being trained as the CAP liaison to Congressman Elliot Engel. I made an appearance on a March 2001 Learning Channel presentation entitled: "Superhuman Body, The Future of Medicine: SelfRepair". My most challenging teaching project was co-chairing a committee which comprehensively re-wrote and fully implemented a new Pathology residency curriculum at MGH.

My training has made me extremely adaptive and goal-oriented. Now that I am a board certified pathologist and Assistant Professor at AEGOM, my clinical and teaching skills are well established. It is now time to dedicate the greatest part ofmy attcintion to learning how to conduct basic research. My current position has given me the resources and support to make a fresh start, studying the same phenomena which have, '. occupied my entire career, but from a perspective which is oriented by basic scientific issues. Developing a new perspective with new techniques is what I do best. 'My new education, under the guidance ofDr. Zhu, will transfonn me into an independent researcher, with a powerful combination of clinical experience and rigorous basic science training.

Continuation Format Page Page 15PHS 398/2590 (Rev. 05/01)


c. Career Development Activities During Award Period

Mentors. The most important component ofmy developmental plan for the next five years is daily interaction

with Dr. Liang Zhu. He is an extremely talented researcher and focused teacher. Aside from closely overseeing my experiments, Dr. Zhu gives detailed critiques ofmy lab book in one-on-one sessions, makes sure that I keep up with pertinent publications, ruthlessly edits my research proposals, and is available for consultation around the clock. Dr. Shafritz is the Director of the Liver Center and has ongoing projects studying liver transplantation models, lentivirus vectors, and hepatic progenitor cells. Drs. Zhu and Shafritz also have an ongoing study of the proliferative capacity of fetal stem cells isolated from embryonal day 14 ofp27 knockout mice. Dr. Shafritz will meet formally with me to review my progress, and the proximity of their labs will make him readily available for consultation. This summer Dr. Antonia Follenzi from Dr. Luigi Naldini's lab (an expert in lentivirus vectors) will be joining the Liver Center. Dr. Follenzi collaborated on the development of the lentivirus vector that we will be using in this project, and has agreed to make herself available for consultation and collaboration with our neighboring lab.

Laboratory environment. Dr. Zhu's laboratory employs 5 graduate students and one postdoctoral fellow studying various cell

. cycle regulators. We meet as a group once per week to present our work and foster discussion. Our laboratory is located within AECOM's Marion Bessin Liver Research Center, which is a NIDDK-funded facility housing four core research facilities, and 38 Principal Investigators representing 12 departments of the Medical SchooL The Liver Center has an active education program featuring research seminars, visiting scientists, pathobiology sessions and work-in-progress discussion groups. Through the Liver Center I have regular interaction with such experienced investigators as Drs. Roy Chowdhury, Sanjeev Gupta, and my co-sponsor, David Shafritz. ill addition to the Liver Center facilities, I have access to resources at the Albert Einstein Cancer Center. These include a core mouse transgenic facility with outstanding expertise.

Coursework. While at MGH, I completed a Collaborative IRB Training Initiative (CIT!) which covered research

integrity and misconduct, peer review/ownership/conflicts of interest, protection ofhuman subjects in research education, radiation fire safety, blood borne pathogens, and animal care and handling. I also took several intensive courses in current techniques in Molecular Biology, which included seminars on nucleic acid analysis, protein expression and antibodies, protein imaging, cloning and gene expression, PCR applications, gene

J transfer and viral vectors, transgenic and knockout animals, site directed mutagenesis, yeast two-hybrid , \I analysis, GI model systems, human genomic analysis, DNA microarray technologies, and the use ofmolecular ~,:y biology software. I also took an intensive course in Clinical Biostatistics, which included seminars on the study

~ ~ design and data presentation, summarizing data, probability, confidence intervals and hypothesis tests, I,~ estimating and comparing means and proportions, methods for analyzing data, and clinical decision making.

'\ '\I Through Einstein I will take a mouse genetics course and an annual course on the responsible conduct of ,~ \ /esearch.

.trNew research skills and concepts. ' ,}- The current project will give me a host of new laboratory techniques including: cloning ere-mediated ~ knockout mice, RNAi, lentivirus vectors, hepatocyte transplantation techniques, FAH and HBV mouse models, , and numerous new assays. Much more important, I will receive a thorough education in the biochemistry of the

liver, and training in developing hypothesis-driven basic research proposals. This project is ideally suited to giving me precisely the sort ofexperience I need to pursue a career as an independent researcher. I fully expect that after five years with Dr. Zhu I will publish significant p27 results and will write my first ROI proposal in . the fourth year of this project at the latest "

Page 16 Continuation Format Page PHS 39812590 (Rev. 05/01)

Ochoa, Erin R.

Albert Einstein College of Medicine of Yeshiva University Jack and Pearl Resnick Campus 1300 Morris Park Avenue, Bronx, NY 10461

Liang Zhu, M.D., Ph.D. Dept. ofDevelopmental and Molecular Biology

Phone: (718) 430-3320/ Fax: (718) 430-8975 email: [email protected]

Center for Scientific Review National Institutes of Health Suite 1040 6701 Rockledge Drive MSC 7710 Bethesda MD 20892-7710

January 30, 2003

Dear reviewers,

I am writing with great enthusiasm to support Dr. Erin Ochoa's K08 application by providing you with rather detailed information to assist you in your evaluatiOn.

Dr. Ochoa and I started discussing her research career development when she was interviewing for the current position at Einstein. We kept our discussion and in September of 2002 she joined my laboratory with a 75% protected research time commitment from her Pathology Department Chair Dr. Mike Prystowski.

Potential to become an independent physician-scientist As demonstrated in her CV, Dr. Ochoa has developed a strong interest in research since her

medical school years. It is certainly impressive that she had two fIrst-author research publications as a medical student (not a MSTP trainee). In her resident years at MGH, she continued to participate in basic research as much as she could as a resident. Due to the nature of her status as a resident, she however did not have the opportunity to conduct full time research. She nevertheless coauthored numerous publications, meeting abstracts, and review articles during that period. Her appointment at the current position was also negotiated to include 75% protected time for research. This pattern of her career development is consistent with efforts by a highly committed physicianscientist.

Another important feature of Dr. Ochoa's career development is that she has had developed and maintained strong and sustained interests in liver research since the beginning, both clinically as now a specialized liver pathologist and in her basic research (evidenced by her research publications and the current grant application). I believe this heralds well for an independent physician-scientist with an uncommon edge of performing liver translational research, which, in turn, will more effectively propel her research and clinical career development at the same time.

Perhaps the most important and promising sign at this stage of her career development is that she has already developed an independent analysis capability, which is indeed uncommon for research trainees at this level and certainly ofpredictive value in assessing her potential to becoming an independent physician-scientist in the near future. She is very good at literature searches and very well read. She has initiated discussions with almost all the investigators at the Albert Einstein Liver Research Center, which covers almost all aspects of liver research, to ensure that her knowledge base is the most uP-t9-date. She actively participates in the Liver Center seminars and journal clubs and asks critical questions. She also initiates communications with various leaders in the field to discuss her research plan. She then digests the input with her own research interests and comes up with very well organized research ideas and plans, which she very effectively presents in the lab meetings and various discussions.

I therefore fmnly believe that Dr. Ochoa has strong potential to becoming an independent physician-scientist in liver research, given the essential support of this K08 career development

~--

Ochoa, Erin R.

award. Below, I will describe in detail the various aspects of training planed for her under the K08 mechanism.

Time commitment Dr. Ochoa currently holds an assistant professor position as a pathologist in the affiliated

Montefiore Medical Center. In this position, she is guaranteed to spend 75% effort on basic laboratory research in my lab, as assured by the letter from her Chairman Dr. Prystowsky. This 75%-effort protected research time does not include any teaching, committee, administrative, or consultation responsibilities. Dr. Ochoa spends the other 25% effort in the pathology lab at the Montefiore Medical Center performing her clinical duties and teaching pathology residents. Due to the nature of her pathology practice (specialty in the liver), Dr. Ochoa is able to be flexible in her clinical time. This affords her a great advantage in planning experiments in the lab. In the Montefiore pathology lab, Dr. Ochoa is also able to facilitate the pathology work on her research samples.

Research plan I was trained in biochemical and molecular systems to study basic regulatory mechanisms

of cell proliferation by cell cycle regulators. A few years back, I decided to invest in applying the basic cell cycle knowledge to more specific types of cells with unique biological and clinical importance. I have developed an intense interest in hepatocytes, due to its regenerative ability, amenability to various experimental approaches, and close relation to clinical medicine. Based on the biochemical and physiological functions of the cyclin-dependent kinase inhibitor p27Kipl, I hypothesized that targeting p27Kipl may benefit cell-based therapies in which appropriate proliferation is important, such as hepatocyte transplantation. In 2001, we published our results demonstrating the improved ability of hepatocytes from p27 knockout mice to proliferate after transplantation and to rescue the hosts in the FAH liver failure model. This beneficial effect ofp27 inactivation has also been seen in bone marrow transplantation experiments. A few other reports in

.. the recent literature further demonstrated the potential of promoting appropriate cell proliferation for clinical benefits. Taken together, I believe that appropriate stimulation of cell proliferation by targeting cell cycle regulators is a novel concept that merits further study.

Dr. Ochoajoined my lab at a time when my liver research presents both ample opportunities to train within the general bounds of my interests and to branch out, armed with the training obtained in my lab, with her own more clinically oriented interests. We both agreed that this was indeed the basis for her training in my lab. Below, I describe three key aspects of her research training.

Our fmding that hepatocytes from p27 knockout mice have better proliferation capacity raises a number of mandatory questions. We must use more clinically relevant approaches to inactivate p27 to determine the roles of p27 in hepatocyte proliferation ai:J.d to better assess the clinical potentials of our novel concept. Dr. Ochoa has proposed a number of new methods to inactivate p27, including the Cre-LoxP mediated hepatocyte-specific and timed p27 knockout, hepatocyte-specific and controlled expression of Skp2 to target p27 for degradation, and hepatocyte-specific and controlled expression of siRNA to knockdown p27. She has established collaboration with Dr. Kiyokawa to use his p2710xllox mice and Dr. Ochoa has made solid progress in the generation of Skp2 transgenic mice and siRNA to p27 (as she describes in the application). The establishment of these mouse lines will provide essential reagents to study the roles of p27 in hepatocytes and provide Dr. Ochoa the most current mouse genetics skills. The use of these newly established hepatocytes in transplantation studies will reveal whether inactivation of p27 through methods other than germline knockout will provide clinical benefits as seen with hepatocytes isolated from the original p27 knockout mice. These studies will provide Dr. Ochoa with intense training she needs to become a bona fide liver researcher, a personal career goal since her medical school years. The completion of these studies will generate at least two full research publications on the effects of inactivating p27 in various stages of hepatocyte development with various techniques.

One concern about the use of p27 inactivation to improve hepatocyte transplantation success is the associated tumor risk. In all the published studi~s, inactivation of p27 has not led to

,.

18 -

------------

Ochoa, Erin R.

the increase in liver tumor frequency, suggesting that p27 is not a tumor suppressor in the liver. However, we believe that tumor risks of p27 inactivation must be more carefully studied to provide a more thorough experimental basis for our novel concept. Dr. Ochoa proposed to determine the roles of p27 in the Alb-HBV HCC model. The course of tumor development in this model has been well established and damage-induced hepatocyte proliferation has been believed to playa key role. Inactivation of p27 in various stages of this HCC model will provide stringent and relevant tests of the risks associated with p27 inactivation. This project will provide Dr. Ochoa with systematic training in mouse liver cancer biology and pathology (as compared with human liver pathology). This is essential for Dr. Ochoa's transition from a liver pathologist to a current liver research experimentalist using animal models. At lease one publication will result from this line of study.

A significant portion of Dr. Ochoa's proposal also takes into consideration of her transition to an independent liver researcher in areas not identical to mine. One specific aspect is her keen interest in developing ex vivo manipulation of p27 in hepatocytes using lentivirus. This approach is clearly the closest to human hepatocyte application, which Dr. Ochoa puts great emphasis throughout the development of her research plan; and which is not within the scope of my liver research plan. In this area, Dr. Ochoa will receive more expert guidance from her co-mentor Dr. David Shafritz, as described in his letter. Dr. Ochoa has also established a collaborative relationship with Dr. A. Follenzi in the lab of Dr. Luigi Naldini, an authority in lentivirus vector development, to ensure immediate access to the most advanced lentivirus constructs. If successful, which we believe is very likely based on the available data in recent literatur~, Dr. Ochoa will effectively become a leader (with at least one high impact publication) in the area ofusing lentivirus-mediated genetic targeting of cell cycle regulators to manipulate hepatocyte proliferation for the improvement of hepatocyte transplantation efficiency.

Interaction with mentors, mentors' labs, the liver research center, and the more general scientific community.

In my lab, I talk to everyone about their experiments on a daily basis. We have weekly lab meetings alternating between work-in-progress and journal-club. Everyone presents work-inprogress once a month and journal club once every two months. I make myself available to everyone at any time to answer questions and discuss various issues. I also perform my own experiments in the lab on a routine basis, facilitating my interaction with the trainees. As a member of the lab, Dr. Ochoa participates in all these activities. I also realize that Dr. Ochoa is different from other trainees in the lab in many ways and adjust my approach to her accordingly. Since she did not have the intense research training as a PhD, I pay particular attention to the many technical details of her experiments. At the same time, I encourage and make use of her extensive knowledge in liver biology and pathology in her experiments. In years 3-5 of her training, I will intentionally foster her independency in experiments, in communications with various reviewers, and in presenting at meetings. In due course, I will also involve her in the many other aspects of . running a lab such as assigning students to her for supervision, managing budgets, and writing her independent grant applications.

I will also involve myself in Dr. Ochoa's various training courses as she describes in her Candidate's plan. I believe that Dr. Ochoa will benefit tremendously in these courses. In particular, Einstein holds an annual NIH-funded mouse genetic course. This intense week-long course is open to scientists nationally and internationally and taught by authoritative figures in mouse genetics. I will make sure Dr. Ochoa has a slot in this course in the fITst year.

Dr. Ochoa's interaction with the co-mentor Dr. David Shafritz is similarly on a regular basis, plus a formally sGheduled monthly one-on-one meeting, which Dr. Shafritz will describe in detail in his letter.

An important environment for Dr. Ochoa outside the mentors' labs is the Einstein Liver Center. My lab is located on the Liver Center floor, ~ording Dr. Ochoa immediate access to all the Liver Center resources (PIs, peers, and various core supports guaranteed by my membership with the Liver Center). Within the Liver Center, Dr. Ochoa participates in the seminar series by outside speakers, weekly journal clubs, and year-end fellow's presentation (in which Dr. Ochoa will have a chance to more formally present her research to audiences from the whole school).

My full membership with the Einstein Cancer Center also guarantees Dr. Ochoa access to core supports of the Cancer Center such as the most advanced mouse transgenic, imaging, and

19

-

Ochoa, Erin R.

flow cytometry technical and scientific resources. For one example, the generation of transgenic mice with Skp2 expression under the control of the tetracycline regulated promoter (as shown in the preliminary studies) was recently performed expediently in the Einstein Mouse Transgenic Core. .

Dr. Ochoa is also participating in the many training activities in the Department of Developmental and Molecular Biology, in which I have my primary appointment, and the Department of Pathology, in which Dr. Ochoa has her primary appointment In my department, Dr. Ochoa participates in the weekly work-in-progress seminars and many department-sponsored seminars by outside speakers. Dr. Ochoa is in charge of the Pathology department seminar series.

As an integral part of her research training, Dr. Ochoa will participate in the annual meetings of AASLD to present her research and communicate with colleagues in the field. In fact, she has been attending this meeting in the past several years. In this past meeting, Dr. Ochoa presented a poster on her confocal reflectance microscopy of the liver and initiated communication with a number of experts in the field.

Mentor lab's research funding My lab is currently funded by three major research grants, an ROI to study the functions of

the tumor suppressor pRE, a DOD to study the pl6-pRB growth control pathway in prostate cancer cells, and an ROI to study the cyclin-dependent kinase inhibitor p27Kipi in hepatocyte proliferation (please see the attached OTHER SUPPORT page). All of these projects follow the common thread of studying mechanisms of cell proliferation regulation with emphases on unique features of various cell types. The project on hepatocyte proliferation regulation by p27KipI provides ample support for the experiments proposed by Dr. Ochoa. Other fimding opportunities are also available. For one example, I have recently declined a three-year grant award from the Roche Organ Transplantation Foundation due to overlap of the aims with my current ROI; but was invited to reapply with newer research materials. Smaller funding opportunities ($20k annual direct cost) are available annually from the Einstein Liver Center that Dr. Ochoa and I are eligible to apply for.

Mentor's training record My postdoc fellow Dr. Hong Jiang recently finished his training with two fITSt author

publications (MCB and Oncogene) and one first author manuscript currently under review. He became a scientist with a startup biotech company. Currently, I have one postdoc fellow in the lab studying cell cycle regulation of prostate cancer cells. Two students have graduated from my lab. Peter Guida (PhD) went to do a postdoc fellowship in the Brookhaven National Laboratory, and Anthony Karnezis (MD, PhD) went to a pathology residency training program at UCSF. I have currently five graduate students in the lab. I have been on the advisory committees for more than 20 graduate students in the past 5 years and for 5 current students.

Based on the above, I whole-heartedly that Dr. Ochoa is an ideal candidate for the K08 award, which will ensure her sucCess in becoming an independent physician-scientist, a career goal that means so much to Dr. Ochoa and that she has worked for with the highest degree of dedication that I personally witnessed as a mentor and a colleague.

Sincererly,

20

Ochoa, Erin R.

ALBERT EINSTEIN COLLEGE OF MEDICINE OFYESmVA UNIVERSITY

JACKAND PEARL RESNICK CAMPUS • 1300 MORRIS PARK AVENUE • BRONX. NEW YORK 10461-1602

MARION BESSIN LIVER RESEARCH CENTER Ullmann Building, Room 625 PHONE: (718) 430-2098

David A. Shafritz. M.D., Director FAX: (718) 430-8975 Professor ofMedicine, Cell Biology and Pathology

TELEX: 7105932106Herman Lopata Professor ofLiver Disease Research

Allan W. Wolkoff, M.D., Associate Director Professor ofMedicine andAnatomy &: Structural Biology

January 30, 2003

Center for Scientific Review National Institutes ofHealth Suite 1040 6701 Rockledge Drive - MSC 7710 Bethesda, MD 20892-7710

Dear Committee Members:

I am. writing this letter as a co-sponsor ofDr. Erin Ochoa's Nffi K08 proposal targeting p27kip1 to improve hepatocyte transplantation.

Dr. Ochoa is working in Dr. Zhu's lab, an Einstein Liver Center Investigator physically located in the liver center space, on understanding the role ofthe kinase inhibitor p27 in hepatocyte proliferation. Dr. Zhu has recently reported that p27 knockout hepatocytes can be used to improve hepatocyte transplantation efficiency. Dr. Ochoa's current proposal includes a number of novel and essential projects to further test the concept that targeting p27 can be used to improve hepatocyte transplantation. My lab has had a long-term interest in the field of hepatocyte transplantation. In the area of cell cycle regulation in hepatocytes, Dr. Zhu and I have had previous and current collaborative projects. The two labs therefore interact extensively.

Dr. Liang Zhu will be Dr. Ochoa's primary sponsor and will supervise her work through daily interaction. Dr. Zhu is an extremely talented, experienced NllI funded researcher, who should have no trouble keeping this project on track and dealing with any obstacles which arise. Dr. Zhu is a hands on supervisor, who spends enormous energy reviewing lab-data, troubleshooting experiments, editing abstracts, papers and proposals, one-on-one with his trainees. Working with Dr. Zhu will give Dr. Ochoa a thorough education in all aspects ofscientific research.

A component ofDr. Ochoa's proposal is on the establishment of lentivirus-mediated ex vivo gene transfer to target p27. I~ave extensive experience in the use oflentivirus to transduce hepatocytes. I have active grant-funded projects, which are closely related to Dr. Ochoa's proposal overall and to the lentivirus experiments in particular. The proximity ofmy laboratory to that ofDr. Liang Zhu (where Dr. Ochoa will be doing most ofher work), will give us ample opportunities for interaction, and easily allow me to monitor her progress. On a formal basis, I will meet with Drs. Ochoa and Zhu once per month to discuss her progress. I have extensive exp~rience in fostering young investigators in this regard.

2l

Ochoa, Erin R.

As Director ofthe Marion Bessin Liver Research Center, I will assure Dr. Ochoa's access to all Center resources and facilities to help her carry out every phase ofher project.

It is certainly impressive that Dr. Ochoa has already made significant progress in Dr. Zhu's lab. Her research plan is well thought-out after many discussions with Dr. Zhu and myself, as well as various other liver Investigators in and outside of our Institution. I predict that she will obtain and report significant results from this project and based on this she will transit into a successful independent investigator here at our Liver Center. She has the full support and confidence of her Chairman in the Department ofPathology, which is shared by the senior leadership ofthe Liver Center as well.

I encourage you to support this candidate as she begins a promising career towards an independent scientist.

Sincerely yours,

{[L.o{J David A. Shafritz, M.D. Herman Lopata Professor of Liver Disease Research

22

30. GEN. 2003 15:41 HiS CANCER RES TURIN 39119933225 t~R. 738 P.2/2

Ochoa,Erin R.

Institute for Cancer Research and Treatment

MlOllili FDllenzi. MD.. P1lD. !.:lboraloly or GenII Tralllll'e' and Therapy

Sir, Provo 142. 10060 ClIndiplo (Torf"o) IIsly TeJ:+39- 0".993.3223 F~ ...39-0".993.3225

pfollenz/@Irec unUQ.it

Letter ofcollaboration for "2.1.03 K08 NlH applicaton".

I 1lIldersigned, Dr Antonia FoUCDZi, confum that r will be deUghted to collaborate with Dr. Erin R. Ocho~ MD on the project to lmock-down p27 in hcpatocytes by Skp2 or p27-specitic aNAi over expression

Yours sincerely.

,"

23

Ochoa, Erin R.

UNIVERSITY OF ILLINOIS

AT CHICAGO

Department of Molecular Genetics (MC 669) College of Medicine 900 South Ashland Avenue Chicago, Illinois 60607-7170

January 28, 2003

Erin Rubin Ochoa, MD Laboratory of Liang Zhu, MD, PhD Albert Einstein College of Medicine 1300 Morris Park Avenue, Room U-519 Bronx, NY 10461

Dear Dr. Ochoa,

I am pleased to confirm our collaboration on the study ofp27 in hepatocytes. I will provide you with p2710x/lox mice, we are currently generating. These animals will allow you to knockout p27 specifically in hepatocytes when crossed with transgenic mice with hepatocyte specific expression of the Cre recombinase. With these mice, you should be able to determine roles of p27 in hepatocytes in the absence of complexities that exist when p27 is disrupted in the whole. mouse. You will then be able to compare the phenotypes ofhepatocyte-specific p27 knockout to those previously observed in p27 knockout mice in your mentor's lab as reported in Karnezis et al. JCI, 2001.

I believe your project makes an excellent K08 proposal and I am looking forward to a fruitful collaboration.

Sincerely,

?~~~.",~ Hiroaki Kiyokawa, M.D., Ph.D. Assistant Professor ofMolecular Genetics

, \

UIC "

Phone (312) 996-0162 • Fax (312) 413-0353

MONTEFIORE MEDICAL CENTER DEPARTMENT OF PATHOLOGY

• • . The University Hospital for the Albert Einstein College of Medicine

•

MICHAEL B. PRYSTOWSKY, M.D., Ph.D. Chairman Professor Pathology 718·920-2456 Office

January 27,2003 718-882-8461 Fax E-mail: [email protected]

Center for Scientific Review National Institutes of Health Suite 1040 6701 Rockledge Drive MSC 7710 Bethesda:MD 20892-7710

Re: Description of institutional environment and institutional commitment of Dr. Ochoa's . RCA proposal

To the Committee:

Dr. Erin Ochoa was recruited with the commitment from the Department of Pathology to nurture, develop and support her career as a physician scientist. The five year plan includes the following: 1gain attending level experience in surgical pathology, 2- identify a research project and mentor, 3initiate project and prepare grant proposal, 4- continue research and sub-specialty clinical work and 5- develop independent research project for independent funding.

Dr. Ochba joined the Montefiore Medical Center (MMC) / Albert Einstein College of Medicine (AEC011) faculty as an Assistant Professor in January, 2002 working as a full-time surgical pathologist for the first eight months. She has had a long-standing interest in gastrointestinallliver pathology; during this time Dr. Ochoa developed a strong professional relationship with clinicians securing her ability to perfonn sub-specialty pathology service work in the future. Dr. Ochoa also identified a mentor, Dr. Liang Shu, and a research project described below. Working with her division chief, Dr. J. Pullman, we constructed a schedule which began in September, 2002, where Dr. Ochoa devoted one day per week perfonning GI/liver service pathology and worked the remaining time starting her research project and preparing the K08 grant application. Thus, the Department of Pathology is providing significant support for the development of Dr. Ochoa's

. research oriented career; we anticipate that funding ofthe K08 award to carry out the work described below will greatly enhance her career development.

Dr. Ochoa will be studying the therapeutic potential of p27Kip1 suppression, and its role in hepatogenesis. She will be working under the supervision of Drs. Liang Zhu and David Shafritz in the internationally recognized Marion Bessin Liver Research Center at AECOM The Marion Bessin Liver Research Center Was established with support from the NIDDK as a state of the art, interdisciplinary facility committed to investigating the fundamental mechanisms of liver function and pathogenesis and to training th~ next generation of liver scientists. Through Einstein, Dr. Ochoa will have access to a wide range of educational and career development opportunities which have been specifically designed to foster beginning investigators.

Mailing Address: " Montefiore Medical Center 111 East 210th Street

Ochoa, Erin R.

Drs. Zhu and Shafritz are both experienced Nlli funded liver researchers, who will closely guide Dr. Ochoa's work through daily interaction. With Dr. Zhu's able assistance, Dr. Ochoa has already met the technical challenge of post transcriptionally decreasing p27 expression through a novel technique

, employing the RNA interference pathway (RNAi). Dr. Zhu's lab will provide Dr. Ochoa the scientific environment and ample resources for her to cany out the proposed research. Dr. David Shafritz's laboratory has more clinically oriented hepatocyte transplantation projects, including the study of lentiviral-mediated gene transfers to primary hepatocytes before transplantation. He will therefore be able to provide Dr. Ochoa expert guidance which complements Dr. Zhu's.

Dr. Ochoa receives the full salary of a staff pathologist at Montefiore Medical Center. Her clinical responsibilities are already limited to the guidelines of the K08 and her research time will be protected throughout the course of this project. The recruitment of Dr. Ochoa from MGH to Einstein was based in large part on our commitment to foster Dr. Ochoa's long-term dedication to an independent research career as a physician-scientist in liver research.

We understand the commitment from the investigator, mentors and the institution that is required to develop an independent, physician-scientist investigator. We have a carefully designed plan that we have initiated. Awarding of the K08 will certainly facilitate the transition to an independent scientist.

Sincerely,

. J ~7,[/ Jc~el PIYst:w:~MD,~ Professor and University Chairman

26

Principal Investigator/Program Director (Last, first, middle): Ochoa. Erin R. a. Specific Aims

p27kip1 (we use p27 in this text) inhibits the activity of various cyclin-dependent kinases to restrain cell proliferation. It was found that the targeted inactivation ofp27 in mice results in proportionally enlarged animals with pronounced multi-organomegaly, including the liver. These animals show increased spontaneous tumor growth only in the pituitary glands. Carcinogen treatment (IR or NED) caused more tumors in intestine and reproductive organs as well as thymic lymphomas in knockout mice compared with wild type mice. Importantly, liver tumor incidence was not elevated in either spontaneous or carcinogentreated p27 knockout mice. In humans, p27 has not been found mutated in tumors (Chen et aI., 2000), although lower p27 protein abundance has been found to correlate with poorer prognoses in certain tumor types (Ito et al., 1999). Interestingly, it was reported that p27 protein levels were higher in human liver tumors compared with neighboring nonnalliver tissues, although in these tumors lower p27 levels still correlated with poorer prognosis (Fiorentino et a1., 2000). These findings led to our hypothesis that p27 suppression could have therapeutic benefits in hepatocyte transplantation where increased cell proliferation is desirable. To support this hypothesis, our lab has recently reported that hepatocytes isolated from p27 knockout mice better proliferated and rescued host liver failure in the FAH mouse hepatocyte transplantation model. Cheng et al. showed that bone marrow stern cells from p27 knockout mice more efficiently rescued lethally irradiated mice after transplantation, suggesting that this concept of targeting p27 to benefit cell transplantation can also be applied to other cell types (Cheng et al., 2000). In this application I propose to employ new experimental approaches to test our hypothesis in more clinically relevant conditions.

Aim 1. To establish new p27 targeting strategies to better determine the role of p27 in hepatocellular proliferation and carcinogenesis.

In previous studies, p27 was inactivated in early embryogenesis in the whole animal. So, the reported hepatocyte phenotypes may have been affected by non-hepatocyte-autonomous effects and/or by the fact that p27 was inactivated in early animal development. To address these two important issues, we propose to develop new strains of transgenic mice in which p27 is targeted in hepatocyte-specific and temporally controlled manners. We will also establish methods to achieve reversible p27 inactivation. In analyzing the effects of p27 inactivation on hepatocyte proliferation, we will more stringently determine the role of p27 in hepatocellular carcinogenesis by using the Alb-HBV mouse hepatocellular carcinoma (BCe) model.

Aim 2. To achieve p27 suppression in primary hepatocytes in culture, and to determine the biochemical effects of in vivo (Aim 1) and in vitro (Aim 2) p27 inactivation in cultured primary hepatocytes.

To study the role of p27 in hepatocyte proliferation at a level that is more closely relevant to human hepatocytes, we will establish lentivirus-mediated gene transfer to manipulate p27 in primary hepatocytes. Once this is accomplished, we will use molecular biology experiments to determine, and compare, the effects ofp27 suppression in vivo (Aim 1) and in vitro (Aim 2).

Aim 3. To determine whether and to what degree p27 inactivation by the various methods described in Aims 1 and 2 can improve hepatocyte proliferation after transplantation into a failing liver.

We will use our established FAH hepatocyte transplantation model to determine the effects of p27 suppression on hepatocyte ttansplantation efficiency. Here, we also propose to create a "partial liver failure" condition in the FAR hosts to more stringently determine the proliferative potential of various p27defficient hepatocytes. \

\,

The successful completion of these three aims will represent essential progress in our understanding of the roles of p27 in hepatocyte proliferation and its relevance to human hepatocyte transplantation. These studies will also provide me with the training necessary for my transition to an independent liver researcher.

~s 398 (Rev. 05/01) Page 27 Number pages consecutively at the bottom throughout the application. Do not use suffixes such as 3a. 3b.

Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R. including liver cells. Also, carcinogen treatment, IR or NEU, revealed higher tumor development in multiple tissues including intestine, reprodlictive organs, and thymic lymphomas in homozygous as well as heterozygous p27 knockout mice (Fero et al., 1998), suggesting that lack of p27 could be causal in tumor development in some tissue types under mutagenic conditions.

3. Hepatocyte proliferation and its clinical importance. Understanding and controlling hepatocyte proliferation is of urgent clinical significance due to the

potential of transplanted hepatocytes to replace failing host livers. Whole organ transplantation can successfully treat a number of conditions that lead to liver failure, including: non-cholestatic cirrhosis, cholestatic liver disease, acute hepatic necrosis, biliary atresia, metabolic diseases, and malignant neoplasms. However, the demand for donor organs far exceeds the supply. From January to August 2002, in the United States, 12,092 liver transplantations were performed from 6,206 donor organs. 17,305 other candidates remain on waiting lists as of 12113/02 (www.unos.org; UNOS, 2002). There are similar shortages of a wide range of other transplantable tissue and organ types. To meet this growing demand, a range of therapies attempts to use smaller amounts of donor tissue to treat multiple hosts. Some such approach seems promising in liver due to its native regenerative powers. Given optimal circumstances, a whole, functioning liver can spontaneously regenerate after loss of 213 of its original mass (though, interestingly, the new organ lacks the gross lobular form).

There are three basic strategies for rescuing a failing liver with small amounts of donor tissue. A culture of isolated donor cells can be infused into a host liver. These engraft in the host liver, proliferate, and can eventually replace the host liver with healthy new tissue under certain conditions. Transplanted normal hepatocytes can proliferate to such an extent that the donor cells can repopulate the entire host liver when the host hepatocytes are damaged. Sandgren et al. using the Alb-uPA transgenic mice (Sandgren et al., 1991) fIrst demonstrated this. More recent examples in mouse include the FAH null mouse model (Overturf et aI., 1996); transplantation of Bcl-2-expressing hepatocytes into hosts treated with anti-Fas (Mignon et al., 1998); and HSV-tk hepatocyte transgenic model (Braun et al., 2000). These results have generated much excitement about hepatocyte transplantation, although it is clear that host liver conditions in these models have little relevance to human liver diseases. Alternatively, the growing fIeld of tissue engineering attempts to culture large, functioning, transplantable liver masses in vitro or in a secondary host. It may also be possible to create extra-corporeal, biosynthetic devices which mimic the function, but not form, of native liver (similar to the development of the kidney dialysis machine). During my resident training at Mass. General Hospital, I participated in researches in this area in the lab of Dr. Vacanti. The principle obstacle faced by liver tissue engineering is that in vivo hepatocyte proliferation depends upon a highly oxygen- and nutrient-rich environment which cannot yet be mimicked ex vivo should be in vitro (Ochoa and Vacanti, 2002).

The hepatocyte transplantation approach sidesteps the environment problem by relying upon the existing host liver vasculature to support the growth of new tissues from transplanted hepatocytes. This benefIt comes at the cost of limiting the amount of donor cells which can safely be transplanted without. occluding vasculature, thereby causing portal hypertension and further damage to the host. The scenario of hepatocyte proliferation in a failing liver has provided the best conditions in which to study hepatocyte proliferation. Such studies have already significantly contributed to our growing understanding of the proliferative capacity ofhepatocytes. Our recent study (Kamezis et al., 2001) demonstrated that the proliferation activity ofhepatocytes can be stimulated by manipulation of certain cell-cyc1e regulators such as p27. In this regard, p27 inactivation may eventually prove to be a useful tool for liver tissue engineering as well.

4. Overexpression of Skp2 as an alternative method of suppressing p27. p27 protein abundance, in the cell is primarily regulated by protein degradation through the Skp2

mediated ubiquitin-proteasome pathway. When residue Thr187 ofp27 is phosphorylated, it is targeted to the SCFRocl ubiquitin ligase complex fo~ multiple ubiquitination through the F-box protein Skp2 (Alessandrini et al., 1997). Ectopic expression of Skp2 can lead to the degradation of p27 and consequently induces S phase entry in quiescent cells in serum-free media (Sutterluty et al., 1999). These studies have already been extended to hepatocytes. Nelson et al. recently reported that overexpression of Skp2, through an adenovirus vector, can lead to reduction of p27 protein levels and S phase entry in primary hepatocytes in the absence of EGF, and even in adult liver (Nelsen et al., 2001). Co-expression of cyclin E further enhanced these effects. These results are consistent with our data obtained from 27 knockout h.e atoc es

S 398 (Rev. 05/01) Page 29 Number pages consecutively at the bottom throughout the application. Do not use suffixes such as 3a. 3b.

Principal Investigator/Program Director (Last, first, middle): Ochoa. Erin R. feasible place for gene manipulation of human hepatocytes is the primary hepatocyte culture. Towards this goal, we have proposed to establish lentivirus-mediated p27 targeting in cultured mouse primary hepatocytes.

Lentiviruses are a family of retroviruses which induce chronic and progressive disease. By separating the cis-acting sequences required for the transfer of the viral genome to target cells from the trans-acting sequences encoding the viral proteins, lentiviral vectors have been successfully used in gene transfer experiments, including hepatocytes. Lentiviral vectors have undergone extensive improvement to provide better safety and more efficient gene transfer since their fIrst reported use in transferring marker genes into the neurons of adult rat brains (Naldini et aI., 1996) and now have become a preferred vehicle for delivering long term transgene expression to resting cells in vitro or in vivo.

Advances in safety have decreased the efficiency of infection relative to the original virus, thereby decreasing the efficiency of gene transfer. More recently, efficiency has been partially restored by the reinclusion of a cPPT/CTS sequence from the middle of the pol gene(Follenzi et al., 2000). This modifIcation strongly increased the total amount of genome integrated into the DNA of the target cells by enhancing the nuclear translocation of the vector genome. Relevant to the current research proposal, this advanced lentiviral vector design has been used to more efficiently deliver reporter genes to non-dividing mouse hepatocytes in vivo (VandenDriessche et al., 2002), and to nondividing primary rat hepatocytes in vitro (Nguyen et al., 2002).

In this proposal, we will also take advantage of the recently reported applications of lentiviral vectors to deliver RNAi. Qin et aI. reported the successful use oflentivirus vectors to deliver siRNAs to suppress the HN-1 coreceptor CCRS in human peripheral blood T lymphocytes, despite the previous reports that RNAi may target lentivirus itself (Gitlin et al., 2002; Jacque et al., 2002; Novina et al., 2002; Qin et aI., 2003). Taken together, we believe that lentivirus is the ideal vehicle for us to target p27 in primary hepatocytes (Aim 2).

c. Preliminary Studies.

1. A brief summary of the proof of principle that targeting p27 can better rescue failing liver in the FAR mouse model (please see attached reprint Karnezis et al for detailes).

Primary hepatocytes from the 1'27 knockout mice are more active in S phase entIy in vitro. Adult hepatocytes isolated from p27 knockout mice had elevated Cdk2 protein levels and p 130 proteins were present in more phosphorylated forms. These are usually indications of active proliferation. However, immunofluorescent staining for BrdU, which shows the actual number of cells progressing through S phase, showed a normal level of proliferation. This indicates that these hepatocytes were in a different quiescent state than the adult wild type. After two days in culture, the p27-null adult hepatocytes showed a significant increase in total DNA synthesis activity relative to the wild type (both with and without EGF as a stimulus). BrdU labeling at this point showed signifIcant increase in S phase cells. Morphological changes and cell death after 4-5 days followed a similar pattern to the wild type. So, the difference in p27-null adult hepatocytes seemed to allow them to enter S-phase, but not to expand in culture, more easily than the wild type.

Primary hepatocytes from 1'27 knockout mice have better proliferation potential after transplantation in an FAH liver failure model. Male p27-null adult primary hepatocytes were injected through the spleens of male FAR-null mice. Inactivation ofFAH (fumarylacetoacetate hydrolase) leads to an accumulation of hepatotoxic tyrosine degradation intermediates unless the mice are treated with 2-nitro-4-trifluoromethylbenzoyl-I,3-cyclohexanidione (NTBC) in their drinking water. Withdrawal ofNTBC results in a timed, controlled model of liver failure in 2 months, with which to test new therapies. Male donor/host conditions have a lower survival rate and were used to provide maximally stringent test conditions.

Anti-FAR staining showed similar patterns of p27-null and wild type hepatocyte engraftment and proliferation after one month. However, at 2 months, the p27-null hepatocyte transplantated mice showed signifIcantly greater body weight and survival rates. Quantitative PCR of the wild type FAR DNA sequence showed higher total amounts in the p27 null mice, indicating that a higher total number of donor hepatocytes were present than in those transplanted with wild-type hepatocytes. Anti FAH staining showed growing, but isolated, clusters of wild-type donor derived tissue, but larger, coalescing areas of p27 null donor

. derived tissue, which were also formin a ro riate chord-like structures. S 398 (Rev. 05/01) • Page 31

Number pages consecutively at the bottom throughout the application. Do not use suffixes such as 3a, 3b.

Principal Investigator/Program Director (Last, first, middle): Ochoa. Erin R.

A. Future directions. The XhoI Hind ill

~t-c_n_B......i_m Ec_OW tetO CMV Human Skp2 ~SV40 Poly A

minimal promoter 0.5kb

V tetO-Skp2B. - - + - + Dox

Skp2

Saos 2 rtTA Saos 2

c.

D.

C\I ,.... ~ g ~ u:: 11. 11. 11.

1650

1000 650

400

200 100

Figure 1. Generation of tetO-Skp2 transgenic mice. (a) Schematic drawing of our tetO-Skp2 construct. (b) The tetO-8kp2 construct was transfected into 8aos-2 cells or a derivative of Saos-2 cells that contain the tet-controlled transactivator rtTA, as indicated. The addition of Doxycycline induced the expression of 8kp2 in 8aos-rtTA cells but not in Saos-2 cells. In the absence of doxycycline, no Skp2 above

\

background levels was observed. (c) Tail DNA genotyping with primers P1 and P2 identified the presence of the transgene in 6 of 26 mice generated after oocytes injection. (d) The identity of the peR product for the transgene was confirmed by EcoRI, Sacll, and BamHI digestion.

above study provided a proof of principle for the therapeutic potential for p27 suppression. At the same time, it raised a number of questions that must be addressed if this novel concept is to be tested with human hepatocytes. The most important was that p27 was suppressed during early embryogenesis in the whole animal. This resulted in differences in the quiescent states of the adult p27-null and wild type hepatocytes which were used to rescue FAHnull mice. This opens the possibility that temporally controlled extra-hepatic mechanisms were responsible for the reported phenotypes. The reason that this is important, is that with human hepatocytes, p27 can only be inactivated in mature hepatocytes. So, the next step toward clinical relevance will be to . suppress p27 expression in normal adult mice. Further, to minimizing the risk of tumorigenesis, these new suppression techniques should be reversible once the desired therapeutic response has been elicited.

2. Generation of tetO-Skp2 transgenic mice

We cloned the full-length human Skp2 cDNA under the control

pills 398 (Rev. 05/01) . . Page 32 Number pages consecutively at the bottom throughout the' application. Do not use suffixes such as 38. 3b.

Principal Investigator/Program Director (Last, first, middle): Ochoa. Erin R. of the tetO promoter in pUHD10-3 and confmned tet-controlled expression of Skp2 in a cell line with rtTA (Figure IA and B). We gel-purified the tetO-CMV-Skp2 fragment (XhoI to HindIII) and it was injected into fertilized oocytes by the technical staff at the Einstein Mouse Transgenic Facility. Resulting mice were tested for the presence of the tetO-Skp2 transgene (Figure IC). As shown in figure IC, and in data not shown (genotyping of the mice is still in progress), 6 out of 26 contained the 1.7 kb PCR product demonstrating the presence of the transgene. The identity of this band was confmned by further restriction digestion as shown. Currently we are mating these mice to achieve germline transmission of the transgene.

3. Expressing p27 specific shRNA from the U6 promoter -- . The recent demonstration that polymerase ill promoters can be used to express small hairpin RNA to

achieve efficient gene silencing makes it possible to employ RNAi in cell lines with stably transfected pol ID-shRNA constructs (Brurnmelkamp et al., 2002; Hasuwa et al., 2002; Kawasaki and Taira, 2003). Xia H, et al., were also successful with a modified pol IT promoter (Xia H, et al., 2002). We decided to use the pol ill strategy to establish p27 targeting in cultured cells. In designing the shRNA for p27 targeting, we used the web tool available from Dr. G Hannon at Cold Springs Harbor, which generated potential p27 targeting sequences. From this list we picked two sequences that are completely conserved between mouse and human and have no other matches in the GenBank database. We then generated the two U6p27shRNA constructs by PCR (Figure 2A). The 5' primer contains sequences of human U6 promoter according to GenBank. The 3' primer contains (from 5' to 3') the poly T transcription stop signal, the hairpin sequences

A. U6-p27#24 B. U6-p27#310

EcoRV ..), Sac I p27#24~~~K

p27#310

U6tetO-p27#24D. c.U6tetO-p27#31O

: _T~ ~. ... ~~

p27 -"-~ ~ A • _

loading E. +1

." TTGAAAGTATTTCGATTTCTTGGCTT TATA1'ATCTTGTGGAAAGGACGAAACACCG~ 06

+1

... TTGAAAGTACTCTATCATTGATAGAGTTA1'ATA1'CTTGTGGAAAGGACGAAACACCG~ 06tet

Figure 2. Targeting p27 with RNAi (a) Plasmid constructs containing the human U6 promoter and p27 specific shRNAs were generated by PCR with the indicated primers and a pCRII®-TOPO® vector. The EcoRVand Sacl sites can be used to cut out the cassette for cloning into the lentivirus vector as described later. (b) The predicted hairpin structures expressed from these U6shRNA plasmids. The G-U pairings were designed based on the Cold Spring Harbor web tool. (c) The U6p~7#24 and U6p27#310 plasmids were transfected into 293T cells with a puromycin resistant plasmid ,at a transfection frequency of about 60%. The transfected cells were selected with puromycin for three days and the surviving cells were analyzed by western blotting for the level of endogenous p27. Equal loading was indicated by the non-specific band. (d) The U6tetOp27shRNA plasmids were modified to include the tetO sequences as shown in (e).

p~s 398 (Rev. 05/01) Page 33 Number pages consecutively at the bottom throughout the application. Do not use suffixes such as 38, 3b.

Principal Investigator/Program Director (Last, first, middle): Ochoa.. Erin R. specific for two regions of p27, and the U6 promoter sequence (as shown in Figure 2A). The PCR

products were cloned into the pC~-TOPO~ vector with the Invitrogen Topo TA cloning kit to generate U6p27shRNA#31O and U6p27shRNA#24 as shown in figure 2A. The CSH web tool also arbitrarily introduced throughout the design a few G-U pairings which have been found to stabilize these constructs during propagation in bacteria without interfering with homologous mRNA recognition (Figure 2B). Sequences of all constructs were confirmed by DNA sequencing.

To test our shRNA constructs, we cotransfected 293T cells with U6p27shRNA#31Oor U6p27shRNA#24 as well as GFP-expressing plasmid containing the puromycin resistant gene by the calcium phosphate method (this generally transfects about 60% of the cells as demonstrated by GFP

expression). Two days after transfection, the cells were treated with puromycin (lJ.lg/ml) for three days to kill untransfected cells. The surviving cells were then harvested for Western blot analysis for levels of cellular p27 protein. Equal amounts of extracts (based on Bradford assay) were loaded in each lane (as can be judged by the non-specific band as loading control (Fig.2C). The results demonstrate significantly greater reduction of p27 protein levels by U6p27shRNA#31O than by U6p27shRNA#24. Therefore, we shall use the #310 version in future experiments.

Modification of the U6 promoter for tet-controlled expression. The next key challenge to employing the pol ill promoter strategy to mouse hepatocytes in vivo is to limit the expression of pol III promoters, which are ubiquitous in specific cell types. Since Ohkawa et al. successfully modified the U6 promoter into a tetcontrolled promoter (U6tetOl), we reasoned that combining the U6tet with hepatocyte-specific expression of the tet transactivator (such as the established Alb-tTA) should allow hepatocyte-specific and inducible expression of shRNA (Ohkawa and Taira, 2000). We generated such modified U6 promoter based on Ohkawa's paper. The resulting constructs are shown in Figure 2E. We then generated the two U6tetOp27shRNA constructs by PCR as shown in Figure 2D (we call these our U6 tetO-p27shRNA#24 and U6tetO-p27shRNA#31O constructs). We are testing U6tetO-p27shRNA#31O for response to tet regulation.

4. Lentivirus-mediated gene transfer. We initially used the Invitrogen pLenti6N5-D-TOPO kit to produce high titer virus stocks of a test

GFP lentivirus. This kit provides an optimized mix of help plasmids for cotransfection with the lentivirus plasmids. We have shown that unconcentrated GFP lentivirus can infect more than 90% of the population when tested with the actively proliferating osteosarcoma cell Saos-2. Although, in theory, lentivirus infection does not depend on host cells being proliferating, we observed only less than 10% infection of primary mouse hepatocytes with the same virus stock. One approach to improve the infection efficiency of primary hepatocytes will be to use the more advanced vectors that include the cPPT/CTS sequence, as we will discuss in the Methods section. Dr. Follenzi, one of the collaborators on this advanced vector design, will be coming to work at the Einstein Liver Center, and will be available for consultation as we work on this system. Also, our cosponsor, Dr. David Shafritz, is working on a similar lentivirus project.

5. Characterization of Alb-HBV mice We have started the study of the roles of p27 in HCC development using Alb-HEV mice. Mice

were obtained from the Jackson Lab and breeding colonies have been established. We have gradually harvested these mice at various ages (the oldest now being 9 months) to observe the HCC disease course. Figure 3 displays the differences between a 9-month Alb-HBV mouse and an age matched control. The body weight of the 9 month Alb-HBVmouse was 42g (control=30g) with the liver weight of 2.28g (1.38g for the control). The liver was large with a pale, granular capsule. No nodules were identified upon sectioning. Microscopic examination of the liver showed 40% macrovesicular steatosis with single-cell necrosis with acidophil body formation, focal necrosis of multiple hepatocytes and an inflammatory infIltrate of polymorphonuclear leukocytes and macrophages. Hepatocellular pleomorphism, feathery degeneration eosinophilic clumping, microvesicular s~eatosis were observed consistent with the diagnosis of steatohepatitis. The portal tracts were uninvolved, bile ducts were normal and cholestasis was not observed. Similar fmdings have been described by Chisari et al(Chisari et aI., 1987). Immunohistochemical staining (Invision + Kit (Dako K4001) to Hepatitis B Virus Surface Antigen (HBsAg) was performed using the monoclonal mouse anti-Hepatitis B Surface Antigen 3E7 (Dako N1597) at a 1:2concentraion and discloses marked cytoplasmic staining. Immunohistochemical staining (Invision + Kit (Dako K4(01) to BrdU (Monoclonal Mouse BrdU (Ab-2) (Calbiochem NA20-100UG) at a 1:200 concentration reveals

pAs 398 (Rev. 05/01) Page 34 ,"Number pages consecutively at the bottom throughout the appficalion. Do not use suffixes such as Sa, 3b.

Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R.

Wild Type Alb-HEV

H&E

HBsAg

BrdU

Figure 3. Initial characterization of the Alb-HBV liver. An Alb-HCC mouse was sacrificed together with an age-matched wild type mouse. The Alb-HBV liver is larger and more granular. H&E stain shows hepatic steatohepatitis in Alb-HBV liver. The Alb-HBV liver is clearly positive for HBV Surface ~ntigen staining although areas of negative staining in the same liver can clearly qe observed. It was believed that these cells have lost the HBV transgen~ and will undergo regenerative proliferation, which may be indicated by the presence of BrdU positive hepatocytes (indicated by arrow) in the' Alb-HBV liver (after a one-hour BrdU labeling before sacrifice). Original magnification 200X.

BrdU positive hepatocytes and nonparenchymal cells in the Alb-HBV liver but not in the control liver. This is consistent with the notion that hepatocyte damage by HBV has led to regenerative proliferation, which is believed to play the causal role in tumorigenesis. When our various new p27 knockout and knockdown mice have been crossed with AlbHBV transgenics, these assays will be carried out to determine the

. consequence of p27 inactivation in this disease course.

d. Experimental Design and Methods

Aim 1. To establish new p27 targeting strategies which better determine the role of p27 in hepatocellular proliferation and carcinogenesis.

Rationale and general design for

Aim 1

In previous work, p27kipl was knocked out in mice in early embryogenesis throughout the entire animal. This resulted in multi-organomegaly and phenotypic changes in adult hepatocytes. When isolated by liver perfusion, these hepatocytes were shown to be more proliferative than the wild type, and to

p~s 398 (Rev. 05/01) Page 35 Number pages consecutively at the bottom throughout the application. Do not use suffixes such as 3a, 3b.

Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R. better rescue failing livers in the FAH modeL While significant as a proof of principle that p27 inactivation could have therapeutic benefits in the treatment of liver failure, these findings did not address a number of essential issues: 1) The observed changes and therapeutic benefits of isolated hepatocytes could have been due to extrahepatic mechanisms caused by knocking out p27 in the whole animal. 2) The observed changes and therapeutic benefits of isolated hepatocytes could have been due to the early embryonic time point at which p27 was knocked out 3) In the desired treatment of human liver failure, it will be necessary to inactive p27 in adult hepatocytes. 4) In the desired treatment of human liver failure, it will not be possible to employ transgenic knockout techniques. 5) We need a more careful determination of tumor risks associated with inactivating p27 in hepatocytes. 6) In the desired treatment of human liver failure, it will be necessary to inactivate p27 transiently, in order to minimize the risk of carcinogenesis.

Specific Aim 1 addresses many of these issues.

1. Inactivating p27 in MXI-Cre induced p27 knockout mice. Recent advances in mouse gene targeting have made it possible to knockout p27 in a highly

controlled manner. Cre-IoxP recombination allows knockout where Cre recombinase is expressed and the target gene is flanked by 10xP sites in the gerrnline. The expression of Cre can be controlled by a variety of tissue specific promoters, such as the Albumin promoter in hepatocytes, or by inducible expression systems, such as variations of the tetracycline system. One of the first strategies to achieve inducible knockout used the mouse IFN-a inducible Myxovirus resistance-l gene promoter to express ere (Mxl-Cre) (Kuhn et al., 1995). This promoter is silent in healthy mice (particularly when they are maintained in a pathogen-free environment). Induction of this promoter by a single injection of IFN-a or polyinosinicpolycytidylic acid (pol IIC) to 8-wk old mice resulted in complete knockout of a floxed DNA polymerase J3 (Kuhn et al., 1995) or S6 gene (Volarevic et al., 2000) in the liver two days later, while other organs showed partial or no detectable knockout. Most recently, pol IIC induced Mx1-Cre almost completely deleted c-jun activity in hepatocytes and non-parenchymal cells, thereby antagonizing the pro-apoptotic activity ofp53 in HCC development (BferI et al., 2003). Clearly, this may now be considered an established method to achieve controlled knockout in the liver. By crossing p2710x/lox mice with MXI-Cre mice, we will generate a transgenic system with which we can determi.Iie the effects of early embryonic knockout of p27 in the liver alone, and also the effects of knocking out p27 in the liver later in embryogenesis and post-gestationally. Long-term observation ofMxl-Cre knockout mice will further determine the risk of spontaneous carcinogenesis linked to p27 inactivation.

2. Inactivating p27 with reversible overexpression of Skp2 in tetO-Skp2/AlbtTA bitransgenic mice.

As discussed in the previous section, the overexpression of the F-box protein, Skp2, has been shown to be an effective in regulating p27 levels in hepatocytes. It is also feasible to reversibly express a gene of interest in a cell-specific manner using the tetracycline-controlled expression system. In fact, the expression of H-rasV12G in melanocytes was turned on and off more than one round when the reverse tetracycline-controlled transactivator rtTA was expressed from the tyrosinase gene promoter (Chin et al., 1999). As discussed before, hepatocytes have been shown to allow tetracycline-induced gene expression when controlled by an Albumin promoter (Manickan et al., 2001). We therefore propose to use the tetracycline-controlled gene expression system to express Skp2 to achieve reversible inactivation of p27 in adult hepatocytes. This will allow us to determine whether the inactivation of p27 in adult hepatocytes leads to phenotypic changes which are similar to those observed in our p27 knockout hepatocytes. Long-term observation of mice in which Skp2 is overexpressed will also help to assess the risk of spontaneous carcinogenesis under p27 targeting conditions which are more closely relevant with human hepatocytes.

It should be noted that there is some risk that Skp2 may target other molecules for ubiquitilization, and that Skp2 may pose more of a carcin6genic risk than other p27 inactivation techniques (Bloom and Pagano, 2003). For these reasons, it is desirable to have an alternate transgenic system in which p27 can be transiently regulated in adult hepatocytes.

3. Inactivating p27 with reversible RNAi in U6tetO-p27shRNAlAlb-tTA bi-transgenic mice. p~s 398 (Rev. 05/01) Page 36 Number pages consecutively at the bottom throughout the application. Do not use suffixes such as 3a, 3b.

Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R. The basis for our proposal to use RNAi to knockdown p27 is the recent reports that RNAi is

effective in the mouse liver (Lewis et at, 2002; McCaffrey et al., 2002; Xia et aI., 2002). Although the fIrst reported studies used synthetic 21 nucleotide RNAs, expression of small hairpin RNA from pol ill promoters have been shown to be equally effective (Brurnmelkamp et al., 2002; Hasuwa et al., 2002; Kawasaki and Taira, 2003; Paddison et al., 2002; Tuschl, 2002). Therefore, based on these studies, we believe small hairpin RNA expression in the liver will also be effective. The second component of our proposal, to use the modified U6pol ill promoter for tet-controlled expression, is based on the report that such modifIed promoter could indeed function as a tet-regulated promoter (Ohkawa and Taira, 2000). We are currently testing our U6tetO-p27shRNA construct in cultured cells to confIrm that our constructs will function as expected from these previous studies.

We believe that it is appropriate and well justifIed to attempt to establish U6tetO-p27shRNA transgenic mice. These mice will be crossed with Alb-tTA mice (similar to those described above in our tetO-Skp2 system) to give us transgenic mice in which p27shRNA can be inducibly expressed in hepatocytes at a desired time. If successful, we will have gained a powerful tool for the future study ofp27 and other regulators in hepatocytes. This RNAi system will compliment our tetO-Skp2 mice and provide evidence of whether Skp2 has targets other than p27, and whether Skp2 overexpression has additional carcinogenic risks.

4. Determining associated tumor risks with the Alb-HBV transgenic mice.

Tumor risk associated with the transplantation ofp27 deficient hepatocytes needs to be detennined with appropriate HCC model systems. Previous observations that p27 knockout mice contained more hepatocytes in the liver but did not show increased spontaneous or carcinogen-induced HCC and that p27 knockout hepatocytes were better able to rescue host liver failure after transplantation into p27 wild type mice, have led us to propose the hypothesis that tissue-specifIc roles ofp27 will allow its inactivation in hepatocytes to result in appropriate and benefIcial proliferation, but not tumor. Obviously, the tumor risk component is crucial to the validity of this hypothesis.

Although p27 knockout mice do not have increased hepatocellular carcinoma (HCC) incidence, the role ofp27 in HCC, particularly after extensive hepatocyte proliferation, remains to be detennined due to a number of considerations. An important feature of human, as well as mouse, HCC development is the extensive damage-induced hepatocyte proliferation prior to oncogenic transformation. Since p27 is thought to play important roles in cell proliferation, the role of p27 in HCC is more appropriately determined in this context. Also, the generation of hepatocyte-specifIc, inducible p27 inactivation with various strategies will provide experimental systems to closely mimic the situation of natural mutations in hepatocytes and transplantation of p27 defIcient hepatocytes to a p27 wild type host but avoid the complications of surgery and immune rejection. Hepatocyte specifIc inactivation of p27 will also allow longer life span of the animals (in the absence of tumors in other cell types) to revea1liver phenotypes that may require a long latent period. Many mouse HCC models exist. In this application, we propose to determine the role ofp27 in hepatocellular carcinogenesis in the Alb-HBV model as described below.

The Alb-HBV HCC model involves persistent damage-induced hepatocyte proliferation prior to oncogenic transformation and provides a highly relevant model for human HCC. Albumin promoter-directed transgenic expression of the HBV large envelop polypeptide contributed signifIcantly to our understanding of the mechanisms of HCC development after chronic HBV infection, the single most important etiologic factor of human HCC. High level expression of the HBV large envelop e polypeptide causes signifIcant and persistent hepatocyte injury which in turn causes persistent damage-induced regenerative proliferation of hepatocytes that do not contain high levels of HBsAg, hyperplasic nodules, followed by hepatocyte dysplasia, adenoma, and eventually HCC at the age of twelve months (Chisari et aI., 1989), This disease course represents perhaps the most demonstrable sequential and progressive histological and biochemical changes in the development of HCC. The major component in this series of events, the damage-induced proliferation (Huang and Chisari, 1995), is directly relevant to the functions ofp27. Therefore, this model provides a more meaningful test for the tumor suppressor roles of p27 in hepatocytes.

The Albert Einstein Mouse Transgenic Core Facility has extensive experience in all of these types of experiments. The Facility will provide us with reagents and advice to construct the transgene and knockout vectors and to establish the desired ES clones. The staff of the Facility will perform all injection and P'i4s 398 (Rev. 05/01) ," Page 37 Number pages consecutively at the bottom throughout the application. Do not use suffixes such as sa, 3b.

Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R. implantation procedures. Thus, we have superlative technical support from the mouse genetics expertise at Einstein.

Experimental design, methods, expectation, and data interpretation for Aim 1

1. Generation of p27Iox/lox;Mxl-Cre mice. We will obtain p2710xllox mice from Dr. H Kiyokawa (University oflllinois) in the next several

months, based on his progress in generating such mice (see letter from Dr. Hiroaki Kiyokawa). We will backcross the p2710xllo:x allele onto pure C571B6 background by mating them with commercial C571B6 mice. We will study the phenotypes of various new p27 knockouts on pure genetic background as much as we can. In cases where the comparison on pure genetic background is not practical, we will use littermates for comparison. Mxl-Cre transgenic mice (Kuhn et al., 1995) are available on C571B6 background from the Jackson Lab. We will mate them with p2710xllox mice on C571B6 background to generate p2710xllox;MxlCre mice. The mating scheme is indicated in the box below.

mate 1: p2710xllox x Mx-Cre/+ to get: p2710x/+;Mx-Crel+ (50%)

mate 1.1: p2710x/+;Mx-Cre/+ x p2710x/+;Mx-Crel+ to get: p2710xllox (25%);Mx-Cre/+(75%) (18%) p27+/+ (25%);Mx-Cre/+(75%) (18%)

mate 2: p2710xllox;Mx-Crel+ x p2710xllox;Mx-Cre/+ to get: p2710xllox (100%);Mx-Cre/+(75%) (75%)

Percentages in blue color indicates the frequency of the allele, while percentages in red color indicate the frequency of the indicated mice. According to this mating schedule, 75% of the mice from mate 2 will be available for hepatocyte-specific p27 knockout. Since all the mice are on pure C571B6, we will use p27+1+;Mx-Cre from mate 1.1 as controls.

Induction of Mxl-Cre will be achieved by a single peritoneal injection of recombinant IFNa as described (Volarevic et al., 2000). Although pol IIC works as well as lFNa, we will use IFNu since pol IIC can stimulate the production of cytokines other than IFN, such as TNFa, which may affect the liver. With these mice, we plan to knockout p27 in four general time periods (early embryogenesis, postnatal (when hepatocytes are still proliferating), young adult mice, and aged mice. Based on the several reports that successfully used this Mxl-Cre system to knockout genes in the liver, we can predict with high certainty that our experiments with this system will be successful (Eferl et al., 2003).

2. Generation of transgenic mice with tet-controlled expression of Skp2 and RNAi in hepatocytes.

As described in Preliminary studies, the generation of tetO-Skp2 mice has progressed to the stage of mating of the founders. We do not expect any significant difficulties in obtaining colonies of tetO-Skp2 mice with low and high copy numbers of the transgene, as determined'by Southern blot analysis. Generation of U6tetO-p27shRNA mice will start once the activity of the construct has been confmned in cultured cells (see Preliminary data).

Mice transgenic for U6tetO-p27shRNA or tetO-Skp2 will be mated with Alb-tTA mice provided by Dr. Jake Liang from the Liver Disease Section of the NIDDK (Manickan et al., 2001). Dr. Liang has described conditions for induction by doxycycline withdrawal in detail, and we will follow them in our studies. Specifically, mice will be maintained with doxycycline treatment (for repression of tTA) and induction will be achieved by,withdrawal of doxycycline treatment for at least one week. The off condition Will be tested one week after the discontinuation of the induction condition (deinduction). Another member of our lab is in the process of generating a "tet-on" version of Alb-tTA using a more recent version of the reversed tTA, rtTA2s-M2, which has better tet-dependent response and protein stability and has been shown to be effective in hepatocytes (Schonig et al., 2002; Urlinger et al., 2000). If these transgenic mice become available, we will use them for this project. The tet-on version offers the convenience of doxycycline treatment for induction (rather than for maintenance) and speed of induction (rather than waiting for doxycycline to dissipate from the animal system).

p~s 398 (Rev. 05/0.1) Page 38 Number pages consecutively at the bottom throughout the application. 00 not use suffixes such as 3a. 3b.

Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R. Western.blotting will be used to determine the status of Skp2 expression and Northern blotting for

the status ofp27shRNA expression. Once this is accomplished, we will determine the protein levels ofp27 in the liver, our goal of these experiments. To boost the sensitivity of detection for suppression ofp27 in hepatocytes, we will isolate hepatocytes by liver perfusion and use the pure hepatocyte prep for Western blotting of p27 (hepatocytes only constitute about two thirds of total cells in the liver).

We predict that the Skp2 line of experiments will be successful based on the report that Skp2 overexpression indeed promoted hepatocyte proliferation (Nelsen et al., 2001) and the success oftet regulated expression in hepatocytes in transgenic mice (Manickan et al., 2001). We realize that the success of the RNAi line of experiments, although of great impact if successful, is not as predictable. As described in the Rationale section for generating the hepatocyte inducible RNAi transgenic mice, we feel that our design of the RNAi line of experiments is based on solid grounds, which in theory predicts good probability of success in knocking down p27 with strategies other than gene knockout. In the event that we fail at the RNAi experiments due to unpredictable factors, the major theme of this application can still be carried out with the more proven methods (the Mx1-Cre system and the Skp2 system).

3. Characterization of liver-specific, inducible p27 knockout and transient hepatocytespecific knockdown mice.

Once the new p27 knockout and knockdown mice are generated, we will perform the following experiments to determine the consequences of p27 inactivation. When p27 is inactivated by Mxl-Cre, we will start the measurement from postnatal period (1-3 weeks), to 2-3 months, to about one year of age, dependent on the initial results. With reversible p27 inactivation mice, we will restore p27 expression after p27 inactivation phenotypes have developed and harvest samples after the restoration of p27 expression for one month, compared with mice that maintain the expression ofp27~hRNA or Skp2 for the same periods of time. It is important to note that we have our early-embryonic p27 knockout results following similar protocols as a baseline comparison.

a) Liver weight will be measured and analyzed as liver/body weight ratio. The ratio will be determined in a time course, dependent on the time of p27 inactivation and restoration as described above.

b) Immunohistochemical studies will be performed in order to measure hepatocyte proliferation in the liver. We will use BrdU labeling to quantitate S-phase hepatocytes, and mitotic index to quantitate cell division. TUNEL assay will be used to detect apoptotic hepatocytes. At the same time, general liver histology and pathology will also be examined to determine whether hepatocyte-specific p27 will lead to pathological changes in hepatocytes such as dysplasia, steatosis, proliferative nodules, adenomas, microcarcinomas, necrosis foci, etc.

c) Biochemical studies will be carried out to determine the protein levels of cyclin D, cyclin E, cyclin A, Cdk4/6, Cdk2, pl30, p107, pRB, etc; and Cdk2 and Cdk4 associated kinase activity in various liver samples. It is important to note here that since hepatocytes account for 60-70% of total cell number in the liver, changes in various measurements as a result of hepatocyte-specific p27 knockdown will generally be underestimated.

Most of the methods for b and c above have been used in (Karnezis et aI., 2001b) We will essentially follow the same protocols. We will fIrst study p27 knockout in early liver and at 2-months. The Mxl-Cre-mediated knockout should be very closely similar with germline knockout, and inducible knockout at 2-months will represent adult hepatocytes (hepatocyte proliferation associated with normal liver development has ceased at this time). Therefore these two p27 knockout strategies will yield a general time frame for the functional effects of p27.

We expect that inactivation ofp27 by Mxl-Cre will lead to the presence of more appropriately differentiated hepatocytes in the liver, similar to what has been observed in the regular (gerrnline) p27 knockout mice. Since adenovirus-mediated Skp2 overexpression in adult liver could induce hepatocyte proliferation, we expect that p27 inactivation in 2-month old hepatocytes will lead to hepatocyte proliferation as well, which will indicate that mature hepatocytes in p27 knockout mice have adapted to the absence of p27 in the previous regular p27 knockout mice, since they are not proliferative at the adult stage (Kamens et al., 2oo1a). The degree ofhepatocyte proliferation stimulation will be compared with the effects of adenovirus-mediated Skp2 overexpression as reported (Nelsen et al., 2001). Although the expectation is that these two methods should lead to similar levels of stimulation since they are based on the same biochemical basis (inactivation of p27), it is possible that one method will be more effective than the other, which will suggest functional differences between simple p27 inactivation and Skp2 overexpression. Results from these ex eriments will then lead to 27shRNA-induced 27 knockdown at similar time oints,

S 398 (Rev. 05/01) Page 39 Number pages consecutively at the bottom throughout the application. Do not use suffixes such as 3a, 3b.

Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R. and Skp2inducible knockdown at later time points (such as one-year old) to determine whether inactivation of p27 in aged livers can also stimulate proliferation.

On the other hand (although unlikely given the Skp2 Qverexpression results of Nelson et al), if p27 knockout in 2-month hepatocytes fails to stimulate them to enter S phase while p27 knockout in early hepatogenesis does, it would suggest that the effects of p27 knockout are limited to the period before hepatocytes have normally exited the cell cycle. This scenario has been observed in TGFa transgenic mice (Jhappan et al., 1990; Sandgren et aI., 1990). We will then induce p27 knockout before I-month when hepatocytes are still proliferating. If none of the new p27 knockout strategies can lead to proliferation stimulation, one would consider the possibility that liver enlargement in the original regular p27 knockout mice is a secondary effect in response to increases in metabolic demands since the animals are larger. This would reveal the need for more careful studies to determine the primary effects of p27 knockout in the whole animal. Again we do not think this scenario is likely. How p27 knockout will affect hepatocyte proliferation in vitro and after transplantation will be determined in Specific Aims 2 and 3.

The effects of inducible expression ofp27shRNA or Skp2 in hepatocytes will provide parallel comparisons with liver-specific p27 knockout and the reported Skp2 overexpression via adenovirus vectors. If inducible inhibition of p27 is successful with these systems, we can then determine whether the expression of p27 protein as well as any observed hepatocyte proliferation phenotypes can be reversed when p27shRNA or Skp2 expression is turned off.

4. Determination of the carcinogenic role of p27 in the Alb-HBV HCC model. Establishment of Alb-HBV-p27 knockout/down mice. Mouse strains (Mxl-Cre;p2710xllox, tetO-Skp2;AlbtTA, and U6tetO-p27shRNA (described above) will be crossed with Alb-HBV mice (see Preliminary studies). We will ftrst focus upon the Mxl-Cre;p2710x/lox mice in these experiment, since the interpretation of results from p27 knockout will be more clear-cut than results form p27 knockdown by Skp2 and p27shRNA. Studies of Skp2 and p27shRNA mediated p27 knockdown in this line of experiments will become more interesting and pressing if the hepatocyte proliferation phenotypes of these transgenic mice prove to be very signiftcant.

The genotypes of the progeny mice will be determined by standard methods. We will use 4-5 mice for each experimental point. Equal numbers of littermate mice without the p27 knockout/down genotypes will be used as controls. We will use only male mice since it has been shoWn that mouse genetic background and sex play an important role in the kinetics of HCC development in this model and their influences correlated with the expression levels of HBsAg, the severity of hepatocyte injury, and hepatocyte proliferation (Chisari et al., 1989).

Reported progression of HCC development in Alb-HBV mice. The important feature of HCC development in this HCC model is that the progression of various disease stages follows a chronological course with predictable, demonstrable, and well-characterized pathological changes. In male Alb-HBV mice, the course of HCC development should follow the time line as described below:

2-3 months of age: hepatocyte injury begins as evidenced by elevated SGPT levels. 6-12 months of age: microscopic regenerative nodules become noticeable. Most of them can be

diagnosed as microscopic nodular regenerative hyperplasia. These regenerative hepatocytes are usually negative for HBV envelop protein staining and appear against a background of envelop protein positive hepatocytes with ground glass appearance, suggesting that these cells have lost transgene expression and therefore have gained proliferation advantage (all hepatocytes are uniformly positive for envelop protein staining before 2 months). Some of the hepatocytes in these nodules can be AFP positive, a marker of hepatocellular regeneration and transformation.

A small number of the nodules can be diagnosed as microcarcinoma based on increased mitotic activity, cellular dysplasia, trabecular architecture and compression of surrounding normal tissue.

Grossly evident tumors are not present at this time. Hepatocyte nuclear aneuploidy becomes evident as measured by FACS analysis. 12 months of age: Serum AFP s4u'ts to rise, which correlates with the appearance of grossly

detectable tumors. 18-21 months of age: All mice will have palpable liver tumors.

Some of the tumors are hepatocellular adenomas with heterogeneous appearances of cells, increased mitotic activity, focal areas of severe dysplasia (characterized by cytologic pleomorphism, increased nuclear to cyto lasmic ratio, multinucleation and bizarre mitotic ft mes). Some of them are full-blown he atocellular


Principal Investigator/Program Director (Las~ first, middle): Ochoa, Erin R. carcinomas that can be trabecular, well differentiated, and mitotically quiet, or solid, containing sheets of poorly differentiated epithelial cells and mitotically active, locally invasive, hemorrhagic, and necrotic.

In addition, Dr. Chuck RogIer in our Liver Research Center has extensive experience in the study of hepatocellular carcinomas. He has devised a scoring system to facilitate analysis of the progression of hepatocellular carcinogenesis (Yang et al., 2000). With his help, we have devised the following scoring system for mice of the three groups at various ages. Samples are analyzed and scored in a blind fashion:

Score Lesion

o Normal liver.

1 Mild microscopic regenerative nodules (microscopic nodular regenerative hyperplasia) become noticeable.

2 Regenerative nodules increase in number and size (occupy about 5% of the liver).

3 Regenerative hepatocytes become dysplastic (cytologic pleomorphism, increased nuclear to cytoplasmic ratio, multinucleation).

4 Regenerative hepatocyte nodules contain dysplastic cells, show clear signs of mitotic activity, and compress surrounding normal tissue (microcarcinomas).

5 Nodules become macroscopic. The tumors can be trabecular, well differentiated, and mitotically quiet, or solid with sheets of poorly differentiated epithelial cells and mitotically active, locally invasive, hemorrhagic, and necrotic.

6 Many grossly large tumors are present.

As discussed in Preliminary studies, we have obtained Alb-HBV mice on a C571B6 background from the Jackson lab and have been making observations for 9 months. Our immediate plan is to establish in our own hands the kinetics ofHCC development in the Alb-HBV mice with wild type p27. This will prepare us for the analysis of p27 knockout/down mice once these mice become available.

Assay of HCC development in Alb-HBV-p27 knockout/down mice. Based on the described timeline of HCC development in this model, we will conduct the following determinations.

(1) Determination of SGPT (measures hepatocyte injury), and serum AFP (measures hepatocyte regenerative proliferation and proliferation associated with oncogenic transformation) in a time course.

(2) Histological evaluation. Samples will be analyzed and scored in a blind fashion according to Dr. RogIer's scoring system described above.

(3) Survival curves will be generated.

Results from these experiments will demonstrate whether the lack of p27 in hepatocytes alters the kinetics and nature of this disease course and to what extent. We will pay particular attention to the degree of hepatocyte regenerative proliferation in livers of hepatocyte-specific p27 knockdown mice. The expectation is that p27-deficient hepatocytes will be able to proliferate more actively in this stage ofHCC development. If so, we will be able to determine whether this increased proliferation translates to faster progression to dysplasia, adenoma, or carcinomas.

Aim 2. To achieve p27 suppression in primary hepatocytes in culture, and to determine the biochemical effects of in vivo (Aim 1) and in vitro (Aim 2) p27 inactivation in cultured primary hepatocytes.

ll.ationale\and general design for Aim 2

1. Lentivirus-mediated inactivation of p27 in primary hepatocytes is the most feasible approach to manipulating the p27 gene in human hepatocytes.

When our knowledge of p27 inactivation in hepatocyte transplantation is to be extended to human cells, we will need to eneticall mani ulate the 27 ene in rim he atoc es isolated b liver erfusion.

S 398 (Rev. 05/01) Page 41 Number pages consecutively at the bottom throughout the application. Do not use suffixes such as 3a. 3b.

Principal Investigator/Program Director (Last, first, middle): Ochoa Erin R. It is clear that the most feasible approach to achieving this is the lentivirus-mediated gene transfer. The most advanced lentiviral vectors contain anl18-bp pol fragment containing a cPPTICTS element and have been shown to infect up to 66% of primary mouse hepatocytes in culture and retain expression from the vector after hepatocyte transplantation (Follenzi et al., 2000). We have established collaboration with Drs. Antonia Follenzi and Luigi Naldini (Diversity of Torino), and have obtained their cPPT/CTS containing lentivirus vector.

In addition to ectopically expressing the protein of choice, lentivirus vectors have more recently been used to deliver small hairpin RNA expressed from a pol ill promoter. Qin et al. used a lentivirus vector to transduce human peripheral blood T lymphocytes with pol ill-driven shRNAsto inactivate the mV-I coreceptor, CCRV (Qin et al., 2003). Also, G Barton and R Medzhitov used a retrovirus to deliver pol ill driven shRNAs to inactivate the human p53 gene in HEK293T cells and primary human fibroblasts (Barton and Medzhitov, 2002). The success of these studies was despite the reports that RNA viruses might themselves be sensitive to RNA interference (Gitlin et al., 2002; Jacque et al., 2002; Novina et aI., 2002). We believe that we can use the same technology to inactivate p27 in primary hepatocytes. Skp2 expression has already been delivered by an adenovirus vector (Nelsen et al., 2001). We believe lentirirus-mediated delivery of Skp2 will generate similar phenotypes in hepatocytes. These represent our most clinically relevant p27 targeting techniques.

Lentivirus vectors are also compatible with the tet-controlled expression system (Vigna et al., 2002). In fact, because mv-I-derived vectors target particular regions of the chromatin, they seem to anow more efficient transduction and robust regulation of expression. (Vigna et al. 2002). Thus, in the future, we have the potential to generate tet-regulated expression in lentivirus vectors to futher improve the p27 inactivation strategy.

2. The in vitro study of hepatocytes will determine the biochemical basis of observed phenotypic changes in p27-deficient hepatocytes.

Molecular biology studies with primary hepatocytes will be an important part of this project. Primary hepatocytes can be isolated from the mouse liver in sufficient quantity and purity to allow in vitro studies. Molecular biology experiments will then provide insight into the mechanics of the observed hepatocyte phenotypes and, therefore, offer the potential for further improvement of appropriate hepatocyte proliferation by rational design. Various hepatocyte culture conditions are available to study hepatocyte biology. Using serum-free media and EGF as an hepatocyte mitogen, it has been shown that p27 knockout hepatocytes were more active than wild type hepatocytes in their ability to enter S phase in the absence or presence of EGF. Biochemical assays showed that cyclin FlCdk2 complexes in p27 knockout hepatocytes contained more kinase activity, providing direct evidence for the kinase inhibitor role of p27 in hepatocytes. Primary p27 knockout hepatocytes, like the wild type hepatocytes, were not capable of sustained proliferation and expansion in serum-free media with EGF as a mitogen. These studies, as described in detail in Karnezis et al., form the framework of our in vitro studies with new p27 inactivation techniques.

3. Will p27 inactivation in vitro by lentivirus-mediated gene transfer have the same . effects as p27 inactivation in vivo in transgenic mice?

Once we have established efficient p27 suppression with lentivirus-mediated gene transfer and biochemical assays to characterize the p27 deficient hepatocytes isolated from various transgenic mice (Aim 1), we will compare, for one example, p27 deficient hepatocytes isolated form tetO-Skp2;Alb-tTA mice with wild type hepatocytes infected with Skp2 expressing lentivirus. Again, it is important to study this aspect of the lentivirus approach, since it is the only way to work with human hepatocytes. An important advantage of the in vitro studies is that if differences do exist, then biochemical assays will reveal underlying . molecular mechanisms (kinase activity, inhibitor binding, protein levels, protein subcellular localization).

Experimental design, methods, expectation, and data interpretation for Aim 2 i

i 1. Establish lentivirus-mediated p27 suppression in primary hepatocytes. As discussed in Preliminary studies, we haVe used the lentivirus system recently made available by Invitrogen. However, it has become clear from the work of Dr. Follenzi, who recently visited the Einstein Liver Center and will be coming to work at Einstein this summer, that the addition of the cPPT-CTS sequence significantly improved the efficiency of gene transfer (Follenzi et al., 2000; Vigna et aI., 2002).

fiAs 398 (Rev. 05/01) Page 42 Number pages consecutively at the bottom throughout the application. Do not use suffixes such as sa. 3b.

RRE cPPT-CTS

GA

Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R. We have obtained this advanced

dR3RU5 (LTR) lentivirus vector from Dr. Naldini. (the lab PI of Dr. Follenzi) as shown in figure 4. We will clone the Skp2 cDNA in the MCS under the CMV

Sacl~ promoter of this vector. ForpUC19 expression of p27shRNA, we

Wpre will swap the whole promotercDNA cassette, with SacI and

_____ RSV EcoRV with the U6-p27shRNA eGFP--IfJ shown in Figure 2.

MCS Establish high-efficiency lentiviral infection in primat:y hepatocytes. To establish the whole viral CMVor Alb production and hepatocyte infection procedures, we will fIrst use the GFP-expressing lentiviral vector shown in Figure 4. WeEcoRV will continue to use the helper plasmid mix provided in the Invitrogen lentivirus kit since the

Figure 4. Lentivirus vector vendor claims that this mix has Cis-acting sequences of the lentiviral vector which are indicated for been optimized for the highest maximal transduction efficiency include: cPPT-CTS sequence from virus yield. We will use the

293FT cells provided in the same the HIV-1 pol gene, the viral LTRs with the U3 deletion, the major kit for cotransfection with the splice donor site (SD), the encapsulation signal ('¥) including the lentivirus vectors and the helper 5' portion of the gag gene (GA), the Rev response element (RRE) plasmid mix. Media of theand splice .acceptor sites (SA) from the erlV gene, and the transfected cells will be harvested

posttranscriptional regulatory element of woodchuck hepatitis 48 hours after transfection as the virus (Wpre). The vector carries a cassette for the enhanced green viral stocks. Virus titers of the fluorescent portion (eGFP) driven by either CMV or Alb promoters. stocks will be detennined by To express Skp2, we will replace eGFP with the human Skp2 cDNA infection of the same 293FT cell in the MCS. For RNAi studies, the restriction sites Sacl and EcoRV and counting for GFP-positive will be used to replace CMV-eGFP-Wpre with the U6p27shRNA cells. We will use the viral stocks sequences. to infect primary mouse

hepatocytes, which will be isolated by the cell culture core of the Einstein Liver Center, in the presence of 8 Jlglml polybrene in serumfree media for 5-6 hours. The infected hepatocytes will then be cultured in regular media for daily observation under a fluorescent microscope to detennine the efficiency of infection. Our goal is to achieve up to 80% infection efficiency with these improved lentivirus v~tors (Follenzi et aI., 2000; Manganini et al., 2002; VandenDriessche et aI., 2002).

Establish high-efficiency lentiviral Skp2 and p27shRNA expression in primary hepatocytes. Once the whole procedure is established. we will move on to Skp2-expressing and p27shRNA-expressing lentiviruses. To titer these viral stocks. we will use the ultracentrifugation method routinely used by Dr. Follenzi. Stocks of sufficiently high titers, as compared with the GFP virus, will be used to infect primary hepatocytes (with GFP virus infection carried out in parallyl as control). At regular time points after infection, the infected primary hepatocytes will be subject to western blotting to determine the levels of p27 proteins. If we fail to suppress p27 protein levels after infection in the initial experiments, we will make sure that the infection with Skp2 and p27RNAi viruses are of sufficiently high efficiency. For Skp2. this can be done by determining the expression of Skp2 in individual hepatocytes by immunofluorescence staining. For p27shRNA, we will use RNA in situ hybridization with a probe against the antisense portion of the p27 h' in. It is conceivable that we rna encounter difficulties in the efficiency of infection with rim

S 398 (Rev. 05/01) . Page 43 Number pages consecutively at the bOttom throughout the application. Do not use suffixes such as 3a. 3b.

Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R. hepatocytes. However, we believe that such difficulties can be overcome by further concentrating the viral stocks. Again, Drs. Follenzi and Shafritz both have experience in this area and will be available for consultation.

2. In vitro biochemical and molecular studies to determine the effects and mechanisms of p27 suppression in hepatocytes

With primary hepatocytes isolated from various p27 inactivation mice or after successful infection with lentiviruses, we will perfonn the following experiments. For these experiments, at least three independent sets of experiments, each contains testing (p27 deficient) and control (p27 wild type) samples, will be performed. If the effects of p27 inactivation are not dramatic, more sets of experiments will be performed to allow statistic analysis. It is important to note that these studies will be carried out in parallel with hepatocytes isolated from the original p27 knockout mice as reported in Karnezis et aI., giving us a baseline for comparison.

Determination of Cdk2 kinase activity in time course of cell cycle reentry. We will conduct time course experiments from day 1 to day 3 of the primary culture to determine the activity of Cdk2 in various p27 deficient hepatocytes compared with wild type hepatocytes from littermates. We will perform Cdk.4 kinase assay when differences in Cdk2 kinases are identified. This experiment will be done in the presence or absence of EGF to determine whether any stimulus effects are dependent on hepatocyte mitogens.

Determination of cell cycle profiles. In the same culture conditions as above, we Will determine S phase entry of hepatocytes with two separate methods. Tritiated thymidine incorporation of the whole culture measures the total DNA synthesis activity, while BrdU labeling by immunofluorescence staining reveals the actual number of cells that are progressing through S phase. In previous studies we have found that the regular p27 knockout hepatocytes, like wild type hepatocytes, were unable to proliferate and expand in culture due to degeneration and apoptosis in culture. We will determine this property for the new p27 knockout and knockdown hepatocytes, as well as lentiviral transfection cultures.

Determination of the molecular perturbations to cyclinlCdk complexes in the absence of p27. Once we determine the time-course for abnormal activation of Cdk2, we will focus on one early post-gestational time point to investigate the reasons for the activation of Cdk2 kinase in the absence of p27 (or for the lack of Cdk2 kinase activation in the absence of p27, if this turns out to be the case).

We will determine the protein levels of relevant regulators including Cdk2, cyclin E, cyclin A, cyclin Dl, and Cdk4(6). This experiment will reveal whether the amounts of cyclins and Cdks could be a cause for any changes in the kinase activity.

We will determine the status of cyclinlCdk complex fonnation to reveal the "assembly factor" aspect of p27 since p27 is known to serve this function for the cyc1in D kinase complex. Specifically, we will determine how much cyclin D, Cdk4, cyclin E, and Cdk2 are present in cyclin D/Cdk4 and cyclin E/Cdk2 complexes by co-immunoprecipitation. For wild type cells, we will also determine how much p27 is associated with each cyc1in1Cdk complexes.

We will immuno-deplete p27 from wild type hepatocyte extracts. Cdk4 and Cdk2 in the extracts after depletion of p27 will be assayed for their amounts and kinase activity, compared with Cdk:4 and Cdk2 in extracts of p27 null hepatocytes. Theoretically, when the amounts of Cdk4 and Cdk2 in p27 null extracts and wild type extracts after p27 depletion are adjusted to be equal, the associated kinase activities should be similar, ifp27 only inhibits cyclinlCdk through binding.

If the binder function of p27 is not sufficient to explain any observed changes in kinase activity, we will examine other aspects of Cdk2 regulation, such as activating phosphorylation of Thrl60 and dephosphorylation of Tyrl5. Thrl60 phosphorylation of Cdk2 can be measured by the appearance of the faster migrating band of Cdk2 on Western blots. We can also determine whether and to what degree Cdk2 complexes from wild type and knockout hepatocyte extracts can be activated in vitro by CAK (cyclin HlCdk7IMatl), which phosphorylates Thrl60, or by Cdc25A, which dephosphorylates Tyr15. Results from this series of experimentS will shed light on the involvement ofp27 in Cdk2 phosphorylation.

3. Determination of whether the deregulation of Cdk2 kinase in p27 null hepatocytes affects their differentiation status.

AAs 398 (Rev. 05/01) Page 44 Number pages consecutively at the bottom throughout the application. Do not use suffixes such as 3a, 3b.

Principal Investigator/Program Director (Last, first, middle): Ochoa. Erin R. Wild type and p27 null hepatocytes in the time course after their plating, in parallel with studies

described above to study kinase regulation, will be subjected to Northern blot analysis to deteanine the kinetics of dedifferentiation. Expression of albumin and other liver specific gene will be detennined. From this experiment, we willieam how the changes in Cdk2 kinase and S phase entry affect the differentiation process.

4. Morphological analysis of the effects of p27 inactivation in primary hepatocyte culture.

A morphological analysis of the progressive effects of our various p27 inactivation techniques will parallel the biochemical studies described above.

Results from the above experiments will allow us to understand the molecular effects of p27 suppression. Based on our previous studies, we know that S phase entry measured by DNA synthesis markers (3H-thymidine and BrdU incorporation) will be more active in p27 deficient hepatocytes in the presence or absence of the hepatocyte mitogen EGF. Another easily detectable change in p27 deficient hepatocytes in culture is the highly elevated Cdk2 associated kinase activity. We predict that at: least these two parameters will be useful criteria in judging the effects of p27 inactivation by various methods in vivo and in vitro.

Aim 3. To determine whether and to what degree the knockdown of p27 in mature hepatocytes can improve proliferation after transplantation into a failing liver.

Rationale and general design for Aim 3

1. Determination of whether inactivation of p27 in mature hepatocytes can improve hepatocyte proliferation after transplantation will reveal more information about the role of p27 in hepatocytes and is more relevant to human hepatocyte transplantation.

We have shown that hepatocytes isolated from p27 knockout mice proliferated more actively after transplantation into the FAH null host and achieved higher efficiency in rescuing liver failure. Since p27 was knocked out in the germline of these mice, these hepatocytes completed their development program in the absence of p27 in the whole organism. As described for Specific Aim 1, we proposed a strategies to knockout p27 specifically in the liver and in adult animals (Mxl-Cre). The proliferation ability of hepatocytes obtained from these knockout mice after transplantation must next be carefully determined. ill addition to providing a better understanding of how p27 effects the proliferation of hepatocytes in vivo, transplantation experiments with the new p27-deficient hepatocytes are more relevant to the evaluation of human transplantation scenarios since inactivation of p27 in adult hepatocytes will be the only feasible approach to p27 targeting in human hepatocyte transplantation. Based upon results obtained from these transgenic mice, we will then move on to evaluating the transplantation of primary adult hepatocytes in which p27 knockdown is delivered by a lentivirus vector. Thus, successful transgenic transplantations will be followed up by the most clinically relevant transplantation procedures.

2. Transplantation of p27 deficient hepatocytes into less stimulus host environments to determine the extent of proliferation stimulation that inactivation of p27 in hepatocytes can achieve.

We have been using the FAH knockout mouse model to conduct our hepatocyte transplantation experiments. We will continue to use this model to study the new types of p27-deficient hepatocytes. However, the FAH null mice, when discontinued from NTBC treatment, offer a very strong stimulus host environment for the transplanted hepatocytes. Most host liver diseases that call for hepatocyte transplantation do not offer such a strong stimulus environment. The lack of a strong stimulus environment is one important reason for the failure o~ the transplanted hepatocytes to proliferate. We reasoned that a less stimulus environment will provide a more stringent test for the proliferation potential of p27-deficient hepatocytes. It is known that, while FAR mice discontinued from NTBC treatment offer strong proliferation stimulus to transplanted hepatocytes, FAH null mice on full NTBC treatment do not provide any proliferation stimulus to the transplanted wild type hepatocytes. We reasoned that we should be able to create a less stimulus host environment for the transplanted hepatocytes by providing partial NTBC treatment. If the new ty es of 27-deficient he atoc tes show more active roliferation than wild t e


Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R. hepatocytes in the less stimulus host environment, it will provide further support for the potential usefulness of the new concept of targeting p27 to benefit hepatocyte transplantation.

Experimental design, methods, expectation, and data interpretation for Aim 3

1. Determination of the proliferation potential of p27 deficient hepatocytes after transplantation into FAH null mice.

We have chosen FAH (fumarylacetoacetate hydrolase) null mice for transplantation experiments. FAH is the last enzyme in the tyrosine degradation pathway. Mice with targeted inactivation of the FAH genes accumulate tyrosine metabolic intennediates, which are toxic to hepatocytes. This toxicity leads to hepatocyte injury and liver failure in about two months (Grompe et al., 1993). These animals, however, can be maintained in a healthy state by treatment with NTBC [2-(2-nitro-4-trifluoro-methylbenzyol)-1,3 cyclohexanedione) in the drinking water, since NTBC inhibits the proximal degradation enzyme of the tyrosine pathway to prevent the production of hepatotoxic catabolites (Grompe et al., 1995). On the day of transplantation, NTBC is withdrawn from the drinking water. Since the FAH mouse is a deletion mutant, spontaneous reversion, and therefore overgrowth of the reverted hepatocytes, is not a concern.

We have collaborated with Dr. Grompe to use the two new aspects of the FAR transplantation model to determine the proliferation potential ofp27 knockout hepatocytes. Dr. Grompe has found that it is possible to repopulate the livers of FAR null mice with allogeneic hepatocytes in the absence of immunosuppressive drugs. This is likely due to the immunosuppressive action of succinylacetone (Tschudy et al., 1982), the key metabolite accumulated in tyrosinemia. We postulated that allogeneic hepatocytes with more active proliferation potentials may have an advantage in rescuing the liver failure under this less optimal transplantation condition, which more closely resembles human hepatocyte transplantation where only allogeneic donor cells are available. With these considerations, we used wild type or p27 null mice on the 129/Sv x C57BU6 hybrid background as donors and FAR null mice on 129/Sv background as recipients. In addition, Dr. Grompe has found that male FAH null mice die from more acute liver failure than female FAH null mice after NTBC withdrawal. We have therefore used male FAR mice as recipients, assuming they might be more likely to reveal the differences between p27 null and wild type donor cells. Our results from these experiments show that p27 knockout mice have improved proliferation ability to better rescue the FAH mice than wild type hepatocytes (Karnezis et aI., 2oo1a).

For consistency, we will use the same transplantation protocol to study the new p27 deficient hepatocytes. lx105 hepatocytes from male mice on a mixed (129/C57) background will be transplanted to male FAR null mice on pure 129 background by splenic injection and NTBC treatment discontinued. Body weights of the hosts will be detennined three times a week and recorded. Both the body weight and survival data will be tabulated and analyzed. The extent of donor hepatocyte proliferation will be determined by semi-quantitative PCR and immunohistochemical studies will be perfonned with anti-FAH antibody to visualize the donor cells for the extent of proliferation and architecture of the proliferative clusters. All these methods have been described in detail in our recent publication (Karnezis et al., 2001a).

We will first focus on induction ofp27 knockout at two months of age (p2710xllox;M:xl-Cre); The use of lentivirus-delivered p27shRNA-or Skp2-expressing hepatocytes will be dependent upon their phenotypes in the liver. If they have a strong phenotype, we will determine their proliferation after transplantation as well (although any effects from Skp2 overexpression can also come from mechanisms other than the inactivation of p27).

The results of these experiments are difficult to predict. Two alternatives are plausible. It may be that in the absence of p27 in embryogenesis, hepatocytes in the p27 knockout mice never truly entered the quiescent state (like p27 wild type hepatocytes) and, therefore, were able to enter the cell cycle and proliferate more easily. If this was the case, hepatocytes with their p27 inactivated later in life may not be more active in proliferation after transplantation. Alternatively, it may be that adaptation and compensation mechanisms have reduced'the stimulation that the inactivation ofp27 in a mature hepatocyte could have achieved, and hepatocytes with induced. p27 knockout in adult stage will, therefore, display more proliferation after transplantation. If thelatter is the case, then we will move on to use hepatocytes from mice in which induction ofp27 knockout is done at older (one year) age and in vitro (as described in Specific Aim 2).

2. Establishment of a "partial stimulation" FAH model to determine the extent of proliferation stimulation obtained by p27 inactivation in hepatocytes. i'RS 398 (Rev. 05/01) Page 46 Number pages consecutively at the bottom throughout the application. Do not use suffixes such as sa. 3b.

----------

50 +-----+-----t---~

Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R. At the concentration we currently

180 Jlg/liter NTBC in drinking water use (7.5 mglliter), FAH null mice are healthy since their hepatocytes do not accumulate toxic tyrosine degradation intermediates maleylacetoacetate (MAA)

100 and fumarylacetoacetate (FAA). In this condition, transplanted FAH wild type

1-+-38U I hepatocytes do not proliferate. To ~39R determine the dosages of NTC that will

1 -i.:- 40l I yield a moderate liver failure and 75 therefore a less stimulus environment for 1--*-41RR I

~ the donor cells, we have reduced NTBCo 1-.-42ll concentration down to 30% and 2.5% of the full strength (7.5 mglliter) in the drinking water of adult FAH null mice. We have measured the body weights of these mice for a period of two months o 20 40 60 now and found that even at 2.5 % of the

days full dose (180 j.lglliter), FAH mice have not lost weight (Figure 5). Whether these mice have developed partial liver Figure 5. Mouse body weights after NTBC concentration in failure will be determined by liver drinking water was reduced to 180 ~g/Iiter (2.5% of the function tests (alanine aminotransferase

full-strength) at day O. A group of five 2-month old FAH (ALT), unconjugated bilirubin). If theymale mice were used in this experiment. already partial liver failure, we will use

this dosage of NTBC to treat FAH null mice after hepatocyte transplantation. If they do not have indications of liver failure, we will test lower NTBC concentrations until we identify a concentration that will cause partial liver failure as measured by liver function tests.

We will then transplant hepatocytes (we will start with the type of p27 deficient hepatocytes that showed the most proliferation in the regular FAH transplantation procedure and compare them with wild type hepatocytes) into FAH null hosts and switch to partial NTBC treatment. In this transplantation scenario, weight loss may become less an indicator of the efficiency of proliferation by the donor cells. The measurement of proliferation extent by the donor cells will be visualized by FAH staining for the donor cells and quantitated by semi-quantitative PCR at different time points. We anticipate that, due to the lack of a strong stimulus host environment, it will take longer than two months to achieve significant proliferation of donor cells and, therefore, we will collect samples for longer than two months (the exact time points will be determined by the initial results). In this scenario of longer-term observation, we will use congenic hepatocytes for transplantation and will also pay attention to tumor development in the host liver. As always, at least five mice will be used for each transplantation (with a particular type of donor hepatocytes) and three independent experiments will be performed to reach a conclusion.

In all of these transplantation studies we begin with Mx1-Cre hepatocytes because they most closely resemble our baseline whole-mouse p27 knockout hepatocytes, and therefore represent the greatest chance of rescuing failing hosts. Depending upon the phenotypes ofletiviral-mediated tetO-Skp2 overexpression and tetO-p27shRNA, we will test these next. If successful, our most clinically relevant results will be from lentiviral tetO-p27shRNA into a partial stimulation FAH modeL

Estimated timetable for completion of the proposed studies.

p27 loxllox mice will be available before the beginning of the grant period. The mating of p27 loxllox to Mx I-Cre transgenies will then begin, and it will take 6-12 moths to generate sufficient numbers of mice. TetO-Skp2 mice have reached the stage of mating founders. Matings with Alb-rTA will proceed as mice become available and Skp2 overexpression studies and mating with Alb-HBV transgenics will begin as mice become available. The activity of tetO-p27shRNA is being tested in culture. Transgenic mice will be generated once desired activity has been confIrmed. Aim I will proceed as mice become available, and Ii~s 398 (Rev. 05/01) . Page 47 Number pages consecutively 'lit the bottom throughout the appficalion. Do not use suffixes suCh as 3a, 3b.

Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R. should take 2-3 years. HCC studies will take 1-2 years as mice become available. For Aim 2, in vitro studies involving knockout mice can begin when mice become available in year 2 of the grant Lentivirus knockdown studies will begin within the next six months. Characterization of primary hepatocyte cell cultures will be ongoing for 2-3 years in each of these systems. Aim 3 can be carried out in paranel with Aim2. Transplantation results take longer to obtain and analyze, and will continue well into year 4. Finally, extra time can be used to explore extensions of our primary results to other liver failure models.

e. Human Subjects. None.

f. Vertebrate Animals.

1. Description of proposed animal use.

Proposed use of mice. p27 loxllox mice will be obtained from Dr. Hiroaki Kiyokawa (University of Dlinois). FAR null mice were provided by Dr. M. Grompe (Oregon Health Science University) and are maintained on NTBC treated water. Alb-HEV transgenic mice have been and Mxl-Cre mice will be purchased from Jackson Lab. Alb-tTA mice will be obtained from Dr. Jack Liang (Nlli). Generation of all mice described in Aim 1 mice will be accomplished at the Einstein Mouse Transgenic Facility. All animal use is approved by the Animal Institute of the Albert Einstein College of Medicine.

Preparation ofhepatocytes by liver perfusion. p27-/- mice and their wild type littennate conlrols will be used as donors of hepatocytes for culture and transplantation to determine and compare their proliferation potential. We will use the two-step collagenase perfusion protocol. This is a non-survival operation. Mice will be anesthetized with injection of Avertin (section 4 below). The abdomen will be opened through a midline incision. The liver will be perfused through the portal vein sequentially with EGTA solution, Leffert's solution and collagenase solution. After beginning the perfusion the mouse is killed by opening the thorax. Following collagenase digestion, the liver is removed from the body, minced, and hepatocytes harvested by Percoll centrifugation.

Hepatocyte transplantation. FAH null mice will be used as hosts for hepatocyte transplantation. We will use the intrasplenic injection protocol of hepatocyte transplantation. The abdomen is prepared by removing the hair and cleansing with an antiseptic. The spleen is exposed through a left subchondral incision and is secured by a suture passed through the splenic mesentery. A 26-gauge needle is inserted into the splenic pulp and 1 x 1cP viable hepatocytes in a volume of 50 microliters are slowly injected. The needle is withdrawn and hemostasis is achieved by tightening the suture around the puncture site.. Post-surgical monitoring will follow routine protocols.

The liver functions ofFAH null mice are maintained by treating them with 2-(2-nitro-4-trifluoromethylbenzyol)-1,3-cyclohexanedione (NTBC). NTBC (provided by Swedish Orphan AB) is added to the drinking water to a concentration of 7.5 mg/liter. Mter withdrawal ofNTBC from the drinking water, FAR null mice will lose weight and die by about two months. If the proliferation of transplanted hepatocytes (FAR positive) is successful, these mice will regain partial or complete liver function, achieve weight-gain, and survive beyond two months.

Recipient mice will be sacrificed at one and two months after transplantation to obtain liver samples to examine the proliferation of transplanted hepatocytes.

2. Justification of animal use. The overall goal of this study is to determine the functions of the cyclin-dependent kinase inhibitor

p27 in hepatocyte proliferation. The most physiologically relevant form of hepatocyte proliferation is that during liver regeneration and after hepatocyte lransplantation into the appropriate host liver. As such, it is necessary to use animals. Non-animal a1~ernatives are currently not available. Culture-based hepatocyte growth regulation also provides a valid experimental system to study the functions of p27 in hepatocyte proliferation. Cultured based experimental system, however, does not reproduce the growth regulation in the liver in whole animals. Mice are chosen due to the availability of p27 null slrains and various other genetically altered strains as proposed.

fias 398 (Re~. 05{01) Page 48 Number pages consecutively at the bottom throughout the application. Do not use suffixes such as Sa, 3b.

Principallnvestigator/Program Director (Last, first, middle): Ochoa, Erin R. I have performed Medline literature search and have determined that alternatives to procedures that

may cause more than momentary pain or distress are not available.

3. Veterinary care. Three full-time veterinarians participate in our program of care and use. Veterinary care ineludes a

program for prevention of disease, daily observation and surveillance for assessment of animal health; appropriate methods of disease control, diagnosis, and treatment; guidance of animal users in appropriate methods of handling, restrain, anesthesia, analgesia, and euthanasia; and monitoring of surgical. programs and post-surgical care.

4. Description of procedures for minimizing discomfort, distress, pain, and euthanasia method.

Mice are anesthetized with Avertin, 0.015 ml of a 2.5% solution/gram of body weight, intraperitoneal injection (IP). Successful anesthesia is confIrmed by the absence of corneal and toe-pinch reflexes, which is also monitored during the surgical procedure to ensure that the mice are anesthetized throughout the procedure. When experiments end, animals are killed by cervical dislocation. This method is consistent with the recommendation of the AVMF Panel on Euthanasia

g. Literature Cited. Alessandrini, A., Chiaur, D. S., and Pagano, M. (1997). Regulation of the cyelin-dependent kinase inhibitor p27 by degradation and phosphorylation. Leukemia i1, 342-345. Barton, G. M., and Medzhitov, R (2002). Retroviral delivery of small interfering RNA into primary cells. Proc Nat! Acad Sci USA 99,14943-14945. Bloom, J., and Pagano, M. (2003). Deregulated degradation of the cdk inhibitor p27 and malignant transformation. Semin Cancer Bioi 13, 41-47. Braun, K. M., Degen, J. L., and Sandgren, E. P. (2000). Hepatocyte transplantation in a model of toxininduced liver disease: variable therapeutic effect during replacement of damaged parenchyma by donor cells. Nat Med 6, 320-326. Brummelkamp, T. R., Bernards, R, and Agami, R (2002). Stable suppression of tumorigenicity by virusmediated RNA interference. Cancer Cell 2, 243-247. Caplen, N. J., Fleenor, J., Fire, A., and Morgan, R. A. (2000). dsRNA-mediated gene silencing in cultured Drosophila cells: a tissue culture model for the analysis of RNA interference. Gene 252, 95-105. Chen, P., and Segil, N. (1999). p27(Kipl) links cell proliferation to morphogenesis in the developing organ of Corti. Development i26, 1581-1590. Chen, T. C., Ng, K. E, Lien, J. M., Jeng, L. B., Chen, M. F., and Hsieh, L. L. (2000). Mutational analysis of the p27(kipl) gene in hepatocellular carcinoma. Cancer Lett 153,169-173. Cheng, T., Rodrigues, N., Dombkowski, D., Stier, S., and Scadden, D. T. (2000). Stem cell repopulation efficiency but not pool size is governed by p27Kipl. Nat Medicine 6, 1235-1240. Chin, L., Tam, A., Pomerantz, J., Wong, M., Holash, J., Bardeesy, N., Shen, Q., O'Hagan, R., Pantginis, J., Zhou, R., et al. (1999). Essential role for oncogenic Ras in tumour maintenance. Nature 400, 468-472. Chisari, F, Y., Filippi, P., Buras, J., McLachlan, A., Popper, H., Pinkert, C. A., Palmiter, R. D., and Brinster, R L. (1987). Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice. Proc Nat! Acad Sci USA 84, 6909-6913. Chisari, F. Y., Klopchin, K., Moriyama, T., Pasquinelli, c., Dunsford, H. A., Sell, S., Pinkert, C. A., Brinster, R. L., and Palmiter, R. D. (1989). Molecular pathogenesis of hepatocellular carcinoma in hepatitis B virus transgenic mice. Cell 59, 1145-1156. Clurman, B. E., Sheaff, R. J., Thress, K., Groudine, M., and Roberts, J. M. (1996). Turnover of cyelin E by the ubiquitin-proteasome pathway'~s regulated by cdk2 binding and cyelin phosphorylatin. Genes Dev 10, 1979-1990. \ Cottrell, T. R., and Doering, T. L. (2003)., Silence of the strands: RNA interference in eukaryotic pathogens. Trends Microbiolil, 37-43. ' Eferl, R, Ricci, R., Kenner, L., Zenz, R., David, J. P., Rath, M., and Wagner, E. F. (2003). Liver Tumor Development. c-Jun Antagonizes the Proapoptotic Activity of p53. Cellii2, 181-192.

1iRs 398 (Rev. 05/01) Page 49 Number pages consecutively at the bottom throughout the application. Do not use suffixes such as sa. 3b.

-

------

Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R. Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001). Duplexes of 21-nueleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411,494-498. Fang, E, arend, G., Watanabe, N., Hunter, T.; and Ruoslahti, E. (1996). Dependence of cyelin E-CDK2 kinase activity on cell anchorage. Science 271,499-502. Fero, M. L., Randel, E., Gurley, K. E., Roberts, J. M., and Kemp, C. J. (1998). The murine gene p27Kipl is haplo-insufficient for tumour suppression. Nature 396, 177-180. Fiorentino, M., Altimari, A., D'Errico, A., Cukor, B., Barozzi, C., Loda, M., and Grigioni, W. E (2000). Acquired expression of p27 is a favorable prognostic indicator in patients with hepatocellular carcinoma. Clin Cancer Res 6, 3966-3972. Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391,806-811. Follenzi, A., Ailles, L. E., Bakovic, S., Geuna, M., and Naldini, L. (2000). Gene transfer by lentiviral vectors is limited by nuclear translocation and rescued by HIV-1 pol sequences. Nat Genet 25, 217-222. Gitlin, L., Karelsky, S., and Andino, R (2002). Short interfering RNA confers intracellular antiviral immunity in human cells. Nature 418, 430-434. Grompe, M., al-Dhalimy, M., Finegold, M., au, C., Burlingame, T., Kennaway, N. G., and Soriano, P. (1993). Loss of fumarylacetoacetate hydrolase is responsible for the neonatal hepatic dysfunction phenotype of lethal albino mice. Genes Dev 7, 2298-2307. Grompe, M., Lindstedt, S., al-Dhalimy, M., Kennaway, N. G., Papaconstantinou, J., Torres-Ramos, C. A., Ou, C. N., and Finegold, M. (1995). Pharmacological correction of neonatal lethal hepatic dysfunction in a murine model of hereditary tyrosinaemia type I. Nature Genetics 10, 453-459. Gstaiger, M., Jordan, R, Lim, M., Catzavelos, C., Mestan, J., Slingerland, 1., and Krek, W. (2001). Skp2 is oncogenic and overexpressed in human cancers. Proc Natl Acad Sci USA 98,5043-5048. Hannon, G. J. (2002). RNA interference. Nature 418, 244-251. . Hasuwa, H., Kaseda, K., Einarsdottir, T., and Okabe, M. (2002). Small interfering RNA and gene silencing in transgenic mice and rats. FEBS Lett 532, 227-230. Huang, S. N., and Chisari, F. V. (1995). Strong, sustained hepatocellular proliferation precedes hepatocarcinogenesis in hepatitis B surface antigen transgenic mice. Hepatology 21, 620-626. Ito, Y., Matsuura, N., Sakon, M., Miyoshi, E., Noda, K., Takeda, T., Umeshita, K., Nagano, H., Nakamori, S., Dono, K., et al. (1999). Expression and prognostic roles of the GI-S modulators in hepatocellular carcinoma: p27 independently predicts the recurrence. Hepatology 30, 90-99. Jacque, J. M., Triques, K., and Stevenson, M. (2002). Modulation ofHIV-1 replication by RNA interference. Nature 418,435-438. Jhappan, C., Stahle, C., Harkins, R. N., Fausto, N., Smith, G. H., and Merlino, G. T. (1990). TGF alpha overexpression in transgenic mice induces liver neoplasia and abnormal development of the mammary gland and pancreas. Cell 61, 1137-1146. Karnezis, A. N., Dorokhov, M., Grompe, M., and Zhu, L. (2001a). Loss ofp27(Kipl) enhances the transplantation efficiency of hepatocytes transferred into diseased livers. J Clin Invest 108, 383-390. Karnezis, A. N., Dorokhov, M., Grompe, M., and Zhu, L. (2001b). Loss ofp27(Kipl) enhances the transplantation efficiency of hepatocytes transferred into diseased livers. J elin Invest 108, 383-390. Kawasaki, H., and Taira, K. (2003). Short hairpin type of dsRNAs that are controlled by tRNA(Val) promoter significantly induce RNAi-mediated gene silencing in the cytoplasm of human cells. Nucleic Acids Res 31, 700-707. Kiyokawa, H., Kineman, RD., Manova-Todorova, K., Soares, V. c., Hoffman, E. S., Ono, M., Khanam, D., Hayday, A. C., Frohman, L. A., and Koff, A. (1996). Enhanced growth of mice lacking the cyelin-dependent kinase inhibitor function ofp27Kipl. Cell 85, 721-732. Koepp, D. M., Schaefer, L K., Ye, X., Keyomarsi, K., Chu, C., Harper, J. W., and Elledge, S. J. (2001). Phosphorylation-dependent ubiquitination of eyclin E by the SCFFbw7 ubiquitin ligase. Science 294,173-177. Kops, G. J., de Ruiter, N. D~, De Vries:"Smits, A. M., Powell, D. R., Bos, J. L., and Burgering, B. M. (1999). Direct control of the Forkhead transcription factor AFX by protein kinase B. Nature 398,630-634. Koyama, R., Raines, E. W., Bornfeldt, K. E., Roberts, J. M., and Ross, R (1996). Fibrillar collagen inhibits arterial smooth musele proliferation through regulation of Cdk2 inhibitors. Cell 87, 1069-1078.

pQs 398 (Rev. 05/01) Page 50 Number pages consecutively at the bOttom throughout the application. Do not use suffixes such as sa. 3b.

------ -

Principallnvestigator/Program Director (Last, first, middle): Ochoa, Erin R. Kuhn, R., Schwenk, F., Aguet, M., and Rajewsky, K. (1995). Inducible gene targeting in mice. Science 269, 1427-1429. Latres, E., Chiarle, R., Schulman, B. A., Pavletich, N. P., Pellicer, A., Inghirami, G., and Pagano, M. (2001), Role of the F-box protein Skp2 in lymphomagenesis, Proc Natl Acad Sci USA 98, 2515-2520. Lewis, D. L., Hagstrom, J. E., Loomis, A. G., Wolff, J. A., and Herweijer, H. (2002). Efficient delivery of siRNA for inhibition of gene expression in postnatal mice. Nat Genet 32, 107-108. Lowenheim, H., Furness, D. N., Kil, J., Zinn, C., Gultig, K., Fero, M. L., Frost, D., Gummer, A. W., Roberts, J. M., Rubel, E. W., et ai. (1999). Gene disruption of p27(Kip1) allows cell proliferation in the postnatal and adult organ of corti. Proc Nat! Acad Sci (USA) 96, 4084-4088. Manganini, M., Serarmi, M., Bambacioni, E, Casati, C., Erba, E., Follenzi, A., Naldini, L., Bernasconi, S., Gaipa, G., Rambaldi, A., et ai. (2002). A human immunodeficiency virus type 1 pol gene-derived sequence (cPPT/CTS) increases the efficiency of transduction of human nondividing monocytes and T lymphocytes by lentiviral vectors. Hum Gene Ther 13, 1793-1807. Manickan, E., Satoi, J., Wang, T. C., and Liang, T. J. (2001). Conditional liver-specific expression of simian virus 40 T antigen leads to regulatable development of hepatic neoplasm in transgenic mice. J BioI Chern 276, 13989-13994. Marti, A., Wirbelauer, c., Scheffner, M., and Krek, W. (1999). Interaction between ubiquitin-protein ligase SCFSKP@ and E2F-l underlies the regulation of E2F-l degradation. Nat Cell BioI}, 14-19. McCaffrey, A. P., Meuse, L., Pham, T. T., Conklin, D. S., Hannon, G. J., and Kay, M. A. (2002). RNA interference in adult mice. Nature 418,38-39. Medema, R H., Kops, G. J., Bos, J. L., and Burgering, B. M. (2000). AFX-like Forkhead transcription factors mediate cell-cyele regulation by Ras and PKB through p27kipl. Nature 404, 782-787. Mignon, A., Guidotti, 1. E., Mitchell, C., Fabre, M., Wernet, A., De La Coste, A., Soubrane, 0., Gilgenkrantz, H., and Kahn, A. (1998). Selective repopulation of normal mouse liver by Fas/CD95resistant hepatocytes. Nat Med 4, 1185-1188. Minamishima, Y. A., and Nakayama, K. (2002). Recovery of liver mass without proliferation of hepatocytes after partial hepatectomy in Skp2-deficient mice. Cancer Res 62, 995-999. Moberg, K. H., Bell, D. W., Wahrer, D. C., Haber, D. A., and Hariharan, I. K. (2001). Archipelago regulates Cyelin E levels in Drosophila and is mutated in human cancer cell lines. Nature 413,311-316. Morgan, D. O. (1997). Cyelin-dependent kinases: engines, clocks, and microprocessors. AnTIu Rev Cell & Dev..BioI13,261-291. Nakayama, K., Nagahama, H., Minamishima, Y. A., Matsumoto, M., Nakamichi, I., Kitagawa, K., Shirane, M., Tsunematsu, R., Tsukiyama, T. I., shida, N., et aI. (2000). Targeted disruption of Skp2 results in accumulation of cyclin E and p27(Kip1), polyploidy and centrosome overduplication. EMBO J 19, 2069-2081. Naldini, L., Blomer, U., Gage, F. H., Trono, D., and Verma, I. M. (1996). Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Froc Natl Acad Sci USA 93, 11382-11388. . Nelsen, C. J., Hansen, L. K., Rickheim, D. G., Chen, C., Stanley, M. W., Krek, W., and Albrecht, J. H. (2001). Induction of hepatocyte proliferation and liver hyperplasia by the targeted expression of cyelin E and skp2. Oncogene 20, i825-1831. Nguyen, T. H., Oberholzer, J., Birraux, J., Majno, P., Morel, P., and Trono, D. (2002). Highly efficient lentiviral vector-mediated transduction of nondividing, fully reimplantable primary hepatocytes. Mol Ther 6, 199-209. Novina, C. D., Murray, M. F., Dykxhoorn, D. M., Beresford, P. J., Riess, J., Lee, S. K., Collman, R. G., Lieberman, J., Shankar, P., and Sharp, P. A. (2002). siRNA-directed inhibition of HN-1 infection. Nat Med 8,681-686. Ochoa, E. R, and Vacanti, J. P. (2002). An Overview of the Pathology and Approaches to Tissue Engineering. Ann NY Acad Sci 979,10-26. Ohkawa, J., and Taira, K. (2000). Control of the functional activity of an antisense RNA by a tetracyelineresponsive derivative of the human U6 snRNA promoter. Hum Gene Ther 11,577-585. Overturf, K., AI-Dhalimy, M., Tanguay, R, Brantly, M., Ou, C. N., Finegold, M., and Grompe, M. (1996). Hepatocytes corrected by gene therapy are selected in vivo in a murine model of hereditary tyrosinaemia type I. Nature Genetics 12, 266-273. p~s 398 (Rev. 05/01) Page 51 "lurnber pages consecutively at the bottom throughout the application. 00 not use suffixes such as 3a, 3b.

... Principal Investigator/Program Director (Last, first, middle): Ochoa, Erin R.

Paddison, P. J., Caudy, A. A., Bernstein, E., Hannon, G. J., and Conklin, D. S. (2002). Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev 16,948-958. Qin, X. F., An, D. S., Chen, 1. S., and Baltimore, D. (2003). Inhibiting HIV-l infection in human T cells by lentiviral-mediated delivery of small interfering RNA against CCR5. Proc Natl Acad Sci USA 100, 183-188. Reynisd6ttir, 1., Polyak, K., Iavarone, A., and Massague, J. (1995). Kip/Cip and Ink4 Cdk inhibitors

cooperate to induce cell cycle arrest in response to TGF-p. Genes Dev 9, 1831-1845. Sandgren, E. P., Luetteke, N. c., Palmiter, RD., Brinster, R. L., and Lee, D. C. (1990). Overexpression of TGF alpha in transgenic mice: induction of epithelial hyperplasia, pancreatic metaplasia, and carcinoma of the breast. Cell 61, 1121-1135. Sandgren, E. P., Palmiter, R D., Heckel, J. L., Daugherty, C. C., Brinster, R L., and Degen, J. L. (1991). Complete hepatic regeneration after somatic deletion of an albumin-plasminogen activator transgene. Cell 66, 245-256. Schonig, K., Schwenk, F., Rajewsky, K., and Bujard, H. (2002). Stringent doxycycline dependent control of CRE recombinase in vivo. Nucleic Acids Res 30, e134. Strohmaier, H., Sprock, C. H., Kaiser, P., Won, K. A., Sangfelt, 0., and Reed, S. 1. (2001). Human Fbox protein hCdc4 targets cyclin E for proteolysis and is mutated in a breast cancer cell line. Nature 413, 316-322. Sutterluty, H., Chatelain, E., Marti, A., Wirbelauer, C., Senften, M., Muller, D., and Krek, W. (1999). p45SKP2 promotes p27Kipi degradation and induces S phase in quiescent cells. Nature Cell Biology 1, 207-214. Tschudy, D. P., Hess, R A., Frykholm, B. c., and Blaese, R. M. (1982). Immunosuppressive activity of succinylacetone. J Lab Clin Med 99, 526-532. Tuschl, T. (2002). Expanding small RNA interference. Nat Biotechnol 20, 446-448. Tuttle, R L., Gill, N. S., Pugh, W., Lee, J. P., Koeberlein, B., Furth, E. E., Polonsky, K. S., Naji, A., and Birnbaum, M. J. (2001). Regulation of pancreatic beta-cell growth and survival by the serine/threonine protein kinase Aktl/PKBalpha. Nat Med 7, 1133-1137. Di-Tei, K., Zenno, S., Miyata, Y., and Saigo, K. (2000). Sensitive assay of RNA interference in Drosophila and Chinese hamster cultured cells using fIrefly luciferase gene as target. FEBS Lett 479, 79-82. Drlinger, S., Baron, D., Thellmann, M., Hasan, M. T., Bujard, H., and Hillen, W. (2000). Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc Nat! Acad Sci USA 97, 7963-7968. VandenDriessche, T., Thorrez, L., Naldini, L., Follenzi, A., Moons, L., Berneman, Z., Collen, D., and Chuah, M. K. (2002). Lentiviral vectors containing the human immunodefIciency virus type-l central polypurine tract can efficiently transduce nondividing hepatocytes and antigen-presenting cells in vivo. Blood 100, 813-822. Vigna, E., Cavalieri, S., Ailles, L., Geuna, M., Loew, R, Bujard, H., and Naldini, L. (2002). Robust and efficient regulation of transgene expression in vivo by improved tetracycline-dependent lentiviral vectors. Mol Ther 5,252-261. Volarevic, S., Stewart, M. J., Ledermann, B., Zilberman, F., Terracciano, L., Montini, E., Grompe, M., Kozma, S. C., and Thomas, G. (2000). Proliferation, but not growth, blocked by conditional deletion of 40S ribosomal protein S6. Science 288,2045-2047. Xia, H., Mao, Q., Paulson, H. L., and Davidson, B. L. (2002). siRNA-mediated gene silencing in vitro and in vivo. Nat Biotechnol20, 1006-1010. Yang, X., Bhaumik, M., Bhattacharyya, R, Gong, S., RogIer, C. E., and Stanley, P. (2000). New evidence for an extra-hepatic role of N-acetylglucosaminyltransferase ill in the progression of diethylnitrosamine-induced liver tumors in mice. Cancer Res 60,3313-3319. Zindy, F., Cunningham, J. J., Sherr, C. J., Jogal, S., Smeyne, R J., and Roussel, M. F. (1999). Postnatal neuronal proliferation in mice lllcking Ink4d and Kipl inhibitors of cyclin-dependent kinases. Proc Natl Acad Sci (USA) 96, 13462-13467.

pAs 398 (Rev. 05/01) Page 52 Number pages consecutively at LlJe bottom throughout the application. Do not use suffixes such as 38. 3b.

o'

Documents

01:22:03 NIDDK K08 Targeting p27kip1 to Improve Hepatocyte Transplantation (Doc 154-6:3:09 Exhibit 1.2)