89
Supplemental Figure S1. Phenylpropanoid and riboflavin biosynthesis pathways. Transcriptomic data obtained for genes encoding enzymes involved in the phenylpropanoid and riboflavin biosynthesis pathways in Arabidopsis (A) and Medicago (B). Red and green arrows indicate up- and down-regulation of the genes, the weight of the arrows is proportional to the delta RPKM between Fe-deficient and Fe-sufficient plants on a log10 scale. 1

 · Web viewSupplemental Figure S1. Phenylpropanoid and riboflavin biosynthesis pathways. Transcriptomic data obtained for genes encoding enzymes involved in the phenylpropanoid and

  • Upload
    vothu

  • View
    217

  • Download
    0

Embed Size (px)

Citation preview

Supplemental Figure S1. Phenylpropanoid and riboflavin biosynthesis pathways. Transcriptomic data obtained for genes encoding enzymes involved in the phenylpropanoid and riboflavin biosynthesis pathways in Arabidopsis (A) and Medicago (B). Red and green arrows indicate up- and down-regulation of the genes, the weight of the arrows is proportional to the delta RPKM between Fe-deficient and Fe-sufficient plants on a log10 scale.

1

Supplemental Figure S2. Influence of the pH on growth on available Fe media. Plant photos (A) and leaf fresh weight measurements (B) of col-0, f6’h1-1 and pdr9-2 plants grown on available Fe conditions at normal (5.5) and high pH (7.0). No statistical differences were observed between treatments or genotypes (Duncan test, p<0.05).

2

Supplemental Table S1. Arabidopsis - Medicago orthologs of differentially expressed genes. ΔAt and ΔMt denote delta RPKM values.

At ID Mt ID Symbol Description ΔAt ΔMtOrthologs regulated in both species

AT1G01580 Medtr7g038510 FRO2 ferric reduction oxidase 2 754.1 135.24

AT3G07720 Medtr2g069030 Galactose oxidase/kelch repeat superfamily protein 593.35 1258.2

AT1G77120 Medtr3g089940 ATADH1 alcohol dehydrogenase 1 201.43 348.41

AT3G52880 contig_58737_1 MDAR1 monodehydroascorbate reductase 1 180.95 250.96

AT5G37600 Medtr3g065250 GSR 1 glutamine synthase clone R1 170.88 220.19

AT3G56970 Medtr7g090410 bHLH038 basic helix-loop-helix (bHLH) DNA-binding superfamily protein 144.41 150.35

AT1G48300 Medtr4g124080 DGAT3 diacylglycerol O-acyltransferase 143.56 192.38

AT3G50740 Medtr5g019580 UGT72E1 UDP-glucosyl transferase 72E1 138.38 345.36

AT4G14710 contig_55373_1 ATARD2 RmlC-like cupins superfamily protein 107.22 145.99

AT2G28160 contig_81683_1 FIT1 FER-like regulator of iron uptake 101.76 166.13

AT1G09780 Medtr7g074570 iPGAM1 Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent 88.83 720.4

AT4G16370 contig_54432_2 OPT3 oligopeptide transporter 80.6 576.27

AT2G16060 contig_104207_1 NSHB1 hemoglobin 1 80.49 131.72

AT1G22930 Medtr2g006520 T-complex protein 11 74.23 72.46

AT1G49820 contig_239249_1 MTK1 S-methyl-5-thioribose kinase 71.55 55.08

AT1G14870 Medtr8g104890 PCR2 PLANT CADMIUM RESISTANCE 2 69.14 276.49

AT3G02360 contig_73272_1 6-phosphogluconate dehydrogenase family protein 68.25 303.91

AT5G40760 Medtr7g037440 G6PD6 glucose-6-phosphate dehydrogenase 6 63.45 45.1

AT5G47120 Medtr5g013340 BI1 BAX inhibitor 1 59.11 133.24

AT5G05250 contig_11361_1 Unknown 58.06 406.23

AT5G53450 Medtr3g091290 ORG1 OBP3-responsive gene 1 57.89 50.51

AT5G66985 Medtr5g018540 Unknown 55.24 193.21

AT1G18910 Medtr7g037040 zinc ion binding;zinc ion binding 50.34 552.32

AT5G03380 Medtr7g101590 Heavy metal transport/detoxification superfamily protein 44.36 39.68

AT1G28680 Medtr2g015430 HXXXD-type acyl-transferase family protein 42.44 18.52

AT1G78080 CU651566_18 WIND1 related to AP2 4 41.53 45.2

AT5G54800 Medtr3g049400 GPT1 glucose 6-phosphate/phosphate translocator 1 37.39 131.1

AT4G10270 contig_173393_1 Wound-responsive family protein 34.78 211.42

AT2G01880 AC146550_1005 PAP7 purple acid phosphatase 7 34.36 197.8

AT3G18290 Medtr6g083900 EMB2454 zinc finger protein-related 32.58 75.71

AT1G08650 Medtr1g080020 PPCK1 phosphoenolpyruvate carboxylase kinase 1 32.57 162.92

AT1G32450 Medtr5g014150 NRT1.5 nitrate transporter 1.5 30.87 64.27

AT4G21980 contig_10078_1 ATG8A Ubiquitin-like superfamily protein 30.03 58.32

AT2G20820 AC229695_14 Unknown 29.56 86.31

AT2G32240 Medtr4g076030 Unknown 29.33 103.23

AT3G62580 Medtr1g087320 Late embryogenesis abundant protein (LEA) family protein 27.78 63.22

AT4G17900 Medtr5g030130 PLATZ transcription factor family protein 23 163.72

AT5G56080 Medtr1g084050 NAS2 nicotianamine synthase 2 21.71 120.55

AT2G41660 contig_70912_1 MIZ1 Protein of unknown function, DUF617 21.08 88.47

AT5G04740 contig_169922_1 ACR12 ACT domain-containing protein 18.9 97.34

AT3G02550 contig_61605_1 LBD41 LOB domain-containing protein 41 17.97 240.85

3

At ID Mt ID Symbol Description ΔAt ΔMtAT2G28190 Medtr4g057240 CZSOD2 copper/zinc superoxide dismutase 2 17.72 73.85

AT4G26470 Medtr8g070510 Calcium-binding EF-hand family protein 17.09 63.24

AT4G12910 Medtr8g011350 scpl20 serine carboxypeptidase-like 20 16.91 98.4

AT3G47420 contig_58729_1 PS3 phosphate starvation-induced gene 3 16.6 78.66

AT5G03330 Medtr1g063900 Cysteine proteinases superfamily protein 16.46 88.67

AT4G02940 Medtr1g089860 oxidoreductase, 2OG-Fe(II) oxygenase family protein 16.42 128.9

AT5G42740 Medtr6g009330 Sugar isomerase (SIS) family protein 15.6 144.53

AT5G39950 Medtr7g009070 TRXH2 thioredoxin 2 14.83 102.01

AT5G39890 Medtr7g009710 Protein of unknown function (DUF1637) 14.52 36.23

AT1G71010 contig_55755_1 FAB1C FORMS APLOID AND BINUCLEATE CELLS 1C 14.29 63.14

AT5G19140 contig_51730_1 ATAILP1 Aluminium induced protein with YGL and LRDR motifs 13.56 496.06

AT1G01490 Medtr7g079110 Heavy metal transport/detoxification superfamily protein 13.54 79.64

AT3G44110 Medtr2g087660 J3 DNAJ homologue 3 13.5 235.28

AT1G71950 Medtr1g050640 Proteinase inhibitor, propeptide 13.44 51.65

AT5G02790 contig_136681_1 GSTL3 Glutathione S-transferase family protein 12.28 137.81

AT1G27000 Medtr5g038550 Protein of unknown function (DUF1664) 11.96 55.94

AT5G44730 Medtr2g035440 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein 11.64 57.63

AT1G03290 Medtr1g072560 Unknown 11.09 63.28

AT1G77145 Medtr8g093440 Protein of unknown function (DUF506) 10.36 17.08

AT3G10040 Medtr1g061640 sequence-specific DNA binding transcription factors 10.21 253.55

AT3G22370 Medtr5g026620 HSR3 alternative oxidase 1A 9.8 92.67

AT1G75170 contig_73863_1 Sec14p-like phosphatidylinositol transfer family protein 8.87 30.66

AT1G21450 contig_55834_2 SCL1 SCARECROW-like 1 8.72 68.04

AT5G22890 contig_86816_1 C2H2 and C2HC zinc fingers superfamily protein 8.45 213.28

AT5G06200 contig_76501_1 CASP4 Uncharacterised protein family (UPF0497) 8.36 24.48

AT5G62900 Medtr4g106790 Unknown 7.39 178.35

AT4G19700 Medtr2g028830 RING SBP (S-ribonuclease binding protein) family protein 6.94 70.86

AT4G21580 Medtr2g012420 oxidoreductase, zinc-binding dehydrogenase family protein 6.03 30.68

AT3G20870 Medtr4g065640 ZTP29 ZIP metal ion transporter family 5.3 53.79

AT3G28345 Medtr6g009200 MDR13 ABC transporter family protein 4.95 29.27

AT5G65530 Medtr5g031870 Protein kinase superfamily protein 4.62 102.66

AT5G24030 Medtr6g045200 SLAH3 SLAC1 homologue 3 4.58 95.65

AT1G32740 Medtr5g013690 SBP (S-ribonuclease binding protein) family protein 4.56 51.22

AT3G11810 Medtr4g082550 Unknown 4.52 78.86

AT2G28710 Medtr7g023560 C2H2-type zinc finger family protein 4.41 91.19

AT5G52640 contig_51657_1 HSP90.1 heat shock protein 90.1 4.22 49.46

AT2G24570 Medtr1g009380 WRKY17 WRKY DNA-binding protein 17 4.2 78.93

AT5G01720 contig_8460_1 RNI-like superfamily protein 4.09 39.28

AT3G05700 Medtr1g083780 Drought-responsive family protein 3.58 112.86

AT1G06040 Medtr2g099010 STO B-box zinc finger family protein 3.46 19.26

AT2G23770 Medtr5g019050protein kinase family protein / peptidoglycan-binding LysM domain-containing protein 2.38 24.56

AT5G13210 Medtr5g045160 Uncharacterised conserved protein UCP015417, vWA 2.08 56.97

AT1G12880 contig_163835_1 NUDT12 nudix hydrolase homolog 12 2.02 127.16

AT5G24270 Medtr3g091440 SOS3 Calcium-binding EF-hand family protein 1.7 28.5

AT3G58270 contig_59160_1 Arabidopsis phospholipase-like protein (PEARLI 4) with TRAF-like 1.15 40.51

4

At ID Mt ID Symbol Description ΔAt ΔMtdomain

AT3G03890 contig_51444_1 FMN binding 1.08 33.83

AT4G22758 Medtr5g011770 Unknown 0.98 51.39

AT1G43170 Medtr1g098540 RPL3A ribosomal protein 1 -148.18 -257.19

AT2G38380 Medtr2g029740 Peroxidase superfamily protein -133.53 -151.6

AT2G41840 Medtr8g105340 Ribosomal protein S5 family protein -129.42 -127.67

AT1G70600 Medtr5g033090 Ribosomal protein L18e/L15 superfamily protein -128.27 -246.09

AT5G04800 contig_56630_3 Ribosomal S17 family protein -122.31 -105.01

AT1G07890 Medtr4g061140 MEE6 ascorbate peroxidase 1 -122.02 -353.04

AT3G53420 Medtr7g101190 PIP2A plasma membrane intrinsic protein 2A -114.92 -28.85

AT4G21960 Medtr4g132110 PRXR1 Peroxidase superfamily protein -103.82 -593.29

AT1G33140 Medtr3g093110 PGY2 Ribosomal protein L6 family -103.81 -214.12

AT5G47700 Medtr3g092600 60S acidic ribosomal protein family -102.46 -156.98

AT3G53980 Medtr7g065210Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein -99.18 -1235.4

AT1G33120 Medtr3g093110 Ribosomal protein L6 family -96.81 -214.12

AT1G30510 Medtr2g030200 RFNR2 root FNR 2 -94.56 -173.87

AT5G27850 Medtr1g083460 Ribosomal protein L18e/L15 superfamily protein -94.45 -87.11

AT5G02960 Medtr7g100720 Ribosomal protein S12/S23 family protein -94.19 -133.77

AT1G75750 Medtr1g025250 GASA1 GAST1 protein homolog 1 -59.9 -171.69

AT5G19780 Medtr8g085980 TUA5 tubulin alpha-5 -58.35 -221.1

AT5G63160 Medtr4g104140 BT1 BTB and TAZ domain protein 1 -58.04 -358.16

AT3G22230 Medtr2g035930 Ribosomal L27e protein family -56.68 -108.77

AT5G19770 Medtr8g085980 TUA3 tubulin alpha-3 -56.66 -221.1

AT1G77330 contig_74946_1 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein -55.1 -15.48

AT3G48930 Medtr8g076830 EMB1080 Nucleic acid-binding, OB-fold-like protein -47.53 -90.6

AT1G37130 Medtr5g059820 NR2 nitrate reductase 2 -46.72 -281.44

AT5G54370 contig_78727_2 Late embryogenesis abundant (LEA) protein-related -40.73 -41.17

AT3G58610 Medtr4g079780 ketol-acid reductoisomerase -39.55 -137.54

AT4G37870 Medtr5g030620 PEPCK phosphoenolpyruvate carboxykinase 1 -38.43 -115.77

AT5G63660 contig_108737_1 PDF2.5 Scorpion toxin-like knottin superfamily protein -38.06 -71.54

AT3G20510 Medtr5g092160 Transmembrane proteins 14C -36.41 -29.4

AT4G23400 contig_81430_1 PIP1D plasma membrane intrinsic protein 1;5 -36.02 -33.28

AT5G53460 contig_51074_2 GLT1 NADH-dependent glutamate synthase 1 -33.7 -46.96

AT1G05260 Medtr2g088770 RCI3A Peroxidase superfamily protein -33.62 -268.81

AT5G40850 contig_51408_1 UPM1 urophorphyrin methylase 1 -31.3 -51.34

AT1G43710 Medtr2g008120 emb1075 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein -22.35 -53.27

AT5G12250 Medtr7g089120 TUB6 beta-6 tubulin -21.85 -173.56

AT5G47770 Medtr2g027300 FPS1 farnesyl diphosphate synthase 1 -21.2 -75.3

AT2G05920 Medtr2g042130 Subtilase family protein -18.84 -29.95

AT1G52820 contig_8607_1 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein -18.27 -114.67

AT1G78300 Medtr3g099380 GRF2 general regulatory factor 2 -17.98 -70.67

AT1G72150 contig_83395_1 PATL1 PATELLIN 1 -17.91 -40.68

AT3G12390 Medtr7g088680Nascent polypeptide-associated complex (NAC), alpha subunit family protein -17.89 -109.91

AT4G25570 AC235674_4 ACYB-2 Cytochrome b561/ferric reductase transmembrane protein family -17.86 -130.07

AT5G18170 Medtr6g029460 GDH1 glutamate dehydrogenase 1 -17.69 -50.8

5

At ID Mt ID Symbol Description ΔAt ΔMtAT4G02290 Medtr1g088190 GH9B13 glycosyl hydrolase 9B13 -17.66 -28.89

AT5G62350 Medtr3g008840 Plant invertase/pectin methylesterase inhibitor superfamily protein -16.59 -64.13

AT5G02610 Medtr4g062410 Ribosomal L29 family protein -15.98 -93.77

AT5G20950 Medtr3g079750 Glycosyl hydrolase family protein -15.23 -35.11

AT5G19600 Medtr6g086170 SULTR3;5 sulfate transporter 3;5 -15.02 -13.13

AT3G17210 Medtr4g124920 HS1 heat stable protein 1 -14.47 -47.23

AT1G30360 Medtr2g018780 ERD4 Early-responsive to dehydration stress protein (ERD4) -14.27 -20.01

AT5G13110 Medtr7g022440 G6PD2 glucose-6-phosphate dehydrogenase 2 -13.81 -118.07

AT3G15810 Medtr4g010180 Protein of unknown function (DUF567) -13.69 -23.08

AT5G60920 contig_67949_1 COBCOBRA-like extracellular glycosyl-phosphatidyl inositol-anchored protein family -13.26 -32.79

AT5G48230 Medtr5g098310 EMB1276 acetoacetyl-CoA thiolase 2 -12.7 -215.88

AT4G03210 Medtr2g089140 XTH9 xyloglucan endotransglucosylase/hydrolase 9 -12.49 -97

AT3G51840 contig_84094_1 ATSCX acyl-CoA oxidase 4 -11.91 -34.49

AT5G49720 Medtr2g028480 TSD1 glycosyl hydrolase 9A1 -11.78 -101.33

AT1G04680 contig_50680_1 Pectin lyase-like superfamily protein -11.55 -39.42

AT1G20330 Medtr3g114780 SMT2 sterol methyltransferase 2 -11.37 -120.47

AT4G00430 contig_81430_1 TMP-C plasma membrane intrinsic protein 1;4 -11.23 -33.28

AT3G12110 Medtr7g026230 ACT11 actin-11 -10.98 -160.64

AT2G04780 Medtr5g098060 FLA7 FASCICLIN-like arabinoogalactan 7 -10.91 -95.01

AT5G48485 Medtr7g052640 DIR1Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein -10.4 -28.61

AT3G06650 Medtr2g034090 ACLB-1 ATP-citrate lyase B-1 -10.33 -186.82

AT1G08560 Medtr5g012010 SYP111 syntaxin of plants 111 -9.16 -26.83

AT5G38020 Medtr3g117060S-adenosyl-L-methionine-dependent methyltransferases superfamily protein -9.09 -78.2

AT5G16440 Medtr7g080060 IPP1 isopentenyl diphosphate isomerase 1 -8.96 -72.64

AT3G55120 Medtr1g115890 TT5 Chalcone-flavanone isomerase family protein -8.93 -38.13

AT5G65810 Medtr2g010540 CGR3 Unk golgi protein -8.5 -25.54

AT5G54770 contig_73132_1 TZ thiazole biosynthetic enzyme, chloroplast (ARA6) (THI1) (THI4) -8.4 -90.22

AT3G23090 Medtr1g075310 TPX2 (targeting protein for Xklp2) protein family -8.35 -61.54

AT1G69230 Medtr5g045310 SP1L2 SPIRAL1-like2 -8.25 -73.08

AT4G01070 Medtr7g117170 UGT72B1 UDP-Glycosyltransferase superfamily protein -8.02 -53.82

AT3G26720 Medtr7g084040 Glycosyl hydrolase family 38 protein -7.75 -29.87

AT4G37160 contig_83547_1 sks15 SKU5 similar 15 -7.46 -60.78

AT1G18250 Medtr8g107140 ATLP-1 Pathogenesis-related thaumatin superfamily protein -7.26 -32.39

AT1G12240 Medtr4g101630 VAC-INV Glycosyl hydrolases family 32 protein -7.22 -55.83

AT1G30690 contig_53767_2 Sec14p-like phosphatidylinositol transfer family protein -7.18 -57.4

AT1G75680 Medtr3g113720 GH9B7 glycosyl hydrolase 9B7 -6.91 -23.6

AT3G53620 Medtr1g068810 PPa4 pyrophosphorylase 4 -6.38 -82.9

AT2G28790 contig_83119_1 Pathogenesis-related thaumatin superfamily protein -6.31 -83.72

AT1G10670 Medtr5g033920 ACLA-1 ATP-citrate lyase A-1 -6.18 -67.05

AT5G62720 Medtr4g107630 Integral membrane HPP family protein -5.84 -45.58

AT3G11050 Medtr5g083170 FER2 ferritin 2 -5.82 -50.66

AT1G58440 contig_163699_1 XF1 FAD/NAD(P)-binding oxidoreductase family protein -5.6 -101.8

AT4G08290 Medtr3g072530 nodulin MtN21 /EamA-like transporter family protein -4.7 -27.58

AT1G09750 Medtr3g100500 Eukaryotic aspartyl protease family protein -4.59 -45.69

6

At ID Mt ID Symbol Description ΔAt ΔMtAT5G47560 Medtr4g133230 TDT tonoplast dicarboxylate transporter -4.53 -33.13

AT4G37640 Medtr5g015590 ACA2 calcium ATPase 2 -4.41 -171.97

AT3G16570 Medtr4g119860 RALF23 rapid alkalinization factor 23 -4.19 -71.08

AT4G26850 Medtr5g093390 VTC2 phosphate guanylyltransferase -3.74 -31.07

AT5G44130 contig_60621_1 FLA13 FASCICLIN-like arabinogalactan protein 13 precursor -2.97 -359.08

AT3G22120 Medtr3g082100 CWLP cell wall-plasma membrane linker protein -2.66 -687.95

AT4G20820 AC235662_2 FAD-binding Berberine family protein -2.43 -17.6

AT5G07010 Medtr3g013500 ST2A sulfotransferase 2A -2.21 -28.33

AT3G20570 Medtr4g081100 ENODL9 early nodulin-like protein 9 -1.8 -29.36

AT5G06740 contig_9706_1 Concanavalin A-like lectin protein kinase family protein -1.67 -18.67

AT4G30190 Medtr4g127710 AHA2 H(+)-ATPase 2 412.27 -264.94

AT2G36880 contig_64993_1 MAT3 methionine adenosyltransferase 3 327.33 -38.61

AT4G34050 Medtr4g085590 CCoAOMT1S-adenosyl-L-methionine-dependent methyltransferases superfamily protein 310.9 -125.02

AT4G13940 Medtr3g084340 SAHH1 S-adenosyl-L-homocysteine hydrolase 271.47 -234.48

AT2G30490 Medtr5g075450 REF3 cinnamate-4-hydroxylase 211.1 -119.63

AT1G08830 Medtr7g114240 CSD1 copper/zinc superoxide dismutase 1 173.53 -342.61

AT4G13930 Medtr3g084310 SHM4 serine hydroxymethyltransferase 4 167.64 -141.16

AT1G22410 Medtr5g064500 Class-II DAHP synthetase family protein 130.32 -144.3

AT2G32720 Medtr4g022350 CB5-B cytochrome B5 isoform B 102.15 -30.35

AT2G01670 AC233676_26 NUDT17 nudix hydrolase homolog 17 70.2 -93.85

AT1G65840 Medtr3g064370 PAO4 polyamine oxidase 4 65.74 -64.62

AT3G02780 Medtr7g080060 IPP2 isopentenyl pyrophosphate:dimethylallyl pyrophosphate isomerase 2 60.94 -72.64

AT4G30210 Medtr4g128020 ATR2 P450 reductase 2 53.71 -58.92

AT4G25030 Medtr1g095600 Unknown 51.83 -213.81

AT2G40890 contig_51544_1 CYP98A3 cytochrome P450, family 98, subfamily A, polypeptide 3 50.18 -35.86

AT3G18280 Medtr6g082480Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein 32.55 -53.71

AT1G72510 Medtr8g021190 Protein of unknown function (DUF1677) 29.1 -49.82

AT3G06890 Medtr4g120020 Unknown 20.15 -33.92

AT2G33770 Medtr2g013650 UBC24 phosphate 2 15.73 -155.99

AT1G49000 Medtr4g112270 Unknown 15.42 -14.25

AT3G01860 Medtr6g023580 Unknown 14.96 -33.82

AT5G51830 Medtr6g089480 pfkB-like carbohydrate kinase family protein 14.42 -42.82

AT1G33800 Medtr3g005710 Protein of unknown function (DUF579) 13.25 -36.13

AT3G45310 contig_50810_1 Cysteine proteinases superfamily protein 13 -139.86

AT2G45180 Medtr4g101260Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein 10.58 -730.64

AT2G27920 contig_61069_1 SCPL51 serine carboxypeptidase-like 51 10.13 -26.46

AT1G18210 Medtr8g107110 Calcium-binding EF-hand family protein 8.64 -77.66

AT1G55740 Medtr5g096820 SIP1 seed imbibition 1 6.1 -57.89

AT5G02560 Medtr2g096610 HTA12 histone H2A 12 5.27 -89.66

AT5G51460 Medtr3g008500 ATTPPA Haloacid dehalogenase-like hydrolase (HAD) superfamily protein 5.21 -135.32

AT5G20050 Medtr4g113710 Protein kinase superfamily protein 4.86 -48.58

AT5G54530 contig_61379_1 Protein of unknown function, DUF538 4.79 -34.38

AT2G21540 Medtr3g117090 SFH3 SEC14-like 3 3.94 -17.03

AT1G09090 Medtr7g113130 RBOHB respiratory burst oxidase homolog B 3.59 -107.89

7

At ID Mt ID Symbol Description ΔAt ΔMtAT2G39410 contig_90406_1 alpha/beta-Hydrolases superfamily protein 3.04 -52.83

AT1G78260 Medtr5g064120 RNA-binding (RRM/RBD/RNP motifs) family protein 2.98 -37.19

AT5G55560 Medtr5g094390 Protein kinase superfamily protein 2.08 -27.07

AT4G26140 Medtr2g039120 BGAL12 beta-galactosidase 12 1.55 -52.53

AT2G01660 Medtr8g104990 PDLP6 plasmodesmata-located protein 6 1.36 -24.11

AT3G18270 contig_71600_1 CYP77A5P cytochrome P450, family 77, subfamily A, polypeptide 5 pseudogene 0.61 -85.19

AT2G44050 contig_50382_2 COS16,7-dimethyl-8-ribityllumazine synthase / DMRL synthase / lumazine synthase / riboflavin synthase -9.11 6195.88

AT3G52960 contig_53018_2 Thioredoxin superfamily protein -13.57 262.92

AT3G56240 Medtr7g013660 CCH copper chaperone -104.66 241.57

AT5G19750 Medtr7g088590 Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein -4.11 227.79

AT3G62040 contig_51299_1 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein -71.06 198.49

AT1G19570 contig_60399_1 DHAR5 dehydroascorbate reductase -82.87 186.55

AT4G35090 contig_165461_1 CAT2 catalase 2 -55.83 152.12

AT2G28780 Medtr2g096670 Unknown -21.37 124.77

AT3G12500 Medtr3g118390 PR3 basic chitinase -32.5 124.28

AT3G62700 Medtr1g088680 MRP10 multidrug resistance-associated protein 10 -4.09 120.42

AT5G09810 Medtr3g095530 ACT7 actin 7 -62.42 118.52

AT3G16520 contig_129258_1 UGT88A1 UDP-glucosyl transferase 88A1 -1.94 102.73

AT3G04720 contig_48496_1 PR4 pathogenesis-related 4 -105.54 94.13

AT3G43520 contig_56085_2 Transmembrane proteins 14C -4.85 92.81

AT4G34740 Medtr4g072110 CIA1 GLN phosphoribosyl pyrophosphate amidotransferase 2 -3.57 71.11

AT4G27520 contig_240047_1 ENODL2 early nodulin-like protein 2 -13.74 69.9

AT3G57610 Medtr7g092260 ADSS adenylosuccinate synthase -3.87 67.89

AT5G66760 Medtr5g020050 SDH1-1 succinate dehydrogenase 1-1 -14.74 66.03

AT5G43180 Medtr7g073370 Protein of unknown function, DUF599 -26.89 62.64

AT3G29575 contig_86383_1 AFP3 ABI five binding protein 3 -2.8 61.13

AT2G36130 contig_48988_1 Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein -6.04 59.56

AT2G47510 Medtr1g087900 FUM1 fumarase 1 -8.22 58.47

AT2G34480 Medtr5g091120 Ribosomal protein L18ae/LX family protein -106.15 58.08

AT1G30270 Medtr2g049790 SnRK3.23 CBL-interacting protein kinase 23 -10.94 57.62

AT3G06780 contig_85674_1 glycine-rich protein -2.87 56.03

AT5G01410 Medtr2g017520 RSR4 Aldolase-type TIM barrel family protein -10.76 55.55

AT4G34630 Medtr4g071120 Unknown -2.98 54.86

AT1G73300 Medtr4g021520 scpl2 serine carboxypeptidase-like 2 -2.68 44.64

AT4G33090 Medtr3g104720 ATAPM1 aminopeptidase M1 -12.9 44.35

AT2G38870 Medtr5g090250 Serine protease inhibitor, potato inhibitor I-type family protein -10.61 39.15

AT3G56460 contig_75559_1 GroES-like zinc-binding alcohol dehydrogenase family protein -5.26 38.77

AT1G79040 Medtr2g064650 PSBR photosystem II subunit R -19.43 36.21

AT2G45910 Medtr7g077780 U-box domain-containing protein kinase family protein -1.5 33.43

AT3G48690 Medtr4g086510 CXE12 alpha/beta-Hydrolases superfamily protein -4.34 33.1

AT5G61130 Medtr4g083070 PDCB1 plasmodesmata callose-binding protein 1 -12.5 32.22

AT5G62810 Medtr4g106880 PEX14 peroxin 14 -3.95 32.02

AT3G02850 Medtr5g077770 SKOR STELAR K+ outward rectifier -12.06 29.92

AT3G07310 Medtr8g012420 Protein of unknown function (DUF760) -4.72 29.19

8

At ID Mt ID Symbol Description ΔAt ΔMtAT3G46290 Medtr4g061930 HERK1 hercules receptor kinase 1 -1.47 28.19

AT3G62290 Medtr6g005820 ATARFA1E ADP-ribosylation factor A1E -29.94 21.76

AT1G09620 Medtr7g006450ATP binding;leucine-tRNA ligases;aminoacyl-tRNA ligases;nucleotide binding;ATP binding;aminoacyl-tRNA ligases -8.47 14.74

AT4G40030 Medtr8g061940 Histone superfamily protein -6.96 12.35

Differentially expressed only in Arabidopsis roots

AT4G31940 Medtr6g042610 CYP82C4 cytochrome P450, family 82, subfamily C, polypeptide 4 891.34

AT3G13610 Medtr3g043900 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein 702.54

AT1G07590 contig_54974_1 Tetratricopeptide repeat (TPR)-like superfamily protein 575.01

AT2G37040 Medtr1g064090 PAL1 PHE ammonia lyase 1 475.77

AT4G31970 Medtr6g042610 CYP82C2 cytochrome P450, family 82, subfamily C, polypeptide 2 298.74

AT3G53480 Medtr4g123850 PIS1 pleiotropic drug resistance 9 270.91

AT2G36530 Medtr6g060570 LOS2 Enolase 234.59

AT3G12900 Medtr2g068840 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein 190.3

AT1G51680 Medtr4g005750 AT4CL1 4-coumarate:CoA ligase 1 176.04

AT5G36890 Medtr3g033790 BGLU42 beta glucosidase 42 113.72

AT5G48930 AC233655_19 HCT hydroxycinnamoyl-CoA shikimate/quinate hydroxycinnamoyl transferase 101.78

AT4G19160 Medtr3g014680 95.12

AT3G21070 Medtr4g076990 NADK1 NAD kinase 1 94.81

AT3G54880 contig_51002_1 82.35

AT3G01120 Medtr7g011230 MTO1 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein 80.85

AT1G52760 Medtr4g127220 LysoPL2 lysophospholipase 2 78.23

AT5G19760 Medtr8g086070 Mitochondrial substrate carrier family protein 74.43

AT3G48450 Medtr4g104250 RPM1-interacting protein 4 (RIN4) family protein 73.04

AT4G25640 Medtr1g100180 FFT detoxifying efflux carrier 35 66.9

AT3G14940 contig_69163_1 PPC3 phosphoenolpyruvate carboxylase 3 65.92

AT5G03570 contig_60158_1 IREG2 iron regulated 2 63.2

AT3G23600 contig_238373_1 alpha/beta-Hydrolases superfamily protein 55.67

AT2G05830 Medtr2g042450 NagB/RpiA/CoA transferase-like superfamily protein 55.26

AT5G13420 Medtr7g006560 Aldolase-type TIM barrel family protein 53.87

AT5G66120 Medtr5g022580 3-dehydroquinate synthase, putative 52.82

AT5G62390 contig_59915_1 BAG7 BCL-2-associated athanogene 7 51.47

AT2G16660 Medtr5g022380 Major facilitator superfamily protein 47.7

AT3G22890 contig_238152_1 APS1 ATP sulfurylase 1 47.07

AT4G02330 contig_51305_1 PME41 Plant invertase/pectin methylesterase inhibitor superfamily 45.74

AT1G48850 contig_48774_1 EMB1144chorismate synthase, putative / 5-enolpyruvylshikimate-3-phosphate phospholyase, putative 45.27

AT4G02890 Medtr7g116360 UBQ14 Ubiquitin family protein 44.47

AT5G53850 contig_57740_1 haloacid dehalogenase-like hydrolase family protein 41.74

AT1G29280 Medtr8g087000 WRKY65 WRKY DNA-binding protein 65 40.48

AT2G45400 Medtr7g074730 BEN1 NAD(P)-binding Rossmann-fold superfamily protein 39.65

AT5G17770 Medtr7g087090 CBR1 NADH:cytochrome B5 reductase 1 39.24

AT3G27890 Medtr8g039090 NQR NADPH:quinone oxidoreductase 37.1

AT5G20090 contig_165349_1 Uncharacterised protein family (UPF0041) 36.44

AT2G43590 Medtr2g099470 Chitinase family protein 35.77

AT3G06350 Medtr4g090620 MEE32 dehydroquinate dehydratase, putative / shikimate dehydrogenase, putative 34.73

9

At ID Mt ID Symbol Description ΔAt ΔMtAT3G44990 Medtr2g095800 XTR8 xyloglucan endo-transglycosylase-related 8 34.39

AT1G77280 contig_58230_1Protein kinase protein with adenine nucleotide alpha hydrolases-like domain 33.91

AT2G22250 Medtr8g091280 MEE17 aspartate aminotransferase 32.84

AT4G11600 Medtr8g098410 PHGPX glutathione peroxidase 6 32.82

AT5G47870 contig_114259_1 RAD52-2B 30.86

AT1G17180 contig_74219_1 GSTU25 glutathione S-transferase TAU 25 29.68

AT4G36990 Medtr5g017470 HSFB1 heat shock factor 4 28

AT2G45300 Medtr4g024620 RNA 3'-terminal phosphate cyclase/enolpyruvate transferase, alpha/beta 26.64

AT5G27920 Medtr7g112570 F-box family protein 25.74

AT5G46230 Medtr2g019480 Protein of unknown function, DUF538 24.6

AT5G62480 Medtr5g040430 GSTU9 glutathione S-transferase tau 9 24.09

AT5G65670 Medtr8g067530 IAA9 indole-3-acetic acid inducible 9 23.78

AT1G15670 contig_239833_1 Galactose oxidase/kelch repeat superfamily protein 23.3

AT5G41790 contig_59710_1 CIP1 COP1-interactive protein 1 23.29

AT3G29034 Medtr6g012640 23.12

AT5G67370 Medtr5g016100 Protein of unknown function (DUF1230) 22.81

AT3G29200 contig_56796_1 CM1 chorismate mutase 1 22.8

AT5G19970 contig_9061_1 21.24

AT5G24760 Medtr6g068930 GroES-like zinc-binding dehydrogenase family protein 20.79

AT4G35040 Medtr4g073100 bZIP19 Basic-leucine zipper (bZIP) transcription factor family protein 20.47

AT4G38620 Medtr4g073420 MYB4 myb domain protein 4 20.35

AT5G56350 Medtr7g100760 Pyruvate kinase family protein 19.91

AT1G72430 Medtr8g022440 SAUR-like auxin-responsive protein family 19.9

AT3G11750 Medtr2g088720 FOLB1 Dihydroneopterin aldolase 19.82

AT4G26060 contig_71139_1 Ribosomal protein L18ae family 19.77

AT3G27090 contig_74333_1 DCD (Development and Cell Death) domain protein 18.99

AT4G35630 Medtr8g074010 PSAT phosphoserine aminotransferase 18.72

AT5G49810 Medtr2g005110 MMT methionine S-methyltransferase 18.38

AT5G54500 Medtr2g081810 FQR1 flavodoxin-like quinone reductase 1 18.31

AT1G23440 contig_10205_1 Peptidase C15, pyroglutamyl peptidase I-like 18

AT4G19370 Medtr5g025640 Protein of unknown function (DUF1218) 17.77

AT3G58060 Medtr3g062610 Cation efflux family protein 17.55

AT3G27060 contig_71076_1 TSO2 Ferritin/ribonucleotide reductase-like family protein 17.51

AT5G54680 Medtr4g081370 ILR3 basic helix-loop-helix (bHLH) DNA-binding superfamily protein 17.37

AT2G28910 Medtr1g044570 CXIP4 CAX interacting protein 4 17.31

AT5G42830 Medtr3g102020 HXXXD-type acyl-transferase family protein 17.29

AT2G46710 Medtr8g026680 Rho GTPase activating protein with PAK-box/P21-Rho-binding domain 16.79

AT2G02390 contig_55748_1 GSTZ1 glutathione S-transferase zeta 1 16.76

AT2G35840 Medtr1g040560 Sucrose-6F-phosphate phosphohydrolase family protein 16.72

AT4G23850 Medtr5g009350 LACS4 AMP-dependent synthetase and ligase family protein 16.59

AT1G01630 Medtr3g098530 Sec14p-like phosphatidylinositol transfer family protein 16.37

AT1G76990 contig_114135_1 ACR3 ACT domain repeat 3 16.34

AT1G64980 Medtr5g007050 Nucleotide-diphospho-sugar transferases superfamily protein 16.06

AT4G32480 Medtr4g078310 Protein of unknown function (DUF506) 15.83

10

At ID Mt ID Symbol Description ΔAt ΔMtAT4G15093 Medtr6g064960 catalytic LigB subunit of aromatic ring-opening dioxygenase family 15.56

AT5G65380 Medtr5g032720 MATE efflux family protein 15.48

AT1G03080 Medtr1g071540 kinase interacting (KIP1-like) family protein 15.4

AT1G08320 Medtr2g086420 TGA9 bZIP transcription factor family protein 15.36

AT4G32650 Medtr3g108320 KC1 potassium channel in Arabidopsis thaliana 3 15.36

AT5G13910 contig_18329_1 LEP Integrase-type DNA-binding superfamily protein 15.33

AT2G22430 contig_53935_2 HB6 homeobox protein 6 15.3

AT4G18710 contig_98575_1 UCU1 Protein kinase superfamily protein 14.86

AT5G03460 Medtr7g102320 14.85

AT3G50660 Medtr5g020020 SNP2 Cytochrome P450 superfamily protein 14.69

AT4G29040 Medtr7g099640 RPT2a regulatory particle AAA-ATPase 2A 14.62

AT2G39530 Medtr7g024750 Uncharacterised protein family (UPF0497) 14.35

AT5G25770 AC225507_41 alpha/beta-Hydrolases superfamily protein 14.21

AT3G56930 Medtr7g088350 DHHC-type zinc finger family protein 14.18

AT1G63460 Medtr8g098400 GPX8 glutathione peroxidase 8 13.84

AT3G12670 Medtr2g062770 emb2742 CTP synthase family protein 13.53

AT2G30360 Medtr5g075100 SNRK3.22 SOS3-interacting protein 4 13.51

AT3G04090 Medtr7g085070 SIP1A small and basic intrinsic protein 1A 13.46

AT3G07270 Medtr7g055700 GTP cyclohydrolase I 13.22

AT3G20650 Medtr7g110030 mRNA capping enzyme family protein 12.77

AT3G57870 Medtr5g016630 SCE1A sumo conjugation enzyme 1 12.72

AT5G50760 contig_169687_1 SAUR-like auxin-responsive protein family 12.59

AT1G09970 contig_51288_1 RLK7 Leucine-rich receptor-like protein kinase family protein 12.53

AT2G46740 Medtr5g005540 D-arabinono-1,4-lactone oxidase family protein 12.33

AT4G19670 Medtr2g028870 RING/U-box superfamily protein 12.27

AT4G16830 Medtr7g081660 Hyaluronan / mRNA binding family 12.03

AT1G25480 contig_54144_1 Aluminium activated malate transporter family protein 11.96

AT2G45430 contig_74397_1 AHL22 AT-hook motif nuclear-localized protein 22 11.94

AT5G58800 Medtr5g070030 Quinone reductase family protein 11.86

AT3G59910 contig_114523_1 Ankyrin repeat family protein 11.76

AT1G67940 Medtr8g107410 NAP3 non-intrinsic ABC protein 3 11.65

AT2G32080 Medtr4g083230PUR ALPHA-1 purin-rich alpha 1 11.59

AT3G24503 Medtr6g086300 REF1 aldehyde dehydrogenase 2C4 11.56

AT1G04850 Medtr8g085380 ubiquitin-associated (UBA)/TS-N domain-containing protein 11.52

AT4G10380 Medtr1g098080 NLM8 NOD26-like intrinsic protein 5;1 11.18

AT2G44160 Medtr1g039970 MTHFR2 methylenetetrahydrofolate reductase 2 11.16

AT5G21950 Medtr3g105290 alpha/beta-Hydrolases superfamily protein 10.98

AT5G53140 Medtr3g091060 Protein phosphatase 2C family protein 10.91

AT5G24800 Medtr1g008990 BZO2H2 basic leucine zipper 9 10.89

AT1G76760 Medtr1g098660 TY1 thioredoxin Y1 10.88

AT1G10940 Medtr8g095330 SRK2A Protein kinase superfamily protein 10.81

AT3G47640 Medtr4g108360 PYE basic helix-loop-helix (bHLH) DNA-binding superfamily protein 10.78

AT5G02580 contig_12954_1 Plant protein 1589 of unknown function 10.77

AT1G70660 Medtr8g105010 UEV1B MMS ZWEI homologue 2 10.53

11

At ID Mt ID Symbol Description ΔAt ΔMtAT3G02580 contig_9028_1 STE1 sterol 1 10.29

AT3G51370 Medtr8g074930 Protein phosphatase 2C family protein 10.25

AT5G35180 contig_50451_1 Protein of unknown function (DUF1336) 10.11

AT2G35610 Medtr8g072310 XEG113 xyloglucanase 113 10.1

AT3G08710 Medtr4g111950 TRX H9 thioredoxin H-type 9 10

AT1G51840 contig_173304_1 protein kinase-related 9.93

AT1G12520 Medtr4g101820 CCS copper chaperone for SOD1 9.93

AT2G42750 Medtr2g083920 DNAJ heat shock N-terminal domain-containing protein 9.92

AT3G27880 Medtr6g006950 Protein of unknown function (DUF1645) 9.84

AT1G01650 Medtr8g030680 SPPL4 SIGNAL PEPTIDE PEPTIDASE-LIKE 4 9.79

AT4G36980 Medtr5g017430 9.7

AT5G64370 Medtr4g093570 PYD3 beta-ureidopropionase 9.62

AT1G69640 Medtr5g040320 SBH1 sphingoid base hydroxylase 1 9.49

AT5G12040 Medtr3g104850Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase family protein 9.33

AT1G26690 contig_81908_1 emp24/gp25L/p24 family/GOLD family protein 9.32

AT5G18900 Medtr2g020800 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein 9.22

AT4G39540 contig_104603_1 SK2 shikimate kinase 2 9.19

AT5G26820 contig_8776_1 RTS3 iron-regulated protein 3 9.06

AT5G66815 contig_74316_2 8.98

AT3G04910 Medtr1g081330 ZIK4 with no lysine (K) kinase 1 8.93

AT3G59280 Medtr1g098440 TXR1 Protein Transporter, Pam16 8.85

AT2G28760 Medtr2g096660 UXS6 UDP-XYL synthase 6 8.83

AT3G52740 Medtr7g104540 8.68

AT3G03190 Medtr3g064700 GSTF11 glutathione S-transferase F11 8.54

AT5G54790 Medtr2g083300 8.53

AT2G28550 Medtr4g061200 TOE1 related to AP2.7 8.45

AT2G46700 Medtr7g118020 CRK3 CDPK-related kinase 3 8.39

AT1G19850 contig_61036_1 MPTranscriptional factor B3 family protein / auxin-responsive factor AUX/IAA-related 8.3

AT3G25900 Medtr5g056640 HMT-1 Homocysteine S-methyltransferase family protein 8.24

AT5G38530 contig_50685_1 TSBtype2 tryptophan synthase beta type 2 8.12

AT5G12010 Medtr2g040130 8.07

AT5G35750 Medtr5g097410 HK2 histidine kinase 2 8.02

AT1G65690 contig_57190_2Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family 7.99

AT3G28480 Medtr6g009440 Oxoglutarate/iron-dependent oxygenase 7.96

AT4G22590 Medtr4g101600 TPPG Haloacid dehalogenase-like hydrolase (HAD) superfamily protein 7.92

AT3G05290 Medtr5g039730 PNC1 peroxisomal adenine nucleotide carrier 1 7.91

AT1G27320 Medtr3g085130 HK3 histidine kinase 3 7.89

AT5G20660 Medtr1g095040 Zn-dependent exopeptidases superfamily protein 7.88

AT4G02860 Medtr1g072500 Phenazine biosynthesis PhzC/PhzF protein 7.8

AT3G51670 contig_54907_1SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein 7.8

AT2G21520 Medtr3g117100 Sec14p-like phosphatidylinositol transfer family protein 7.64

AT2G17990 Medtr8g076020 7.56

AT1G79380 Medtr6g092020 Ca(2)-dependent phospholipid-binding protein (Copine) family 7.56

AT1G13245 Medtr5g053440 RTFL17 ROTUNDIFOLIA like 17 7.44

12

At ID Mt ID Symbol Description ΔAt ΔMtAT3G22750 Medtr5g006560 Protein kinase superfamily protein 7.41

AT2G23540 contig_9183_1 GDSL-like Lipase/Acylhydrolase superfamily protein 7.4

AT4G13270 contig_68800_1Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family 7.34

AT4G05020 Medtr4g091240 NDB2 NAD(P)H dehydrogenase B2 7.22

AT5G12200 Medtr5g089280 PYD2 pyrimidine 2 7.2

AT5G20400 Medtr3g117420 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein 7.16

AT4G16520 Medtr4g101090 ATG8F Ubiquitin-like superfamily protein 7.16

AT1G74340 Medtr8g066600 DPMS2 dolichol phosphate-mannose biosynthesis regulatory protein-related 7.16

AT1G67480 Medtr3g085570 Galactose oxidase/kelch repeat superfamily protein 7.08

AT1G71100 Medtr1g108440 RSW10 Ribose 5-phosphate isomerase, type A protein 7.05

AT1G71980 contig_49396_1 Protease-associated (PA) RING/U-box zinc finger family protein 7.05

AT4G21450 Medtr4g091470 PapD-like superfamily protein 7

AT3G11420 contig_68468_1 Protein of unknown function (DUF604) 6.96

AT2G45330 Medtr4g023500 TRPT RNA 2'-phosphotransferase, Tpt1 / KptA family 6.93

AT4G00895 Medtr7g117900 ATPase, F1 complex, OSCP/delta subunit protein 6.89

AT5G06370 contig_74204_1 NC domain-containing protein-related 6.87

AT3G53270 Medtr3g113180 Small nuclear RNA activating complex (SNAPc), subunit SNAP43 protein 6.73

AT5G13750 Medtr3g010850 ZIFL1 zinc induced facilitator-like 1 6.72

AT3G14470 Medtr4g043500 NB-ARC domain-containing disease resistance protein 6.62

AT2G40800 contig_48328_4 6.61

AT5G22360 contig_75314_1 VAMP714 vesicle-associated membrane protein 714 6.56

AT1G32400 Medtr5g014080 TOM2A tobamovirus multiplication 2A 6.56

AT1G48320 Medtr2g045050 Thioesterase superfamily protein 6.5

AT5G54670 Medtr2g082570 KATC kinesin 3 6.48

AT4G13420 Medtr8g088200 HAK5 high affinity K+ transporter 5 6.47

AT2G43080 Medtr1g116810 AT-P4H-1 P4H isoform 1 6.41

AT5G53330 Medtr3g090640 Ubiquitin-associated/translation elongation factor EF1B protein 6.26

AT5G41990 Medtr3g080960 WNK8 with no lysine (K) kinase 8 6.23

AT4G17260 Medtr5g012390 Lactate/malate dehydrogenase family protein 6.22

AT4G31130 Medtr3g108630 Protein of unknown function (DUF1218) 6.22

AT3G49760 Medtr5g015090 bZIP5 basic leucine-zipper 5 6.2

AT4G13345 Medtr8g103740 MEE55 Serinc-domain containing serine and sphingolipid biosynthesis protein 6.2

AT5G67390 Medtr4g095440 6.17

AT5G55960 contig_165797_1 6.16

AT1G14190 Medtr5g041340 Glucose-methanol-choline (GMC) oxidoreductase family protein 6.13

AT1G51760 Medtr2g100510 JR3 peptidase M20/M25/M40 family protein 6.12

AT1G06290 Medtr4g079290 ATACX3 acyl-CoA oxidase 3 6.07

AT3G13772 contig_55303_1 TMN7 transmembrane nine 7 6.07

AT2G17240 Medtr4g012810 6.06

AT1G70610 Medtr5g033080 TAP1 transporter associated with antigen processing protein 1 6.03

AT4G33430 Medtr2g008360 SERK3 BRI1-associated receptor kinase 5.94

AT1G12050 Medtr2g025640 fumarylacetoacetase, putative 5.93

AT5G15130 Medtr4g107970 WRKY72 WRKY DNA-binding protein 72 5.91

AT3G17770 contig_50630_1 Dihydroxyacetone kinase 5.9

13

At ID Mt ID Symbol Description ΔAt ΔMtAT1G61590 Medtr5g026370 Protein kinase superfamily protein 5.84

AT2G46370 Medtr7g117110 JAR1 Auxin-responsive GH3 family protein 5.82

AT5G59140 contig_8613_2 BTB/POZ domain-containing protein 5.79

AT5G35690 Medtr4g027090 5.76

AT2G02800 Medtr5g038870 Kin2 protein kinase 2B 5.74

AT5G45480 Medtr8g020780 Protein of unknown function (DUF594) 5.73

AT5G55860 Medtr3g060660 Plant protein of unknown function (DUF827) 5.73

AT2G45590 Medtr8g035560 Protein kinase superfamily protein 5.71

AT1G61560 Medtr2g093750 MLO6 Seven transmembrane MLO family protein 5.66

AT1G76980 contig_74863_1 5.63

AT2G33390 Medtr1g045370 5.63

AT1G76520 Medtr8g072560 Auxin efflux carrier family protein 5.62

AT3G21550 Medtr2g020850 DMP2 DUF679 domain membrane protein 2 5.61

AT5G23890 contig_58481_1 5.57

AT1G68150 contig_12264_1 WRKY9 WRKY DNA-binding protein 9 5.52

AT1G32130 Medtr5g028030 IWS1 Transcription elongation factor (TFIIS) family protein 5.5

AT4G38360 Medtr3g118470 LAZ1 Protein of unknown function (DUF300) 5.46

AT1G05680 contig_60109_1 UGT74E2 Uridine diphosphate glycosyltransferase 74E2 5.46

AT5G27840 Medtr7g112870 TOPP8 Calcineurin-like metallo-phosphoesterase superfamily protein 5.45

AT1G74790 Medtr7g036900 catalytics 5.42

AT2G25180 Medtr3g106220 RR12 response regulator 12 5.42

AT5G24090 Medtr1g099320 CHIA chitinase A 5.41

AT5G03760 Medtr1g061510 RAT4 Nucleotide-diphospho-sugar transferases superfamily protein 5.38

AT4G39140 Medtr8g037750 RING/U-box superfamily protein 5.36

AT3G28210 contig_169244_1 SAP12 zinc finger (AN1-like) family protein 5.34

AT5G47730 Medtr2g027140 Sec14p-like phosphatidylinositol transfer family protein 5.34

AT1G24560 contig_49552_3 5.33

AT1G12420 Medtr4g101950 ACR8 ACT domain repeat 8 5.27

AT1G19110 Medtr2g042570 inter-alpha-trypsin inhibitor heavy chain-related 5.26

AT1G03950 contig_64995_1 VPS2.3 vacuolar protein sorting-associated protein 2.3 5.21

AT1G54320 contig_49360_2 LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein 5.21

AT2G44410 Medtr4g029440 RING/U-box superfamily protein 5.2

AT1G03470 Medtr7g108070 Kinase interacting (KIP1-like) family protein 5.2

AT5G03340 AC235487_5 ATPase, AAA-type, CDC48 protein 5.15

AT5G24810 Medtr1g008980 ABC1 family protein 5.14

AT2G32700 Medtr4g080530 MUM1 LEUNIG_homolog 5.09

AT4G03320 Medtr5g024800 Tic20-IV translocon at the inner envelope membrane of chloroplasts 20-IV 5.08

AT5G59480 Medtr2g097520 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein 5.07

AT5G55970 Medtr5g096410 RING/U-box superfamily protein 5.06

AT4G30160 Medtr2g036860 VLN4 villin 4 5.06

AT1G48790 Medtr8g104310 AMSH1 associated molecule with the SH3 domain of STAM 1 4.93

AT3G21630 Medtr3g080050LYSM RLK1 chitin elicitor receptor kinase 1 4.86

AT1G69850 Medtr5g038380 NTL1 nitrate transporter 1:2 4.85

AT3G11690 contig_11626_1 4.85

14

At ID Mt ID Symbol Description ΔAt ΔMtAT3G09920 contig_52775_1 PIP5K9 phosphatidyl inositol monophosphate 5 kinase 4.85

AT4G25360 Medtr7g034610 TBL18 TRICHOME BIREFRINGENCE-LIKE 18 4.84

AT1G09645 Medtr4g032200 4.8

AT5G60580 Medtr4g059540 RING/U-box superfamily protein 4.75

AT4G23550 contig_60648_1 WRKY29 WRKY family transcription factor 4.75

AT5G43100 Medtr5g016260 Eukaryotic aspartyl protease family protein 4.71

AT1G26670 Medtr5g042530 VTI1B Vesicle transport v-SNARE family protein 4.68

AT5G19530 Medtr5g006140 ACL5S-adenosyl-L-methionine-dependent methyltransferases superfamily protein 4.67

AT3G28850 Medtr7g010090 Glutaredoxin family protein 4.56

AT4G30240 Medtr4g128220 Syntaxin/t-SNARE family protein 4.54

AT3G02700 Medtr5g076250 NC domain-containing protein-related 4.53

AT4G19040 Medtr5g027200 EDR2 ENHANCED DISEASE RESISTANCE 2 4.52

AT1G02410 contig_53045_1 cytochrome c oxidase assembly protein CtaG / Cox11 family 4.51

AT3G47730 Medtr3g099990 ATH1 ATP-binding cassette A2 4.48

AT3G15510 contig_8291_1 NARS1 NAC domain containing protein 2 4.47

AT3G51000 contig_61596_3 alpha/beta-Hydrolases superfamily protein 4.44

AT3G60300 contig_49862_1 RWD domain-containing protein 4.44

AT3G12830 contig_93481_1 SAUR-like auxin-responsive protein family 4.42

AT3G52190 contig_59176_2 PHF1 phosphate transporter traffic facilitator1 4.37

AT1G05120 Medtr4g049500 Helicase protein with RING/U-box domain 4.28

AT1G25280 Medtr2g007930 TLP10 tubby like protein 10 4.28

AT5G57035 contig_59724_1 U-box domain-containing protein kinase family protein 4.27

AT1G22040 contig_62630_1 Galactose oxidase/kelch repeat superfamily protein 4.25

AT1G07870 Medtr2g095880 Protein kinase superfamily protein 4.23

AT2G19450 Medtr2g039940 TAG1 membrane bound O-acyl transferase (MBOAT) family protein 4.23

AT3G59300 Medtr5g090150 Pentatricopeptide repeat (PPR) superfamily protein 4.23

AT5G39240 Medtr6g015150 4.2

AT5G10180 Medtr3g087740 SULTR2;1 slufate transporter 2;1 4.18

AT2G03760 Medtr8g066220 ST1 sulphotransferase 12 4.18

AT3G14840 Medtr8g058070 Leucine-rich repeat transmembrane protein kinase 4.17

AT4G17570 Medtr5g013370 GATA26 GATA transcription factor 26 4.16

AT5G57480 Medtr4g128260 P-loop containing nucleoside triphosphate hydrolases superfamily protein 4.16

AT2G47260 Medtr1g086790 WRKY23 WRKY DNA-binding protein 23 4.13

AT5G52830 Medtr1g099600 WRKY27 WRKY DNA-binding protein 27 4.09

AT5G07910 contig_63155_1 Leucine-rich repeat (LRR) family protein 4.08

AT5G54650 Medtr4g081410 Fh5 formin homology5 4.06

AT3G07940 Medtr3g017500 Calcium-dependent ARF-type GTPase activating protein family 3.94

AT1G03350 Medtr1g089850 BSD domain-containing protein 3.88

AT5G03730 Medtr1g050690 SIS1 Protein kinase superfamily protein 3.87

AT4G06534 Medtr3g102120 3.87

AT4G21215 Medtr5g005560 3.84

AT2G36330 Medtr3g078010 Uncharacterised protein family (UPF0497) 3.83

AT5G53110 Medtr3g091200 RING/U-box superfamily protein 3.78

AT3G23200 contig_49903_1 Uncharacterised protein family (UPF0497) 3.77

15

At ID Mt ID Symbol Description ΔAt ΔMtAT5G28150 Medtr7g114790 Plant protein of unknown function (DUF868) 3.75

AT5G17010 Medtr4g077770 Major facilitator superfamily protein 3.75

AT3G26000 contig_237775_1 Ribonuclease inhibitor 3.74

AT1G74640 Medtr4g108630 alpha/beta-Hydrolases superfamily protein 3.71

AT3G20410 Medtr5g092810 CPK9 calmodulin-domain protein kinase 9 3.66

AT5G60410 Medtr4g060510 SIZ1DNA-binding protein with MIZ/SP-RING zinc finger, PHD-finger and SAP domain 3.66

AT3G16230 Medtr2g101350 Predicted eukaryotic LigT 3.65

AT5G56180 Medtr3g010170 ATARP8 actin-related protein 8 3.63

AT2G20560 Medtr4g078850 DNAJ heat shock family protein 3.63

AT2G17760 Medtr5g022880 Eukaryotic aspartyl protease family protein 3.6

AT5G11950 Medtr1g015830 LOG8 Putative lysine decarboxylase family protein 3.59

AT3G05858 Medtr4g124220 3.58

AT1G29760 Medtr8g087730 Putative adipose-regulatory protein (Seipin) 3.57

AT1G73980 Medtr4g112790 Phosphoribulokinase / Uridine kinase family 3.54

AT2G03810 Medtr5g047930 18S pre-ribosomal assembly protein gar2-related 3.51

AT3G29170 Medtr2g017920 Eukaryotic protein of unknown function (DUF872) 3.49

AT5G37590 Medtr3g065220 Tetratricopeptide repeat (TPR)-like superfamily protein 3.48

AT3G19970 contig_13376_1 alpha/beta-Hydrolases superfamily protein 3.47

AT4G12735 Medtr3g026790 3.47

AT5G25820 contig_10052_1 Exostosin family protein 3.46

AT5G19390 Medtr5g089490 Rho GTPase activation protein (RhoGAP) with PH domain 3.44

AT4G01370 Medtr7g078690 MPK4 MAP kinase 4 3.41

AT3G27960 contig_62391_2 Tetratricopeptide repeat (TPR)-like superfamily protein 3.4

AT1G22540 Medtr3g005010 Major facilitator superfamily protein 3.4

AT1G54060 Medtr8g022290 ASIL1 6B-interacting protein 1-like 1 3.35

AT5G15080 contig_61799_1 Protein kinase superfamily protein 3.34

AT1G25390 Medtr1g110130 Protein kinase superfamily protein 3.34

AT3G47670 contig_61430_1 Plant invertase/pectin methylesterase inhibitor superfamily protein 3.32

AT2G46620 Medtr7g117950 P-loop containing nucleoside triphosphate hydrolases superfamily protein 3.31

AT1G62300 contig_64381_1 WRKY6 WRKY family transcription factor 3.31

AT2G31140 contig_75065_2 Peptidase S24/S26A/S26B/S26C family protein 3.27

AT5G22800 Medtr3g118360 EMB86 Alanyl-tRNA synthetase, class IIc 3.24

AT4G35550 contig_168590_1 WOX13 WUSCHEL related homeobox 13 3.22

AT5G13700 Medtr3g033000 PAO1 polyamine oxidase 1 3.2

AT1G19700 Medtr1g023050 BLH10 BEL1-like homeodomain 10 3.17

AT3G09085 Medtr8g073280 Protein of unknown function (DUF962) 3.16

AT3G62270 Medtr7g110000 HCO3- transporter family 3.14

AT5G42570 Medtr4g049540 B-cell receptor-associated 31-like 3.12

AT1G30000 Medtr2g019520 MNS3 alpha-mannosidase 3 3.11

AT3G59090 Medtr5g091370 3.11

AT2G26570 Medtr3g101660 WEB1 Plant protein of unknown function (DUF827) 3.1

AT2G29990 Medtr5g071250 NDA2 alternative NAD(P)H dehydrogenase 2 3.09

AT1G17140 contig_8458_1 RIP1 interactor of constitutive active rops 1 3.07

AT5G28830 Medtr7g115070 calcium-binding EF hand family protein 3.07

16

At ID Mt ID Symbol Description ΔAt ΔMtAT1G07230 contig_69360_2 NPC1 non-specific phospholipase C1 3.06

AT1G04990 Medtr5g085200 Zinc finger C-x8-C-x5-C-x3-H type family protein 3.03

AT1G72220 Medtr5g064890 RING/U-box superfamily protein 3

AT3G24180 Medtr1g072720 Beta-glucosidase, GBA2 type family protein 3

AT1G49710 Medtr4g086010 FUT12 fucosyltransferase 12 2.97

AT5G06839 Medtr7g092750 TGA10 bZIP transcription factor family protein 2.94

AT5G13030 Medtr1g116880 2.93

AT5G65290 Medtr3g086840 LMBR1-like membrane protein 2.92

AT1G13570 AC233842_6 F-box/RNI-like superfamily protein 2.91

AT5G34940 Medtr4g116070 GUS3 glucuronidase 3 2.9

AT4G25560 Medtr6g055910 MYB18 myb domain protein 18 2.85

AT5G19070 contig_164321_1 SNARE associated Golgi protein family 2.85

AT3G10970 Medtr3g072340 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein 2.82

AT1G33250 Medtr5g008060 Protein of unknown function (DUF604) 2.81

AT4G17140 Medtr5g013780 pleckstrin homology (PH) domain-containing protein 2.79

AT5G53420 Medtr1g008220 CCT motif family protein 2.77

AT3G07160 Medtr1g116470 GSL10 glucan synthase-like 10 2.77

AT5G24320 Medtr1g007740 Transducin/WD40 repeat-like superfamily protein 2.76

AT5G23720 Medtr8g100000 PHS1 dual specificity protein phosphatase family protein 2.75

AT1G05200 Medtr2g088450 GLUR3 glutamate receptor 3.4 2.75

AT4G27780 contig_52731_1 ACBP2 acyl-CoA binding protein 2 2.75

AT1G33780 Medtr3g005140 Protein of unknown function (DUF179) 2.74

AT1G70520 Medtr5g033690 CRK2 cysteine-rich RLK (RECEPTOR-like protein kinase) 2 2.74

AT5G35370 Medtr3g072800 S-locus lectin protein kinase family protein 2.74

AT1G47380 Medtr3g101540 Protein phosphatase 2C family protein 2.71

AT5G24460 Medtr3g092810 2.7

AT2G34660 Medtr2g019020 MRP2 multidrug resistance-associated protein 2 2.68

AT4G28570 contig_55603_1 Long-chain fatty alcohol dehydrogenase family protein 2.67

AT5G62260 Medtr7g034630 AT hook motif DNA-binding family protein 2.67

AT1G67560 AC233656_18 LOX6 PLAT/LH2 domain-containing lipoxygenase family protein 2.66

AT3G46450 Medtr4g063520SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein 2.65

AT4G30100 Medtr8g020390 P-loop containing nucleoside triphosphate hydrolases superfamily protein 2.63

AT5G62150 Medtr8g043870 peptidoglycan-binding LysM domain-containing protein 2.63

AT5G11860 Medtr5g045920 SSP5 SCP1-like small phosphatase 5 2.62

AT5G53480 contig_49649_1 ARM repeat superfamily protein 2.6

AT1G49430 contig_83197_1 LRD2 long-chain acyl-CoA synthetase 2 2.59

AT1G53035 Medtr2g013680 2.58

AT2G20320 Medtr7g099030 DENN (AEX-3) domain-containing protein 2.57

AT2G31130 Medtr4g079720 2.57

AT4G03510 contig_75028_1 RMA1 RING membrane-anchor 1 2.56

AT3G50910 Medtr5g020870 2.55

AT1G61240 Medtr2g012570 Protein of unknown function (DUF707) 2.54

AT2G15695 Medtr4g086420 Protein of unknown function DUF829, transmembrane 53 2.54

AT3G53490 Medtr7g100150 2.54

17

At ID Mt ID Symbol Description ΔAt ΔMtAT5G46560 Medtr5g014010 2.53

AT1G61690 contig_60486_1 phosphoinositide binding 2.52

AT2G35920 Medtr1g056490 RNA helicase family protein 2.52

AT1G31350 Medtr5g026580 KUF1 KAR-UP F-box 1 2.5

AT1G68430 Medtr1g110190 2.48

AT1G22180 Medtr5g062310 Sec14p-like phosphatidylinositol transfer family protein 2.46

AT2G25620 Medtr3g107880 DBP1 DNA-binding protein phosphatase 1 2.44

AT3G03860 Medtr6g029240 ATAPRL5 APR-like 5 2.44

AT3G13050 Medtr4g005090 NiaP Major facilitator superfamily protein 2.44

AT4G16110 Medtr2g034960 RR2 response regulator 2 2.41

AT3G24450 Medtr6g086020 Heavy metal transport/detoxification superfamily protein 2.41

AT2G30530 Medtr3g062850 2.39

AT4G33790 Medtr2g086090 G7 Jojoba acyl CoA reductase-related male sterility protein 2.36

AT4G27800 contig_110333_1 TAP38 thylakoid-associated phosphatase 38 2.35

AT1G33270 Medtr2g007650 Acyl transferase/acyl hydrolase/lysophospholipase superfamily protein 2.33

AT3G01980 Medtr1g007800 NAD(P)-binding Rossmann-fold superfamily protein 2.32

AT1G22510 Medtr3g005800 RING/U-box protein with domain of unknown function (DUF 1232) 2.24

AT1G18890 contig_50481_1 CPK10 calcium-dependent protein kinase 1 2.22

AT5G25050 Medtr1g014250 Major facilitator superfamily protein 2.21

AT5G50840 Medtr1g095640 2.2

AT2G38300 Medtr7g069660 myb-like HTH transcriptional regulator family protein 2.19

AT3G13690 Medtr2g100290Protein kinase protein with adenine nucleotide alpha hydrolases-like domain 2.19

AT3G21295 contig_56981_2 Tudor/PWWP/MBT superfamily protein 2.16

AT1G77770 Medtr3g073240 Protein of unknown function (DUF1644) 2.13

AT4G03000 Medtr2g020870 RING/U-box superfamily protein 2.11

AT5G49570 Medtr7g114940 PNG1 peptide-N-glycanase 1 2.09

AT1G56420 Medtr1g084000 2.07

AT2G26780 Medtr5g089000 ARM repeat superfamily protein 2.07

AT5G34930 Medtr4g115980 arogenate dehydrogenase 2.06

AT1G01710 contig_55114_1 Acyl-CoA thioesterase family protein 2.06

AT5G20610 contig_57092_1 2.02

AT1G28050 Medtr7g083540 B-box type zinc finger protein with CCT domain 2.01

AT3G10420 AC233660_29 SPD1 P-loop containing nucleoside triphosphate hydrolases superfamily protein 2

AT1G80210 Medtr2g103110 BRCC36A Mov34/MPN/PAD-1 family protein 1.97

AT5G61430 contig_103035_1 NAC100 NAC domain containing protein 100 1.97

AT5G12400 Medtr4g076180 DNA binding;zinc ion binding;DNA binding 1.95

AT1G44750 Medtr7g080750 PUP11 purine permease 11 1.94

AT2G44750 Medtr8g058440 TPK2 thiamin pyrophosphokinase 2 1.93

AT3G27010 Medtr7g028160 TCP20TEOSINTE BRANCHED 1, cycloidea, PCF (TCP)-domain family protein 20 1.93

AT1G03370 Medtr2g027360 C2 calcium/lipid-binding and GRAM domain containing protein 1.93

AT1G34260 contig_49533_1 FAB1D FORMS APLOID AND BINUCLEATE CELLS 1A 1.91

AT1G68550 contig_75149_1 CRF10 Integrase-type DNA-binding superfamily protein 1.82

AT1G23830 contig_57535_2 1.81

AT4G36470 Medtr5g046110S-adenosyl-L-methionine-dependent methyltransferases superfamily protein 1.8

18

At ID Mt ID Symbol Description ΔAt ΔMtAT5G39660 Medtr6g012450 CDF2 cycling DOF factor 2 1.79

AT2G44850 contig_116241_1 1.79

AT2G29900 contig_8513_1 PS2 Presenilin-2 1.77

AT3G06330 Medtr2g020520 RING/U-box superfamily protein 1.77

AT1G79570 contig_8811_1Protein kinase superfamily protein with octicosapeptide/Phox/Bem1p domain 1.77

AT2G15730 Medtr4g086580 P-loop containing nucleoside triphosphate hydrolases superfamily protein 1.75

AT1G58250 Medtr3g099880 SABGolgi-body localisation protein domain ;RNA pol II promoter Fmp27 protein domain 1.74

AT3G03440 Medtr5g079550 ARM repeat superfamily protein 1.73

AT4G02730 Medtr1g072140 WDR5b Transducin/WD40 repeat-like superfamily protein 1.72

AT1G22710 Medtr4g131920 SUT1 sucrose-proton symporter 2 1.72

AT5G41800 contig_66064_1 Transmembrane amino acid transporter family protein 1.71

AT1G55310 Medtr3g083550 SR33 SC35-like splicing factor 33 1.7

AT2G25730 Medtr3g108360 1.69

AT4G11570 Medtr8g098300 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein 1.62

AT3G07070 Medtr7g058810 Protein kinase superfamily protein 1.62

AT2G29620 contig_49825_1 1.6

AT4G26180 Medtr6g091800 Mitochondrial substrate carrier family protein 1.6

AT1G74360 contig_62734_1 Leucine-rich repeat protein kinase family protein 1.58

AT4G03260 contig_53221_1 Outer arm dynein light chain 1 protein 1.56

AT2G01913 contig_62144_1 1.56

AT3G47850 contig_239741_1 1.55

AT3G24760 Medtr7g065550 Galactose oxidase/kelch repeat superfamily protein 1.53

AT5G62500 Medtr4g108330 EB1B end binding protein 1B 1.5

AT1G54710 Medtr1g082300 ATG18H homolog of yeast autophagy 18 (ATG18) H 1.47

AT2G45690 contig_9964_1 SSE1 shrunken seed protein (SSE1) 1.44

AT4G22860 Medtr4g101890 Cell cycle regulated microtubule associated protein 1.43

AT1G34220 contig_69417_1 Regulator of Vps4 activity in the MVB pathway protein 1.4

AT5G04020 Medtr7g090500 calmodulin binding 1.37

AT1G77810 Medtr3g073370 Galactosyltransferase family protein 1.37

AT2G27290 Medtr4g052010 Protein of unknown function (DUF1279) 1.34

AT3G07970 Medtr3g030540 QRT2 Pectin lyase-like superfamily protein 1.33

AT5G22400 Medtr7g104900 Rho GTPase activating protein with PAK-box/P21-Rho-binding domain 1.32

AT5G50670 Medtr3g099080 SPL13BSquamosa promoter-binding protein-like (SBP domain) transcription factor family protein 1.27

AT5G23150 Medtr4g075060 HUA2 Tudor/PWWP/MBT domain-containing protein 1.25

AT1G80570 contig_60341_2 RNI-like superfamily protein 1.23

AT3G08960 Medtr7g069460 ARM repeat superfamily protein 1.19

AT1G62350 Medtr1g031110 Pentatricopeptide repeat (PPR) superfamily protein 1.18

AT1G07630 contig_65662_1 PLL5 pol-like 5 1.18

AT5G50570 Medtr3g099080 SPL13ASquamosa promoter-binding protein-like (SBP domain) transcription factor family protein 1.16

AT4G29420 Medtr8g101930 F-box/RNI-like superfamily protein 1.11

AT3G19360 Medtr4g113970 Zinc finger (CCCH-type) family protein 1.05

AT3G15390 Medtr2g013430 SDE5 silencing defective 5 1.03

AT1G70140 Medtr5g036540 FH8 formin 8 1.02

AT3G61490 Medtr7g038050 Pectin lyase-like superfamily protein 0.99

19

At ID Mt ID Symbol Description ΔAt ΔMtAT5G19030 contig_131235_1 RNA-binding (RRM/RBD/RNP motifs) family protein 0.97

AT2G32800 contig_52929_1 AP4.3A protein kinase family protein 0.89

AT4G16440 Medtr3g117360 ferredoxin hydrogenases 0.78

AT1G42540 Medtr3g115910 GLR3.3 glutamate receptor 3.3 0.75

AT4G39420 Medtr8g092100 0.62

AT3G10550 contig_85282_1 MTM1 Myotubularin-like phosphatases II superfamily 0.39

AT3G03140 Medtr4g077550 Tudor/PWWP/MBT superfamily protein -0.44

AT2G27060 Medtr5g087780 Leucine-rich repeat protein kinase family protein -0.6

AT4G37890 Medtr5g030690 EDA40 Zinc finger (C3HC4-type RING finger) family protein -0.64

AT1G71310 Medtr4g035350 RAD52-1B.2 cobalt ion binding -0.66

AT4G38370 Medtr5g099030 Phosphoglycerate mutase family protein -0.71

AT3G24495 Medtr6g086270 MSH7 MUTS homolog 7 -0.73

AT2G23360 contig_51064_1 Plant protein of unknown function (DUF869) -0.74

AT1G73660 Medtr8g107000 protein tyrosine kinase family protein -0.78

AT1G80030 Medtr2g104030 Molecular chaperone Hsp40/DnaJ family protein -0.79

AT4G13970 Medtr4g080580 zinc ion binding -0.8

AT1G34355 Medtr1g096000 PS1 forkhead-associated (FHA) domain-containing protein -0.8

AT2G40130 contig_7860_1Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein -0.81

AT2G45770 Medtr8g032340 FRD4 signal recognition particle receptor protein, chloroplast (FTSY) -0.81

AT3G46980 Medtr5g069630 PHT4;3 phosphate transporter 4;3 -0.85

AT5G58160 Medtr4g131020 actin binding -0.86

AT3G17360 Medtr4g123730 POK1 phragmoplast orienting kinesin 1 -0.89

AT2G24640 contig_62831_1 UBP19 ubiquitin-specific protease 19 -0.9

AT4G30720 contig_49504_3 PDE327 FAD/NAD(P)-binding oxidoreductase family protein -0.9

AT5G08720 Medtr8g094800 -0.91

AT2G01210 contig_55621_1 Leucine-rich repeat protein kinase family protein -0.92

AT5G01920 Medtr8g005720 STN8 Protein kinase superfamily protein -0.94

AT5G50340 Medtr8g014670

ATP-dependent peptidases;nucleotide binding;serine-type endopeptidases;DNA helicases;ATP binding;damaged DNA binding;nucleoside-triphosphatases -0.95

AT1G02370 Medtr1g086820 Tetratricopeptide repeat (TPR)-like superfamily protein -0.95

AT2G42700 Medtr4g080110 -0.97

AT5G05970 Medtr5g081240 NEDD1 Transducin/WD40 repeat-like superfamily protein -0.98

AT4G36970 CU571152_1022 Remorin family protein -0.98

AT5G57250 Medtr2g037740 Pentatricopeptide repeat (PPR) superfamily protein -0.99

AT1G69400 Medtr5g043000 Transducin/WD40 repeat-like superfamily protein -1

AT2G43200 Medtr7g006060S-adenosyl-L-methionine-dependent methyltransferases superfamily protein -1

AT4G13370 contig_12390_1 Plant protein of unknown function (DUF936) -1.01

AT3G17970 Medtr8g107280 TOC64-III translocon at the outer membrane of chloroplasts 64-III -1.01

AT3G48160 Medtr4g106540 E2L3 DP-E2F-like 1 -1.02

AT4G02110 Medtr1g087290 transcription coactivators -1.03

AT5G64390 Medtr4g093650 HEN4 RNA-binding KH domain-containing protein -1.03

AT4G33480 AC235665_66 -1.05

AT2G20980 Medtr3g117880 MCM10 minichromosome maintenance 10 -1.07

AT5G66810 contig_74606_1 -1.07

20

At ID Mt ID Symbol Description ΔAt ΔMtAT5G03450 Medtr7g102280 Transducin/WD40 repeat-like superfamily protein -1.07

AT5G05560 Medtr5g082890 EMB2771 E3 ubiquitin ligase, putative -1.07

AT3G02690 contig_109863_2 nodulin MtN21 /EamA-like transporter family protein -1.08

AT5G60040 Medtr4g061800 NRPC1 nuclear RNA polymerase C1 -1.14

AT4G38440 Medtr5g046240 IYO -1.15

AT5G63920 Medtr3g096640 TOP3A topoisomerase 3alpha -1.15

AT2G30320 Medtr5g074640 Pseudouridine synthase family protein -1.16

AT5G66770 Medtr4g077760 GRAS family transcription factor -1.17

AT1G05410 Medtr5g006390 Protein of unknown function (DUF1423) -1.18

AT5G07320 Medtr3g098460 APC3 Mitochondrial substrate carrier family protein -1.19

AT1G69210 Medtr5g045020 Uncharacterised protein family UPF0090 -1.2

AT5G05450 Medtr3g071620 P-loop containing nucleoside triphosphate hydrolases superfamily protein -1.2

AT3G06980 Medtr3g118120 DEA(D/H)-box RNA helicase family protein -1.22

AT4G22730 Medtr5g011840 Leucine-rich repeat protein kinase family protein -1.22

AT1G26810 Medtr5g041210 GALT1 galactosyltransferase1 -1.23

AT3G18680 Medtr8g093330 Amino acid kinase family protein -1.25

AT4G35240 Medtr5g098980 Protein of unknown function (DUF630 and DUF632) -1.25

AT3G19120 Medtr4g086650 PIF / Ping-Pong family of plant transposases -1.26

AT4G00340 Medtr8g030500 RLK4 receptor-like protein kinase 4 -1.27

AT4G24270 AC235757_52 EMB140 EMBRYO DEFECTIVE 140 -1.27

AT1G67620 Medtr3g085720 Lojap-related protein -1.3

AT1G30460 contig_82226_1 CPSF30 cleavage and polyadenylation specificity factor 30 -1.3

AT5G33280 Medtr4g115640 Voltage-gated chloride channel family protein -1.3

AT1G57540 contig_167076_1 -1.32

AT2G39190 Medtr1g095480 ATATH8 Protein kinase superfamily protein -1.33

AT2G34190 Medtr8g086520 Xanthine/uracil permease family protein -1.34

AT1G73820 contig_62560_1 Ssu72-like family protein -1.34

AT4G20910 contig_54961_1 HEN1 double-stranded RNA binding protein-related / DsRBD protein-related -1.35

AT3G58790 contig_89944_1 GAUT15 galacturonosyltransferase 15 -1.36

AT2G34450 contig_74575_1 HMG-box (high mobility group) DNA-binding family protein -1.36

AT4G30310 Medtr4g128640 FGGY family of carbohydrate kinase -1.37

AT3G10700 Medtr8g101540 GalAK galacturonic acid kinase -1.37

AT1G72250 Medtr2g064820 Di-glucose binding protein with Kinesin motor domain -1.38

AT5G45380 Medtr5g026640 DUR3 solute:sodium symporters;urea transmembrane transporters -1.39

AT1G06590 Medtr5g091020 -1.4

AT5G51750 Medtr1g102350 SBT1.3 subtilase 1.3 -1.42

AT5G22050 Medtr2g087680 Protein kinase superfamily protein -1.43

AT1G11800 Medtr4g132300 endonuclease/exonuclease/phosphatase family protein -1.43

AT2G20340 Medtr7g098730 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein -1.44

AT5G46640 Medtr4g098460 AT hook motif DNA-binding family protein -1.44

AT5G25630 Medtr1g008310 Tetratricopeptide repeat (TPR)-like superfamily protein -1.45

AT5G24330 Medtr1g007670 SDG34 ARABIDOPSIS TRITHORAX-RELATED PROTEIN 6 -1.45

AT3G62060 Medtr7g110900 Pectinacetylesterase family protein -1.46

AT1G66680 Medtr7g082910 AR401S-adenosyl-L-methionine-dependent methyltransferases superfamily protein -1.48

21

At ID Mt ID Symbol Description ΔAt ΔMtAT1G12800 contig_53888_1 Nucleic acid-binding, OB-fold-like protein -1.49

AT5G64860 Medtr3g094840 DPE1 disproportionating enzyme -1.5

AT1G73880 Medtr2g059240 UGT89B1 UDP-glucosyl transferase 89B1 -1.5

AT2G39930 Medtr8g101490 ISA1 isoamylase 1 -1.5

AT4G37445 contig_83487_3 -1.51

AT2G25830 Medtr3g109620 YebC-related -1.51

AT1G18060 Medtr8g106690 -1.51

AT4G33490 Medtr3g096930 Eukaryotic aspartyl protease family protein -1.51

AT1G73730 Medtr2g098470 SLIM1 ETHYLENE-INSENSITIVE3-like 3 -1.51

AT3G12750 contig_62420_1 ZIP1 zinc transporter 1 precursor -1.51

AT5G52520 Medtr3g100910 PRORS1 Class II aaRS and biotin synthetases superfamily protein -1.52

AT1G70200 Medtr5g035330 RNA-binding (RRM/RBD/RNP motifs) family protein -1.53

AT3G56040 Medtr3g071440 UGP3 UDP-glucose pyrophosphorylase 3 -1.54

AT4G02725 contig_49338_1 -1.54

AT2G40190 contig_74197_2 LEW3 UDP-Glycosyltransferase superfamily protein -1.54

AT5G42140 Medtr1g099220Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain -1.54

AT2G41890 Medtr7g092050curculin-like (mannose-binding) lectin family protein / PAN domain-containing protein -1.54

AT5G49960 Medtr2g005870 -1.55

AT1G10780 Medtr2g007220 F-box/RNI-like superfamily protein -1.55

AT4G37920 Medtr5g030900 -1.56

AT2G40480 Medtr5g083980 Plant protein of unknown function (DUF827) -1.56

AT2G45280 Medtr4g112130 RAD51C RAS associated with diabetes protein 51C -1.56

AT1G08980 Medtr1g082750 TOC64-I amidase 1 -1.58

AT2G43410 Medtr4g068120 FPA RNA binding -1.58

AT2G24240 Medtr4g130970 BTB/POZ domain with WD40/YVTN repeat-like protein -1.59

AT3G19720 contig_59863_1 DRP5B P-loop containing nucleoside triphosphate hydrolases superfamily protein -1.6

AT4G03500 Medtr5g085830 Ankyrin repeat family protein -1.61

AT3G49500 Medtr3g107390 SGS2 RNA-dependent RNA polymerase 6 -1.61

AT1G74000 Medtr2g058450 SS3 strictosidine synthase 3 -1.62

AT1G73690 contig_55382_1 CDKD1;1 cyclin-dependent kinase D1;1 -1.63

AT5G18700 Medtr2g020380 RUK Protein kinase family protein with ARM repeat domain -1.65

AT4G28706 Medtr7g099270 pfkB-like carbohydrate kinase family protein -1.66

AT2G37510 Medtr7g099940 RNA-binding (RRM/RBD/RNP motifs) family protein -1.67

AT2G34460 Medtr4g115730 NAD(P)-binding Rossmann-fold superfamily protein -1.67

AT2G22420 Medtr4g031060 Peroxidase superfamily protein -1.67

AT1G64600 Medtr8g040700 methyltransferases;copper ion binding -1.68

AT3G19810 Medtr8g086630 Protein of unknown function (DUF177) -1.69

AT1G49670 Medtr4g086400 NQR ARP protein (REF) -1.7

AT1G69220 Medtr5g045190 SIK1 Protein kinase superfamily protein -1.7

AT1G04290 Medtr3g098130 Thioesterase superfamily protein -1.71

AT4G19540 contig_61824_2 INDL IND1(iron-sulfur protein required for NADH dehydrogenase)-like -1.71

AT1G50120 Medtr8g009530 -1.73

AT1G60550 contig_162843_1 ECHID enoyl-CoA hydratase/isomerase D -1.73

AT5G57930 Medtr2g088390 emb1629 Arabidopsis thaliana protein of unknown function (DUF794) -1.76

22

At ID Mt ID Symbol Description ΔAt ΔMtAT4G36930 Medtr5g017040 SPT basic helix-loop-helix (bHLH) DNA-binding superfamily protein -1.76

AT5G66470 contig_50631_1 RNA binding;GTP binding -1.76

AT5G35970 contig_50424_1 P-loop containing nucleoside triphosphate hydrolases superfamily protein -1.77

AT3G11890 contig_53458_1 Sterile alpha motif (SAM) domain-containing protein -1.77

AT3G26780 contig_56873_1 MEF14 Phosphoglycerate mutase family protein -1.77

AT4G00730 Medtr7g076080 ANL2Homeobox-leucine zipper family protein / lipid-binding START domain-containing protein -1.78

AT5G11720 Medtr2g031110 Glycosyl hydrolases family 31 protein -1.78

AT3G26744 contig_50484_2 SCRM basic helix-loop-helix (bHLH) DNA-binding superfamily protein -1.81

AT1G09960 Medtr5g067470 SUT4 sucrose transporter 4 -1.82

AT4G14930 Medtr1g104500 Survival protein SurE-like phosphatase/nucleotidase -1.83

AT3G20020 contig_49474_2 PRMT6 protein arginine methyltransferase 6 -1.83

AT4G09040 Medtr3g099590 RNA-binding (RRM/RBD/RNP motifs) family protein -1.84

AT3G02730 Medtr7g080250 TRXF1 thioredoxin F-type 1 -1.84

AT1G48950 Medtr4g112060 C3HC zinc finger-like -1.85

AT5G18590 Medtr4g119100 Galactose oxidase/kelch repeat superfamily protein -1.87

AT4G36650 Medtr5g019910 PBRP plant-specific TFIIB-related protein -1.87

AT5G40250 contig_61644_1 RING/U-box superfamily protein -1.89

AT4G04885 contig_85934_1 PCFS4 PCF11P-similar protein 4 -1.89

AT3G63190 Medtr1g072170 RRF ribosome recycling factor, chloroplast precursor -1.89

AT3G63530 contig_54115_1 BB2 RING/U-box superfamily protein -1.89

AT3G43540 contig_84187_1 Protein of unknown function (DUF1350) -1.89

AT3G01680 Medtr7g032660 SEOR1 -1.9

AT5G11330 Medtr1g011690 FAD/NAD(P)-binding oxidoreductase family protein -1.91

AT1G63160 contig_169953_1 RFC2 replication factor C 2 -1.92

AT2G35100 Medtr4g084200 ARAD1 Exostosin family protein -1.92

AT5G14550 Medtr8g094180Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein -1.94

AT3G47860 Medtr5g092080 CHL chloroplastic lipocalin -1.94

AT4G37130 Medtr5g018390 hydroxyproline-rich glycoprotein family protein -1.94

AT3G61590 AC233577_28 HWS Galactose oxidase/kelch repeat superfamily protein -1.94

AT2G38730 Medtr8g040180 Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein -1.95

AT1G78895 contig_55693_2 Reticulon family protein -1.95

AT1G21070 contig_61732_1 Nucleotide-sugar transporter family protein -1.96

AT4G17770 contig_94834_1 TPS5 trehalose phosphatase/synthase 5 -1.97

AT1G04635 Medtr5g068650 EMB1687 ribonuclease P family protein / Rpp14 family protein -2.01

AT4G03415 Medtr4g037470 Protein phosphatase 2C family protein -2.01

AT4G25240 Medtr3g008580 SKS1 SKU5 similar 1 -2.03

AT4G27610 contig_237660_1 -2.03

AT4G23493 Medtr5g010040 -2.03

AT3G23670 Medtr3g084790 PAKRP1L phragmoplast-associated kinesin-related protein, putative -2.04

AT3G59490 Medtr2g098960 -2.05

AT4G04850 Medtr4g092790 KEA3 K+ efflux antiporter 3 -2.05

AT2G19170 Medtr4g127480 SLP3 subtilisin-like serine protease 3 -2.06

AT5G48910 Medtr6g060510 LPA66 Pentatricopeptide repeat (PPR) superfamily protein -2.06

AT1G30330 Medtr2g018690 ARF6 auxin response factor 6 -2.06

23

At ID Mt ID Symbol Description ΔAt ΔMtAT2G27680 contig_66828_3 NAD(P)-linked oxidoreductase superfamily protein -2.06

AT5G14940 Medtr6g008690 Major facilitator superfamily protein -2.07

AT5G50180 Medtr3g076970 Protein kinase superfamily protein -2.09

AT5G06060 contig_49566_2 NAD(P)-binding Rossmann-fold superfamily protein -2.09

AT4G32570 Medtr3g107950 TIFY8 TIFY domain protein 8 -2.09

AT2G47680 Medtr1g088590 zinc finger (CCCH type) helicase family protein -2.1

AT2G34860 Medtr1g116170 EDA3 DnaJ/Hsp40 cysteine-rich domain superfamily protein -2.1

AT4G08920 Medtr5g063920 OOP2 cryptochrome 1 -2.11

AT2G46820 Medtr7g118290 TMP14 photosystem I P subunit -2.12

AT2G01630 contig_103600_1 O-Glycosyl hydrolases family 17 protein -2.12

AT4G15450 Medtr8g102510 Senescence/dehydration-associated protein-related -2.13

AT1G09160 Medtr7g112430 Protein phosphatase 2C family protein -2.13

AT3G23660 Medtr3g084740 Sec23/Sec24 protein transport family protein -2.13

AT5G37020 Medtr3g064050 ATARF8 auxin response factor 8 -2.14

AT5G63380 Medtr3g088880 AMP-dependent synthetase and ligase family protein -2.14

AT3G54750 contig_62280_1 -2.14

AT3G12930 Medtr2g069470 Lojap-related protein -2.16

AT3G48260 Medtr3g076650 WNK3 with no lysine (K) kinase 3 -2.18

AT1G34020 Medtr1g098240 Nucleotide-sugar transporter family protein -2.2

AT1G77580 contig_63272_1 Plant protein of unknown function (DUF869) -2.2

AT4G37510 Medtr5g016070 Ribonuclease III family protein -2.21

AT4G01800 Medtr1g086050 SECA1 Albino or Glassy Yellow 1 -2.21

AT4G15110 Medtr5g009110 CYP97B3 cytochrome P450, family 97, subfamily B, polypeptide 3 -2.21

AT5G24300 Medtr3g091570 SS1 Glycogen/starch synthases, ADP-glucose type -2.23

AT1G49450 contig_103031_1 Transducin/WD40 repeat-like superfamily protein -2.23

AT3G29320 Medtr6g014480 PHS1 Glycosyl transferase, family 35 -2.24

AT2G20680 Medtr4g078230 MAN2 Glycosyl hydrolase superfamily protein -2.24

AT5G01460 contig_48227_1 LMBR1-like membrane protein -2.24

AT4G26540 Medtr3g060880 Leucine-rich repeat receptor-like protein kinase family protein -2.24

AT3G24040 contig_51734_1Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein -2.25

AT3G05330 Medtr7g113510 ATTAN cyclin family -2.26

AT5G08050 Medtr3g026020 Protein of unknown function (DUF1118) -2.27

AT1G01225 contig_81613_1 NC domain-containing protein-related -2.27

AT2G31270 Medtr6g077680 CDT1A homolog of yeast CDT1 A -2.28

AT3G02050 contig_51262_1 KUP3 K+ uptake transporter 3 -2.28

AT1G16070 AC233655_49 TLP8 tubby like protein 8 -2.29

AT1G56050 contig_54749_1 GTP-binding protein-related -2.29

AT2G26180 Medtr3g104570 IQD6 IQ-domain 6 -2.3

AT1G47550 Medtr1g021680 SEC3A exocyst complex component sec3A -2.31

AT1G15290 Medtr4g009960 Tetratricopeptide repeat (TPR)-like superfamily protein -2.31

AT3G10110 Medtr4g078050 MEE67Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein -2.32

AT1G54780 Medtr1g082420 TLP18.3 thylakoid lumen 18.3 kDa protein -2.32

AT5G51020 Medtr3g098510 CRL crumpled leaf -2.32

AT2G32590 contig_69328_1 EMB2795 -2.32

24

At ID Mt ID Symbol Description ΔAt ΔMtAT2G37050 Medtr7g100630 Leucine-rich repeat protein kinase family protein -2.32

AT5G18580 Medtr4g119230 TON2 tonneau 2 (TON2) -2.33

AT5G64330 Medtr4g093850 RPT3 Phototropic-responsive NPH3 family protein -2.34

AT2G30105 contig_241297_1 -2.34

AT3G18390 Medtr6g084410 EMB1865 CRS1 / YhbY (CRM) domain-containing protein -2.35

AT4G18370 Medtr2g019140 HHOA DEGP protease 5 -2.35

AT1G72830 Medtr2g099490 NF-YA3 nuclear factor Y, subunit A3 -2.36

AT3G01800 Medtr8g040070 Ribosome recycling factor -2.38

AT5G12370 Medtr8g023330 SEC10 exocyst complex component sec10 -2.38

AT1G69420 Medtr5g042870 DHHC-type zinc finger family protein -2.38

AT2G39800 Medtr4g020450 P5CS1 delta1-pyrroline-5-carboxylate synthase 1 -2.38

AT3G45230 Medtr2g094170 hydroxyproline-rich glycoprotein family protein -2.39

AT5G47040 Medtr5g013790 LON2 lon protease 2 -2.41

AT3G43610 AC151525_7 Spc97 / Spc98 family of spindle pole body (SBP) component -2.41

AT2G17410 Medtr5g024920 ARID/BRIGHT DNA-binding domain-containing protein -2.43

AT5G51010 Medtr3g098520 Rubredoxin-like superfamily protein -2.43

AT2G37330 Medtr7g100160 ALS3 aluminum sensitive 3 -2.44

AT1G19800 Medtr3g005100 TGD1 trigalactosyldiacylglycerol 1 -2.45

AT2G05100 Medtr5g097280 LHCB2.1 photosystem II light harvesting complex gene 2.1 -2.45

AT2G43880 Medtr2g049400 Pectin lyase-like superfamily protein -2.46

AT3G20150 Medtr5g094310 Kinesin motor family protein -2.46

AT1G15440 Medtr7g076230 PWP2 periodic tryptophan protein 2 -2.47

AT2G16850 Medtr3g118010 PIP3B plasma membrane intrinsic protein 2;8 -2.47

AT3G59780 Medtr3g084020 Rhodanese/Cell cycle control phosphatase superfamily protein -2.48

AT1G79520 contig_9679_1 Cation efflux family protein -2.49

AT4G16650 Medtr4g100810 O-fucosyltransferase family protein -2.49

AT4G21520 Medtr4g091080 Transducin/WD40 repeat-like superfamily protein -2.5

AT1G52540 Medtr2g103950 Protein kinase superfamily protein -2.5

AT2G43330 Medtr7g005910 INT1 inositol transporter 1 -2.51

AT5G51600 Medtr7g034620 PLE Microtubule associated protein (MAP65/ASE1) family protein -2.52

AT4G19900 Medtr4g084060 alpha 1,4-glycosyltransferase family protein -2.54

AT2G47450 contig_84060_1 CPSRP43 chloroplast signal recognition particle component (CAO) -2.54

AT3G42660 Medtr2g059200 transducin family protein / WD-40 repeat family protein -2.56

AT1G32200 Medtr5g029230 ATS1 phospholipid/glycerol acyltransferase family protein -2.56

AT1G20160 Medtr3g104930 ATSBT5.2 Subtilisin-like serine endopeptidase family protein -2.56

AT3G08850 Medtr7g072330 RAPTOR1B HEAT repeat ;WD domain, G-beta repeat protein protein -2.56

AT2G25800 Medtr3g109630 Protein of unknown function (DUF810) -2.57

AT5G47390 Medtr4g100630 myb-like transcription factor family protein -2.59

AT4G04910 AC233659_1 NSF AAA-type ATPase family protein -2.6

AT4G35720 Medtr5g023290 Arabidopsis protein of unknown function (DUF241) -2.63

AT3G57560 Medtr3g108460 NAGK N-acetyl-l-glutamate kinase -2.63

AT5G55280 Medtr5g094120 FTSZ1-1 homolog of bacterial cytokinesis Z-ring protein FTSZ 1-1 -2.63

AT1G49340 Medtr3g116250ATPI4K ALPHA Phosphatidylinositol 3- and 4-kinase family protein -2.63

AT3G15650 Medtr2g103140 alpha/beta-Hydrolases superfamily protein -2.63

25

At ID Mt ID Symbol Description ΔAt ΔMtAT5G11420 Medtr1g011800 Protein of unknown function, DUF642 -2.64

AT3G27230 Medtr3g071050S-adenosyl-L-methionine-dependent methyltransferases superfamily protein -2.64

AT2G40490 Medtr3g072330 HEME2 Uroporphyrinogen decarboxylase -2.66

AT4G22290 Medtr2g025190 Ubiquitin-specific protease family C19-related protein -2.66

AT1G33810 Medtr4g031650 -2.67

AT2G33820 contig_52393_1 MBAC1 Mitochondrial substrate carrier family protein -2.67

AT5G24120 Medtr3g090900 SIGE sigma factor E -2.69

AT4G39120 Medtr3g117220 IMPL2 myo-inositol monophosphatase like 2 -2.69

AT3G18830 Medtr3g116240 PMT5 polyol/monosaccharide transporter 5 -2.7

AT2G25270 Medtr3g106510 -2.71

AT4G36180 Medtr5g021670 Leucine-rich receptor-like protein kinase family protein -2.71

AT5G67030 CU571152_1020 ZEP zeaxanthin epoxidase (ZEP) (ABA1) -2.75

AT1G75760 Medtr3g113920 ER lumen protein retaining receptor family protein -2.76

AT5G49820 Medtr4g077650 RUS6 Protein of unknown function, DUF647 -2.78

AT3G17930 Medtr8g107430 -2.81

AT4G14310 Medtr2g077700 Transducin/WD40 repeat-like superfamily protein -2.81

AT2G19090 Medtr4g127620 Protein of unknown function (DUF630 and DUF632) -2.82

AT4G01400 Medtr7g118240 -2.82

AT1G50440 contig_11442_1 RING/FYVE/PHD zinc finger superfamily protein -2.82

AT1G63100 contig_163792_1 GRAS family transcription factor -2.83

AT1G44575 Medtr3g088040 PSBS Chlorophyll A-B binding family protein -2.84

AT2G32230 Medtr2g101360 PRORP1 proteinaceous RNase P 1 -2.85

AT2G38560 contig_8799_2 TFIIS transcript elongation factor IIS -2.85

AT3G45780 Medtr2g095980 RPT1 phototropin 1 -2.86

AT5G46110 Medtr5g044220 TPT Glucose-6-phosphate/phosphate translocator-related -2.88

AT1G11820 Medtr4g132280 O-Glycosyl hydrolases family 17 protein -2.88

AT3G02540 contig_165443_1 RAD23C Rad23 UV excision repair protein family -2.88

AT4G05180 contig_113032_1 PSII-Q photosystem II subunit Q-2 -2.88

AT1G03090 Medtr1g071610 MCCAmethylcrotonyl-CoA carboxylase alpha chain, mitochondrial / 3-methylcrotonyl-CoA carboxylase 1 (MCCA) -2.91

AT1G71040 contig_55775_3 LPR2 Cupredoxin superfamily protein -2.92

AT3G21250 Medtr8g040620 MRP6 multidrug resistance-associated protein 6 -2.92

AT1G20560 Medtr5g008800 AAE1 acyl activating enzyme 1 -2.92

AT3G44890 Medtr4g057210 RPL9 ribosomal protein L9 -2.94

AT2G34260 Medtr4g111810 WDR55 transducin family protein / WD-40 repeat family protein -2.95

AT1G02560 Medtr1g086940 NCLPP5 nuclear encoded CLP protease 5 -2.95

AT1G29980 Medtr2g019600 Protein of unknown function, DUF642 -2.96

AT1G62750 Medtr4g101750 SCO1 Translation elongation factor EFG/EF2 protein -2.98

AT5G12170 Medtr7g054190 CLT3 CRT (chloroquine-resistance transporter)-like transporter 3 -2.98

AT5G16370 Medtr5g076240 AAE5 acyl activating enzyme 5 -3

AT1G15170 Medtr1g108840 MATE efflux family protein -3

AT4G00370 Medtr8g030600 PHT4;4 Major facilitator superfamily protein -3

AT4G29830 contig_52710_2 VIP3 Transducin/WD40 repeat-like superfamily protein -3

AT2G45440 contig_63969_1 DHDPS2 dihydrodipicolinate synthase -3

AT3G56010 Medtr3g070960 -3.01

26

At ID Mt ID Symbol Description ΔAt ΔMtAT3G45300 Medtr4g060480 IVDH isovaleryl-CoA-dehydrogenase -3.01

AT2G34570 Medtr2g097630 MEE21 PIN domain-like family protein -3.02

AT1G17220 Medtr2g064840 FUG1 Translation initiation factor 2, small GTP-binding protein -3.03

AT2G18710 contig_55610_2 SCY1 SECY homolog 1 -3.03

AT1G68220 contig_57992_1 Protein of unknown function (DUF1218) -3.04

AT4G39460 Medtr8g092080 SAMT1 S-adenosylmethionine carrier 1 -3.04

AT4G29060 Medtr6g088270 emb2726 elongation factor Ts family protein -3.06

AT5G07040 contig_165725_1 RING/U-box superfamily protein -3.07

AT1G58340 Medtr5g067460 ZRZ MATE efflux family protein -3.08

AT5G65760 contig_54915_1 Serine carboxypeptidase S28 family protein -3.1

AT2G40316 Medtr3g071640 -3.11

AT4G01310 Medtr7g078800 Ribosomal L5P family protein -3.11

AT5G60930 Medtr3g100270 P-loop containing nucleoside triphosphate hydrolases superfamily protein -3.11

AT1G68140 AC235662_28 Protein of unknown function (DUF1644) -3.13

AT2G47790 Medtr7g108870 Transducin/WD40 repeat-like superfamily protein -3.14

AT3G13120 contig_59243_1 Ribosomal protein S10p/S20e family protein -3.14

AT2G36390 contig_81226_2 SBE2.1 starch branching enzyme 2.1 -3.15

AT1G50460 Medtr5g009000 HKL1 hexokinase-like 1 -3.17

AT2G19940 Medtr1g012540oxidoreductases, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor;copper ion binding -3.17

AT4G13250 Medtr6g088500 NYC1 NAD(P)-binding Rossmann-fold superfamily protein -3.17

AT5G59010 contig_55420_2 Protein kinase protein with tetratricopeptide repeat domain -3.17

AT3G07180 contig_55113_1 GPI transamidase component PIG-S-related -3.18

AT1G32190 Medtr5g029210 alpha/beta-Hydrolases superfamily protein -3.19

AT4G38090 contig_48678_1 Ribosomal protein S5 domain 2-like superfamily protein -3.19

AT2G29890 contig_50561_1 VLN1 villin-like 1 -3.21

AT1G11090 contig_57136_2 alpha/beta-Hydrolases superfamily protein -3.21

AT5G63890 Medtr2g030520 HISN8 histidinol dehydrogenase -3.21

AT1G03360 Medtr4g121550 RRP4 ribosomal RNA processing 4 -3.22

AT5G49360 Medtr2g034720 BXL1 beta-xylosidase 1 -3.22

AT5G47190 Medtr5g013300 Ribosomal protein L19 family protein -3.24

AT5G40870 Medtr4g103620 UKL1 uridine kinase/uracil phosphoribosyltransferase 1 -3.24

AT1G48900 Medtr4g010050 Signal recognition particle, SRP54 subunit protein -3.24

AT5G10730 Medtr3g105660 NAD(P)-binding Rossmann-fold superfamily protein -3.24

AT2G45830 Medtr6g031170 DTA2 downstream target of AGL15 2 -3.25

AT2G21650 Medtr7g089210 RSM1 Homeodomain-like superfamily protein -3.28

AT4G36440 Medtr8g076840 -3.28

AT2G47420 Medtr3g007750 DIM1A Ribosomal RNA adenine dimethylase family protein -3.3

AT4G26900 contig_53939_1 HISN4 HIS HF -3.3

AT5G14320 Medtr3g073140 EMB3137 Ribosomal protein S13/S18 family -3.31

AT1G74970 Medtr1g021760 TWN3 ribosomal protein S9 -3.31

AT1G08130 Medtr4g057340 LIG1 DNA ligase 1 -3.31

AT1G10970 Medtr3g104400 ZIP4 zinc transporter 4 precursor -3.31

AT2G20890 contig_51095_2 THF1 photosystem II reaction center PSB29 protein -3.33

AT4G20020 Medtr2g006210 -3.34

27

At ID Mt ID Symbol Description ΔAt ΔMtAT1G15820 Medtr2g008610 LHCB6 light harvesting complex photosystem II subunit 6 -3.35

AT4G18480 Medtr2g015390 CHLI1 P-loop containing nucleoside triphosphate hydrolases superfamily protein -3.36

AT1G70940 contig_107783_1 PIN3 Auxin efflux carrier family protein -3.37

AT1G54500 Medtr7g114590 Rubredoxin-like superfamily protein -3.37

AT5G62960 Medtr3g077630 -3.38

AT1G80890 Medtr4g007290 -3.39

AT1G12900 Medtr7g084800 GAPA-2 glyceraldehyde 3-phosphate dehydrogenase A subunit 2 -3.4

AT2G37500 AC233662_37 arginine biosynthesis protein ArgJ family -3.4

AT5G14910 contig_56286_1 Heavy metal transport/detoxification superfamily protein -3.42

AT3G26060 Medtr4g124790 PRXQ Thioredoxin superfamily protein -3.44

AT5G01220 Medtr4g015260 SQD2 sulfoquinovosyldiacylglycerol 2 -3.45

AT5G10460 Medtr4g087590 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein -3.46

AT3G16480 Medtr8g014660 MPPalpha mitochondrial processing peptidase alpha subunit -3.47

AT1G10370 Medtr8g061950 GSTU17 Glutathione S-transferase family protein -3.47

AT3G23890 Medtr3g031040 TOPII topoisomerase II -3.49

AT3G57030 contig_63337_1 Calcium-dependent phosphotriesterase superfamily protein -3.51

AT2G01900 Medtr1g038810 DNAse I-like superfamily protein -3.51

AT2G04160 Medtr3g082200 AIR3 Subtilisin-like serine endopeptidase family protein -3.52

AT5G01840 contig_12368_1 OFP1 ovate family protein 1 -3.53

AT3G63410 Medtr1g071110 VTE3S-adenosyl-L-methionine-dependent methyltransferases superfamily protein -3.54

AT1G43670 AC234952_12 FINS1 Inositol monophosphatase family protein -3.54

AT1G11380 Medtr4g091550 PLAC8 family protein -3.54

AT5G51960 Medtr6g068850 -3.55

AT2G34500 Medtr2g019640 CYP710A1 cytochrome P450, family 710, subfamily A, polypeptide 1 -3.56

AT1G16430 Medtr2g062860 Surfeit locus protein 5 subunit 22 of Mediator complex -3.57

AT3G20790 Medtr2g098500 NAD(P)-binding Rossmann-fold superfamily protein -3.64

AT2G20190 Medtr7g099480 CLASP CLIP-associated protein -3.64

AT1G73180 Medtr4g087280 Eukaryotic translation initiation factor eIF2A family protein -3.65

AT5G26200 Medtr3g104810 Mitochondrial substrate carrier family protein -3.65

AT4G35050 Medtr4g073080 NFC3 Transducin family protein / WD-40 repeat family protein -3.66

AT4G15900 Medtr2g019400 PRL1 pleiotropic regulatory locus 1 -3.66

AT4G20070 Medtr2g035370 ATAAH allantoate amidohydrolase -3.68

AT5G16120 AC233109_47 alpha/beta-Hydrolases superfamily protein -3.68

AT1G07260 Medtr5g070090 UGT71C3 UDP-glucosyl transferase 71C3 -3.7

AT3G18080 contig_71004_1 BGLU44 B-S glucosidase 44 -3.7

AT4G24670 Medtr3g077250 TAR2 tryptophan aminotransferase related 2 -3.71

AT5G53620 Medtr3g092250 -3.71

AT5G26850 contig_74458_1 Uncharacterized protein -3.72

AT4G32260 Medtr3g106820 PDE334 ATPase, F0 complex, subunit B/B', bacterial/chloroplast -3.75

AT3G61470 AC233657_22 LHCA2 photosystem I light harvesting complex gene 2 -3.75

AT1G80560 Medtr2g104610 IMD2 isopropylmalate dehydrogenase 2 -3.78

AT1G74910 Medtr6g008840 ADP-glucose pyrophosphorylase family protein -3.79

AT5G64816 contig_111047_2 -3.79

AT1G28490 Medtr5g092870 SYP61 syntaxin of plants 61 -3.8

28

At ID Mt ID Symbol Description ΔAt ΔMtAT1G79850 Medtr2g101770 RPS17 ribosomal protein S17 -3.8

AT1G09850 contig_52011_1 XBCP3 xylem bark cysteine peptidase 3 -3.8

AT1G24793 contig_53038_1 LpxC1 UDP-3-O-acyl N-acetylglycosamine deacetylase family protein -3.82

AT3G06930 Medtr4g119900 PRMT4B protein arginine methyltransferase 4B -3.83

AT1G06110 Medtr4g068130 SKIP16 SKP1/ASK-interacting protein 16 -3.85

AT1G31780 Medtr5g025410 -3.87

AT5G54270 Medtr2g081090 LHCB3*1 light-harvesting chlorophyll B-binding protein 3 -3.87

AT3G58460 AC235488_12 RBL15 RHOMBOID-like protein 15 -3.88

AT1G25145 contig_53038_1 LpxC4 UDP-3-O-acyl N-acetylglycosamine deacetylase family protein -3.92

AT5G21105 contig_20548_1 Plant L-ascorbate oxidase -3.93

AT4G31120 Medtr3g108640 SKB1 SHK1 binding protein 1 -3.93

AT4G25080 Medtr8g100120 CHLM magnesium-protoporphyrin IX methyltransferase -3.94

AT4G39300 Medtr4g070030 -3.94

AT1G04590 Medtr5g012120 -3.95

AT3G61650 Medtr7g117050 TUBG1 gamma-tubulin -3.96

AT1G48690 contig_68860_1 Auxin-responsive GH3 family protein -4

AT2G39210 AC233660_6 Major facilitator superfamily protein -4.01

AT3G06550 Medtr4g122920 RWA2 O-acetyltransferase family protein -4.01

AT4G34030 Medtr4g085890 MCCB 3-methylcrotonyl-CoA carboxylase -4.03

AT1G16916 Medtr2g076020 -4.04

AT4G01330 Medtr7g078730 Protein kinase superfamily protein -4.08

AT5G63810 Medtr3g096900 BGAL10 beta-galactosidase 10 -4.1

AT5G24580 Medtr5g069180 Heavy metal transport/detoxification superfamily protein -4.12

AT5G13840 contig_62825_1 FZR3 FIZZY-related 3 -4.14

AT3G09090 Medtr4g014960 DEX1 defective in exine formation protein (DEX1) -4.14

AT4G18060 Medtr8g087990 SH3 domain-containing protein -4.15

AT4G02530 Medtr4g114790 chloroplast thylakoid lumen protein -4.15

AT4G26510 Medtr3g061030 UKL4 uridine kinase-like 4 -4.18

AT2G29560 Medtr5g096970 ENOC cytosolic enolase -4.19

AT5G67270 Medtr5g016520 EB1C end binding protein 1C -4.2

AT1G72090 contig_50858_2 Methylthiotransferase -4.2

AT5G13520 Medtr1g116230 peptidase M1 family protein -4.23

AT5G06570 contig_111817_1 alpha/beta-Hydrolases superfamily protein -4.23

AT5G59770 Medtr4g060990 Protein-tyrosine phosphatase-like, PTPLA -4.29

AT4G38660 contig_58999_1 Pathogenesis-related thaumatin superfamily protein -4.3

AT5G51890 Medtr1g101830 Peroxidase superfamily protein -4.3

AT5G23250 Medtr6g077820 Succinyl-CoA ligase, alpha subunit -4.31

AT2G42250 Medtr7g092600 CYP712A1 cytochrome P450, family 712, subfamily A, polypeptide 1 -4.34

AT3G08890 Medtr7g070000 Protein of unknown function, DUF538 -4.34

AT2G37660 contig_57177_1 NAD(P)-binding Rossmann-fold superfamily protein -4.37

AT3G14770 AC235677_9 SWEET2 Nodulin MtN3 family protein -4.39

AT1G21880 Medtr3g072410 LYM1 lysm domain GPI-anchored protein 1 precursor -4.4

AT5G58490 Medtr5g072620 NAD(P)-binding Rossmann-fold superfamily protein -4.4

AT5G57660 Medtr4g128930 COL5 CONSTANS-like 5 -4.43

AT3G14390 Medtr5g022700 Pyridoxal-dependent decarboxylase family protein -4.43

29

At ID Mt ID Symbol Description ΔAt ΔMtAT5G64680 Medtr8g012410 -4.44

AT4G05520 Medtr2g025180 EHD2 EPS15 homology domain 2 -4.45

AT5G42320 contig_75649_1 Zn-dependent exopeptidases superfamily protein -4.45

AT5G57490 Medtr4g128300 VDAC4 voltage dependent anion channel 4 -4.48

AT1G14730 CU633465_8 Cytochrome b561/ferric reductase transmembrane protein family -4.48

AT2G26500 contig_8810_1 cytochrome b6f complex subunit (petM), putative -4.48

AT2G40840 Medtr7g088740 DPE2 disproportionating enzyme 2 -4.48

AT3G62370 Medtr1g086810 heme binding -4.5

AT3G51740 Medtr4g014070 IMK2 inflorescence meristem receptor-like kinase 2 -4.5

AT4G12800 Medtr7g079900 PSAL photosystem I subunit l -4.52

AT1G65900 Medtr3g064600 -4.52

AT2G47600 Medtr1g088430 MHX1 magnesium/proton exchanger -4.56

AT5G06150 Medtr5g088980 CYCB1;2 Cyclin family protein -4.56

AT4G26620 Medtr5g096090 Sucrase/ferredoxin-like family protein -4.57

AT1G01510 Medtr7g078990 AN NAD(P)-binding Rossmann-fold superfamily protein -4.6

AT2G26260 Medtr3g105440AT3BETAHSD/D2 3beta-hydroxysteroid-dehydrogenase/decarboxylase isoform 2 -4.6

AT1G02870 Medtr1g088670 -4.62

AT5G47780 Medtr2g027740 GAUT4 galacturonosyltransferase 4 -4.62

AT5G66190 Medtr5g022300 FNR1 ferredoxin-NADP(+)-oxidoreductase 1 -4.63

AT1G30840 contig_126311_1 PUP4 purine permease 4 -4.64

AT3G02530 contig_103817_1 TCP-1/cpn60 chaperonin family protein -4.65

AT5G65640 Medtr5g030770 bHLH093 beta HLH protein 93 -4.67

AT4G34810 Medtr3g117640 SAUR-like auxin-responsive protein family -4.68

AT1G26750 Medtr2g087760 -4.69

AT5G09310 Medtr3g096320 -4.74

AT2G48010 contig_76093_1 RKF3 receptor-like kinase in in flowers 3 -4.74

AT5G66560 AC157372_3 Phototropic-responsive NPH3 family protein -4.74

AT3G16560 contig_63842_1 Protein phosphatase 2C family protein -4.75

AT5G52540 Medtr1g100120 Protein of unknown function (DUF819) -4.78

AT2G42850 Medtr5g091760 CYP718 cytochrome P450, family 718 -4.79

AT1G11190 Medtr2g012440 ENDO1 bifunctional nuclease i -4.8

AT1G26300 Medtr5g048180 BSD domain-containing protein -4.82

AT1G73885 contig_83849_1 -4.82

AT5G61410 contig_84883_1 RPE D-ribulose-5-phosphate-3-epimerase -4.83

AT1G75560 Medtr3g117400 zinc knuckle (CCHC-type) family protein -4.84

AT4G31180 Medtr1g014140 Class II aminoacyl-tRNA and biotin synthetases superfamily protein -4.84

AT4G02500 Medtr4g119880 XXT2 UDP-xylosyltransferase 2 -4.84

AT3G19910 Medtr1g114240 RING/U-box superfamily protein -4.87

AT2G38370 Medtr7g072550 Plant protein of unknown function (DUF827) -4.88

AT2G27310 contig_239060_1 F-box family protein -4.94

AT2G47500 Medtr1g087880P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain -4.94

AT2G37080 Medtr7g100730 RIP3 ROP interactive partner 3 -4.94

AT5G08415 contig_52792_2 Radical SAM superfamily protein -4.98

AT1G73920 Medtr8g103850 alpha/beta-Hydrolases superfamily protein -4.99

30

At ID Mt ID Symbol Description ΔAt ΔMtAT1G14220 Medtr5g041010 Ribonuclease T2 family protein -4.99

AT5G58330 contig_58024_2 lactate/malate dehydrogenase family protein -5.04

AT5G58000 contig_62167_1 Reticulon family protein -5.04

AT5G21060 Medtr3g079330 Glyceraldehyde-3-phosphate dehydrogenase-like family protein -5.05

AT1G52230 Medtr2g101820 PSI-H photosystem I subunit H2 -5.05

AT5G60760 AC233663_13 P-loop containing nucleoside triphosphate hydrolases superfamily protein -5.05

AT3G06850 contig_56186_1 LTA1 2-oxoacid dehydrogenases acyltransferase family protein -5.07

AT1G20340 Medtr3g114850 PETE2 Cupredoxin superfamily protein -5.08

AT5G47720 AC233669_12 Thiolase family protein -5.14

AT1G77590 Medtr3g087980 LACS9 long chain acyl-CoA synthetase 9 -5.18

AT1G07080 Medtr3g031790 Thioredoxin superfamily protein -5.2

AT2G21970 contig_55335_1 2-Sep stress enhanced protein 2 -5.2

AT1G75820 Medtr4g070970 FLO5 Leucine-rich receptor-like protein kinase family protein -5.21

AT4G15560 Medtr4g118640 DXS Deoxyxylulose-5-phosphate synthase -5.24

AT5G26680 Medtr1g085130 5'-3' exonuclease family protein -5.25

AT5G18860 Medtr4g118590 NSH3 inosine-uridine preferring nucleoside hydrolase family protein -5.26

AT2G20515 contig_82912_2 -5.31

AT4G34260 contig_53270_1 FUC95A 1,2-alpha-L-fucosidases -5.34

AT5G49650 Medtr3g110710 XK2 xylulose kinase-2 -5.36

AT2G24580 Medtr3g108990 FAD-dependent oxidoreductase family protein -5.38

AT1G15550 Medtr2g102620 GA4 gibberellin 3-oxidase 1 -5.4

AT3G06580 Medtr4g122670 GALK Mevalonate/galactokinase family protein -5.41

AT1G47490 Medtr3g101370 RBP47C RNA-binding protein 47C -5.43

AT5G58320 Medtr5g075490 Kinase interacting (KIP1-like) family protein -5.43

AT5G26742 Medtr7g111130 emb1138 DEAD box RNA helicase (RH3) -5.48

AT3G02870 Medtr2g026060 VTC4 Inositol monophosphatase family protein -5.49

AT4G30920 Medtr4g130860 LAP2 Cytosol aminopeptidase family protein -5.51

AT2G07050 Medtr5g008810 CAS1 cycloartenol synthase 1 -5.53

AT3G56940 Medtr7g088340 CRD1 dicarboxylate diiron protein, putative (Crd1) -5.58

AT3G54110 Medtr4g018750 UCP1 plant uncoupling mitochondrial protein 1 -5.61

AT3G18760 contig_64457_2 Translation elongation factor EF1B/ribosomal protein S6 family protein -5.61

AT1G69310 Medtr5g043880 WRKY57 WRKY DNA-binding protein 57 -5.63

AT5G20280 Medtr4g115620 SPSA1 sucrose phosphate synthase 1F -5.66

AT1G43650 Medtr6g036450 nodulin MtN21 /EamA-like transporter family protein -5.67

AT5G55730 contig_248110_1 FLA1 FASCICLIN-like arabinogalactan 1 -5.69

AT4G28360 Medtr1g040020 Ribosomal protein L22p/L17e family protein -5.69

AT4G27230 Medtr2g082220 HTA2 histone H2A 2 -5.71

AT4G34490 Medtr4g069960 CAP1 cyclase associated protein 1 -5.73

AT2G46800 Medtr2g036390 ZAT1 zinc transporter of Arabidopsis thaliana -5.79

AT5G53370 Medtr1g008140 PMEPCRF pectin methylesterase PCR fragment F -5.85

AT5G50400 Medtr4g103520 PAP27 purple acid phosphatase 27 -5.87

AT3G16310 Medtr2g101270 mitotic phosphoprotein N' end (MPPN) family protein -5.92

AT3G06040 contig_50933_1Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein -5.96

AT3G04600 AC202489_40 Nucleotidylyl transferase superfamily protein -6.04

AT5G64040 Medtr3g095540 PSAN photosystem I reaction center subunit PSI-N, chloroplast, putative / PSI-N, -6.06

31

At ID Mt ID Symbol Description ΔAt ΔMtputative (PSAN)

AT5G66530 Medtr5g020640 Galactose mutarotase-like superfamily protein -6.09

AT4G24770 contig_61747_1 RBP31 31-kDa RNA binding protein -6.16

AT5G54600 Medtr2g082410 Translation protein SH3-like family protein -6.17

AT5G50920 Medtr8g100040 HSP93-V CLPC homologue 1 -6.19

AT3G57280 Medtr7g090890 Transmembrane proteins 14C -6.22

AT3G25150 Medtr7g055610Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain -6.23

AT1G02640 Medtr7g109390 BXL2 beta-xylosidase 2 -6.24

AT3G17940 Medtr6g069630 Galactose mutarotase-like superfamily protein -6.25

AT3G14690 Medtr4g031820 CYP72A15 cytochrome P450, family 72, subfamily A, polypeptide 15 -6.27

AT4G17830 Medtr5g014410 Peptidase M20/M25/M40 family protein -6.31

AT2G16430 contig_53483_2 PAP10 purple acid phosphatase 10 -6.31

AT3G56910 Medtr7g088520 PSRP5 plastid-specific 50S ribosomal protein 5 -6.32

AT4G33680 Medtr4g092620 AGD2 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein -6.33

AT5G14590 Medtr6g005470 Isocitrate/isopropylmalate dehydrogenase family protein -6.38

AT2G41560 contig_63245_2 ACA4 autoinhibited Ca(2+)-ATPase, isoform 4 -6.39

AT1G30380 contig_63128_1 PSAK photosystem I subunit K -6.4

AT5G57020 contig_83825_1 NMT1 myristoyl-CoA:protein N-myristoyltransferase -6.51

AT3G25290 Medtr7g051910 Auxin-responsive family protein -6.52

AT5G23290 Medtr1g114500 PFD5 prefoldin 5 -6.57

AT4G06744 Medtr1g018910 Leucine-rich repeat (LRR) family protein -6.63

AT3G48000 Medtr4g107040 ALDH2B4 aldehyde dehydrogenase 2B4 -6.63

AT1G70330 contig_49672_2 ENT1,AT equilibrative nucleotide transporter 1 -6.71

AT3G25980 Medtr3g085940 MAD2 DNA-binding HORMA family protein -6.72

AT5G03040 Medtr7g100790 iqd2 IQ-domain 2 -6.72

AT5G01530 Medtr4g015570 LHCB4.1 light harvesting complex photosystem II -6.75

AT1G78630 contig_60967_3 emb1473 Ribosomal protein L13 family protein -6.77

AT2G33340 Medtr1g044720 MAC3B MOS4-associated complex 3B -6.79

AT5G05780 Medtr5g081980 RPN8A RP non-ATPase subunit 8A -6.81

AT5G15220 Medtr3g014010 Ribosomal protein L27 family protein -6.83

AT1G09630 Medtr2g005510 RAB11c RAB GTPase 11C -6.83

AT4G18550 Medtr2g015690 DSEL alpha/beta-Hydrolases superfamily protein -6.86

AT2G22125 Medtr8g091470 POM2 binding -6.91

AT2G16750 Medtr4g073140Protein kinase protein with adenine nucleotide alpha hydrolases-like domain -6.95

AT1G13380 Medtr5g057670 Protein of unknown function (DUF1218) -6.98

AT3G15190 Medtr8g061350 chloroplast 30S ribosomal protein S20, putative -7.01

AT4G20360 Medtr3g076660 RABE1b RAB GTPase homolog E1B -7.03

AT2G33450 contig_70003_1 Ribosomal L28 family -7.04

AT2G30520 Medtr5g075640 RPT2 Phototropic-responsive NPH3 family protein -7.08

AT3G56130 Medtr3g071960 biotin/lipoyl attachment domain-containing protein -7.08

AT5G62670 contig_162917_1 HA11 H(+)-ATPase 11 -7.11

AT3G13110 contig_114531_1 SERAT2;2 serine acetyltransferase 2;2 -7.13

AT3G02220 contig_74869_1 -7.18

AT2G46890 AC233662_23 Protein of unknown function (DUF1295) -7.25

AT2G27830 contig_10853_1 -7.29

32

At ID Mt ID Symbol Description ΔAt ΔMtAT5G47100 Medtr5g013560 CBL9 calcineurin B-like protein 9 -7.33

AT1G12230 Medtr4g101620 Aldolase superfamily protein -7.44

AT2G26900 Medtr4g113090 BASS2 Sodium Bile acid symporter family -7.5

AT3G53580 contig_58004_1 diaminopimelate epimerase family protein -7.53

AT3G63520 contig_54065_1 NCED1 carotenoid cleavage dioxygenase 1 -7.61

AT1G74470 contig_52909_2 Pyridine nucleotide-disulphide oxidoreductase family protein -7.65

AT3G02350 AC146721_1014 GAUT9 galacturonosyltransferase 9 -7.74

AT1G06680 contig_54319_1 PSII-P photosystem II subunit P-1 -7.74

AT2G30970 Medtr4g080140 ASP1 aspartate aminotransferase 1 -7.76

AT3G16350 Medtr2g100930 Homeodomain-like superfamily protein -7.81

AT3G11900 contig_51063_1 ANT1 aromatic and neutral transporter 1 -7.83

AT1G50110 Medtr4g092590D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein -7.84

AT3G62930 Medtr7g108250 Thioredoxin superfamily protein -7.88

AT3G16950 Medtr4g121880 ptlpd1 lipoamide dehydrogenase 1 -7.88

AT5G65630 Medtr4g092900 GTE7 global transcription factor group E7 -7.95

AT4G37790 Medtr5g014890 HAT22 Homeobox-leucine zipper protein family -8

AT1G33590 Medtr3g009050 Leucine-rich repeat (LRR) family protein -8.01

AT5G46160 Medtr5g096490 Ribosomal protein L14p/L23e family protein -8.03

AT1G32170 Medtr5g029100 XTR4 xyloglucan endotransglucosylase/hydrolase 30 -8.05

AT4G15610 Medtr4g118800 Uncharacterised protein family (UPF0497) -8.06

AT3G10850 Medtr5g068440 GLY2 Metallo-hydrolase/oxidoreductase superfamily protein -8.18

AT1G30130 Medtr2g019220 -8.19

AT1G10840 Medtr7g021870 TIF3H1 translation initiation factor 3 subunit H1 -8.39

AT1G06650 Medtr8g009090 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein -8.45

AT1G27970 Medtr3g085070 NTF2B nuclear transport factor 2B -8.45

AT2G24765 Medtr4g128910 ATARL1 ADP-ribosylation factor 3 -8.47

AT1G48350 Medtr2g044920 EMB3105 Ribosomal L18p/L5e family protein -8.48

AT1G70670 AC233676_19 CLO4 Caleosin-related family protein -8.52

AT3G47470 contig_14889_1 LHCA4 light-harvesting chlorophyll-protein complex I subunit A4 -8.52

AT1G31330 contig_83576_1 PSAF photosystem I subunit F -8.58

AT1G03900 contig_56448_1 NAP4 non-intrinsic ABC protein 4 -8.6

AT5G13630 contig_130635_1 GUN5magnesium-chelatase subunit chlH, chloroplast, putative / Mg-protoporphyrin IX chelatase, putative (CHLH) -8.61

AT1G68740 contig_50536_1 PHO1;H1 EXS (ERD1/XPR1/SYG1) family protein -8.64

AT2G22230 contig_50092_3 Thioesterase superfamily protein -8.66

AT2G44360 contig_51896_3 -8.77

AT5G13980 Medtr7g084030 Glycosyl hydrolase family 38 protein -8.8

AT4G27000 contig_72924_1 ATRBP45C RNA-binding (RRM/RBD/RNP motifs) family protein -8.82

AT2G28470 Medtr2g094060 BGAL8 beta-galactosidase 8 -8.88

AT4G29840 Medtr2g099510 TS Pyridoxal-5'-phosphate-dependent enzyme family protein -8.9

AT3G62030 Medtr7g110980 ROC4 rotamase CYP 4 -8.97

AT5G49760 Medtr2g028580 Leucine-rich repeat protein kinase family protein -9.11

AT4G10840 contig_238147_1 Tetratricopeptide repeat (TPR)-like superfamily protein -9.14

AT1G04400 Medtr1g043190 PHH1 cryptochrome 2 -9.28

AT5G20080 Medtr4g114030 FAD/NAD(P)-binding oxidoreductase -9.3

33

At ID Mt ID Symbol Description ΔAt ΔMtAT1G60950 Medtr8g088720 FED A 2Fe-2S ferredoxin-like superfamily protein -9.44

AT2G26980 Medtr5g088350 SnRK3.17 CBL-interacting protein kinase 3 -9.45

AT2G39730 Medtr5g080450 RCA rubisco activase -9.5

AT5G59520 Medtr2g097580 ZIP2 ZRT/IRT-like protein 2 -9.53

AT5G65010 Medtr3g087220 ASN2 asparagine synthetase 2 -9.54

AT5G42080 Medtr5g009150 RSW9 dynamin-like protein -9.54

AT2G36310 Medtr7g104270 URH1 uridine-ribohydrolase 1 -9.55

AT1G05010 Medtr2g025120 EFE ethylene-forming enzyme -9.57

AT5G26010 Medtr4g121770 Protein phosphatase 2C family protein -9.58

AT4G23650 Medtr5g009830 CPK3 calcium-dependent protein kinase 6 -9.68

AT1G68560 contig_50618_1 XYL1 alpha-xylosidase 1 -9.69

AT1G36160 CU651589_11 PAS3 acetyl-CoA carboxylase 1 -9.74

AT5G25100 Medtr3g105950 Endomembrane protein 70 protein family -9.84

AT3G01690 Medtr7g032640 alpha/beta-Hydrolases superfamily protein -9.9

AT3G05530 Medtr1g083330 RPT5A regulatory particle triple-A ATPase 5A -10.06

AT4G24830 Medtr5g042880 arginosuccinate synthase family -10.15

AT1G27090 Medtr5g037960 glycine-rich protein -10.16

AT4G15802 Medtr1g088760 HSBP heat shock factor binding protein -10.17

AT5G53550 Medtr3g092090 YSL3 YELLOW STRIPE like 3 -10.4

AT2G36885 contig_10274_1 -10.6

AT3G58500 AC235488_36 PP2A-4 protein phosphatase 2A-4 -10.61

AT1G30700 contig_86020_1 FAD-binding Berberine family protein -10.78

AT3G10020 contig_75883_1 -10.8

AT5G66570 Medtr5g018670 PSBO1 PS II oxygen-evolving complex 1 -10.82

AT5G20190 Medtr4g114690 Tetratricopeptide repeat (TPR)-like superfamily protein -10.84

AT2G42590 Medtr8g086270 GRF9 general regulatory factor 9 -10.86

AT2G43750 Medtr4g087520 OASB O-acetylserine (thiol) lyase B -10.89

AT4G35850 Medtr6g021740 Pentatricopeptide repeat (PPR) superfamily protein -10.92

AT2G05990 Medtr4g074810 MOD1 NAD(P)-binding Rossmann-fold superfamily protein -10.93

AT1G10950 Medtr2g006300 TMN1 transmembrane nine 1 -10.95

AT2G39990 Medtr3g070190 eIF3F eukaryotic translation initiation factor 2 -11.01

AT5G57090 Medtr4g127100 WAV6 Auxin efflux carrier family protein -11.03

AT4G18040 Medtr2g018260 eIF4E1 eukaryotic translation initiation factor 4E -11.17

AT5G67490 Medtr3g109290 -11.17

AT3G23000 contig_57466_1 SnRK3.10 CBL-interacting protein kinase 7 -11.23

AT1G11860 Medtr4g132360 Glycine cleavage T-protein family -11.29

AT2G42570 Medtr4g079700 TBL39 TRICHOME BIREFRINGENCE-LIKE 39 -11.32

AT2G06520 contig_124315_1 PSBX photosystem II subunit X -11.42

AT5G45410 Medtr5g026910 -11.56

AT4G27410 contig_65520_1 RD26NAC (No Apical Meristem) domain transcriptional regulator superfamily protein -11.56

AT1G31340 Medtr5g092700 RUB1 related to ubiquitin 1 -11.72

AT2G42740 Medtr8g046140 RPL16A ribosomal protein large subunit 16A -11.73

AT4G36220 Medtr5g021390 FAH1 ferulic acid 5-hydroxylase 1 -11.75

AT1G59960 Medtr4g072350 NAD(P)-linked oxidoreductase superfamily protein -11.75

34

At ID Mt ID Symbol Description ΔAt ΔMtAT5G18670 Medtr2g020240 BMY3 beta-amylase 3 -11.9

AT2G16510 Medtr4g072050 ATPase, F0/V0 complex, subunit C protein -11.91

AT3G03250 Medtr5g077000 UGP1 UDP-GLUCOSE PYROPHOSPHORYLASE 1 -12.08

AT1G67090 Medtr6g018310 RBCS1A ribulose bisphosphate carboxylase small chain 1A -12.11

AT3G49780 contig_82395_1 PSK4 phytosulfokine 4 precursor -12.25

AT2G47270 contig_130046_1 UPB1sequence-specific DNA binding transcription factors;transcription regulators -12.48

AT5G01740 Medtr7g071970 Nuclear transport factor 2 (NTF2) family protein -12.56

AT2G41530 contig_114117_1 SFGH S-formylglutathione hydrolase -12.9

AT1G10030 Medtr3g110600 ERG28 homolog of yeast ergosterol28 -13.04

AT4G10040 Medtr5g008460 CYTC-2 cytochrome c-2 -13.08

AT4G32690 Medtr1g008700 GLB3 hemoglobin 3 -13.22

AT5G46290 Medtr4g096690 KASI 3-ketoacyl-acyl carrier protein synthase I -13.35

AT2G37970 Medtr4g019150 SOUL-1 SOUL heme-binding family protein -13.4

AT4G14030 Medtr3g084410 SBP1 selenium-binding protein 1 -13.62

AT2G20990 Medtr4g073400 SYTA synaptotagmin A -13.66

AT1G21140 Medtr1g099010 Vacuolar iron transporter (VIT) family protein -13.72

AT1G11080 Medtr2g012850 scpl31 serine carboxypeptidase-like 31 -13.82

AT4G32870 Medtr3g109880 Polyketide cyclase/dehydrase and lipid transport superfamily protein -14.03

AT4G26220 Medtr8g101900S-adenosyl-L-methionine-dependent methyltransferases superfamily protein -14.09

AT2G27860 contig_7643_1 AXS1 UDP-D-apiose/UDP-D-xylose synthase 1 -14.11

AT2G21250 Medtr4g072060 NAD(P)-linked oxidoreductase superfamily protein -14.28

AT5G52920 Medtr1g099360 PKP2 plastidic pyruvate kinase beta subunit 1 -14.62

AT1G50480 Medtr1g116140 THFS 10-formyltetrahydrofolate synthetase -14.64

AT5G25757 AC225507_16 RNA polymerase I-associated factor PAF67 -15.34

AT1G01090 contig_15772_1PDH-E1 ALPHA pyruvate dehydrogenase E1 alpha -15.56

AT4G24620 Medtr5g065880 PGI1 phosphoglucose isomerase 1 -15.7

AT2G34560 Medtr4g096870 P-loop containing nucleoside triphosphate hydrolases superfamily protein -15.74

AT2G45220 contig_115356_1 Plant invertase/pectin methylesterase inhibitor superfamily -16.5

AT3G11830 Medtr5g087560 TCP-1/cpn60 chaperonin family protein -16.56

AT2G46280 Medtr2g087640 TRIP-1 TGF-beta receptor interacting protein 1 -16.56

AT4G02930 Medtr2g021300 GTP binding Elongation factor Tu family protein -16.58

AT2G28000 AC233663_14 SLP chaperonin-60alpha -16.68

AT4G19210 Medtr1g114170 RLI2 RNAse l inhibitor protein 2 -17.45

AT1G11680 contig_176089_1 EMB1738 CYTOCHROME P450 51G1 -17.52

AT5G10580 Medtr3g109280 Protein of unknown function, DUF599 -17.66

AT1G71880 Medtr4g131920 SUC1 sucrose-proton symporter 1 -17.83

AT1G50490 Medtr4g076200 UBC20 ubiquitin-conjugating enzyme 20 -18.09

AT5G05010 AC233577_36 clathrin adaptor complexes medium subunit family protein -18.34

AT3G20050 Medtr8g088270 TCP-1 T-complex protein 1 alpha subunit -18.35

AT1G24510 Medtr3g086330 TCP-1/cpn60 chaperonin family protein -18.92

AT5G41685 contig_57213_3 Mitochondrial outer membrane translocase complex, subunit Tom7 -19.11

AT3G18190 contig_52211_1 TCP-1/cpn60 chaperonin family protein -19.16

AT3G23940 Medtr2g089340 dehydratase family -19.19

AT1G61740 Medtr2g010740 Sulfite exporter TauE/SafE family protein -19.33

35

At ID Mt ID Symbol Description ΔAt ΔMtAT3G08030 Medtr4g039720 Protein of unknown function, DUF642 -19.8

AT4G31500 Medtr5g045770 SUR2 cytochrome P450, family 83, subfamily B, polypeptide 1 -20.02

AT3G06035 Medtr5g005710 Glycoprotein membrane precursor GPI-anchored -20.04

AT5G19890 Medtr2g040000 Peroxidase superfamily protein -20.06

AT2G17710 Medtr5g022970 -20.11

AT3G56070 Medtr7g116340 ROC2 rotamase cyclophilin 2 -20.12

AT1G57720 contig_61303_1 Translation elongation factor EF1B, gamma chain -20.3

AT5G35360 Medtr8g101330 CAC2 acetyl Co-enzyme a carboxylase biotin carboxylase subunit -20.7

AT4G04770 Medtr7g030030 LAF6 ATP binding cassette protein 1 -21.07

AT1G29250 contig_103480_1 Alba DNA/RNA-binding protein -21.48

AT2G28840 contig_97057_1 XBAT31 XB3 ortholog 1 in Arabidopsis thaliana -21.75

AT5G14800 Medtr7g090160 P5CR pyrroline-5- carboxylate (P5C) reductase -21.79

AT1G76010 Medtr3g095260 Alba DNA/RNA-binding protein -22.05

AT5G05170 Medtr3g030040 IXR1 Cellulose synthase family protein -23.38

AT3G27240 Medtr6g023230 Cytochrome C1 family -23.51

AT4G11150 Medtr5g009720 VHA-E1 vacuolar ATP synthase subunit E1 -24.05

AT4G39660 Medtr8g091660 AGT2 alanine:glyoxylate aminotransferase 2 -24.21

AT3G13790 Medtr2g099950 ATCWINV1 Glycosyl hydrolases family 32 protein -24.23

AT3G23990 Medtr1g090140 HSP60-3B heat shock protein 60 -26.21

AT5G44340 Medtr2g031310 TUB4 tubulin beta chain 4 -27.74

AT1G58290 Medtr3g111190 HEMA1 Glutamyl-tRNA reductase family protein -29.8

AT3G09220 contig_83673_1 LAC7 laccase 7 -31.75

AT1G49570 Medtr5g017850 Peroxidase superfamily protein -32.31

AT4G23100 Medtr8g098350 RML1 glutamate-cysteine ligase -32.86

AT5G20720 Medtr4g124910 CPN21 chaperonin 20 -32.88

AT2G37270 AC235488_13 RPS5B ribosomal protein 5B -35.94

AT1G65930 Medtr5g077070 cICDH cytosolic NADP+-dependent isocitrate dehydrogenase -36.4

AT1G74060 Medtr3g094860 Ribosomal protein L6 family protein -38.59

AT1G73230 Medtr4g071000 Nascent polypeptide-associated complex NAC -39

AT3G25190 contig_9984_1 Vacuolar iron transporter (VIT) family protein -40.42

AT4G36130 Medtr7g076940 Ribosomal protein L2 family -40.6

AT4G00100 Medtr5g011910 RPS13A ribosomal protein S13A -46.71

AT2G17360 Medtr4g014590 Ribosomal protein S4 (RPS4A) family protein -48.29

AT1G07770 contig_61401_2 RPS15A ribosomal protein S15A -49.55

AT5G13930 Medtr7g084300 TT4 Chalcone and stilbene synthase family protein -51.19

AT3G12120 Medtr7g093200 FAD2 fatty acid desaturase 2 -52.2

AT3G48990 Medtr3g035130 AMP-dependent synthetase and ligase family protein -52.83

AT3G04840 Medtr5g006440 Ribosomal protein S3Ae -53.06

AT5G35530 Medtr6g052220 Ribosomal protein S3 family protein -54.73

AT4G11010 contig_66062_1 NDPK3 nucleoside diphosphate kinase 3 -55.99

AT2G05710 Medtr4g048190 ACO3 aconitase 3 -60.5

AT5G01600 Medtr4g014540 FER1 ferretin 1 -60.79

AT2G37130 Medtr1g066380 Peroxidase superfamily protein -62.5

AT4G09800 Medtr1g098220 RPS18C S18 ribosomal protein -65.09

AT3G60750 Medtr5g059410 Transketolase -65.77

36

At ID Mt ID Symbol Description ΔAt ΔMtAT5G39740 Medtr3g118030 RPL5B ribosomal protein L5 B -66.08

AT2G32060 Medtr5g012890 Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein -66.61

AT5G04590 contig_98100_3 SIR sulfite reductase -68.03

AT5G07090 Medtr4g014590 Ribosomal protein S4 (RPS4A) family protein -68.32

AT2G31610 Medtr6g052220 Ribosomal protein S3 family protein -68.89

AT1G22780 Medtr1g098220 RPS18A Ribosomal protein S13/S18 family -69.03

AT3G44010 Medtr5g005130 Ribosomal protein S14p/S29e family protein -72.99

AT3G11510 Medtr4g096790 Ribosomal protein S11 family protein -74.27

AT4G11650 contig_167510_1 OSM34 osmotin 34 -76.34

AT1G02780 Medtr1g087910 emb2386 Ribosomal protein L19e family protein -80.74

AT5G54160 Medtr3g092900 OMT1 O-methyltransferase 1 -80.82

AT1G72370 Medtr3g095810 RPSAA 40s ribosomal protein SA -82.74

AT1G08360 Medtr5g012930 Ribosomal protein L1p/L10e family -85.31

AT3G62870 contig_52784_3 Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein -88.42

AT4G16260 Medtr2g034470 Glycosyl hydrolase superfamily protein -93.56

AT2G16600 Medtr4g075290 ROC3 rotamase CYP 3 -94.82

AT2G27530 Medtr5g012930 PGY1 Ribosomal protein L1p/L10e family -102.64

AT4G16720 Medtr2g014220 Ribosomal protein L23/L15e family protein -104.33

AT2G15620 Medtr4g086020 NIR1 nitrite reductase 1 -128.22

AT1G07940 Medtr4g019170 GTP binding Elongation factor Tu family protein -239.45

AT1G07920 Medtr4g019170 GTP binding Elongation factor Tu family protein -276.38

AT1G07930 Medtr4g019170 GTP binding Elongation factor Tu family protein -278.97

AT4G33720 Medtr2g012370CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein -306.55

Differentially expressed only in Medicago roots

AT1G13440 Medtr3g085850 Glyceraldehyde 3-phosphate dehydrogenase 2844.26

AT3G55440 contig_49727_1 Triosephosphate isomerase 1777.08

AT1G76200 Medtr4g075160 hypothetical protein 992.75

AT1G79550 Medtr2g066120 Phosphoglycerate kinase 844.3

AT5G42300 Medtr3g084140 Ubiquitin-like protein 763.74

AT1G72330 Medtr8g023140 Alanine aminotransferase 542.18

AT1G30900 contig_54557_1 Vacuolar sorting receptor 437

AT2G26695 Medtr4g113840 Zinc finger protein-like Ser/Thr protein kinase-like protein 410.4

AT5G11520 contig_53013_1 Aspartate aminotransferase 403.9

AT1G36730 Medtr7g082940 Eukaryotic translation initiation factor 398.92

AT4G26270 Medtr6g090130 6-phosphofructokinase 374.03

AT5G49480 Medtr4g122260 Hypersensitive reaction associated Ca2+-binding protein 345.53

AT1G63660 contig_166826_1 GMP synthase 320.6

AT1G76650 contig_105546_1 Calmodulin-like protein 320.08

AT1G14450 contig_49831_3 Unknown protein 307.36

AT5G41860 contig_124839_1 Unknown protein 292.95

AT5G56030 Medtr5g096460 Heat shock protein 288.7

AT3G03150 Medtr5g008210 hypothetical protein 279.12

AT4G25450 AC229695_20 ABC transporter B family member 260.95

AT3G16770 Medtr1g087920 Ethylene responsive transcription factor 2b 255.04

37

At ID Mt ID Symbol Description ΔAt ΔMtAT2G35980 contig_163470_1 NHL1 252.89

AT3G52990 Medtr1g061630 Pyruvate kinase 246.07

AT1G16350 Medtr7g085560 Inosine-5'-monophosphate dehydrogenase 236.98

AT1G19530 contig_84317_1 ST225 233.71

AT5G13170 contig_64507_1 RAG1-activating protein 1 homolog 229.26

AT4G05320 Medtr8g018230 Ubiquitin 226.99

AT5G13490 contig_52798_1 Mitochondrial ADP/ATP carrier proteins 223.23

AT1G31260 Medtr4g083570 Zinc transporter 221.55

AT5G05340 Medtr3g094630 Peroxidase 221.18

AT5G14040 Medtr7g083790 Phosphate carrier protein 210.8

AT5G23950 contig_119523_1 SRC2 208.94

AT5G54940 Medtr3g051950 Translation factor SUI1-like protein 206.18

AT5G13870 Medtr7g084760 Xyloglucan endotransglucosylase 201.29

AT3G23360 Medtr1g075730 Protein phosphatase 2C 195.14

AT1G69840 contig_237495_1 Hypersensitive-induced response protein 193.24

AT5G64350 Medtr2g009390 Peptidyl-prolyl isomerase FKBP12 192.55

AT5G56030 Medtr5g096430 Heat shock protein 191.17

AT1G70420 Medtr5g034230 hypothetical protein 188.32

AT2G37430 Medtr7g100080 Zinc finger protein 188.07

AT4G25200 contig_166444_1 Heat shock protein 185.7

AT1G79790 Medtr7g079530 Phosphoglycolate phosphatase 184.47

AT4G37300 Medtr5g016450 hypothetical protein 181.86

AT5G39570 Medtr6g012780 hypothetical protein 181.27

AT5G14780 contig_81585_1 Formate dehydrogenase 167.36

AT2G17120 AC235671_2 LysM domain-containing GPI-anchored protein 167.24

AT1G51650 Medtr5g040610 ATP synthase subunit epsilon 161.83

AT4G02050 contig_49738_2 Solute carrier family 2%2C facilitated glucose transporter member 161.43

AT5G11770 Medtr3g104310 NADH-ubiquinone oxidoreductase subunit-like protein 155.56

AT1G08280 Medtr4g053520 Beta-galactoside alpha-2%2C6-sialyltransferase 154.36

AT1G78570 contig_164943_1 Dtdp-glucose 4 6-dehydratase 154.32

AT4G27600 Medtr4g078150 Carbohydrate kinase-like protein 153.3

AT1G80920 Medtr4g007300 Chaperone protein dnaJ 152.15

AT1G06530 Medtr5g091710 hypothetical protein 151.36

AT1G07040 Medtr5g038460 hypothetical protein 149.93

AT5G13440 Medtr7g084150 Ubiquinol-cytochrome c reductase iron-sulfur subunit 147.75

AT2G43090 contig_57428_2 3-isopropylmalate dehydratase small subunit 147.6

AT2G22240 Medtr3g087590 L-myo inositol-1 phosphate synthase 146.92

AT4G31320 Medtr3g109160 Auxin-induced protein 6B 144.64

AT1G78090 Medtr5g063080 Trehalose-6-phosphate phosphatase 142.08

AT2G01190 contig_49827_2 Unknown protein 142.03

AT1G16210 Medtr3g118350 Coiled-coil domain-containing protein 136.57

AT4G24690 contig_51270_1 ZZ type zinc finger domain-containing protein 133.31

AT1G72060 contig_23307_1 Type II proteinase inhibitor family protein 132.07

AT1G26800 Medtr5g041310 RING finger protein 130.54

AT1G01720 Medtr3g088110 NAC domain protein 128.9

38

At ID Mt ID Symbol Description ΔAt ΔMtAT2G30040 Medtr5g071560 Serine/threonine protein kinase 128.68

AT5G26170 Medtr3g104750 WRKY transcription factor 128.43

AT4G17585 contig_84091_1 Aluminum-activated malate transporter 125.9

AT5G04750 AC233577_42 hypothetical protein 125.87

AT2G38280 Medtr4g016980 AMP deaminase 125.23

AT5G47030 Medtr8g008870 ATP synthase delta subunit 124.87

AT2G43780 Medtr7g091060 hypothetical protein 123.59

AT3G02090 contig_53535_2 Mitochondrial processing peptidase beta subunit 122.29

AT4G13830 contig_118335_1 Chaperone protein dnaJ 118.75

AT4G20960 Medtr4g119220 Riboflavin biosynthesis protein RibD 117.39

AT3G08610 Medtr8g005360 hypothetical protein 112.06

AT1G67360 Medtr3g085370 REF/SRPP-like protein 110.75

AT5G65750 Medtr7g023770 Oxoglutarate dehydrogenase - like protein 109.39

AT3G51750 Medtr7g069930 hypothetical protein 107.38

AT5G08530 Medtr1g042300 NADH-quinone oxidoreductase subunit F 105.26

AT5G28840 contig_51686_1 NAD-dependent epimerase/dehydratase family-like protein 104.52

AT5G40010 Medtr6g009520 Mitochondrial chaperone BCS1 103.85

AT1G05000 Medtr5g085300 Tyrosine specific protein phosphatase family protein 103.12

AT4G02620 contig_74698_1 Vacuolar ATPase F subunit 102.75

AT5G10770 contig_86495_1 Aspartic proteinase nepenthesin-1 102.21

AT2G41410 Medtr7g090450 hypothetical protein 101.96

AT4G09510 Medtr1g096140 Neutral invertase-like protein 101.2

AT3G18820 Medtr4g069850 Ras-related protein Rab7 101

AT3G63380 contig_7892_1 Calcium-transporting ATPase 100.78

AT2G20420 contig_50632_1 Succinyl-CoA ligase 99.27

AT3G30390 Medtr7g017630 Amino acid transporter 98.01

AT3G03870 Medtr6g029250 hypothetical protein 97.97

AT2G41380 Medtr7g090180 Methyltransferase%2C putative 97.21

AT1G21410 contig_57398_1 F-box/LRR-repeat protein 95.48

AT1G35190 contig_114358_1 2OG-Fe(II) oxygenase 93.88

AT3G26890 Medtr7g083230 hypothetical protein 93.34

AT1G56310 Medtr1g083820 hypothetical protein 92.97

AT1G11650 Medtr4g131970 RNA-binding protein 92.74

AT1G09660 Medtr2g005590 KH domain-containing protein 91.9

AT2G23970 Medtr4g093250 GMP synthase 91.86

AT3G23150 contig_103103_1 Ethylene receptor 91.46

AT2G16500 Medtr4g072020 Arginine decarboxylase 90.63

AT5G20650 Medtr3g105330 Copper transporter 90.63

AT3G02570 AC233656_1025 Mannose-6-phosphate isomerase 87.6

AT1G65720 Medtr3g064040 hypothetical protein 86.4

AT3G61890 Medtr8g026960 Homeobox-leucine zipper protein ATHB-7 86.28

AT2G33040 contig_162431_1 ATP synthase gamma chain 85.51

AT5G54310 Medtr2g080950Arf-GAP with coiled-coil%2C ANK repeat and PH domain-containing protein 83.58

AT2G32260 Medtr2g035810 Choline-phosphate cytidylyltransferase 83.07

39

At ID Mt ID Symbol Description ΔAt ΔMtAT5G57815 contig_80230_1 Cytochrome c oxidase subunit VIb 82.23

AT2G47590 Medtr1g088420 DNA photolyase protein 80.22

AT1G77490 Medtr3g088160 Ascorbate peroxidase 79.68

AT2G21170 contig_63724_1 Triosephosphate isomerase 79.56

AT4G01870 AC233676_31 Protein tolB 79.03

AT4G38580 Medtr3g117890 Farnesylated protein (ATFP6) 78.56

AT4G38520 contig_9318_1 Protein phosphatase 2C 78.53

AT4G04860 contig_54803_1 Derlin-2 78.5

AT1G16840 Medtr2g037970 hypothetical protein 78.14

AT5G18400 Medtr4g074480 Anamorsin-like protein 77.31

AT1G73430 Medtr4g124570 Conserved oligomeric Golgi complex subunit 77.16

AT2G18890 Medtr4g127840 Receptor-like protein kinase 76.24

AT3G14870 Medtr2g075910 hypothetical protein 75.62

AT5G67210 contig_60423_1 Expressed protein 75.19

AT1G79110 Medtr2g069350 S-RNase binding protein 75.11

AT3G04560 Medtr1g079830 hypothetical protein 74.81

AT4G02580 Medtr2g104110 NADH-ubiquinone oxidoreductase 24 kDa subunit 74.56

AT3G26100 Medtr3g086300 RCC1 domain-containing protein 74.14

AT1G60710 Medtr7g021850 Aldo/keto reductase 73.61

AT3G23430 Medtr1g075640 Pho1-like protein 73.02

AT1G55490 contig_64526_1 Chaperonin protein 72.42

AT3G15020 contig_58898_1 Malate dehydrogenase 72.05

AT3G52730 Medtr7g104570 Ubiquinol-cytochrome c reductase complex protein 71.84

AT4G24280 Medtr2g005690 Heat shock protein 71.03

AT5G53120 Medtr3g091090 Spermidine synthase 69.88

AT4G25130 Medtr5g092680 Peptide methionine sulfoxide reductase 69.85

AT5G47060 Medtr5g013770 hypothetical protein 69.57

AT2G37110 Medtr7g100870 hypothetical protein 68.02

AT2G12400 contig_50560_2 Unknown protein 67.95

AT1G01320 AC235758_28 hypothetical protein 67.67

AT1G23100 AC225518_12 10 kDa chaperonin 67.29

AT1G11700 contig_98818_1 Unknown protein 67.11

AT5G50850 Medtr7g005380 Pyruvate dehydrogenase E1 component subunit beta 66.96

AT5G64840 Medtr3g095010 ABC transporter F family member 66.93

AT1G68760 Medtr5g062660 Nudix hydrolase 66.74

AT5G21940 Medtr1g015650 MTD1 66.53

AT2G37750 contig_11279_1 Unknown protein 66.49

AT2G20142 Medtr5g037700 TIR-NBS disease resistance-like protein 66.41

AT5G40780 contig_59035_1 Histidine amino acid transporter 66.19

AT3G10920 contig_57469_1 Superoxide dismutase 66.17

AT3G02100 Medtr7g013200 UDP-glucosyltransferase HRA25 65.07

AT1G62740 Medtr5g012030 Stress-induced-phosphoprotein 64.97

AT4G17010 Medtr3g086600 hypothetical protein 64.71

AT2G23610 Medtr5g018300 Esterase PIR7B 64.59

AT5G03455 Medtr7g102310 Dual specificity phosphatase Cdc25 64.56

40

At ID Mt ID Symbol Description ΔAt ΔMtAT2G37410 contig_66276_1 Mitochondrial import inner membrane translocase subunit Tim17 63.67

AT3G21760 Medtr5g090580 Glucosyltransferase 63.47

AT1G80160 Medtr2g103490 Metallothiol transferase fosB 63.46

AT3G48050 contig_60569_1 Unknown protein 63.24

AT4G33300 Medtr1g021100 Nbs-lrr resistance protein 62.81

AT3G56860 Medtr7g088140 RNA-binding protein 62.41

AT5G22140 contig_70973_1 Nitric oxide reductase FlRd-NAD(+) reductase 61.76

AT3G57785 Medtr1g059290 hypothetical protein 61.76

AT5G50380 Medtr4g103540 Exocyst complex component 61.53

AT4G15550 Medtr3g084520 O-glucosyltransferase 60.85

AT1G03070 Medtr1g071430 BI1-like protein 60.6

AT3G08040 Medtr3g029510 Ferric reductase defective 3b 60.54

AT4G14880 Medtr5g006340 Cysteine synthase 60.49

AT5G67480 Medtr5g015680 Speckle-type POZ protein-like B 60.22

AT3G50530 Medtr4g086660 Calcium/calmodulin-dependent protein kinase CaMK3 59.52

AT3G05500 Medtr2g013440 REF/SRPP-like protein 59.41

AT5G06690 Medtr7g093490 Thioredoxin-like protein 58.86

AT1G08480 Medtr4g084320 hypothetical protein 58.79

AT1G28480 Medtr4g079110 Glutaredoxin-C9 58.11

AT1G06570 Medtr5g091060 4-hydroxyphenylpyruvate dioxygenase 58.08

AT3G51240 Medtr8g075890 Naringenin%2C2-oxoglutarate 3-dioxygenase 58.06

AT4G13540 contig_78972_1 Unknown protein 57.81

AT2G44350 contig_63559_1 Citrate synthase 57.68

AT3G47000 Medtr5g069800 Beta-D-glucan exohydrolase-like protein 56.69

AT1G29260 contig_57916_2 Peroxisomal targeting signal 2 receptor 56.55

AT4G22670 contig_50571_1 TPR repeat-containing protein 56.5

AT3G12050 Medtr7g093500 Activator of 90 kDa heat shock protein ATPase-like protein 56.38

AT3G21260 Medtr3g090530 Pleckstrin homology domain-containing protein 56.35

AT1G65610 Medtr3g082440 Endoglucanase 56.18

AT4G37470 Medtr4g095310 Sigma factor sigB regulation protein rsbQ 55.55

AT5G14500 contig_53225_1 Aldose 1-epimerase-like protein 55.5

AT2G26670 contig_49432_1 Heme oxygenase 55.47

AT1G02460 Medtr1g086390 Polygalacturonase 55.41

AT2G23690 Medtr5g018720 hypothetical protein 55.3

AT2G19590 Medtr6g092620 1-aminocyclopropane-1-carboxylate oxidase 55.29

AT4G36020 Medtr8g075560 Major cold-shock protein 55.18

AT2G31560 Medtr1g116590 hypothetical protein 55.04

AT3G27160 contig_53851_1 30S ribosomal protein S21 54.71

AT4G02510 Medtr8g088370 Chloroplast protein import component Toc159-like protein 54.66

AT4G27435 contig_65732_1 COSII_At1g13380 54.57

AT5G61030 contig_53106_1 RNA-binding protein 54.4

AT3G08650 Medtr7g074060 ZIP transporter 54.35

AT3G45450 contig_166749_1 Chaperone protein ClpB 54.33

AT2G22360 Medtr3g087030 Chaperone dnaJ 54.16

AT5G13190 Medtr7g005440 LITAF-domain-containing protein 54.12

41

At ID Mt ID Symbol Description ΔAt ΔMtAT3G61040 Medtr5g007450 Cytochrome P450 53.75

AT1G75280 Medtr5g020740 Isoflavone reductase-like protein 53.5

AT1G05060 Medtr5g085980 hypothetical protein 53.34

AT5G26830 Medtr5g034820 Threonyl-tRNA synthetase 53.29

AT4G31990 contig_75738_1 Aspartate aminotransferase 53.03

AT5G03370 contig_49929_2 Acylphosphatase 53

AT4G18010 Medtr5g014090 Type I inositol-1%2C4%2C5-trisphosphate 5-phosphatase 52.9

AT1G27385 Medtr3g085280 hypothetical protein 52.83

AT2G23670 Medtr5g018590 hypothetical protein 52.73

AT4G23500 contig_237505_2 Polygalacturonase-like protein 52.6

AT2G17820 Medtr5g022470 Histidine kinase osmosensor protein 52.45

AT1G74310 contig_62410_1 Chaperone ClpB 52.1

AT2G38000 Medtr2g063200 hypothetical protein 51.99

AT1G21550 contig_237582_1 Calmodulin 51.71

AT5G23570 Medtr3g098260 Protein SUPPRESSOR OF GENE SILENCING-like protein 51.69

AT5G24690 Medtr2g081000 hypothetical protein 51.68

AT3G03940 Medtr7g085540 Casein kinase I isoform alpha 51.41

AT2G31670 contig_172521_2 Stress responsive alpha-beta barrel domain protein 51.33

AT5G39670 Medtr4g127560 Calcium-binding mitochondrial carrier protein SCaMC-1 51.14

AT3G22530 contig_54706_1 Unknown protein 50.85

AT5G06710 Medtr7g093430 Homeobox-leucine zipper protein HOX27 50.5

AT2G37160 Medtr7g101110 WD repeat-containing protein 50.05

AT1G50020 contig_110240_1 Tubulin alpha-6 chain 49.81

AT1G52690 contig_69549_1 Late embryogenesis-abundant protein 49.26

AT1G01060 Medtr7g118330 Circadian clock-associated protein 1a 49.22

AT5G66880 Medtr8g079560 Serine/threonine protein kinase SAPK3 48.8

AT2G22850 Medtr4g097440 Ocs element-binding factor 48.75

AT2G13810 Medtr2g008430 LL-diaminopimelate aminotransferase 48.23

AT4G32930 contig_239205_1 Unknown protein 48.22

AT4G00880 Medtr3g092220 Auxin-induced protein 10A5 48.14

AT1G60420 contig_55900_1 Nucleoredoxin 48.01

AT1G31280 Medtr4g083610 Protein argonaute 47.47

AT1G07320 contig_15344_1 50S ribosomal protein L4 47.43

AT1G03475 Medtr5g098800 Coproporphyrinogen-III oxidase 47.33

AT5G66780 Medtr5g020060 hypothetical protein 47.29

AT5G17380 contig_7668_1 Oxalyl-CoA decarboxylase 47.01

AT4G23030 Medtr5g010830 Multidrug and toxin extrusion protein 46.77

AT1G30475 Medtr5g032760 hypothetical protein 46.43

AT5G60570 contig_83299_1 Kelch-like protein 45.94

AT1G65000 contig_73955_1 Unknown protein 45.57

AT3G22840 AC233674_5 Early light inducible protein 45.26

AT1G30910 Medtr2g035480 MOSC domain-containing protein 45.24

AT3G22160 contig_83371_1 Unknown protein 45.11

AT3G06200 contig_63992_2 Guanylate kinase 44.59

AT4G08230 Medtr5g059100 hypothetical protein 44.21

42

At ID Mt ID Symbol Description ΔAt ΔMtAT5G61640 Medtr3g051460 Peptide methionine sulfoxide reductase 43.26

AT1G72170 Medtr3g005050 hypothetical protein 43.09

AT1G70790 Medtr1g031650 ADP-ribosylation factor GTPase-activating protein AGD12 43

AT3G26590 Medtr8g069470 Protein TRANSPARENT TESTA 42.92

AT4G38960 Medtr5g021580 Zinc finger protein CONSTANS-like protein 42.04

AT3G63010 Medtr1g089310 Gibberellic acid receptor-b 41.62

AT5G45390 Medtr5g026840 ATP-dependent Clp protease proteolytic subunit 41.61

AT4G27750 Medtr4g078140 Impaired sucrose induction 1-like protein 41.51

AT2G27230 contig_237765_1 basic helix-loop-helix protein%2C putative 41.35

AT3G22380 Medtr1g104710 Protein TIME FOR COFFEE 41.27

AT2G26230 contig_49059_3 Uricase 41.13

AT4G26750 Medtr5g093880 Vacuolar protein sorting-associated protein VTA1-like protein 40.5

AT4G16640 Medtr5g012680 Matrix metalloproteinase-28 40.36

AT3G13080 Medtr5g094830 Multidrug resistance protein ABC transporter family 40.22

AT2G25737 AC225518_18 hypothetical protein 40.14

AT2G33580 Medtr5g085790 Wall-associated receptor kinase-like protein 40.03

AT1G09130 Medtr7g112640 ATP-dependent Clp protease proteolytic subunit-related protein 39.79

AT2G47890 Medtr7g108150 CONSTANS-like zinc finger protein 39.77

AT4G36010 Medtr5g022310 Thaumatin-like protein 39.4

AT5G49940 Medtr2g005900 NifU-like protein 39.37

AT3G09770 Medtr7g101150 RING finger protein 39.35

AT2G26770 Medtr5g088860 hypothetical protein 39.31

AT5G43850 contig_58245_1 1 2-dihydroxy-3-keto-5-methylthiopentene dioxygenase 39.27

AT1G49970 Medtr1g106550 ATP-dependent Clp protease proteolytic subunit 38.86

AT2G35330 Medtr4g098560 Baculoviral IAP repeat-containing protein 38.75

AT2G41900 Medtr7g092070 Zinc finger CCCH domain-containing protein 38.5

AT1G08510 Medtr4g112970 Acyl-(Acyl carrier protein) thioesterase 38.18

AT2G36250 Medtr7g104500 Cell division protein ftsZ 38.01

AT1G14610 Medtr1g101620 Valyl-tRNA synthetase 37.9

AT4G38100 Medtr5g032440 Glutamyl-tRNA synthetase 37.35

AT3G04500 Medtr1g080150 RNA-binding protein 37.34

AT5G42270 contig_69701_1 Cell division protease ftsH homolog 37.1

AT2G47810 contig_66901_1 Nuclear transcription factor Y subunit B-3 36.92

AT2G45360 Medtr4g024370 NAD(P)H-quinone oxidoreductase subunit 6 36.9

AT5G22300 contig_50029_3 Nitrilase 4A 36.63

AT1G24100 Medtr5g035580 N-hydroxythioamide S-beta-glucosyltransferase 36.58

AT4G38460 AC146550_1001 hypothetical protein 36.48

AT4G10960 Medtr5g009170 UDP-glucose 4-epimerase 36.47

AT2G26140 Medtr3g104470 Cell division protease ftsH-like protein 35.97

AT4G29400 Medtr8g046180 hypothetical protein 35.86

AT5G57040 AC233845_2 Glyoxalase/bleomycin resistance protein/dioxygenase 35.49

AT5G38790 contig_73699_1 Unknown protein 34.99

AT1G49245 Medtr2g029000 hypothetical protein 34.98

AT1G62710 Medtr4g101730 Vacuolar-processing enzyme 34.8

AT5G08560 Medtr5g090420 WD-repeat protein-like protein 34.77

43

At ID Mt ID Symbol Description ΔAt ΔMtAT1G55760 Medtr3g061090 Speckle-type POZ protein-like A 34.75

AT3G10120 Medtr7g104680 hypothetical protein 34.74

AT1G14700 Medtr8g107620 Purple acid phosphatase 34.7

AT2G12550 contig_50399_1 NEDD8 ultimate buster 33.99

AT1G11430 Medtr2g011000 DAG protein 33.53

AT1G21651 contig_58625_2 E3 ubiquitin-protein ligase TRIM50 33.52

AT3G50770 Medtr8g078270 hypothetical protein 32.91

AT1G51140 Medtr1g105280 Transcription factor bHLH130 32.88

AT1G68090 Medtr8g107640 Annexin-like protein 32.75

AT4G01940 Medtr7g109850 NifU-like protein 32.31

AT1G07350 contig_52484_1 Nuclear SR-like RNA binding protein 32.06

AT5G18070 Medtr5g013970 Phosphoacetylglucosamine mutase 31.55

AT2G39490 contig_102134_2 F-box protein 31.4

AT5G04460 AC235664_17 Protein neuralized 31.14

AT5G65660 Medtr8g067590 hypothetical protein 31.05

AT1G15980 Medtr4g007080 hypothetical protein 30.92

AT5G02880 contig_52026_2 Ubiquitin-protein ligase 30.58

AT5G42390 Medtr5g007380 Metalloendopeptidase 30.56

AT1G69523 Medtr5g041780 Methyltransferase-like protein 7A 30.5

AT5G64250 Medtr3g069190 2-nitropropane dioxygenase-like protein 30.41

AT4G12290 Medtr3g080500 Primary amine oxidase 30.27

AT1G10500 Medtr8g092030 Iron-sulfur assembly protein IscA 30.21

AT3G16565 Medtr4g119840 Alanyl-tRNA synthetase 29.98

AT1G04985 Medtr5g084980 hypothetical protein 29.68

AT1G27200 Medtr5g037020 hypothetical protein 29.66

AT4G28730 contig_171369_1 Glutaredoxin 28.98

AT1G68190 AC235678_20 CONSTANS-like zinc finger protein 28.93

AT5G40990 Medtr8g022790 GDSL esterase/lipase 28.89

AT1G29195 contig_131136_1 Unknown protein 28.86

AT1G32540 Medtr4g098500 Zinc finger protein LSD1 28.77

AT4G23050 Medtr5g010730 Tyrosine-protein kinase Lyn 28.41

AT5G38640 AC233140_78 Translation initiation factor eIF-2B delta subunit 28.35

AT5G16490 Medtr7g079870 hypothetical protein 28.33

AT1G63970 Medtr5g010010 2-C-methyl-D-erythritol 2 4-cyclodiphosphate synthase 28.14

AT3G17611 contig_239290_1 Rhomboid domain containing 28.09

AT5G64510 Medtr2g010460 Nicotiana tabacum ORF 27.62

AT4G21920 contig_56887_1 Unknown protein 27.55

AT3G53560 contig_74389_1 Tetratricopeptide repeat domain protein 27.48

AT4G36910 Medtr5g016770 Inosine-5'-monophosphate dehydrogenase 27.39

AT3G14900 Medtr5g080700 hypothetical protein 27.04

AT1G44830 Medtr5g058470 AP2 domain-containing transcription factor 26.96

AT2G38270 Medtr4g016930 Monothiol glutaredoxin-S16 26.93

AT3G10113 contig_61431_1 MYB transcription factor 26.69

AT1G68830 Medtr5g053450 Serine/threonine protein kinase SNT7 26.23

AT5G48470 Medtr1g007490 hypothetical protein 26.11

44

At ID Mt ID Symbol Description ΔAt ΔMtAT2G26700 Medtr4g113790 Protein kinase G11A 26.04

AT3G07550 contig_8588_1 F-box/LRR-repeat protein 26.04

AT5G58350 Medtr5g075220 With no lysine kinase 26.02

AT2G44500 Medtr3g026650 Growth regulator like protein 26

AT5G41960 Medtr5g008220 hypothetical protein 25.64

AT1G55230 Medtr2g021690 hypothetical protein 25.41

AT5G09680 contig_112735_1 Unknown protein 25.1

AT4G05030 Medtr2g027600 hypothetical protein 24.86

AT5G15740 contig_237698_1 Unknown protein 24.76

AT3G22850 AC233674_1 Stem-specific protein TSJT1 24.55

AT1G49470 Medtr4g068340 Transmembrane protein 45B 24.47

AT1G11655 contig_64237_1 Unknown protein 24.4

AT1G02860 Medtr1g088660 E3 ubiquitin-protein ligase BAH1 24.35

AT2G38150 Medtr7g067510 Lactosylceramide 4-alpha-galactosyltransferase 24.23

AT3G49570 Medtr3g093400 hypothetical protein 24.06

AT5G47740 AC233669_4 hypothetical protein 24.04

AT1G17710 AC235757_50 Pyridoxal phosphate phosphatase PHOSPHO2 24.03

AT1G79960 Medtr2g102260 hypothetical protein 23.96

AT1G23550 Medtr3g077870 hypothetical protein 23.76

AT4G12060 Medtr5g011550 ATP-dependent Clp protease ATP-binding subunit clpA-like protein 23.75

AT3G56710 Medtr8g040080 hypothetical protein 23.63

AT1G51540 contig_164115_1 Kelch repeat-containing protein-like protein 23.62

AT5G41610 Medtr5g009770 Na+/H+ antiporter-like protein 23.51

AT2G41250 Medtr7g090370 Phosphoglycolate phosphatase 23.42

AT3G22110 Medtr7g070070 Proteasome subunit alpha type 22.64

AT4G25620 contig_49444_1 Hydroxyproline-rich glycoprotein-like protein 22.62

AT3G62150 Medtr1g086080 ABC transporter B family member 22.5

AT5G26330 Medtr1g104800 Blue copper protein 22.35

AT2G34340 contig_89837_1 Unknown protein 22.1

AT5G64810 Medtr8g092010 WRKY transcription factor 22.06

AT4G22790 Medtr5g011540 Multidrug and toxin extrusion protein 21.79

AT1G79960 Medtr2g102140 hypothetical protein 21.62

AT3G25690 Medtr5g053270 Protein CHUP1 21.58

AT3G13600 Medtr8g085900 Calmodulin binding protein 21.21

AT4G04020 Medtr2g025050 Plastid-lipid-associated protein 20.82

AT4G28590 Medtr8g086060 Thioredoxin family protein 20.68

AT5G12320 Medtr3g088410 Ankyrin repeat domain-containing protein 20.47

AT3G20660 Medtr2g081930 Solute carrier family 22 member 15-like protein 20.45

AT5G59720 Medtr6g061850 18.2 kDa class I heat shock protein 20.35

AT5G46720 Medtr5g030280 hypothetical protein 20.11

AT4G25140 Medtr1g090250 Oleosin 20

AT5G59730 Medtr4g062330 Exocyst complex component 19.83

AT4G27310 Medtr2g089310 Zinc finger protein CONSTANS-like protein 19.75

AT3G59140 Medtr1g099280 Multidrug resistance protein ABC transporter family 19.49

AT1G03270 contig_68308_1 Cbs domain containing protein expressed 19.32

45

At ID Mt ID Symbol Description ΔAt ΔMtAT3G21150 contig_85669_1 Zinc finger protein CONSTANS-like protein 19.09

AT5G12020 contig_115871_1 class II heat shock protein 19.04

AT2G35830 Medtr1g095890 hypothetical protein 18.88

AT1G69490 Medtr5g041940 NAC domain protein 18.81

AT1G01180 contig_242460_1 O-methyltransferase-like protein 18.68

AT3G55580 Medtr3g069030 RCC1 and BTB domain-containing protein 18.65

AT5G03230 Medtr7g101250 hypothetical protein 18.23

AT5G42650 contig_50180_1 Allene oxide synthase 17.18

AT4G39230 Medtr3g116840 Isoflavone reductase-like protein 17.17

AT2G45680 contig_60830_1 TCP family transcription factor 16.66

AT5G17800 Medtr7g086960 Myb-like protein A 16.46

AT5G11550 AC225507_30 U-box domain-containing protein 15.87

AT5G57345 Medtr4g127690 hypothetical protein 15.52

AT1G05630 Medtr6g092670 Type I inositol-1%2C4%2C5-trisphosphate 5-phosphatase 14.68

AT5G46050 Medtr1g075440 Peptide transporter PTR3-A 14.67

AT4G04480 Medtr4g132380 hypothetical protein 13.07

AT5G10310 contig_83747_1 EPIDERMAL PATTERNING FACTOR-like protein 12.57

AT5G53970 Medtr8g061360 Tyrosine aminotransferase 12.35

AT4G15417 Medtr3g080000 Ribonuclease 3-like protein 11.95

AT1G67910 Medtr8g069350 PGPS/D10 -12.52

AT5G61590 Medtr1g090290 Ethylene-responsive transcription factor -13.67

AT2G40080 Medtr3g070490 Early flowering -14.24

AT5G06800 contig_114433_2 MYB-CC type transfactor -14.56

AT3G20820 Medtr2g098250 DNA-damage-repair/toleration protein DRT100 -14.9

AT4G16770 Medtr4g100600 Gibberellin 2-beta-dioxygenase -15.29

AT1G69780 Medtr5g039000 Homeobox-leucine zipper protein -16.47

AT5G15140 Medtr7g009930 Aldose 1-epimerase -16.67

AT1G56220 Medtr1g083440 Auxin-repressed 12.5 kDa protein -16.74

AT5G61590 AC233556_27 Ethylene-responsive transcription factor -16.79

AT3G07130 Medtr3g083810 Purple acid phosphatase -17.4

AT4G35160 Medtr3g083620 O-methyltransferase -17.87

AT2G30210 Medtr5g073210 Laccase-like multicopper oxidase -18.26

AT2G42760 Medtr8g086820 hypothetical protein -18.73

AT2G37460 Medtr7g100050 Auxin-induced protein 5NG4 -19.07

AT2G22760 Medtr4g097940 Transcription factor bHLH19 -19.3

AT2G25770 contig_67078_3 Lachrymatory factor synthase -20

AT5G58660 contig_77717_1 1-aminocyclopropane-1-carboxylate oxidase -20.07

AT1G45130 Medtr1g023120 Beta-galactosidase -20.57

AT3G16850 contig_57387_1 Polygalacturonase-like protein -20.7

AT1G72210 Medtr3g099620 Transcription factor bHLH96 -20.73

AT5G48540 Medtr7g052020 Cysteine-rich repeat secretory protein -20.78

AT1G09390 Medtr7g111780 GDSL esterase/lipase -21.22

AT2G14820 Medtr1g106430 BTB/POZ domain-containing protein -21.24

AT1G77690 Medtr3g072870 Auxin influx carrier -21.39

AT4G30810 Medtr2g063000 Serine carboxypeptidase II-2 -21.8

46

At ID Mt ID Symbol Description ΔAt ΔMtAT4G16780 Medtr5g013010 Homeobox-leucine zipper protein HOX17 -21.8

AT1G64380 Medtr5g009410 Ethylene-responsive transcription factor ERF061 -21.87

AT2G46490 contig_94424_1 Unknown protein -21.97

AT3G12870 contig_162443_1 Unknown protein -22.15

AT2G42870 Medtr5g091690 hypothetical protein -22.17

AT3G61510 Medtr7g079080 1-aminocyclopropane-1-carboxylate synthase -22.2

AT3G23920 contig_61864_1 Beta-amylase -22.2

AT2G17620 Medtr5g023790 G2/mitotic-specific cyclin-1 -22.22

AT3G62640 Medtr7g109290 hypothetical protein -22.23

AT1G17860 Medtr6g078070 Kunitz-type trypsin inhibitor alpha chain -22.56

AT5G38200 Medtr7g082570 hypothetical protein -22.63

AT1G24130 Medtr5g035980 WD repeat-containing protein-like protein -22.88

AT1G12740 Medtr5g010750 Cytochrome P450 -22.88

AT3G07650 Medtr3g082630 Zinc finger protein CONSTANS-LIKE protein -23.08

AT1G02400 Medtr1g086550 Gibberellin 2-beta-dioxygenase -23.28

AT2G32300 Medtr2g088990 Blue copper protein -23.28

AT1G70710 Medtr8g104820 Endo-beta-1 4-glucanase -23.7

AT1G02170 Medtr2g008970 Metacaspase-1 -23.72

AT5G05600 Medtr3g070860 Leucoanthocyanidin dioxygenase -23.77

AT2G25810 contig_83765_1 Aquaporin-like protein -23.77

AT2G24260 Medtr4g131160 Transcription factor bHLH66 -23.81

AT1G11050 Medtr2g006910 Kinase-like protein -23.85

AT4G32830 contig_54502_1 Serine/threonine protein kinase -23.88

AT3G22600 Medtr5g006950 Non-specific lipid-transfer protein -23.93

AT5G54585 contig_81139_1 Unknown protein -23.94

AT3G09870 contig_63248_1 SAUR family protein -24.14

AT1G29050 Medtr2g015720 hypothetical protein -24.14

AT2G29660 AC233571_23 hypothetical protein -24.53

AT5G42180 Medtr1g025980 Peroxidase -24.61

AT4G34215 contig_11487_1 Acetyl xylan esterase A -24.69

AT1G78520 contig_81525_1 Glucan endo-1 3-beta-glucosidase -24.71

AT5G09220 contig_81942_1 Amino acid permease -24.75

AT3G11660 contig_114683_1 NHL1 -24.85

AT3G02885 Medtr5g078220 GASA5-like protein -24.85

AT2G32540 Medtr2g087900 Cellulose synthase-like protein H1 -25.1

AT5G59970 Medtr5g063620 Histone H4 -25.44

AT1G32910 Medtr5g090830 Acetyltransferase%2C putative -25.51

AT2G30860 Medtr5g090920 Glutathione S-transferase -25.51

AT4G39700 Medtr8g091420 hypothetical protein -25.91

AT3G16500 Medtr2g100780 Auxin-responsive protein IAA18 -26.18

AT5G43650 contig_62356_1 Basic helix-loop-helix protein -26.3

AT3G58110 AC233675_23 hypothetical protein -26.35

AT1G35720 Medtr5g063670 Annexin -26.44

AT1G64640 contig_8486_1 CT099 -26.6

AT5G64410 Medtr2g009980 Oligopeptide transporter -26.81

47

At ID Mt ID Symbol Description ΔAt ΔMtAT4G24026 contig_109418_1 Unknown protein -26.88

AT3G26670 contig_49190_1 DUF803 domain membrane protein -26.93

AT1G49230 Medtr3g095560 Ring-H2 zinc finger protein -26.95

AT3G23730 Medtr3g084630 Xyloglucan endotransglycosylase/hydrolase XTH-21 -27.31

AT2G41870 Medtr7g091990 hypothetical protein -27.36

AT4G02630 Medtr5g017080 BRASSINOSTEROID INSENSITIVE 1-associated receptor kinase -27.55

AT4G21570 Medtr2g012360 Transmembrane protein 184C -27.67

AT3G51680 Medtr7g071680 Sex determination protein tasselseed-2 -27.7

AT2G02130 AC229689_4 Defensin -27.78

AT3G46410 contig_85216_1 Receptor-like protein kinase -27.91

AT1G49320 Medtr3g116380 BURP domain-containing protein -28.15

AT2G42690 Medtr4g080100 Feruloyl esterase A -28.65

AT2G30100 contig_56835_1 Pentatricopeptide repeat-containing protein -29.05

AT5G12340 Medtr5g089820 hypothetical protein -29.24

AT3G51950 contig_82599_1 Zinc finger CCCH domain-containing protein -29.72

AT1G10200 Medtr1g017950 Transcription factor lim1 -29.84

AT3G45010 Medtr2g095750 Serine carboxypeptidase -30.07

AT1G65890 Medtr3g064420 2-succinylbenzoate-CoA ligase -30.46

AT4G33640 Medtr4g093660 hypothetical protein -30.61

AT3G13510 Medtr8g088510 hypothetical protein -30.69

AT3G54770 contig_7807_1 RNA binding protein-like protein -30.8

AT1G54070 Medtr8g022300 hypothetical protein -30.89

AT5G65360 Medtr8g092720 Histone H3 -30.98

AT5G58960 contig_52859_2 Unknown protein -31.04

AT5G23750 AC235674_1 Remorin -31.14

AT5G07030 Medtr8g039540 Aspartic proteinase nepenthesin-1 -31.15

AT5G22580 contig_124655_1 Stress responsive A/B Barrel Domain-containing protein -31.26

AT3G26760 Medtr7g083870 Sex determination protein tasselseed-2 -31.42

AT5G36290 Medtr7g079850 Transmembrane protein -31.6

AT2G24300 contig_49484_2 Calmodulin-binding protein 60-D -31.65

AT3G14067 Medtr8g021130 Cucumisin-like serine protease subtilisin-like protease -31.66

AT2G32070 Medtr4g006800 Ribonuclease CAF1 -31.7

AT4G08180 Medtr3g073040 Oxysterol-binding protein-related protein -32

AT3G14310 Medtr8g023310 Pectinesterase -32.24

AT5G65360 Medtr5g029820 Histone H3 -32.29

AT1G75500 Medtr1g023180 Auxin-induced protein 5NG4 -32.3

AT4G37560 contig_74499_1 Formamidase -32.31

AT5G64570 Medtr2g008240 Beta-xylosidase/alpha-L-arabinofuranosidase -32.34

AT5G27450 Medtr7g113660 Mevalonate kinase family protein -32.56

AT5G59970 contig_163568_1 Histone H4 -32.57

AT4G23630 contig_74017_1 Reticulon family protein -32.75

AT2G33400 contig_83309_2 Unknown protein -33.39

AT1G31910 Medtr3g091190 Phosphomevalonate kinase -33.61

AT3G54020 contig_69469_1 Phosphatidylcholine:ceramide cholinephosphotransferase -33.68

AT5G56540 Medtr6g029260 hypothetical protein -33.74

48

At ID Mt ID Symbol Description ΔAt ΔMtAT4G17650 Medtr3g101750 Coenzyme Q-binding protein COQ10-like protein -33.91

AT1G16920 Medtr2g075950 Ras-related protein Rab-11B -34.3

AT2G39020 contig_128180_1 N-acetyltransferase -34.38

AT5G63710 Medtr8g095030 Plasma membrane receptor-like kinase -34.56

AT1G78860 Medtr2g076590 hypothetical protein -34.69

AT4G12280 contig_82416_1 Primary amine oxidase -35.11

AT5G55460 Medtr3g055250 hypothetical protein -35.26

AT5G24490 Medtr3g092720 30S ribosomal protein -35.3

AT2G15220 contig_13813_1 PBSP domain-containing protein -35.31

AT1G74030 contig_164369_1 Enolase -35.55

AT1G06410 Medtr4g080160 Trehalose synthase-like protein -35.62

AT1G78680 Medtr2g075770 Gamma-glutamylhydrolase -35.66

AT1G12630 Medtr1g101550 Ethylene-responsive transcription factor ERF026 -36.05

AT4G13580 contig_114979_1 Dirigent-like protein -36.32

AT5G61210 contig_55142_3 Synaptosomal-associated protein -37.07

AT2G22300 contig_49733_1 Calmodulin-binding transcription activator -37.25

AT3G60810 Medtr4g023550 hypothetical protein -37.36

AT2G28670 contig_64235_1 Disease resistance response/ dirigent-like protein -37.38

AT3G54850 contig_75671_1 U-box domain-containing protein -37.56

AT4G35780 Medtr5g023150 Dual specificity protein kinase pyk2 -38.03

AT4G27470 contig_84035_1 Ring finger protein 185 (Predicted) -38.12

AT1G76880 AC234952_22 GT-2 factor -38.16

AT3G54560 Medtr1g071040 Histone H2A -38.24

AT3G55430 Medtr7g026340 Glucan endo-1%2C3-beta-glucosidase -38.38

AT1G20930 Medtr1g075610 Cyclin-dependent kinase -38.64

AT1G11545 contig_58005_1 Xyloglucan endotransglucosylase/hydrolase -39.08

AT1G31200 contig_49223_1 Phloem protein -39.66

AT3G16920 Medtr2g034680 Endochitinase -39.72

AT5G40240 Medtr1g014090 Auxin-induced protein 5NG4 -39.85

AT5G11280 Medtr3g107550 hypothetical protein -39.96

AT3G16720 contig_107563_1 RING finger family protein -40.96

AT3G53670 AC233662_34 hypothetical protein -41.45

AT5G20100 contig_91504_1 Unknown protein -41.66

AT1G70090 Medtr5g036580 Glycosyltransferase CAZy family GT8 -41.84

AT1G26850 Medtr8g055840 hypothetical protein -41.89

AT2G30600 Medtr5g066730 Kelch-like protein -42

AT1G25275 Medtr2g007950 hypothetical protein -42.08

AT4G19120 Medtr5g026930 hypothetical protein -42.24

AT4G17030 Medtr5g013440 Expansin-like protein -42.3

AT1G74690 Medtr4g108140 IQ domain-containing protein -42.32

AT5G65360 Medtr8g063500 Histone H3 -42.33

AT2G46210 Medtr8g056100 Delta-8 sphingolipid desaturase -42.48

AT3G24550 Medtr6g088610 Somatic embryogenesis receptor kinase -42.82

AT3G03130 Medtr4g077590 hypothetical protein -42.85

AT4G16563 Medtr5g012490 Aspartic proteinase nepenthesin-2 -42.94

49

At ID Mt ID Symbol Description ΔAt ΔMtAT5G18840 Medtr4g118610 Sugar transporter ERD6-like protein -43.29

AT3G58710 Medtr2g083870 Transcription factor -43.31

AT1G28480 Medtr2g014760 Glutaredoxin-C9 -43.35

AT2G02130 Medtr8g070770 Defensin -43.42

AT5G06900 Medtr3g020780 Cytochrome P450 -43.43

AT3G24670 Medtr7g059290 Pectate lyase 1-27 -44.21

AT2G31180 contig_96371_1 Myb-related transcription factor -44.33

AT1G17745 Medtr4g005880 Phosphoglycerate dehydrogenase -44.36

AT2G15760 Medtr4g086620 hypothetical protein -44.58

AT5G66900 Medtr5g018060 Cc-nbs-lrr resistance protein -44.63

AT5G63400 Medtr4g103800 Adenylate kinase B -44.98

AT5G43700 AC233668_19 Auxin-induced protein -45.26

AT5G16250 Medtr7g080550 hypothetical protein -45.47

AT5G03170 Medtr7g101080 Fasciclin-like arabinogalactan protein -45.93

AT1G30135 Medtr8g107300 Protein TIFY 5A -45.93

AT4G24210 contig_131296_1 F-box protein GID2 -46.03

AT3G07390 Medtr8g011650 Auxin-induced in root cultures protein -46.37

AT2G45760 contig_78563_1 Unknown protein -46.65

AT1G48480 Medtr8g107470 Atypical receptor-like kinase MARK -46.66

AT2G23910 Medtr5g029990 Dihydroflavonol-4-reductase -46.73

AT5G10130 Medtr3g087540 Pollen-specific protein C13 -46.83

AT1G23800 contig_240096_1 Aldehyde dehydrogenase -47.05

AT5G60530 Medtr4g059670 hypothetical protein -47.19

AT3G01640 contig_129728_1 GHMP kinase -47.79

AT2G17890 Medtr5g022030 Calcium-dependent protein kinase -47.82

AT4G39670 contig_7863_1 Glycolipid transfer protein domain-containing protein -48.49

AT5G57510 Medtr4g128470 hypothetical protein -49.22

AT2G46270 Medtr7g116890 G-box binding factor -49.28

AT1G78700 Medtr2g075410 Brassinosteroid signaling positive regulator-related protein -49.45

AT5G01210 Medtr4g015180 BAHD acyltransferase DCR -49.47

AT5G57655 Medtr4g128840 Xylose isomerase -49.67

AT4G08950 Medtr8g095910 Phi-1 protein -49.96

AT4G18030 contig_49635_2 Ankyrin protein kinase-like protein -50.08

AT4G27720 Medtr3g092030 Major facilitator superfamily domain-containing protein -50.13

AT4G31840 Medtr1g014120 Early nodulin-like protein -51.04

AT2G05790 Medtr5g085580 Glucan endo-1%2C3-beta-glucosidase -51.32

AT5G20250 Medtr4g115330 Seed imbibition protein -51.35

AT3G09270 contig_121355_1 Glutathione S-transferase -51.51

AT1G60440 contig_60671_2 Pantothenate kinase -51.59

AT4G33420 Medtr7g035030 Peroxidase -51.92

AT2G19800 Medtr8g102150 Inositol oxygenase -52.07

AT1G26480 Medtr5g044160 14-3-3-like protein GF14 iota -52.58

AT1G54690 Medtr7g108320 Histone H2A -52.7

AT4G34200 contig_12516_1 Phosphoglycerate dehydrogenase -53.07

AT3G14230 Medtr8g022820 Ethylene-responsive transcription factor -53.3

50

At ID Mt ID Symbol Description ΔAt ΔMtAT1G78950 Medtr4g005190 Beta-amyrin synthase -53.44

AT4G34410 Medtr4g086220 Ethylene responsive transcription factor 2b -53.56

AT4G39350 Medtr8g092590 Cellulose synthase A catalytic subunit -53.95

AT1G74950 Medtr2g042900 Protein TIFY 10B -54.17

AT3G27170 contig_64704_1 Chloride channel -54.35

AT2G27690 Medtr4g054920 Cytochrome P450 94A1 -54.75

AT2G43480 contig_58062_2 Peroxidase -55.06

AT2G44010 Medtr3g098390 hypothetical protein -55.92

AT5G62865 Medtr4g106650 hypothetical protein -56.45

AT3G05880 Medtr7g111380 Hydrophobic protein LTI6A -56.72

AT3G56480 Medtr7g089090 hypothetical protein -56.89

AT5G54490 Medtr2g081580 Centrin-2 -57.27

AT5G59970 contig_70564_1 Histone H4 -57.47

AT3G05900 Medtr1g084990 hypothetical protein -58.3

AT5G46490 AC151738_26 Tir-nbs-lrr resistance protein -59.86

AT4G23800 contig_62513_1 High mobility group family -60.71

AT3G27200 Medtr6g023760 Plastocyanin-like domain-containing protein -61.23

AT1G17620 Medtr2g100060 hypothetical protein -61.44

AT1G11580 Medtr7g050870 Pectinesterase -61.68

AT1G19715 Medtr5g071200 Myrosinase-binding protein-like protein -62.08

AT1G16670 contig_55871_3 Receptor-like protein kinase -62.22

AT1G19440 Medtr4g070270 3-ketoacyl-CoA synthase -62.82

AT5G48480 Medtr7g052690 Early tobacco anther -63.08

AT3G45600 Medtr4g061010 hypothetical protein -63.27

AT2G18210 contig_84277_1 Unknown protein -63.51

AT4G19230 Medtr8g072260 Abscisic acid 8'-hydroxylase -63.72

AT5G41330 contig_165823_1 Protein binding protein -63.81

AT1G70890 Medtr8g012550 MLP-like protein -64.45

AT1G68490 contig_162623_1 Unknown protein -64.74

AT1G14900 Medtr5g078330 HMG-Y-related protein A -66.18

AT1G15950 Medtr4g006940 Cinnamoyl CoA reductase -66.68

AT5G37720 Medtr3g065490 THO complex subunit -66.86

AT1G31812 Medtr5g026740 Acyl-CoA-binding protein -66.87

AT1G76160 contig_74168_1 Laccase 1a -67.01

AT1G01470 Medtr7g079180 Desiccation protectant protein Lea14-like protein -67.26

AT1G61340 Medtr4g091100 F-box protein SKIP27 -67.87

AT1G48830 Medtr6g021670 40S ribosomal protein S7-like protein -69.13

AT1G66880 Medtr7g082530 Ser/Thr protein kinase -69.61

AT1G36240 Medtr7g021030 60S ribosomal protein L30 -69.77

AT1G31335 Medtr5g098300 hypothetical protein -69.84

AT4G11820 Medtr5g011040 Hydroxymethylglutaryl-CoA synthase -70.65

AT2G30620 contig_57462_1 Histone H1 -70.86

AT5G14920 contig_64922_1 Gibberellin-regulated protein -71.03

AT2G39130 Medtr1g094620 Amino acid transporter -71.4

AT3G05890 Medtr7g111350 Hydrophobic protein RCI2B -71.88

51

At ID Mt ID Symbol Description ΔAt ΔMtAT3G21190 contig_10471_1 Unknown protein -71.94

AT5G66230 Medtr8g075950 hypothetical protein -72.15

AT2G18980 Medtr4g127670 Peroxidase -72.23

AT4G25810 Medtr4g128580 Xyloglucan endotransglucosylase/hydrolase -72.36

AT5G56670 Medtr4g100900 40S ribosomal protein S30 -73.84

AT3G48100 Medtr4g106590 Two-component response regulator ARR5 -74.33

AT1G11260 Medtr4g091370 Sugar transport protein -74.75

AT3G49910 Medtr5g096540 60S ribosomal protein L26 -75.52

AT1G05575 contig_58153_1 Unknown protein -76.57

AT5G23860 Medtr1g101130 Tubulin beta chain -76.89

AT1G08090 AC233663_23 High-affinity nitrate transporter -78.04

AT5G13710 Medtr3g032530 Cycloartenol-C-24-methyltransferase -78.14

AT5G15350 Medtr6g013420 Lamin-like protein -78.98

AT5G63620 Medtr8g095220 Alcohol dehydrogenase-like protein -79.61

AT3G11410 Medtr5g080680 Protein phosphatase 2C -80.07

AT5G17330 Medtr3g064740 Glutamate decarboxylase -80.12

AT5G57290 contig_65077_2 60S acidic ribosomal protein P3 -80.61

AT2G03440 Medtr4g082830 Low-temperature inducible -81.35

AT5G57850 contig_165624_1 Branched-chain amino acid aminotransferase-like protein -84.2

AT2G27480 Medtr2g086560 Calpain-B -84.42

AT2G40010 Medtr3g108280 60S acidic ribosomal protein p0 -85.15

AT3G10985 Medtr3g072030 Wound-induced protein -85.43

AT3G15630 Medtr4g113600 hypothetical protein -86.16

AT5G59970 Medtr3g061440 Histone H4 -86.17

AT2G41475 Medtr2g103670 Embryo-specific protein-like protein -86.37

AT1G80840 Medtr4g007060 WRKY transcription factor -87.13

AT1G67920 Medtr8g105190 hypothetical protein -87.86

AT5G57150 Medtr2g038040 Transcription factor bHLH -90.45

AT3G08900 Medtr5g046030 Alpha-1 4-glucan-protein synthase -90.8

AT3G15260 contig_49964_1 Protein phosphatase 2C -90.89

AT2G40510 contig_50698_2 40S ribosomal protein S26 -92.01

AT4G39830 Medtr8g091390 L-ascorbate oxidase -92.65

AT5G59970 Medtr4g061920 Histone H4 -92.79

AT4G14320 Medtr2g008180 60S ribosomal protein L44 -93.4

AT5G27770 Medtr7g112770 60S ribosomal protein L22-like protein -93.57

AT3G11820 Medtr1g056560 Syntaxin-related protein Nt-syr1 -94.98

AT5G59970 Medtr3g070920 Histone H4 -95.39

AT3G16240 Medtr2g101370 Aquaporin -95.81

AT5G56540 Medtr7g085780 hypothetical protein -96.17

AT4G12420 Medtr4g101650 Monocopper oxidase-like protein SKU5 -97.39

AT3G52450 contig_13703_1 U-box domain-containing protein -97.55

AT5G04500 contig_51497_1 Exostosin-2 -98

AT4G24380 Medtr5g065580 Hydrolase%2C putative -98.35

AT2G39980 Medtr5g081960 BAHD acyltransferase DCR -99.82

AT1G15520 Medtr2g102660 Pleiotropic drug resistance protein -101.4

52

At ID Mt ID Symbol Description ΔAt ΔMtAT5G25560 Medtr3g108240 RING finger and CHY zinc finger domain-containing protein -102.11

AT5G59970 Medtr7g099610 Histone H4 -102.14

AT3G53650 Medtr7g099960 Histone H2B -102.51

AT2G21580 Medtr4g070600 40S ribosomal protein S25-2 -103.4

AT3G55280 Medtr2g096340 60S ribosomal protein L23a -103.4

AT5G60670 Medtr4g059400 60S ribosomal protein L12 -105.32

AT3G10950 Medtr4g103340 60S ribosomal protein L37a -105.77

AT2G36620 Medtr1g061670 60S ribosomal protein L24 -109.45

AT3G22930 Medtr7g034850 Calmodulin-like protein -110.65

AT5G36130 contig_80145_1 Cytochrome P450 -112.82

AT2G26190 Medtr2g039910 Calmodulin-binding protein -113.8

AT4G11070 contig_55030_2 conserved membrane protein%2C putative -114.92

AT2G17220 Medtr5g099130 Protein kinase 2B -114.99

AT3G08510 Medtr3g070720 Phosphoinositide phospholipase C -115.39

AT1G48600 Medtr8g107370 Phosphoethanolamine N-methyltransferase -115.62

AT1G20850 Medtr3g116080 Cysteine proteinase -115.83

AT3G18130 Medtr8g106790 Guanine nucleotide-binding protein subunit beta-like protein -117.7

AT3G04400 Medtr7g098290 60S ribosomal protein L23 -118.36

AT2G47770 Medtr7g108650 hypothetical protein -118.76

AT5G59910 Medtr4g063200 Histone H2B -121.42

AT3G53720 Medtr7g099800 K(+)/H(+) antiporter -121.56

AT2G39570 Medtr7g024320 hypothetical protein -123.05

AT5G67400 Medtr4g095450 Peroxidase -123.47

AT2G20450 Medtr1g075720 60S ribosomal protein L14-1 -125.02

AT3G54250 contig_49641_2 Diphosphomevalonate decarboxylase-like protein -125.81

AT3G19130 Medtr4g086600 RNA Binding Protein -125.82

AT3G29360 Medtr7g012950 UDP-glucose dehydrogenase -126.92

AT1G05850 Medtr7g021640 Endochitinase -128.49

AT1G09690 AC235488_9 60S ribosomal protein L21 -128.64

AT3G53740 Medtr1g100960 60S ribosomal protein L36 -129.92

AT1G15690 Medtr4g115970 Vacuolar proton-inorganic pyrophosphatase -130.96

AT3G03280 Medtr1g108640 hypothetical protein -133.96

AT5G66280 Medtr5g021760 GDP-mannose 4 6-dehydratase -134.07

AT3G13460 Medtr8g088390 YTH domain family protein -134.37

AT4G30660 Medtr4g130660 hypothetical protein -134.48

AT5G59910 Medtr4g071180 Histone H2B -134.99

AT3G13580 Medtr2g038250 60S ribosomal protein L7-4 -138.12

AT2G10940 Medtr4g115360 proline-rich protein -140.93

AT1G03220 Medtr1g072420 Xyloglucan-specific endoglucanase inhibitor protein -141.39

AT1G64190 contig_75082_1 6-phosphogluconate dehydrogenase decarboxylating -141.54

AT5G19510 Medtr5g088660 Elongation factor 1-beta -143.03

AT5G03300 Medtr1g064060 Adenosine kinase -144.75

AT5G67300 Medtr5g016510 R2R3-MYB transcription factor -147.62

AT1G61820 Medtr4g131810 Beta-glucosidase -150.32

AT4G12730 Medtr5g098420 Fasciclin-like arabinogalactan protein -150.86

53

At ID Mt ID Symbol Description ΔAt ΔMtAT3G60900 Medtr7g075270 Fasciclin-like arabinogalactan protein -152.13

AT2G46150 contig_239841_1 Harpin-induced protein -153.21

AT5G38710 Medtr7g020820 Proline dehydrogenase -155.28

AT1G12610 Medtr5g010940 Dehydration-responsive element-binding protein 1F -156.19

AT1G09070 contig_9750_1 SRC2 homolog -157.3

AT4G18100 contig_85159_1 Ribosomal protein L32 -160.25

AT3G45640 Medtr4g061130 Mitogen-activated protein kinase -160.36

AT5G25240 Medtr4g116530 hypothetical protein -160.46

AT1G13520 contig_63506_1 Unknown protein -162.88

AT5G22740 Medtr4g055520 Glucomannan 4-beta-mannosyltransferase -168.56

AT3G62250 Medtr8g088060 Ubiquitin -169.32

AT2G41430 Medtr7g090630 Polyadenylate-binding protein-interacting protein -169.6

AT4G37450 Medtr5g016250 hypothetical protein -176.05

AT3G01470 contig_52252_2 Homeobox-leucine zipper-like protein -176.88

AT5G39130 Medtr1g079490 Germin-like protein subfamily 1 member -182.79

AT5G59970 Medtr8g038460 Histone H4 -182.81

AT5G51990 Medtr1g101600 Dehydration-responsive element binding protein -188.54

AT1G67430 Medtr3g085490 60S ribosomal protein L17 -191.99

AT4G20260 contig_12147_1 Salt stress root protein RS1 -193.11

AT5G18380 Medtr8g106080 40S ribosomal protein S16 -198.92

AT1G19020 Medtr4g106500 hypothetical protein -210.5

AT4G08300 Medtr3g072500 Auxin-induced protein 5NG4 -210.73

AT3G43190 Medtr4g124660 Sucrose synthase -218.05

AT3G19820 contig_135615_1 24-dehydrocholesterol reductase -219.4

AT5G07050 Medtr8g041390 Auxin-induced protein 5NG4 -226.84

AT3G47340 Medtr5g071360 Asparagine synthetase -228.96

AT3G59540 contig_9344_1 60S ribosomal protein L38 -236.6

AT5G59970 Medtr2g096100 Histone H4 -240.36

AT2G21060 contig_76403_1 Cold shock protein-1 -244.35

AT1G76180 Medtr3g117290 Dehydrin -264.46

AT3G53140 Medtr3g096070 Caffeic acid 3-O-methyltransferase -268.29

AT5G03850 Medtr6g013210 30S ribosomal protein S28e -271.98

AT1G64720 Medtr3g092640 StAR-related lipid transfer protein -272.29

AT1G54410 contig_174883_1 Unknown protein -287.13

AT2G32150 Medtr1g104610 Phosphate metabolism protein -318

AT5G17920 Medtr7g086300 Methionine synthase -334.18

AT4G08685 CU651566_3 Pollen allergen Phl p -335.49

AT4G14960 Medtr3g110720 Tubulin alpha-7 chain -431.77

AT4G17340 Medtr5g012810 Aquaporin TIP2-3 -441.57

AT1G62510 Medtr4g101280 14 kDa proline-rich protein DC25 -445.09

AT3G24100 contig_58458_1 Unknown protein -479.55

AT2G03440 Medtr4g082860 Low-temperature inducible -487.23

AT3G51880 Medtr7g068280 HMG1/2-like protein -507.42

AT4G01850 Medtr7g110310 S-adenosylmethionine synthetase -560.43

AT3G15353 Medtr8g060850 Metallothionein-like protein -595.54

54

At ID Mt ID Symbol Description ΔAt ΔMtAT2G21660 Medtr4g070140 Glycine-rich RNA binding protein -826.81

AT1G28330 Medtr2g014240 Auxin-repressed protein -1401.08

55

Supplemental Table S2. Genes used as input for cis-element motif searches with the MEME Suite software. ΔAt and ΔMt denote delta RPKM values.

Gene ID Symbol Description ΔAt ΔMt

Positive genesAT3G13610 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase

superfamily protein702.54

AT2G37040 PAL1 PHE ammonia lyase 1 475.77

AT4G34050 CCoAOMT1 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein

310.9

AT3G53260 PAL2 phenylalanine ammonia-lyase 2 302.35

AT2G30490 REF3 cinnamate-4-hydroxylase 211.1

AT1G51680 AT4CL1 4-coumarate:CoA ligase 1 176.04

AT3G21240 AT4CL2 4-coumarate:CoA ligase 2 130.8

AT5G48930 HCT hydroxycinnamoyl-CoA shikimate/quinate hydroxycinnamoyl transferase

101.78

AT2G40890 CYP98A3 cytochrome P450, family 98, subfamily A, polypeptide 3 50.18

Medtr2g009270 Riboflavin biosynthesis protein 3996.98

Negative controlsAT1G15950 IRX4 cinnamoyl coa reductase 1AT1G20480 AMP-dependent synthetase and ligase family protein -1.24

AT1G20490 AMP-dependent synthetase and ligase family protein

AT1G20500 AMP-dependent synthetase and ligase family protein

AT1G20510 OPCL1 OPC-8:0 CoA ligase1

AT1G21530 AMP-dependent synthetase and ligase family protein

AT1G21540 AMP-dependent synthetase and ligase family protein

AT1G24735 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein

AT1G62940 ACOS5 acyl-CoA synthetase 5

AT1G65060 4CL3 4-coumarate:CoA ligase 3

AT1G67980 CCOAMT caffeoyl-CoA 3-O-methyltransferase

AT1G67990 TSM1 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein

AT1G76290 AMP-dependent synthetase and ligase family protein

AT2G20690 lumazine-binding family protein

AT2G22450 riboflavin biosynthesis protein, putative

AT2G44050 COS1 6,7-dimethyl-8-ribityllumazine synthase -9.11

AT3G10340 PAL4 phenylalanine ammonia-lyase 4

AT3G21230 4CL5 4-coumarate:CoA ligase 5

AT3G47390 PHS1 cytidine/deoxycytidylate deaminase family protein

AT3G48720 DCF HXXXD-type acyl-transferase family protein

AT3G61990 OMTF3 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein

AT3G62000 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein

AT4G05160 AMP-dependent synthetase and ligase family protein

56

Gene ID Symbol Description ΔAt ΔMtAT4G19010 AMP-dependent synthetase and ligase family protein

AT4G20960 Cytidine/deoxycytidylate deaminase family protein

AT4G26220 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein

-14.09

AT5G04230 PAL3 phenyl alanine ammonia-lyase 3

AT5G38120 4CL8 AMP-dependent synthetase and ligase family protein

AT5G41040 HXXXD-type acyl-transferase family protein

AT5G54160 OMT1 O-methyltransferase 1 -80.82

AT5G63380 AMP-dependent synthetase and ligase family protein -2.14

AT5G63560 HXXXD-type acyl-transferase family protein

AT5G64300 RIBA1 GTP cyclohydrolase II

Medtr4g085590 Caffeoyl-CoA O-methyltransferase -125.02

Medtr5g075450 Trans-cinnamate 4-monooxygenase -119.63

57

Supplemental Table S3. List of genes present in the working network. ΔAt and ΔMt denote delta RPKM values. Colums FIT1 and cis- denote regulation by FIT1 and presence of the hhbhAAACCAAv motif, respectively.

ID Symbol Description ΔAt ΔMt FIT1 cis-

Commonly RegulatedAT4G19690 IRT1 iron-regulated transporter 1 843.33 221.55 yesAT1G01580 FRO2 ferric reduction oxidase 2 754.1 135.24 yesAT3G07720 Galactose oxidase/kelch repeat superfamily 593.35 1258.2 yesAT4G30190 AHA2 H(+)-ATPase 2 412.27 1598.08 yesAT3G56970 bHLH38 basic helix-loop-helix (bHLH) DNA-binding 144.41 150.35AT2G28160 FIT1 FER-like regulator of iron uptake 101.76 166.13 yesAT1G09780 iPGAM1 Phosphoglycerate mutase, 2,3-

bisphosphoglycerate-independent88.83 720.4 yes

AT5G40760 G6PD6 glucose-6-phosphate dehydrogenase 6 63.45 45.1 yesAT1G18910 zinc ion binding;zinc ion binding 50.34 552.32 yesAT5G54800 GPT1 glucose 6-phosphate/phosphate translocator 1 37.39 131.1 yesAT2G01880 PAP7 purple acid phosphatase 7 34.36 197.8 yesAT5G39950 TRXH2 thioredoxin 2 14.83 102.01 yesAT5G65530 Protein kinase superfamily protein 4.62 102.66 yesAT4G08290 nodulin MtN21 /EamA-like transporter protein -4.7 -27.58 yesAT5G62720 Integral membrane HPP family protein -5.84 -45.58 yesAT1G30690 Sec14p-like phosphatidylinositol transferprotein -7.18 -57.4 yesAT3G12110 ACT11 actin-11 -10.98 -160.64AT5G13110 G6PD2 glucose-6-phosphate dehydrogenase 2 -13.81 -118.07AT1G52820 2-oxoglutarate (2OG) and Fe(II)-dependent

oxygenase superfamily protein-18.27 -114.67

AT5G12250 TUB6 beta-6 tubulin -21.85 -173.56AT5G40850 UPM1 urophorphyrin methylase 1 -31.3 -51.34AT1G05260 RCI3A Peroxidase superfamily protein -33.62 -268.81 yesAT5G54370 Late embryogenesis abundant protein-related -40.73 -41.17AT1G37130 NR2 nitrate reductase 2 -46.72 -281.44AT1G30510 RFNR2 root FNR 2 -94.56 -173.87Unique ArabidopsisAT4G31940 CYP82C4 cytochrome P450, family 82, subfamily C4 891.34 yesAT1G02500 SAM1 S-adenosylmethionine synthetase 1 711.26 yesAT3G13610 F'6H1 2-oxoglutarate (2OG) and Fe(II)-dependent

oxygenase superfamily protein702.54 yes yes

AT3G53480 PDR9 pleiotropic drug resistance 9 270.91 yesAT3G21240 AT4CL2 4-coumarate:CoA ligase 2 130.8 yesAT5G48930 HCT hydroxycinnamoyl-CoA shikimate/quinate

hydroxycinnamoyl transferase101.78 yes

AT3G58810 MTPA2 metal tolerance protein A2 94.27 yesAT1G52760 LysoPL2 lysophospholipase 2 78.23 yes

58

ID Symbol Description ΔAt ΔMt FIT1 cis-AT5G03570 IREG2 iron regulated 2 63.2 yesAT3G18560 Unknown 55.25 yes yesAT3G21770 Peroxidase superfamily protein 37AT4G14630 GLP9 germin-like protein 9 17.68 yesAT1G51860 Leucine-rich repeat protein kinase family protein 12.31 yesAT3G51330 Eukaryotic aspartyl protease family protein 11.01AT4G23690 Disease resistance-responsive family protein 10.39AT1G05700 Leucine-rich repeat transmembrane protein

kinase10.05 yes

Unique ArabidopsisAT1G52420 UDP-Glycosyltransferase superfamily protein 7.33 yesAT2G46620 P-loop containing nucleoside triphosphate

hydrolases superfamily protein3.31 yes

AT2G28960 Leucine-rich repeat protein kinase family protein 2.94AT5G25160 ZFP3 zinc finger protein 3 -1.6 yesAT5G54040 Cysteine/Histidine-rich C1 domain family

protein-2.1 yes

AT2G42250 CYP712A1 cytochrome P450, family 712, subfamily A1 -4.34AT2G16750 Protein kinase -6.95 yesAT3G20370 TRAF-like family protein -25.79AT5G44380 FAD-binding Berberine family protein -29.35AT1G48630 RACK1B receptor for activated C kinase 1B -32.02AT3G16430 JAL31 jacalin-related lectin 31 -55.85AT3G16460 JAL34 Mannose-binding lectin superfamily protein -63.92AT2G32060 Ribosomal protein L7Ae/L30e/S12e/Gadd45

family-66.61

AT5G64100 Peroxidase superfamily protein -70.26AT2G44790 UCC2 uclacyanin 2 -72.77AT3G09260 PYK10 Glycosyl hydrolase superfamily protein -

569.98Unique MedicagoMedtr2g009270 GTPcII Riboflavin biosynthesis protein 3996.98 yescontig_14068_1 UDP-glucosyltransferase family 1 protein 896.91contig_50590_1 Natural resistance-associated macrophage protein 694.11Medtr8g095750 Metal transporter 514.51 yes yesMedtr2g069300 1-aminocyclopropane-1-carboxylate oxidase-like 509.38Medtr5g075680 Metal tolerance protein 409.25Medtr2g030460 MtN19 protein 397.59Medtr2g015890 Transcription factor bHLH 289.32Medtr3g080090 PDR11 Cation diffusion facilitator 287.4Medtr1g092870 Hippocampus abundant transcript-like protein 142.62Medtr2g076960 14-3-3-like protein GF14 140.59AT4G20960 Cytidine/deoxycytidylate deaminase protein 117.39Medtr5g074710 Peroxidase 96.13

59

ID Symbol Description ΔAt ΔMt FIT1 cis-Medtr1g092880 Hippocampus abundant transcript-like protein 82.02AT5G67210 IRX15-L Protein of unknown function (DUF579) 75.19contig_74046_2 Early nodulin-55-1 65.69contig_164011_1

UDP-glucuronosyltransferase 1-6 46.08

Medtr4g094220 Cytokinin-O-glucosyltransferase 38.06AT2G45360 Protein of unknown function (DUF1442) 36.9 yesMedtr5g018990 Cytochrome P450 36.86contig_81376_1 Inositol 5-phosphatase 31.09AT5G16490 RIC4 ROP-interactive CRIB motif-containing protein 4 28.33Medtr1g087270 hypothetical protein 27.75contig_119591_1

Inositol 1 4 5-trisphosphate 5-phosphatase-like 26.32

AT1G05630 AT5PTASE13 Endonuclease/exonuclease/phosphatase family 14.68Medtr2g093990 Fasciclin-like arabinogalactan protein -14.83Medtr5g037930 Thioredoxin -15.23 yesUnique MedicagoMedtr8g098360 Tubulin beta chain -15.46Medtr8g014930 Receptor-like protein kinase -16.68 yesAT3G07130 PAP15 purple acid phosphatase 15 -17.4 yesMedtr8g075920 Gibberellin-regulated protein -21.41AT2G42870 PAR1 phy rapidly regulated 1 -22.17 yesAT2G25810 TIP4;1 tonoplast intrinsic protein 4;1 -23.77AT4G39700 Heavy metal transport/detoxification protein -25.91Medtr5g074740 Peroxidase -26.46AT1G64640 ENODL8 early nodulin-like protein 8 -26.6Medtr6g029330 hypothetical protein -29.03contig_50499_1 Receptor-like kinase -29.95AT4G33640 Unknown -30.61contig_62943_1 Receptor-like protein kinase -31.68AT3G16920 CTL2 chitinase-like protein 2 -39.72 yesAT5G40240 nodulin MtN21 /EamA-like transporter family -39.85AT1G70090 LGT8 glucosyl transferase family 8 -41.84AT5G06900 CYP93D1 cytochrome P450, family 93, subfamily D1 -43.43AT5G03170 FLA11 FASCICLIN-like arabinogalactan-protein 11 -45.93contig_166030_1

Cytochrome P450 -52.86

Medtr2g092930 Phosphoenolpyruvate carboxylase -59.13Medtr6g088140 Lanosterol synthase -61.61contig_90407_1 Lectin -61.88 yesAT4G11820 MVA1 hydroxymethylglutaryl-CoA synthase -70.65 yesMedtr6g031110 Remorin -83.24Medtr2g021250 Glutamine synthetase -84.56

60

ID Symbol Description ΔAt ΔMt FIT1 cis-Medtr4g108150 Proline-rich protein -143.88AT4G12730 FLA2 FASCICLIN-like arabinogalactan 2 -150.86Medtr4g095280 hypothetical protein -158.84AT4G37450 ATAGP18 arabinogalactan protein 18 -176.05AT4G08300 nodulin MtN21 /EamA-like transporter family -210.73AT3G47340 DIN6 glutamine-dependent asparagine synthase 1 -228.96Medtr1g088230 Indole-3-acetic acid-induced protein ARG2 -246.01 yesMedtr8g072640 3-hydroxy-3-methylglutaryl co-A reductase -329.96AT3G51880 NFD1 high mobility group B1 -507.42 yesOppositely regulatedAT2G30490 REF3 cinnamate-4-hydroxylase 211.1 -119.63 yesAT3G06890 Unknown 20.15 -33.92 yesAT1G78260 RNA-binding (RRM/RBD/RNP motifs) family 2.98 -37.19

61

Supplemental Table S4. Sequence of qRT-PCR primers.

Symbol Gene IDDirection Sequence

AtFRO2

AT1G01580 F

TTACCCGATCGACCACAACAC

RCCGCACTACAAGTCGCCATTAT

AtIRT1AT4G19690 F

CACCATTCGGAATAGCGTTAGG

R CCAGCGGAGCATGCATTTAAtAHA2

AT4G30190 F TGCTCAAAGGACACTTCACG

R GCCCTTTAGCTTCACGACTG

AtFER1AT5G01600 F CTTCTCCGTCGGTTTCTCTC

R GAGGCATGAGATGTGATTGGAtPDR9

AT3G53480 F ACAACCACAATCCAGCAACA

R GCTGGCTCAACTGTTTCACAAtF6'H1

AT3G13610 F AAGGCTGCGACTCACAAGTT

R GCTTGCTCTGCAAGAGGACT

AtEF1AT5G19510 F

GCTGTTCGTGGTGTTGAGATGC

RGGCTCTGAGGTGAGGAAGTCT

62