How can Optical Mapping accelerate my research?

Robert Lynde Deputy Director, Hitachi SolutionsErin Newburn Field Applications Scientist, OpGen Inc.

Webinar: How can Optical Mapping accelerate my research?

August 10th, 2011

Please note: This presentation accompanies the webinar recording at: https://www1.gotomeeting.com/register/367952841

• Part of the Hitachi family of companies that have been around for more than 100 years

• #47 on the Global 500• Everything from bullet trains to life science software

and services• MasterPlex has been on the

market for over 8 years• Introducing MapIt® Optical Mapping Services

Hitachi Solutions America, Ltd.

• A leading innovator in rapid, accurate genomic and DNA analysis systems.

• Its Optical Mapping technology is being used by leading genomic research centers, public health agencies, biodefense organizations, academic institutions, biotechnology companies, and clinical research organizations worldwide to help rapidly analyze microbial genomes.

• In 2010, OpGen released its Optical Mapping System to allow individuals another method to access the Optical Mapping technology.

OpGen, Inc.

What is Optical Mapping and how is it used?

Optical Mapping—Solutions for Whole Genome Analysis

Erin N. Newburn, Ph.D.

Field Applications Scientist

OpGen Inc.

Webinar Agenda

• Optical Mapping technology overview

• Optical Mapping applications– Strain typing– Comparative genomics– Whole genome sequence assembly

• Argus®Optical Mapping System

• Future applications for larger genomes

What is Optical Mapping?

Whole genome, ordered restriction maps

• Whole genome analysis of bacteria, yeast, fungi– High level of precision– Eliminates high cost of sequencing

• De novo process, no sequencing required

Optical Mapping

acagctctcgagaggatcctcgtcgggatccctcgcgctcgagatcgcgtagcgctagagcgctctagaggctcgcggagagctcgcgcgagtgcgtcggggacacattcgaggatccagttagagatcggctcgtgctagaggcctgctcgtagagacacagatagacagatagagcggctcgctctcgctgctcggaagtcgctcgcgtaagttcgcgctggatcccacagctcgcgctgacacagtcgcgtagagatgcggctgagcgctggcgctgaggctggacagtgctgctgagctcggacagctcgtgtggcgcggatccgtgctcggcggatcctagggcgtgtcgcgtgctggatgcgctggtgggccccagtttggcggcgctcgcggctcggctgctggtcgcctgcttt

These patterns are specific to individual organisms- identify, compare microbial isolates

Locates and measures distance between restriction sites

After staining with intercalating dye digestion reveals restriction cleavage sites as “gaps”, under fluorescent microscopy

How Optical Mapping WorksCells gently lysed to extract long genomic DNA molecules, pieces of microbial chromosomes

DNA is captured in parallel arrays of single DNA molecules using microfluidic device

Image Analysis and Markup

Overlapping single molecule restriction maps are aligned to produce a map assembly covering an

entire chromosome

Map Assembly

consensus map

Overlapping single molecule restriction maps are aligned to produce a map assembly covering an entire

chromosome

Patterns of restriction sites highly informative~ 500 sites per Salmonella genome

Characteristic of microbial species and individual isolatesUse to identify samples to strain level

Application Overview

Optical Mapping

Single molecule approach generates whole-genome, ordered restriction maps

Optical Maps are compared to perform high resolution epidemiology, discover genetic variation, and accelerate sequence assembly

Comparative Genomics

Strain Typing

Sequence Assembly

Strain Typing

Strain TypingHigh Resolution Epidemiology with Optical Mapping

Traditional technologies (PFGE, ribotyping & Rep-PCR) provide limited information, are unreliable for distinguishing closely related isolates, do not relate to sequencing data

Strain TypingOptical Mapping Compared to PFGE

USA-400(MW2)GLMC-10

SSCMec VS-alpha PhiSA2 (PVL)

GLMC-10

Optical Mapping detects absence of SSCmec, VS-α, PhiSA2/PVL

USA 400

Strain Typing: Ongoing E coli Outbreak

• E coli O104:H4 outbreak reported in Germany, May 2011

– Shiga toxin positive (rare for O104:H4)

– High incidence of hemolytic uremic syndrome (HUS)

– Similar to Enteroaggregative E coli (EAEC) which normally produces mild illness

• Reports spread to 12 countries, including US, Canada

• Over 3,000 cases reported by June 13, including 35 deaths

Current Outbreak

2001 HUS outbreak

EAEC Seq. Reference

• Whole genome maps available in 48 hours

• Indicated outbreak was clonal – single source

• Identified genomic islands unique to the outbreak

Strain Typing: Ongoing E. coli Outbreak

Outbreak Specific Conserved Region 3

stx2 tehAOutbreak Specific

Conserved Region 1

Outbreak Specific Conserved Region 2

Strain Typing: Ongoing E coli Outbreak

Current Outbreak

Strain Typing: Publication Example

Kotewicz et al (2008) Microbiology 154: 3518-3528

2006 E. coli O157:H7 “Spinach” Outbreak

• 51% hospitalizations v typical 10-20%• 15% kidney failure v typical 2-7% (and 3 deaths)• FDA CFSAN used Optical Mapping to identify 13

chromosomal markers that define the outbreak strain• Outbreak strain contained prophage insertions

carrying extra Shiga toxin genes resulting in increased pathogenicity

• “Most of the chromosomal changes found by optical mapping would not have been detected by microarray-based techniques”

• “Optical mapping ….. provides insights into chromosomal changes and gene acquisitions that neither PFGE nor microarray analysis allow”

Strain Typing Summary

• Optical Mapping provides required resolution to differentiate closely related strains: > 90% sequence similarity

• Other technologies lack resolution and typically focus on a few loci, may not relate to sequencing

Comparative Genomics Background

Definition:Analysis and comparison of genomes from different strains and different species to better understand gene function and relatedness.

Involves:• Sequence similarity• Gene location and synteny (order of genes)• Conserved and non-conserved regions of the genome

Comparative analysis of US Vancomycin-resistant Staphylococcus aureus strains

VRSA-6 has direct repeat

Comparative analysis of US Vancomycin-resistant Staphylococcus aureus strains

Comparative Genomics: Enterococcus faecalis

• E. faecalis isolates are diverse at whole genome level with differences from 0% to 35%

• Strain V583 is whole genome DNA sequence

• ATCC 49477 is 2.9% different at the whole-genome level from V583 using Optical Map

Comparative Genomics: Enterococcus faecalis

ATCC49477

• van genes are responsible for vancomycin resistance in Enterococcus faecalis1

• Optical Mapping can draw attention to insertions that confer antibiotic resistance

1Evers & Courvalin (1996). J Bacteriol 178(5):1302-9.

SequenceAssembly

Anne Buboltz, Microbial Genomics Conference (2009)

Sequence AssemblyRe-sequencing Validation

Alignment with MapSolver™

Four Misassemblies

Contig Breakage and Alignment

Sequencing AssemblyInversion Identified

Sequence Validation:Optical Mapping Finished Genomes

• Finished whole-genome DNA sequences are considered the gold standard (Chain et al. 2009)

• Finished whole-genome DNA sequences provide valuable insights into organization and structure of the genome that draft quality sequences cannot offer (Fraser et al. 2002)

• However, currently no strict quality or validation requirement for submitting a finished whole-genome to GenBank or peer-reviewed journal

• Purpose– Produce Optical Maps of published and peer-reviewed

finished bacterial genomes to validate quality of the finished genome

• Hypothesis– Optical Mapping will identify at least one finished

genome to contain a discrepancy.

• Methodology– Select organisms with finished genomes that are linked to a

specific ATCC submission– Generate Optical Maps using Argus® Optical Mapping System– Compare Optical Maps to in silico maps of finished genomes

13 ATCC isolates selected for validation

Relative in silico Insertion Discrepancy Example

Finished whole-genome DNA sequence contained 131 Kb extra DNA that should not be in ATCC 17978

Sequence Validation:Optical Mapping Finished GenomesRelative in silico Deletion Discrepancy Example

• Finished whole-genome DNA sequence missed a 375 Kb repetitive region, most likely a ribosomal repeat that the sequence assembler compressed

• Optical Mapping can span these large regions by using >150 Kb single molecule restriction maps

Relative in silico Inversion Discrepancy Example

• The first V. cholerae finished genome published in 1999 contains a putative inverted misassembly

• Optical Map of N16961 compared to finished genome of V. cholerae M66-2 published in 2009

• M66-2 contains a putative inverted misassembly at the same locus as the DNA sequence of N16961, and is probably a resequencing error propagated into M66-2

Identify

Order&

Orient

Overlaps

Optical Mapping Complements Sequence Assembly

gggtcagtcgtctaaaggtcgctacgtcagctgatcgtgacgcccctttttaacagtgcagctatgtggacgtacgtagctagcatcgttgcagtcgatgcaaggcgcggctcgcgcggggaaaattttttcgatcgatcgatcgatcgatgcgatcgatttcgcgtatcgatcgatcgtcgatcgatcggcgcgctagaaagagagagctcgcgcgtacatatcgcgtcccttggaggatcgatatagcgctacgagctacgatcgactgatcgat

DNA Sequence

Sequence Assembly: Summary

• Maximum value in contig alignment & gap closure as well as independently validating sequence

• Optical Mapping works best with larger contigs: >40 Kb

Argus® MapCard Processor Argus® Optical MapperArgus® Mapping Work StationArgus® Oil Applicator

Argus® MapCardArgus® QCard

Argus® Sample Preparation Kit HMWArgus® Stain KitArgus® Enzyme Kits

MapManagerMapSolver™

Instrumentation

Optical Mapping Cards

Reagents

Software

Four Key Components

Optical Mapping Cards

QCard• Performs DNA Quality Check• DNA Concentration optimization

MapCard• MapCard and Argus® MapCard

Surface assembled and CFD placed• DNA deposited • Enzymatic reaction performed

CFD(Channel Forming Device) MapCard

Micro Fluidic Channels

Top View of CFD

Bottom View of CFD

Reagent Reservoirs

Argus® MapCard Surface

MapCard Setup

Place CFD on Map Card

Deposit DNA

Remove CFD

Add Cap

MapCard—Stretching DNA Molecules

Load Argus® MapCard Reagents

Place MapCard in MapCard Processor

Result: RE Digested and Stained Single Molecules

MapCard Processing

Place MapCard in Optical Mapper

Optical MapperProcessing

Image & Data Acquisition

Single Molecule Restriction Map Linear Assembly

Consensus Optical Map

Optical Mapper Assembly Process

Future Directions:

Large Genome Application

• Focus on Super-scaffolding– Order and orientate contigs or scaffolds by creating

Super-scaffolds with mapping information

• Hybrid approach combining draft sequence and Optical Mapping

• Uses Argus® System to produce mapping information with cluster-based data pipeline

OpGen Application Accelerates Workflow

OPTICAL MAPPING

1 WEEK

Optical Map SUPER-SCAFFOLD

1 WEEK

Review sequence data in SS context

PCR, PE libraries if need more seq info

Construct Fosmid librarySequence runs

Construct BAC Library

Sequence runs

MarkerAnalysis

WEEKS MONTHSYEARS

Bioinformatics

Library Prep Shotgun

Multiple Paired-end, Mate-Pair Libraries

Sequence runs

Bioinformatics

Library Prep Shotgun

Multiple Paired-end, Mate-Pair Libraries

Sequence runs

Bioinformatics

Multiple rounds

Sequence Scaffold

In Silico Map + Single Molecule

Sequence Driven Map Alignment

Scaffolding Process

Extended Scaffolds

Super-scaffolding

Pair-wise Alignment

Final Scaffold

Goat Genome

Collaboration with BGI, representing the Goat Genome Consortium

BGI Original Input Before O.M. Data*

Result After O.M. Data

N50 (MB) 2.29 16.89N80 (MB) 0.91 6.23N90 (MB) 0.52 2.83

Scaffolds (90% Genome Coverage) 1236 181Gap closed (from scaffolds > 200 kb) N/A 1284

Results presented at Plant and Animal Genome Conference January, 2011

*Illumina HiSeq

How does the MapIt service work?

• Learn more: http://www.miraibio.com/mapit/optical-map-service• Support: support@miraibio.com or 1-650-615-7680• Sales: info@miraibio.com or 1-424-237-8524• MiraiBio Support Menu

• Community• Knowledge Base

• Blog http://www.MiraiBio.com/blog• Webinars: http://www.MiraiBio.com/Webinars• Online Store http://store.MiraiBio.com

Resources

How can Optical Mapping accelerate my research?

Technology

An optical laser device for mapping 3D geometry of ... · 99 Schiller, A. and Renard, P., 2016. An optical laser device for mapping 3D geometry of underwater karst structures: first

Tissue-Specific Optical Mapping Models of Swine Atria

Utilization of Dual-Label Optical Genome Mapping for ... › wp-content › uploads › ... · Utilization of Dual-Label Optical Genome Mapping for Genetic/Epigenetic Diagnosis Hayk

JA - Proposed Few-optical Cycle Laser-driven Particle Accelerate Structure

Optical Mapping as a Method of Whole Genome Analysis

Optical Character Recognition as Sequence Mapping€¦ · Optical Character Recognition as Sequence Mapping Thesis submitted in partial fulﬁllment of the requirements for the degree

Large area optical mapping of surface contact angle · Large area optical mapping of surface contact angle GUILHERME DUTRA,1,6 JOHN CANNING,1,2,3,7 WHAYNE PADDEN,2 CICERO MARTELLI,1,4

High -Density Optical Mapping of the Human Somatosensory Cortex · 2018. 12. 4. · High -Density Optical Mapping of the Human Somatosensory Cortex Christoph H. Schmitz 1,2, Stefan

Optical mapping of human embryonic stem cell-derived … · 2020. 10. 4. · Keywords: Human embryonic stem cells, Cardiomyocyte, Cell transplantation, Optical mapping, Cardiac electrophysiology

Optical Mapping of Plasmodium falciparum …Optical Mapping of Plasmodium falciparum Chromosome 2 Junping Jing, 1Zhongwu Lai, Christopher Aston,1 Jieyi Lin, Daniel J. Carucci,2 Malcolm

Three- Dimensional Optical Mapping of Nanoparticle Distribution in

High-resolution fracture aperture mapping using optical ...detwiler.eng.uci.edu/pdfs/23_ameli_WRR.pdf · High-resolution fracture aperture mapping using ... and R. L. Detwiler (2013),

An optical laser device for mapping 3D geometry of ...An optical laser device for mapping 3Dgeometry of underwater karst structures: first tests in the Ox Bel’Ha system, Yucatan,

Application of PCA to Cardiac Optical Mapping

Ramirez 2011 Optical Mapping of Ab

Mapping a Future for Optical Networking and Communications...Global Environment for Network Innovations _____ Mapping a Future for Optical Networking and Communications Daniel J. Blumenthal

Optical mapping of human embryonic stem cell-derived

Analytix Mapping Manager - Informatica ETL Tool - Data Integration and Data … · · 2010-06-11Analytix Mapping Manager Accelerate Project Delivery ... (SQL Server To Oracle, Etc.)---•

Optical tomographic mapping of the human somatosensory …...Optical tomographic mapping of the human somatosensory cortex Jan Mehnert 1,2, Susanne Holtze 1,2, Stefan P. Koch 1, Christina

Efficient Dense Optical Flow Estimation from Two-Images · Efficient Dense Optical Flow Estimation from Two-Images ... As existing knowledge is not enough to accelerate the MATLAB