The aging kidneys

Outline

Part 1:

• Epedimiology & Significance

• General Aging: Definition & Theories aging

Part 2:

• Application to kidney aging

• Morphological and Functional Changes

Growing general and CKD Population

• Improved survival & lower growth rates the relative

increase in the elderly population.

• Most growing pop. segment:

- US by 2030: 71 million Americans > 65 years or 20% of

the US population.

- EU by 2022:, 21% > 60 & 33% by 2050,

- China by 2040: 374 million or 24.8% of population!

Most growing CKD

segment:

USRDS prevalence

1995–2005 :

3627.5 to 5500.6

pmp (51% increase) in

the age 65–74 years

(73% increase in > 75,

but in <19: only

+16%:70.5 to 82.1)

CKD in the Elderly:Age-standardized rates for CKD 3–5

NEOERICA project

Walsh: Palliative Medicine

Despite

nephrologists:

Not unique to the

kidneys

BUT BUT…

Kidney aging

cause every organ

to age!

How Killer is the Aging Kidneys?

How Morbid is the Aging Kidneys?

USRDS Report 2011

CKD in the Elderly

Stage Description GFR

(ml/min/1.732)

US Prevalence

in Millions

1 Kidney damage and

normal or GFR

90 3.6*

2 Kidney damage and

Mild GFR

60-89 6.5*

3 Moderate GFR 30-59 15.5* (58%)

4 Severe GFR 15-29 0.7*

5 Kidney Failure usually

need dialysis

<15 0.5+

*Extrapolation in adults using NHANES 1999-2004, JAMA 16:180-8, 2007

+US Renal Data System 2008 Annual Data Report

lancet.com Vol 371 June 28, 2008

Concentrate on CKD stage 3.. What conclusions?

CKD patients mostly die with eGFR>50ml/minPREVEND: only 4% of CKD3 are 3b

Taiwan study

J Am Soc Nephrol 18: 1959–1965, 2007

Age- and sex-adjusted survival of CVD

according to the stages of CKD.

PREVEND study

It is MAU (as a marker not a

cause ! of CVD) not eGFR..

Losing GFR down to 30 ml/min

had no effect on occurrence of

CVD

How Killer is the Aging Kidneys?

How Morbid is the Aging Kidneys?

How Morbid is the Aging Kidneys?

• Aged kidneys prone for AKI & other diseases as CVD and

? Mortality

• CKD is a state of general inflammation & low antioxidants

reserve, high AGEs and ROS.. Kidney is a main organ for

oxidants excretions and metabolism

• So, accelerated aging of other organs (e.g. heart, brain,

eyes..) is expected

Aging

• Aging is a cumulative, universal, progressive, intrinsic,

and deleterious process (CUPID)

• The word senescence = "old man”

• Impaired response of body functions when the individual

is challenged

• Not “age-associated diseases,” though accentuated by

such diseases..

• Modulated by racial, hereditary, environmental, dietary

factors and availability of healthcare..

Theories to explain the aging

- Environmental:

- Genetic:

- Mixed theory: both genes and environmental damage contribute to

aging (not mutually exclusive) repetitive, exogenous injury to DNA over

time can modify the expression of genes involved in the aging process.

Cellular senescence organismal senescence

Exogenous or Environmental Theory

Nutritional Factors:Reduction in caloric intake: established benefits

Inverse relationship observed between metabolic rate and the average lifespan of

mammals.

End Products of Advanced Glycosylation:Glucose attached to proteins resulting in AGEs; modifying protein’s chemical

structure & function and by forming bridges with DNA, glycosylation also implicated

in the genomic changes contributing to aging.

Accumulation of Metabolic Waste Products:Accumulation of damaged macromolecules could contribute to cellular aging

(lipofuscin, glycosylated proteins and DNA, accumulation). Glycoside radicals oxidize

and form massive cross-links among proteins, lipids, and nucleic acids.

Genetic Theory: Programmed Aging

Many phenomena in animal lives are genetically programmed

Telomere Shortening

Sequential Inactivation of Reiterative GenesCellular aging is due to the existence of genes with several copies in different

locations on the genome.. cellular aging develop by the inactivation or injury of the

last ( but many proteins codified by a single gene).

Terminal DifferentiationGenes induced by successive cellular divisions, codify proteins that inhibit the

entrance to phase S of the cellular cycle or a reduced proteins capable of stimulating

cellular proliferation (fibronectin in fibroblasts, IL-1 in endothelial cells).

Physiological Basis

of Aging and Geriatrics

Mixed Theory

Oxidant–Antioxidant Balance:

• ROS damage macromolecules within cells. But antioxidants

do not modify the rate of aging.

• ROS production in mitochondria is less in species with

longer life spans: humans 70–100 years vs. 2–3 years in

mice.

• long-term caloric restriction (1 year) in rats decreased

(heart, liver, kidney and skeletal ms.) mitochondrial ROS

production by 50% also decreased the oxidative damage to

mitochondrial DNA, without affecting the oxidative damage

to nuclear DNA. So, lowering the production not adding

external antioxidants is the protection

Mutations

• Cause of many diseases, ageing, cancer:

A hallmark of ageing and cancer is the increase of

genomic instability with age due to increases in

mutations that are expressed at later age. Some

mutations cause apoptosis, aging effect or cancer (cells

cannot age and die)

• Structural or regulatory

The Human Genome

…GGCGGTGTTCCGGGCCATCACCATTGCGGG

CCGGATCAACTGCCCTGTGTACATCACCAAG

GTCATGAGCAAGAGTGCAGCCGACATCATCG

CTCTGGCCAGGAAGAAAGGGCCCCTAGTTTT

TGGAGAGCCCATTGCCGCCAGCCTGGGGACC

GATGGCACCCATTACTGGAGCAAGAACTGGG

CCAAGGCTGCGGCGTTCGTGACTTCCCCTCCSNP (single nucleotide polymorphism)

arranged in 23 pairs of chromosomes

Adenine (A)

Guanine (G)

Thymine (T)

Cytosine (C)

The 2009 Nobel Prize in Physiology or Medicine site

TTAGGG تاجTelomere Shortening

Telomeres and Telomerase

• Telomeres: repetitive DNA sequences at the ends of

all chromosomes (= 92): thousands of TTAGGG تاج

• Protect & separate chromosomes (critical for

structural integrity and accuracy of replication; also

serve as buffer zones for all cells: amoeba to man)

• Without telomeres, the ends of the chromosomes

would be "repaired” as breaks in DNA, leading to

chromosome fusion and massive genomic instability.

• Telomeric sequences shorten each time the DNA

replicates (by 50-200: ? 10K to 5K); when short

cellular senescence (growth arrest) occurs.

Telomerase: The 'Immortalizing' Enzyme

• Human cells are mortal (divide about ?50 X)

cellular clock for the aging & a mech. against cancer..

• Telomerase (reverse transcriptase, hTRT with RNA

template) synthesizes telomere sequences. Cells with

introduced telomerase are continuing to divide (> 250

generations). Telomerase is oncogenic !

• Premature cellular ageing – senescence was induced by

mutations in telomerase. Telomerase appears to be the

mechanism that stops the cellular clock of aging in cancer

cells.

Telomerase: The 'Immortalizing' Enzyme

• The ability of telomerase to maintain telomere length

in cancer cells was identified by Geron scientists in

lung, kidney, ovarian and other cancer cell lines.

• High telomerase activity also seen in germ cells,

stem cells, epidermal skin cells, follicular hair cells.

• The telomerase control gene has been mapped to

3p21 Elizabeth Jordan

The 2009 Nobel Prize in

Physiology or Medicine site

Summary of Telomere theory:

Tel

om

ere

len

gth

in

bp

(hu

ma

n b

loo

d c

ells

)

Telomere length declines in dividing cells as we age

8,000

1,500

3,000

0 35 65

Age in years

Tumor suppressor genes

• Cancer risk rises exponentially with age and accumulating

mutations and oncogenes

• Tumor suppressor genes cause damaged cells to die or

arrest growth (undergo apoptosis or senescence) as a

protective mechanism against cancer

• Two genes’ products known involved in this balance

between aging and cance: p53 & p16: both suppress

cancer at the cost of accelerated aging..

p53—“The Guardian of the Genome”

• Transcription factor: regulates expression of other genes In

humans is encoded by the TP53 gene

• One of the most commonly mutated genes in human

cancers; Regulates the cell cycle; cell proliferation,

apoptosis following damage to DNA, hypoxia, oxidative

stress, excessive mitogenic stimulation, or excessive

telomere shortening.

DNA repair proteins when DNA has sustained damage

• Homozygous p53 TGEM® Rats develop tumors at 3-4

months, and heterozygotes develop tumors at 9 months.

Bourdon et al. (2007) Brit. J. Cancer. 97: 277-282/Charles River site

Anette Melk

• p16INK4a staining in a

case of allograft

nephropathy. (A) Zero

biopsy from a 19-year-old

donor with no p16INK4a

staining. (B) One- year

follow-up biopsy

diagnosed with allograft

nephropathy showing

nuclear and cytoplasmic

staining for p16INK4a in

tubular cells. The amount

of nuclear staining is

compatible with what was

found in normal kidneys

from individuals in their

eighties.

Nephrol Dial Transplant (2003)

18: 2474–2478

Two cellular senescence in renal cells: ‘replicative senescence’ and ‘STASIS’. The

short dysfunctional telomeres will trigger a DNA damage response by activation of

p53. p53 leads to cell-cycle arrest via its main transactivational target p21CIP1/WAF1.

Environmental stresses leads to increase p16INK4a that activate ‘p16/Rb pathway’.

P16INK4a inhibits the activity of the cyclin-dependent kinases (CDKs) 4 and 6,

thereby leading to hypophosphorylation (hypo-P) of retinoblastoma (Rb) and

irreversible cell-cycle arrest (STASIS).

Nephrol Dial Transplant (2003) 18: 2474–2478

Hilary Cronin and Rose Anne Kenny

Part 2: The Aging Kidneys

Morphological and Functional Changes

Gross granularity

and pitting of the

external surface

Loss of Mass &

Loss of Function

But with preserved

homeostasis

Microscopic Changes:‘arterionephrosclerosis of aging’

A diagnosis of exclusion; biopsy (>55 years):

glomerulosclerosis (10% in <40 ! Or = (age/2)-10

IF/TA

• Vascular sclerosis: fibrointimal & medial sclerosis of cortical

arteries & arteriolosclerosis of interlobular/arcuate arteries.

• Cortical nephrons: ischemic changes (tuft lobulation,

mesangium, capillary collapse & obliteration. Hyaline

deposits in residual glomeruli).

• Peritubular capillary density decreased ( low proangiogenic

vascular endothelial growth factors)

• GBM & TBM thickening with reduction of vascular channels

& shunting of blood from afferent to efferent arterioles of the

juxtamedullary glomeruli with adequate blood flow to the

renal medulla.

Sharon Anderson

KI (2008) 74, 710–720

Global glomerulosclerosis

Moderate IF/TA

Arteriolar reveal hyalinosis

Brenner and Rector's The Kidney, 9th ed.

Arteriohyalinosis.

Fibrous intimal thickening

Tubular atrophy.

Lipofuscin pigment

Two markers: senescence-associated -galactosidase (SA– GAL) and accumulation of

lipofuscin granules.

Glomerulosclerosis

Brenner and Rector's The Kidney, 9th ed.

Interstitial fibrosis

combination of glomerulosclerosis,

TA & vascular changes

Artery of interlobular size showing

intimal thickening

J Pathol 2007; 211: 198–205

A normal glomerulus

Af. Arteriole.

Massive nonobstructive

hyaline deposit

Hypertrophic glomerulus with

massive dilatation of hilar capillary

Focal segmental

glomerulosclerosis

An ischemic glomerulus shows collapsing

capillary loops & small capillary lumens.

A hypertrophic glomerulus compensating for obsolete

glomeruli

J Pathol 2007; 211: 198–205

PATHOGENESIS OF RENAL

AGING”

Schema is complicated by

factors such as gender, eNOS

and inhibition, dietary factors &

the effect of aging-associated

genes such as klotho.

KI (2008) 74, 710–720

PATHOGENESIS OF RENAL AGING”The ‘arterionephrosclerosis of aging’

eNOS expression ?triggering inflammation ( & so focal

glomerulosclerosis and TA)

levels of the cell cycle inhibitor p16INK4a with age,

glomerulosclerosis, and IFTA

• Also, critical telomere shortening.

Factors that mediate fibrosis as AT II, TGF-β, AGEs,

oxidative stress, inflammation, and lipids, NO, Klotho,

vitamin D, the vitamin D receptor are evident in kidneys of

aging animals

PATHOGENESIS OF RENAL AGING”

Angiotensin II

• ATII glom. & tub. growth, NO synthesis, growth

factor induction, oxidative stress, inflammation,

apoptosis, and matrix proteins ( collagen-1 gene &

matrix metalloproteinase-1 gene).

• ATII downregulate Klotho gene expression (reversed

by losartan)!

• Hemodynamic effects of ATII maintain FP (eff. art.

Vasoconstriction).

• The arterial changes hypoxia/ischemia

upregulation of hypoxia-induced genes such as HIF,

VEGF, glucose transporter-1, and EPO (rat kidney

studies).

PATHOGENESIS OF RENAL AGING

Angiotensin II

• ATII stimulate profibrotic cytokines, TGF-β & collagen

IV & mediate NO inhibition & transcription of the

proinflammatory MCP-1 & PAI-1 levels ( proteolysis

and fibrinolysi)

• ACEI-treated (or ARBs) aged mice have in

glomerular area, mesangial area, and

glomerulosclerosis compared with untreated mice;

mediated by prevention of age-related in oxidative

stress & AGEs, in eNOS and Klotho.

AGEs & RAGE in the aging process

- AGEs are modifications of proteins, lipids, peptides, amino

acids and nucleic acids by carbohydrates ⁄ reducing sugars

structure & functional: enzymatic function, ligand binding..

- AGEs are formed during ageing as a physiological process,

but are enhanced in chronic diseases such as DM, CKD,

atherosclerosis, Alzheimer’s dis.

- AGEs and RAGE promote nuclear factor-k B activation and

expression of inflammatory genes in the aging kidney.

- Evidence for a direct role of AGE in causing kidney damage

is supported by many animal studies.

Glycation and crosslinking

implicated in progressive

diseases of aging:

vascular diseases (such as

atherosclerosis, systolic

hypertension, pulmonary

hypertension, and poor

capillary circulation), erectile

dysfunction, kidney disease,

stiffness of joints and skin,

arthritis, cataracts,

retinopathy, neuropathy,

Alzheimer's Dementia,

impaired wound healing,

urinary incontinence,

complications of diabetes,

and cardiomyopathies (such

as diastolic dysfunction, left

ventricular hypertrophy, and

congestive heart failure)

Red

uci

ng A

gen

ts

DT

T, B

ME

Lymphocytes in

culture, add

reducing agents

to medium:

(break disulfide

bonds)

senescent

cells divide

again

AGEs & RAGE in the aging process

• AGE intracellular generation of ROS (reciprocal process)

ROS activate signaling pathways as protein kinase C

leading to proinflammatory and profibrotic effects

• The kidney plays an important role in the clearance and

metabolism of AGEs and serum AGE concentrations

increase in chronic renal insufficiency, partly by an increase

in oxidative and carbonyl stress.

• AGE deposition in the kidney is associated with increased

MM, increased BM thickening, increased vascular

permeability, and induction of PDGF and TGF-β, resulting

in glomerulosclerosis and tubulointerstitial fibrosis.

Cascade of events in

cellular injury produced

by AGE

Clin J Am Soc Nephrol 1: 1293–1299, 2006

Effect of a low-glycotoxin diet on glomeruli and renal function in mice: (A)

with diet containing normal high levels of AGEs (RegAGE), and (B) after low-

AGE diet (LowAGE) (n = 6 per group). C, Fractional mesangial volume. D,

TGF-β levels. E, Collagen type IV) messenger RNA (mRNA) levels. F, uACR Am J Pathol 170[6]:1893-1902, 2007. Brenner and Rector's The Kidney, 9th ed.

• Renal biopsy from a patient with diabetic nephropathy stained for

imidazolone. There is a strong deposition of AGEs in the tubules as

well as in the glomerular mesangial area and in endothelial cells

• European Journal of Clinical Investigation Vol 40

Studies on AGE Content in Foods

J Am Diet Assoc. 2010;110:911-916

Oxidative stress:

• Predominant cellular free radicals (normal products of

metabolism) are: superoxide (O2-), hydroxyl (OH-), nitrogen

dioxide (NO2), hydrogen peroxide (H2O2)

• Damage to mitochondria DNA, protein processing and

cellular metabolism leading to: Loss of cellular phenotype,

necrosis, apoptosis

• vitamin E–enriched diet fed to aged rats, markers of

oxidative stress, RPF and GFR, & glomerulosclerosis.

• Studies indicate that ACEI can increase antioxidant enzyme

activity and block TGF-β ?induction by ROS.

Calorie Restriction

• CR (25% to 45% reduction) assoc. with extended life of

animals & age-related proteinuria & glomerulosclerosis

in rats

• CR in rhesus monkeys age-related diseases: insulin res.,

atherosclerosis, DM, cancer, CVD, and brain atrophy, and

immune dysfunction

• CR studies in humans: similar beneficial effects on health

(longevity unknown)

CR reduces aging-related proteinuria in male rats; severe food

restriction (12.5 Kcal/day) initiated at a young age abolishes the steep

rise in protein excretion with aging.

Physiological Basis of Aging and Geriatrics

Calorie Restriction: Potential mechanisms

(1) body fat content,

(2) metabolic rate,

(3) oxidative stress: What about CR+high AGEs?

(4) inflammation,

(5) modulation of mitochondrial function,

(6) activity of sirtuins in most tissues, including the

kidney,

(7) AMP–activated protein kinase (AMPK) signaling,

and

(8) mTOR and S6K1 (ribosomal protein S6 kinase1)

signaling.

Sirtuin mediates histone deacetylase activity. This

deacetylation controls the activity of various proteins

and genes that regulate cell survival, differentiation,

metabolism, DNA repair, inflammation, and longevity.

Several studies have shown that SIRT1 activity is

increased in most tissues, including the kidney, in

response to CR.

Sirtuins

• SIRT1 knockout mice are resistant to the effects of a

calorie-restricted diet. Mice treated with resveratrol, the

synthetic activator of SIRT1, also display the transcriptional

aspects of CR, including protection against age-related

renal disease

• SIRT1 activity controls the activity of various proteins and

genes that regulate cell survival, differentiation, metabolism,

DNA repair, inflammation, and longevity.

• Recent studies indicate a complex regulation of metabolic

pathways in response to CR that integrates the effects of

CR on insulin release, AMPK, SIRT1, and FOXO

activation as well as inhibition of mTOR175-177.

Interestingly these metabolic effects are similar to the

effects of exercise and fasting, which also regulate

AMPK, SIRT1, PPAR γ ?coactivator 1α ?(PGC-1α), and

FOXO activity

The Klotho gene • Expressed in distal tubules; present in the circulation and

urine; supressed by ROS

• Associated c suppression of premature aging and

arteriosclerosis, p. tubular phosphate re-absorption

• Suppresses phosphate reabsorption by directly binding to FGF receptors, Inhibits 1-alpha 25 hydroxylase & so

decreases calcitriol levels

• Both FGF23 and klotho ablated mice develop extensive vascular and soft tissue calcification

7-week-old normal mouse (left) and a klotho mouse, an animal model that shows multiple phenotypes resembling human aging

• FGF23+Klotho act with PTH to reduce iP re-absorption. But,

FGF23+Klotho inhibit calcitriol synthesis (PTH stimulates). FGF23

is inactive in absence of klotho.

• In ESRD, inhibition of tubular iP re-absorption by both PTH and

FGF23+ Klotho becomes ineffective. PTH secretion leads to

excessive iP release from bone with hyperphosphataemia. Nephrol Dial Transplant (2007) 22: 1524–1526

Factors that mediate and moderate age-related

glomerulosclerosis and tubulointerstitial fibrosis.

Brenner and Rector's The Kidney, 9th ed.

J Am Soc Nephrol 21: 1436–1439, 2010

• `Aging induces cell

senescence. Stresses,

as oxidative stress &

mitochondrial injury

induce SIPS through the

p16/retinoblastoma

pathway or ARF/p53

pathway. Senescent

cells have arrested

growth secrete altered

levels of growth factors

and therefore have

increased sensitivity to

injury and decreased

repair after injury.

Clin Geriatr Med 25 (2009) 331–358

• Age‐associated

decrease in GFR

is due to

reduction in RPF

and in Kf (UF

coef)

Age and ERPF

(ml/min) & GFR of

males and females:

Absolute ERPF fall

of 87/ decade in

males vs.11 ml/min

per decade, (P 1⁄4

0.0039).

The fall in GFR of

8.7/decade in

males vs.1.4 in

females (P 1⁄4

0.0074).

The fall in relative

ERPF of 90 per

decade 13 in

Females per

decade, P 1⁄4

0.0008)Nephrol Dial Transplant (2006) 21: 2577–2582

the relationship between age and the FF (%) of

males and females.Nephrol Dial Transplant (2006) 21: 2577–2582

Influence of age at

donation on change

in natriuretic

response to acute

saline load in kidney

donors after

uninephrectomy.

Red circles indicates

normotensive; blue

circles indicates de

novo hypertensive.

Age and H conc. & Bicarb:

lower net acid excretion in

elderly, Plasma bicarbonate

and blood pH change as GFR

changes with age. Plasma

chloride reciprocally increases,

as seen in renal tubular

acidosis or early renal disease.

Decreased ammonium

excretion is noted with aging.

Brenner and Rector's The Kidney,

9th ed.

Sharon Anderson

Sharon Anderson

Urinary Concentration

• Investigations suggest that both volume and osmotic

stimulation of AVP remain intact with age, with

osmoreceptor sensitivity for AVP actually enhanced in the

elderly. Impaired intrarenal AVP response suggested. aged

rats have Na- K-2CL cotransporter and decreased cortical

abundance of epithelial sodium channel. Although restricted

water intake increased the abundance of both NCCK2 and

Na-Cl cotransporter in aging rats, the response remains

significantly blunted. Taken together, these findings imply

that aging can impact both ascending limb solute transport

and collecting tubule water transport.

AKI• Incidence 6.8% to 36%.

• Pre-renal, Renal, and Postrenal

• The leading cause was volume depletion, followed by

nephrotoxic drugs, obstructive uropathy, shock (sepsis

and cardiac), and a combination of several factors. In the

elderly, the combination of several causes is very

common, making up about 20–25% of the AKI in this

population in some studies

The recovery is less frequent and slower

The Most Common Renal Pathology in an Acute

Geriatric Unit

AKI• Incidence 6.8% to 36%,

mortality rate to 50–60% as in other age groups..

• Pre-renal, Renal & Postrenal

• Combination of several causes

is very common (20–25%)

• The recovery is less frequent

and slower

The Most Common Renal Pathology in an Acute

Geriatric Unit

Urinary Tract Infection

• Most common cause of bacterial sepsis in older adults.

60% recurrence after an initial UTI.

• Factors: low pH, micturition dysfunction, obstruction, cell-

medicated immunity, UT abnormalities, and hormonally

dependent changes in vaginal pH, immune system

changes, immobility, comorbidities (DM, cancer, chronic

renal failure)..

• Atypical symptoms such as altered mental status, newly

developed incontinence, urinary retention, or functional

deterioration may be the way of presentation.

• UTIs more easily result in bacteremia, decreased functional

status, and death. (? systemic antimicrobial Rx)

Obstructive Uropathy

• Prostate disease is by far the main cause of low

obstructive uropath in men. Other diseases: Lithiasis,

bladder tumors, neurogenic bladder, and abdominal and

pelvic tumors.

• initially reversible but can lead to irreversible renal failure.

Obviously, therapy will depend on etiology.

• Nephostomy and/or the placement of a vesico-ureteral or

suprapubic catheter an indispensable initial therapy, prior

to finding a permanent solution when possible.

http://lenol66.files.wordpress.com

one trait that :

Optimism

• One trait:

• Surrender happily

to the Creator’s

will

• Thank You

• For You All

• The genome: 3 billion nucleotide

bases (A, C, T, and G). . over

150,000 book pages (The writer?!)..

Disease is often caused by one

letter in 150,000 pages different!

• Around 30,000- genes encoding

more than 100,000 proteins (alternative splicing)

• Almost all (99.9%) bases are

exactly the same in all people.

• Unknown functions for > 50% of

discovered genes.

• 0.1% (100-99.9) difference makes

humans differences. Human

genome is contain 10 million SNPs

Introduction: The Human Genome

Guttmacher A and Collins F. N Engl J Med 2002;347:1512-1520

Alternative Splicing

Types of Mutations that lead to Cancer

• Mutations to proto-oncogenes --> leading to oncogenes, or insertions of oncogenes (genes involved in cell growth and development; growth factors, growth factor receptors etc)

• Mutations to tumor suppressor genes (e.g. Trp53; Genes whose products block abnormal growth)

• Mutations to DNA repair genes (mismatch repair etc)

• Telomere shortening leading to chromosome instability and gene deletions

Genetic Theory: Programmed Aging

Many phenomena in animal lives are genetically programmed. the CLK-1

gene, which contributes to the synthesis of co-enzyme Q (ubiquinone) in the

mitochondrial respiratory chain. Overexpression of CLK-1 increases the rate

of oxidative phosphorylation and reduces life expectancy.

Sequential Inactivation of Reiterative Genes

cellular aging is due to the existence of genes with several copies in different

locations on the genome.. cellular aging develop by the inactivation or injury

of the last ( but many proteins codified by a single gene).

Telomere Shortening

Terminal Differentiationgenes induced by successive cellular divisions, codify proteins that inhibit the

entrance to phase S of the cellular cycle or a reduced proteins capable of stimulating

cellular proliferation (fibronectin in fibroblasts, IL-1 in endothelial cells).

Mixed Theory

Oxidant–Antioxidant Balance:

• ROS damage macromolecules within cells. But antioxidants

do not modify the rate of aging.

• ROS production is mainly in mitochondria (90% of O2

consumption and least DNA repair mechanisms) has

inverse relation among species longevity

• Long-term caloric restriction (1 year) in rats

decreased(heart, liver, kidney and skeletal ms.)

mitochondrial ROS production by 50% also decreased the

oxidative damage to mitochondrial DNA, without affecting

the oxidative damage to nuclear DNA. So, lowering the

production not adding external antioxidants is the protection

• Oxygen free radicals generated as a function of metabolic

rate cause cumulative oxidative damage, resulting in

structural degeneration, functional decline, and age-related

p16

• Cyclin-dependent kinase inhibitor 2A, (CDKN2A,

p16Ink4A) also known as multiple tumor suppressor 1

(MTS-1), is a tumor suppressor protein, that in humans is

encoded by the CDKN2A gene.[1][2][3] P16 plays an

important role in regulating the cell cycle, and mutations in

p16 increase the risk of developing a variety of cancers,

notably melanoma.

PATHOGENESIS OF RENAL

AGING”

It is not clearly understood (?role

of cumulative toxins & Diseases

effects).

Replicative senescence and

oxidative stress are the major

identified factors.

These factors & renal diseases

ultimately lead to renal arterial

sclerosis hypoxic/ischemic ilieu

aging-related glom. sclerosis,

IF/TA RAAS hypertension

renal ischemia cycles. Schema is

complicated by factors such as

gender, eNOS and inhibition,

dietary factors & the effect of

aging-associated genes such as

klotho.

KI (2008) 74, 710–720

For review only

The ‘arterionephrosclerosis of aging’

• Altered endothelial nitric oxide synthase (eNOS)

expression may be the trigger for the inflammation (

& so focal glomerulosclerosis and TA)

• increased levels of the cell cycle inhibitor p16INK4a

with age, glomerulosclerosis, and IFTA

• Also, critical telomere shortening.

• Alterations in the activity of factors that mediate

renal fibrosis, such as AT II, TGF-β, NO, AGEs,

oxidative stress, inflammation, and lipids, as well

factors that prevent fibrosis, such as Klotho, vitamin

D, the vitamin D receptor, and the farnesoid X

receptor (FXR), are also evident in kidneys of aging

animals

Examples of biological

relevant AGE structures

Eur J Clin Invest 2010; 40 (8): 742–755.

The Nobel Prize in Physiology or

Medicine 2009 jointly to

Elizabeth H. Blackburn, Carol W. Greider and Jack

W. Szostak

for the discovery of

"how chromosomes are protected by telomeres and

the enzyme telomerase”

Clin J Am Soc Nephrol 5: 936–942, 2010

Cell senescence in rat kidneys in vivo increases with growth and

age despite lack of telomere shortening.

• Expression of mRNA for

p16INK4a, a characteristic

senescence gene in vitro, was

undetectable in most young rats

but rose 27 fold during growth

and a further 72-fold during

aging.

• Kidney International, Vol. 63 (2003), pp.

2134–2143