View
244
Download
1
Category
Preview:
DESCRIPTION
MSc Thesis Molecular Biology
Citation preview
Vrije Universiteit Brussel Katholieke Universiteit Leuven
Universiteit Antwerpen
Interuniversity Program Molecular Biology (IPMB)
Mechanism of Action of Doc (Death on Curing) from Phage P1
Thesis submitted in partial fulfillment of the requirements for the Degree of Master of Molecular Biology
ZEGEYE HAILU JEBESSA
Promoter: Prof. Dr. Ir. Remy Loris Structural Biology Brussels Faculty of Science and Bioscience Engineering Vrije Universiteit Brussel
Supervisor: Drs Abel Garcia-Pino Structural Biology Brussels
Faculty of Science and Bioscience Engineering. Vrije Universiteit Brussel
Academic year 2008-2009
i
Acknowledgements
I realized finally “No pain No gain”
First and foremost, I thank God for the passion and courage he put inside me to confront all the difficult moments.
My two years study for Master of Molecular Biology is coming to an end. When I remembered the first year, with that much courses, number of professors and sinusitis/Asthma/PC screen reflection creating trouble to my eye, hard but memorable. The second year, it is similar feeling when I have been working in the lab of structural biology being with Medicine background and those bunch of courses but here gastritis was my new syndrome that joins the already exciting sinusitis/asthma.
It is with great feeling that I acknowledge the assistance I have received from many individuals. The length of the list of those who deserve credit makes it impractical to name individuals.
My sincere gratitude goes to my promoter Prof. Dr. Ir. Remy Loris for welcoming me to his lab, and for meticulous comment and correction of my thesis. Your comments are priceless and you made me to think carefully about biology before dealing it. I owe also a special recognition to Dr. Ir. Lieven Buts who were always there at times of my confusion at every corner of the lab. You deserve credit “Bayyee Galattoomii”. I extend my sincere acknowledgement to my supervisor Drs. Abel Garcia-Pino for the guidance and friendly approach. I would also like to thank Ir. Yann, Matia, Radu (Think positive and Possible), Dr. Ir. Natalie, Dr. Ir. Koen, other members of TA group and SBB for courage, support and friendship you gave me during my stay. I can’t forget to thank Ir. Adinda for her kindness and realization of difficulties for people when they are new “Kabaja Guddaan siif qaba”.
I am so grateful to all of you: Prof. Dr. Van Driessche Edilbert for all of your positive concern and answering my queries positively; Rudi Willems, you deserve the most for making life easier in IPMB “No One Died Ever Before” and Greta Verhasselt for updating us with every news of IPMB.
I would also like to thank VLIR for financial assistance during the study period.
Wada Z. you are always circulating in my blood though I weren’t there to take care of you. I owe a special recognition to my Mom without whose assistance my achievements would have been impossible and of course my Dad. I am also grateful to Mes “Me@Ze” Shania.
ii
Abstract
Toxin-antitoxin (TA) modules are diverse and present on plasmid and chromosome of almost all
prokaryotes. They are composed of closely linked genes encoding a stable toxin that can harm the cell
and relatively non-stable partner antitoxin, which protects the cell from the toxin life harming effect.
Toxins, described so far, are known to interfere with vital cellular processes such as replication and
translation targeting DNA gyrase and mRNA or ribosomes respectively. Antitoxin abrogates the
poisoning effect of the toxin through non-covalent protein-protein contact forming a complex.
Accidental release of the toxin from the complex lead to either cell death or growth arrest. Due to this
fact the toxin is considered as a molecular time bomb. Even though the biological function of these
modules is an ongoing debate, their molecular architect and properties are starting to get elucidated
and it seems that these characteristics are conserved across all described TA systems.
Phenomenons of medical significance such as biofilm formation, bacterial persistence during
antibiotic treatment, and bacterial pathogenesis have already been implicated to TA systems. TA
systems owned by pathogens also becoming an attractive antibiotic target.
One of the several TA systems described so far include the phd/doc locus of bacteriophage P1 that
represents the plasmidic form of addiction module. The phd/doc locus of bacteriophage P1 encodes
the toxin Doc (Death on curing) and antitoxin Phd (Prevent host death). Antitoxin Phd has two
distinct functions: it auto regulate transcription from its own operator and protect the cell from the
toxin Doc. Site directed mutagenesis was employed to generate several selected Doc mutants believed
to be associated with its functional activity, cloned into expression vector pET-21b, expressed and
purified, and used for in vitro toxicity assay.
Bacteriophage P1 encoded Doc has previously been described as a protein that mediate efficient cell
growth arrest and mimicked mechanism of action of the aminoglycoside antibiotic hygromycin B in
which both targets 30s ribosomal subunit to inhibit translation and induce growth arrest. Consistent
with this finding our in vitro Doc toxicity experiment demonstrated that Doc inhibit translation
efficiently. Immediate (together with Doc) or later addition of Phd correspondingly neutralized and
reversed Doc induced in vitro translation inhibition. Furthermore, 1:1 complex formation between the
partners was found to be enough for neutralization and reversal of Doc toxicity contrary to the already
described heterotrimeric complex formation (P2D) for Doc inactivation. Residue A61 and H66 on Doc
found to be associated with functional activity of Doc.
iii
List of Abbreviations
AEBSF 4-(2-Aminoethyl) benzenesulfonyl fluoride hydrochloride
BCIP 5-Bromo-4-chloro-3’-indolyphosphate P-toluidine
Bis-Tris Bis(2-hydroxyethyl)-imino-tris(hydroxymethyl)-methane
CaCl2 Calcium chloride
CAPS N-cyclohexyl-3-aminopropane sulphonic acid
CD Circular dichroism
Doc Death on curing
EDTA Ethylenediaminetetraacetic acid
GdHCl Guanidine hydrochloride
HCl Hydrochloric acid
His Histidine
IgG Immunoglobulin G
IMAC Immobilized metal affinity chromatography
IPTG Isopropyl β-D-1-thiogalactopyranoside
LB Luria-Bertani
MES 2-(N-morpholino)ethanesulfonic acid
MgCl2 Magnisim chloride
NaCl Sodium chloride
NaOH Sodium hydroxide
NBT Nitro-blue tetrazolium chloride
PBS Phosphate buffered saline
PCR Polymerase chain reaction
Phd Prevent host death
ppGpp Guanosine tetraphosphate
SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis
TA Toxin-Antitoxin
TBE Tris/Borate/EDTA
Tris Tris(hydroxymethyl)aminomethane
iv
Table of contents
Acknowledgements .............................................................................................................. i
Abstract ............................................................................................................................... ii
List of Abbreviations ......................................................................................................... iii
1. Introduction ..................................................................................................................... 1
2. Toxin-Antitoxin (TA) Modules ...................................................................................... 3
2.1 Discovery of TA Loci ............................................................................................... 3
2.2 General Common Properties of Toxin-Antitoxin Modules ...................................... 3
2.2.1 Families of TA Modules .................................................................................... 3
2.2.2 Genetic Organization and Regulation of Transcription of TA module ............. 4
2.2.3 Structural and Functional Similarities of TA Module ....................................... 8
2.2.4 Features of Toxin and Antitoxin ........................................................................ 9
2.3 Phyletic and Phylogenetic Distribution of TA Modules......................................... 11
2.4 Biological Functions of TA Loci ............................................................................ 12
2.4.1 Programmed Cell Death ................................................................................... 13
2.4.2 Plasmid Stabilization. ...................................................................................... 15
2.4.3 Stabilization of Mobile Genetic Elements (Transposons) ............................... 17
2.4.4 Selfish Genes ................................................................................................... 18
2.4.5 Stress-Response ............................................................................................... 18
2.5 Phd/Doc Toxin-Antitoxin Module from Bacteriophage P1.................................... 20
2.5.1 Interaction between Phd and Doc .................................................................... 21
2.5.2 Cellular Targets of Doc Toxin ......................................................................... 25
3. Aim of the Work ........................................................................................................... 27
4. Materials and Methods .................................................................................................. 28
4.1 Materials ................................................................................................................. 28
4.1.1 Bacterial Growth Media ................................................................................... 28
4.1.2 Bacterial Strains ............................................................................................... 28
4.1.3 Cloning and Expression Vector ....................................................................... 28
4.1.4 Oligonucleotides .............................................................................................. 29
4.1.5 Used Kits .......................................................................................................... 31
4.1.6 Enzymes and Antibodies ................................................................................. 31
4.1.7 Molecular Weight Markers .............................................................................. 32
v
4.1.8 Stock Solutions ................................................................................................ 33
4.2 Methods .................................................................................................................. 34
4.2.1 Cloning and Mutagenesis. ................................................................................. 34
4.2.1.1 Purification of Plasmid DNA. ....................................................................... 34
4.2.1.2 Amplification and Cloning of phd/doc to PET-21b Vector. ......................... 34
4.2.1.3 Site Directed Mutagenesis ............................................................................ 35
4.2.2 Expression and Purification of Wild Type and Mutant Doc, and Phd .............. 38
4.2.2.1 Expression ................................................................................................... 38
4.2.2.2 Purification .................................................................................................... 39
4.2.2.3 SDS-PAGE Analysis .................................................................................... 40
4.2.3 Growth Assay .................................................................................................... 41
4.2.4 In Vitro Translation Assay/Cell Free Expression System ................................. 41
4.2.4.1 Western Blotting ........................................................................................... 42
4.2.5 Circular Dichroism ............................................................................................ 42
5. Results ........................................................................................................................... 43
5.1 Cloning of Phd/doc into pET-21b Vector and Mutagenesis .................................. 43
5.1.1 Construction of PAG2-2 Vector ...................................................................... 43
5.1.2 Isolation of Mutations in doc that are Used for In Vitro Toxicity Assay ........ 43
5.2 Expression and Purification of Phd, Doc, DocH66Y and DocA61R ..................... 45
5.3 DocH66Y Reduces Cell Growth In Vivo ................................................................ 47
5.4 Doc Inhibits Translation In Vitro ............................................................................ 48
5.5 Phd Neutralizes Doc In Vitro .................................................................................. 49
5.6 DocA61R and DocH66Y do not Inhibit Translation In Vitro ................................ 50
5.7 DocH66Y and DocA61R Possesses Definite Secondary Structure ........................ 51
6. Discussion ..................................................................................................................... 52
7. References ..................................................................................................................... 55
Mechanism of Action of Doc (Death on Curing) from Phage P1
1. Introduction
Prokaryotic organisms can be referred as true champions for adaptation and survival
under an impressive variety of conditions and these capabilities never ceased to amaze
the scientific community. Bacteria and Archaea have developed multiple metabolic
strategies to inhabit several niches and utilize various organic and inorganic substrates as
sources of energy. The basis for this extreme rich metabolic diversity most probably lies
on the flexibility of their genomes (Salyers & Whitt, 2002a). Besides vertical gene
transfer, the genetic content of prokaryotes can also be altered through horizontal gene
transfer mechanisms such as conjugation, transduction and transformation (Perry et al.,
2002). These combined factors make it relatively easy for bacteria and archaea to adapt
themselves to several external stimuli and (extreme) selective pressure. One of the
arsenal of these organisms to cope with various environmental challenge involve toxin-
antitoxin module.
At the beginning of the 1980’s, an operon that couples plasmid proliferation with cell
division was identified on the F-plasmid of the bacterium Escherichia coli (Ogura &
Hiraga, 1983) and was subsequently named ccd. Soon thereafter, it was discovered that
Ccd acts by killing cells that become plasmid-free (Gerdes et al., 1986). Many operons
with a similar architecture and capable of stabilizing plasmids have since been identified
and have been named ‘toxin-antitoxin (TA) modules’. They are present on plasmids and
chromosomes of most if not all prokaryotes and research stretching over the past decades
indicates that they play a key role in prokaryotic stress physiology (Gerdes et al., 2005).
TA modules comprise a large group of toxin and antitoxin gene, where the toxin gene
codes the toxin and antitoxin gene codes antitoxin. On the basis of the antitoxin gene they
are distinguished in two types: type I and type II. In type I the antitoxin is antisense RNA
(Gerdes & Wagner, 2007) and in type II the antitoxin is protease sensitive protein (Butts
et al., 2005; Gerdes et al., 2005). Antitoxin protect the cell from toxin action either by
inhibiting the translation of toxin gene by antisense RNA of the antitoxin or sequestering
the toxin via complex formation between partner toxin-antitoxin protein (Gerdes et al.,
1997; Zielenkiewicz & Ceglowski, 2001; Hayes, 2003; Butts et al., 2005; Gerdes et al.,
Chapter 1: Introduction 2
Mechanism of Action of Doc (Death on Curing) from Phage P1
2005; Gerdes & Wagner, 2007). The subject of this master thesis focuses on the second
type.
When bacterial cell acquire a plasmid with a functional TA locus basal level expression
of both the toxin and partner antitoxin is guaranteed and keeping the cell safe from toxin
action. As long as the cells retain at least single copy of plasmid, this situation remains as
it was. When the cell loses plasmid, either fresh toxin or fresh antitoxin will not be
produced and the balance between the toxin and its partner antitoxin get perturbed and
the fate of the cell is dictated by pre-existing toxin-antitoxin complex. The antitoxin has
short in vivo life span while the toxin relatively owns longer in vivo life span. This
situation leaves plasmid cured cell undefended from the toxin action. The stable toxin can
attack its target in cells thereby inhibiting cell growth and ultimately killing the cell.
These mechanisms ensure the retention of the plasmid in the population and thus confer
an advantage to plasmid-retaining cells by reducing the competitiveness of their plasmid-
free counterparts (Hayes, 2003).
The bacterial TA system has recently attracted the attention of many researchers because
of new insights that have been acquired into these events and wide spread distribution
both on plasmids of medical importance and on bacterial chromosomes (Engelberg-Kulka
& Glaser, 1999; Gerdes, 2000; Zielenkiewicz & Ceglowski, 2001; Hargreaves et al.,
2002; Grady & Hayes, 2003; Meinhart et al., 2003).
One of these TA modules includes the 1993 discovered prophage P1 owned phd/doc
locus and will be the subject of my master thesis. Although the regulation and
biophysical properties of this TA module have been studied very well, the killing
mechanism is remained to be elucidated. The theme of the work would be to investigate
in vitro toxicity of Doc and complement this result with existing in vivo studies in order
provide a clue on killing mechanism of the Doc toxin.
Mechanism of Action of Doc (Death on Curing) from Phage P1
2. Toxin-Antitoxin (TA) Modules
2.1 Discovery of TA Loci
Intuitively, it seems likely that cells that rapidly adjust the rate of DNA and protein
synthesis in response to extreme amino-acid starvation would better adapt to stressful
condition. Prokaryotes own TA loci on their genomes that might fulfill this function.
These TA loci are widely distributed on plasmids and chromosomes of bacteria and
archaea. Although database mining has shown that TA loci are ubiquitous in free-living
prokaryotic cells (Pandey & Gerdes, 2005), they were first discovered on plasmid where
they referred as plasmid-borne ‘killer’ genes. These ‘killer’ genes are involved in plasmid
maintenance. Obviously, chromosomal TA loci do not function to stabilize plasmids.
Eventhogh they are still under study, for determination of exact biological function, the
loci are proposed to play a key role in a prokaryotic stress physiology (Gerdes et al.,
2005).
Like eukaryotic chromosome, bacterial plasmids have centromeres, which function to
segregate plasmid molecules prior to cell division (Gerdes et al., 2005). However,
plasmids also encode maintenance loci whose gene products are activated in plasmid-free
cells. These loci function to prevent the proliferation of plasmid-free progeny (Ogura &
Hiraga, 1983; Gerdes et al., 1986), which increases plasmid maintenance in growing
bacterial cultures.
2.2 General Common Properties of Toxin-Antitoxin Modules
2.2.1 Families of TA Modules
Historically, the different proteic TA modules were categorized in to the following eight
families (Table 2.1.): the two component ccdBA, relBE, parDE, higBA, mazEF,phd/doc,
vapBC and the three component ω-ε-ζ (Gerdes et al., 2005; Pandey & Gerdes,2005;
Melderen & Saavedra De Bast, 2009). More recently, additional families of TA modules
have been described such as the hipBA locus of E.coli K-12, which is involved in
persister cell formation (Schumacher et al., 2009). Other families are apparently hybrids
with the toxin gene being related to the toxins of one of the nine classic families
Chapter 2: Toxin-Antitoxin (TA) Modules 4
Mechanism of Action of Doc (Death on Curing) from Phage P1
(including hipBA) but the antitoxin gene belonging to one of the other families. These
families are defined based on amino acid sequence homology (Pandey & Gerdes, 2005).
2.2.2 Genetic Organization and Regulation of Transcription of TA module
The genetic organizations of a few representative TA loci are shown in Fig 2.1. Table 2.1
gives an overview of the components of the nine classic TA modules. In general, the TA
loci are organized into operons in which the upstream gene encodes the antitoxin and the
downstream gene encodes the toxin (Gerdes et al., 1986; Gerdes, 2000; Zielenkiewicz &
Ceglowski, 2001; Butts et al., 2005; Gerdes et al., 2005). One exception to this rule is the
higBA family in which the upstream gene codes for the toxin (Tian et al., 1996; Budde et
al., 2007; Christensen-Dalsgaard & Gerdes, 2006). Both genes are translationally coupled
and transcription of both elements starts at a promoter sequence just upstream of the
antitoxin’s cistron (Gerdes et al., 2005). Transcription autoregulation occurs generally by
binding of the antitoxin or the toxin-antitoxin complexes within their own promoter
regions, which is responsible for regulating expression of both toxin and antitoxin. In
many cases, the toxins act as co repressors of transcription, indicating that a TA complex
binds to the operator sites. In general both toxin and antitoxin are essential for
transcription autoregulation since in most cases the antitoxin has no repressor activity by
itself (Fig 2.2) (Gotfredsen & Gerdes, 1998; Dao-Thi et al., 2000; Gerdes, 2000;
Marianovsky et al., 2001; Kamada et al., 2003; Mandl et al., 2006). An exception to
these general rules is ω-ε-ζ system where the ω dimer (ω2) regulates the transcription of
the toxin (Ζ) and the antitoxin (Ε) (de la Hoz et al., 2000).
Mutational analysis unveiled that the antitoxins bind to the DNA through their N-terminal
domain (Afif et al., 2001; Santos-Sierra et al., 2002; Lemonnier et al., 2004; Zhang et al.,
2003; Smith & Magnuson, 2004 ). These DNA binding domains can belong to any of
several common classes of DNA binding domains. The DNA binding motifs so far
described in antitoxins include the ribbon-helix-helix (RHH) motif (as also seen in the
MetJ/Arc/CopG repressors) of CcdA, RelB and ParD (Phillips, 1994; Raumann et al.,
1994; del Solar et al., 2002; Madl et al., 2006; Oberer et al., 2007), the AbrB-type fold of
MazE known as looped-hinge-helix (Vaughn et al., 2001; Kamada et al., 2003; Loris et
Chapter 2: Toxin-Antitoxin (TA) Modules 5
Mechanism of Action of Doc (Death on Curing) from Phage P1
al., 2003) and the helix-turn-helix (HTH) motif of HigA as also noticed in λ-cro (Gerdes
et al., 2005). In addition, Phd and YefM display a common fold that is not observed in
DNA binding proteins outside the TA world (Chemy & Gazit, 2004; Kamada &
Hanaoka, 2005). HipB exhibits DNA binding motifs similar to 434 Cro and C.AhdI
(Schumacher et al., 2009) belonging to the family Xre-HTH (helix-turn-helix). VapB
antitoxin exhibit DNA binding motif belonging to at least four different classes: HTH,
RHH, Phd/YefM and AbrB (Gerdes et al., 2005) (Table 2.2).
Table 2.1: The eight classic toxin- antitoxin gene families and ω-ε-ζ
TA Family
(locus)
Toxin Target of toxin Antitoxin Prote-ase Phyletic
Distribution
ccdAB CcdB Replication via DNA
Gyrase poisoning
CcdA Lon A
relBE RelE Translation via mRNA
cleavage
RelB Lon A, B, C
parDE ParE Replication via DNA
gyrase poisoning
ParD Unknown A, B
higBA HigB Translation via mRNA
cleavage
HigA Unknown A, B
mazEF Maz/PemK Translation via mRNA
cleavage
MazE/
PemI
Lon/ClpAP A, B
Phd/doc Doc Translation Via Ribosomes
binding
Phd ClpXP A, B, C
VapBC/Vag VapC Translation via
endoribonuclease action
VapB Unknown A, B, C
hipBA HipA Translation via EF-Tu
phosphorylation
HipB A
ω-ε-ζ Ζ Unknown Ε Unknown B
A-Gram negative; B-Gram positive; C-Archaea. Table Taken from Gerdes et al., 2005 and Van Melderen
& Saavedra De Bast, 2009.
Chapter 2: Toxin-Antitoxin (TA) Modules 6
Mechanism of Action of Doc (Death on Curing) from Phage P1
Figure 2.1: Genetic organization of the TA module. Toxin and antitoxins genes along with their products are labeled pink and blue respectively. The figure depicts the general genetic set up of the whole TA module and genetic organization of certain typical TA cassettes. Broken arrows indicate the cellular protease that can degrade the antitoxin either in free form in solution or in complex with the cognate toxin. The right ward arrows indicate the promoter region. Picture reprinted from Gerdes et al., 2005.
Figure 2.2: Negative feed back loop of transcription regulation of the TA module: This Schematic representation is typical for most of the TA module however, there are exception where the third gene involve in the regulation as in case of the three component ω-ε-ζ: where ω-involve in the transcrption regulation. The arced arrow stands for the translational coupling and arrows from the antitoxin/toxin-antitoxin complex indicates tanscriptional auto regulation after binding of the gene product in the own promoter region of toxin and antitoxin. Pictures adapted from Gerdes et al., 2005.
Chapter 2: Toxin-Antitoxin (TA) Modules 7
Mechanism of Action of Doc (Death on Curing) from Phage P1
Table 2.2: The DNA binding domains (antitoxin) of the Toxin-Antitoxin gene families
Toxin Family DNA binding protein (Antitoxin) DNA binding motifs in antitoxin
CcdB CcdA MetJ/Arc/CopG
Doc Phd Phd/YefM
HipA HipB Xre-HTH, 434 Cro, C.AhdI
(Schumacher et al., 2009)
HigB HigA cHTH
MazF MazE AbrB/MazE
ParE ParD MetJ/Arc/CopG
RelE RelB; YefM
MetJ/Arc/CopG; Phd/YefM
VapC PIN domain VapB MetJ/Arc/CopG;Phd/YefM;
cHTH; AbrB
Ζ ω MetJ/Arc/CopG
Table reproduced from Gerdes et al., 2005
The ratio of toxin to antitoxin regulates TA operon transcription. When the concentration
of antitoxin equals that of the toxin, there is enough antitoxin to counteract the action of
the toxin. In this case a toxin-antitoxin complex is formed that represses the transcription
from the operon promoter. At high toxin to antitoxin ratios, a different type of toxin-
antitoxin complex is formed that does not bind to operator DNA and allows for
transcription of the operon. This may happen under conditions where the antitoxin
concentration in the cell is still sufficiently high to avoid activation of the toxin, creating
a buffer against accidental toxin activation. A nice and well-studied example is the
regulation of the F-plasmid ccd module. The stoichiometry of CcdA-CcdB complexes
depends on the CcdA/CcdB ratio: if CcdB is in excess, a hexameric CcdA2-CcdB4
complex forms, and when CcdA is in excess, a tetrameric CcdA2-CcdB2 complex forms
(Afif et al, 2001; Dao-Thi et al., 2002, Dao-Thi et al., 2005). The tetrameric CcdA2-
Chapter 2: Toxin-Antitoxin (TA) Modules 8
Mechanism of Action of Doc (Death on Curing) from Phage P1
CcdB2 complex binds to operator DNA in vitro whereas the hexameric complex does not
(Afif et al., 2001). Moreover, addition of an excess of CcdB to the operator-bound
tetrameric complex destabilizes DNA binding. These results suggest that the CcdA/CcdB
ratio controls transcription of the ccd operon and also predict that elevated levels of CcdB
would stimulate ccd transcription (Afif et al., 2001). In vitro experiment revealed
destabilization of ParDE promoter complex by high ParE concentration (Johnson et al.,
1996). This possibility is further strengthened by the observation that high cellular levels
of Doc stimulate transcription of the phd/doc operon so that it replenishes the antitoxin
since it transcribes faster than its cognate toxin (Magnuson & Yarmolinsky, 1998).
2.2.3 Structural and Functional Similarities of TA Module
Even if the respective genes of different TA families are not homologous, all TA families
have a remarkable similar genetic organization (Gerdes, 2000). Crystal structure analysis
has until now revealed five different toxin folds. Remarkable is that the toxins from the
CcdB and MazF families display strikingly similar 3D structures despite having different
activities (Fig 2.3) (Loris et al., 1999; Kamada et al., 2003). These similarities suggest a
common ancestor (Buts et al., 2005; Gerdes et al., 2005). Similarly, the RelE and YoeB
families of toxins belong to the same family of microbial ribonucleases that also includes
RNase T1, Barnase and restrictocin (Kamada & Hanaoka, 2005; Takagi et al., 2005) (Fig
2.4). RelE apparently lacks some crucial active site residues and is an activator of
ribosomal endonuclease activity (Pedersen et al., 2003). In contrast, YoeB has intrinsic
RNase activity in agreement with a fully formed active site (Kamada & Hanaoka, 2005).
PIN domain fold is predicted to comprise toxins such as VapC (Arcus et al., 2004). The
PIN domain fold is entirely α-helical and unrelated to any of the above discussed toxin
families but posses significant similarity with RNase H from phage T4 (Buts et al.,
2005).
Chapter 2: Toxin-Antitoxin (TA) Modules 9
Mechanism of Action of Doc (Death on Curing) from Phage P1
Figure 2.3: Crystal structure of the dimeric toxins CcdbB, MazF and Kid. Regardless of their functional difference CcdB and MazF family exhibit remarkable structural similarity having the same kind of fold and form the same type of dimer. Toxin Kid from Plasmid R1of E.coli is homolog of the chromosomal toxin MazF. Picture adapted from Buts et al., 2005.
Figure 2.4: Toxins with Ribonuclease folds: The figure depicts the striking structural similarity exhibited by RelE, YoeB with microbial RNase fold that higly resemble RNase T1 of Aspergillus Orygae. β-Strands and α-helices are colored red and yellow respectively placed in identical orientation relative to their homologues. The green color represents the 2´guanosine monophosphate bound in the active site of RNase T1. Picture adapted from Buts et al., 2005.
2.2.4 Features of Toxin and Antitoxin
It is well described that TA systems rely on the difference in in vivo lifetime of the toxin
and cognate antitoxin which is either protein or antisense RNA. Toxins from the given
operon are highly resistant to a given protease while the cognate antitoxin from the same
operon are degraded by specific protease such as Lon, ClpXP or ClpAP shortly after their
Chapter 2: Toxin-Antitoxin (TA) Modules 10
Mechanism of Action of Doc (Death on Curing) from Phage P1
translation, antitoxin has short life span, the phenomena that allows the toxin to exert its
action on the target and induce arrest or death of the cell. Susceptibility of antitoxin to
protease seems to results from a combined effect of low thermodynamic stability and
intrinsically unfolded domain of the antitoxins while they are in their free form.
The toxin is either monomeric or homodimeric and exerts its toxic function by interacting
with a cellular target that is usually associated with replication, as in case of CcdB and
ParE (Critchlow et al., 1997; Maki et al., 1992; Gerdes et al., 2005) or translation,
although through different mechanism, as in case of MazF, RelE, HipA, VapC, HigB and
Doc (Christensen & Gerdes, 2003; Pedersen et al.,2003; Zhang et al., 2003; Butts et al.,
2005; Gerdes et al., 2005; Zhang et al., 2005; Budde et al., 2007; Liu et al., 2008;
Schumacher et al., 2009) (Table 2.1). The proteic antitoxin, always a homodimer,
consists of two domains and often smaller than its toxic partner. The intrinsically well
ordered N-terminal DNA binding domain and the intrinsically unordered C-terminal
domain that become ordered up on binding to the toxin. The then complex formed
between toxin-antitoxin is functionally non-toxic than when it appears in its (the toxin)
free form. In other words, binding of antitoxin to the toxin partner will free the cell from
the poisoning effect of the toxin thereby assures the survival of the cell. The complexes
are formed by non covalent protein-protein contact. The mechanism by which antitoxin
abrogates toxin action involve one of the following different ways: the C-terminal part of
the proteic antitoxin (i) binds to the active site of the toxin (e.g. mazEF; Kamada et al.,
2003), (ii) binds to a site where normally a co-factor binds, the co-factor is needed for the
toxin’s action (e.g. ω-ε-ζ; Meinhart et al., 2003), (iii) allosteric binding of the proteic
antitoxin at a site different from the active site or co-factor binding site ( e.g. ccdAB;
N.De Jonge, oral communication), (iv) steric exclusion of the toxin from its cellular
target by extensive wrapping of the entire antitoxin around the toxin or fold
complementation (relBE; Takagi et al., 2005; phd/doc; Garcia-Pino et al., 2008) or (V)
by extensive interaction between the partners with N and C- terminal domains that locks
the enzyme/toxin in to inactive open conformation (hipBA; Schumacher et al.,2009).
Chapter 2: Toxin-Antitoxin (TA) Modules 11
Mechanism of Action of Doc (Death on Curing) from Phage P1
2.3 Phyletic and Phylogenetic Distribution of TA Modules
Exhaustive search for two domain TA loci using BLASTP and TBLASTN from fully
sequenced genomes of 126 bacteria and archaea for their content of members belonging
to any of known TA families has revealed significantly reasonable number of loci. The
search identified 671 complete TA loci and 37 toxin genes without closely linked
antitoxin gene named solitary toxin gene (Table 2.3). Some TA modules were discovered
both in bacteria and archaea genome. Others discovered only in bacterial genome. The
two largest gene families, vapBC and relBE, were abundantly represented in bacteria and
archaea. While 22 of the 25 phd/doc represented in the bacteria, the remaining three
exclusively found in archaea. Three TA gene families (mazEF, parDE and higBA) were
confined to gram positive and gram negative bacterial domains. While ccdAB confined to
gram negative bacterial domain (Pandey & Gardes, 2005).
Table 2.3: Phyletic distribution of TA loci and Solitary Toxin genes in 126 organisms
Gene Family relBE parDE higBA vapBC mazEF Phd/doc ccdAB Total
Total in Bacteria 129 59 74 139 67 22 5 495
Total in archaea 27 0 0 146 0 3 0 76
Total TAs in 126
organism
156 59 74 285 67 25 5 671
Solitary Toxin 13 0 2 13 7 2 0 37
(Pandey & Gerdes, 2005).
Human pathogens like Mycobacterium tuberculosis, vibro cholera and staphylococcus
aureus are discovered harboring TA loci. In majority of the cases TA loci are highly
abundant free living prokaryotes giving an idea that TA loci are important for adaptation
to ever changing environmental condition. It was concluded that obligate host associated
Chapter 2: Toxin-Antitoxin (TA) Modules 12
Mechanism of Action of Doc (Death on Curing) from Phage P1
organisms do not retain TA loci (Pandey & Gerdes, 2005).The most remarkable example
for this observation comes from the analysis of the genomes of members of the
mycobacterium. Mycobacterium species are members of the phylum Actinobacteria and
are known pathogens of human and animals (wild and domestic animals). It has been
demonstrated that different Mycobacterium species of the genus Mycobacterium display
markedly different life style. Mycobacterium tuberculosis has an extracellular and
intracellular growth phase while Mycobacterium leprae is an obligate intracellular
pathogen. The analysis shows that no functional TA loci in Mycobacterium leprae
whereas there are many different TA loci in Mycobacterium tuberculosis on its 4.4Mb
genome. The striking phylogenetic pattern in Mycobacteria supports the conclusions that
obligate host associated organisms do not retain TA loci while they are beneficial to free-
living organisms.
2.4 Biological Functions of TA Loci
TA families are surprisingly abundant in free-living prokaryotes and almost absent from
obligate host-associated organisms (Pandey & Gerdes; 2005). This striking pattern raises
important questions: what are the functions of all these genes and why do some
organisms have so many whereas others have none. A lot of speculation and hypotheses
have been forwarded for the role of prokaryotic TA module. Plasmids borne TA modules
are proposed to ensure the maintenance of low-copy number plasmids in bacterial
population by mechanism known as postsegregational killing. Cells that retain the
plasmid survive while those who lost the plasmid due to some reason killed by the toxin.
It is evident that the chromosomal TA systems do not serve the purpose of maintenance
of the entire chromosome in the cell and their biological function still remains as a
subject of an extensive research. Chromosomal TA modules have been proposed to
involve in prokaryotic programmed cell death, general prokaryotic stress physiology and
were called “stress managers”, stabilization of plasmid and chromosomal elements or are
proposed to be “selfish DNA” elements. In the following text, TA loci in the context of
the current models that have been proposed to explain the function of TA loci are
described.
Chapter 2: Toxin-Antitoxin (TA) Modules 13
Mechanism of Action of Doc (Death on Curing) from Phage P1
2.4.1 Programmed Cell Death
Programmed cell death (PCD) is an active process that results in self-killing of cells and
is an essential mechanism in multicellular eukaryotes. Generally, PCD, also known as
apoptosis in animals, is required for the elimination of potentially harmful cells (Jacobson
et al., 1997; Nagata, 1997). The causative factors for PCD can be cancerous
transformation, microbial infection, and lethal factors such as heat, mutagens, oxidants,
and chemical toxins. These are among responsible factors for generation of potentially
harmful cells in animals. Intracellular death program may be activated and commit
suicide in a controlled manner in conditions such as confrontation with intra- or
extracellular stresses, because ‘compared with the life of the organism, cells are
apparently cheap’ (Raff, 1998). The suicide of certain cells in a multicellular organism is
thus altruistic and serves the purpose of tightly controlling cell members and the
magnitude of tissues by disposing of cells that are in excess or functions as a mechanism
for protecting the organism from dangerous cells that could potentially threaten
homeostasis (Hentgartner, 2000).
Programmed cell death, like multicellular eukaryotes, has also been observed in
unicellular eukaryotes and prokaryotes (Lewis, 2000; Lane, 2008; Rice & Bayles, 2008).
The pathways and molecular components of PCD in these organisms are very different
from what have been observed in animal apoptosis. Unicellular organism such as
prokaryotes very often display a ‘multicellular-like’ behavior as is illustrated by
phenomena such as quorum sensing and formation of biofilms (Hall-Stoodyley et al.,
2004; Hunter, 2008), by implication leading to the conclusion that the notion of
prokaryotes residing as individual organisms in their natural environment appears to be
incorrect (Engelberg-Kulka et al., 2006). Aizenman et al. (1996) proposed a model for
mazEF-mediated PCD in response to severe nutrient starvation. Subsequently, this model
was broadened to include various other stressful conditions such as DNA damage and
thymine starvation, high temperature and oxidative damage, the presence of antibiotics
with different modes of action (Sat et al., 2001; Sat et al., 2003; Hazan et al., 2001;
Hazan et al., 2004). Controlled cell death of individual in prokaryotes could provide the
surviving member of the community with nutrients during starvation condition, prevent
Chapter 2: Toxin-Antitoxin (TA) Modules 14
Mechanism of Action of Doc (Death on Curing) from Phage P1
the spread of pathogens like bacteriophages, or lower the mutation rate to protect the
genomic content of the population by eliminating cells that have undergone an alteration
in their DNA by mutation or some kind of damage (Lewis, 2000). However, the
individual bacterium do not benefit from PCD. On the contrary it has been described that
during starvation or amino acid scarcity there is growth arrest rather than PCD. They
refer it as programmed cell survival (Gerdes et al., 2005). The following observation
conflict with PCD hypothesis (i) amino-acid starvation of three laboratory E.coli strains
did not induce PCD (ii) E. coli cells in which MazF is overproduced did not form
colonies. However, cell viability could be fully restored by the induction of transcription
of the MazE antitoxin gene after the overproduction of MazF. Therefore, MazF is
bacteriostatic, not bactericidal (iii) cells that cannot synthesize ppGpp (owing to deletion
of both relA and spoT) have a decreased viability during amino-acid starvation, indicating
that ppGpp aids cell survival during nutritional stress rather than the opposite. Most
importantly, there are obtained evidence that cells inhibited by ectopic over expression of
either RelE or MazF could be resuscitated if transcription of their cognate antitoxins was
induced at a later time (Pedersen et al., 2003).
Other hypotheses state that PCD might also be essential in biofilm formation in that the
release of genomic DNA, which becomes part of the biofilm matrix upon lysis of
individual cells, serve as a ‘glue’ that holds all of the members of the community together
(Bayles, 2007). Despite the afore mentioned explanations Amitai et al. (2004) described a
“point of no return” to show a point where ectopic over expression of cognate antitoxin
(MazE) couldn’t reverse the killing activity of the toxin (MazF). Based on the concept of
point of no return one can envisage a model in which MazF mediated RNA cleavage can
be initial step of PCD pathways so that PCD exist in prokaryotes. The chromosome-
encoded mazEF locus of E.coli is thoroughly described as a system that confers PCD
during amino acid starvation and other stressful conditions and schematically displayed in
Fig 2.5.
Chapter 2: Toxin-Antitoxin (TA) Modules 15
Mechanism of Action of Doc (Death on Curing) from Phage P1
Figure 2.5: Schematic Representation of E.Coli MazEF mediated PCD. Picture reproduced from Engelberg-Kulka et al. 2005.
2.4.2 Plasmid Stabilization.
Plasmids are extra chromosomally replicating autonomous genetic elements present in a
cell; size varies from 1 to over 200 kb (Zielenkiewicz & Ceglowski, 2001). Plasmids are
very widely distributed throughout Prokaryotes and, in general, are inherited with a high
degree of stability. Some plasmid genes confer advantage to cells when they are under
selective special environmental conditions. Nevertheless, in many cases, plasmids are
stably inherited over generations without any selective pressure. Thus, there have to exist
mechanisms which enable the maintenance of the plasmid during cell growth in
nonselective conditions. Systems that contribute to this stability are encoded by DNA
Chapter 2: Toxin-Antitoxin (TA) Modules 16
Mechanism of Action of Doc (Death on Curing) from Phage P1
cassettes and are, in most cases, independent of one another. A particular plasmid can
carry different stabilizing cassettes. Even more, cassettes from different plasmids may be
combined to give a stable replicon (Zielenkiewicz & Ceglowski, 2001). TA modules are
one type of plasmid stabilizing cassette and were also first discovered as elements that
ensure the stabilization of low-copy number plasmids (Ogura & Hiraga, 1983; Bravo et
al., 1987; Lehnerr et al., 1993; Roberts et al., 1994). The advantage of plasmid born TA
system seems to ensure stable maintenance of the plasmid in a generation/Progeny
daughter cells by selectively eliminating daughter cells that did not inherit a plasmid copy
at cell division. Due to the difference in a life span of the toxin (longer half life) and
antitoxin (shorter in vivo life span) cells that lost the plasmid will die after segregation by
toxic activity of the poison (Fig 2.6).
Figure 2.6: Genetic organization of TA cassette and Plasmid addiction (Mother and daughter right). The
plasmid bearing one or more TA loci is acquired by the cell and toxin and antitoxin are produced. As long
as the plasmid remains in the cell the non-toxic, non-covalent toxin-antitoxin complex is formed and the
cell won’t experience any adverse effect by the toxin’s action (daughter right). When the plasmid is lost
however, the ‘cured’ progeny dies because the toxin (red) is released from its antitoxin (blue) due to the
difference in cellular life-span between proteins (daughter left). Antitoxins are labile to cellular protease
(green). Figure reprinted from Guglielmini et al. (2008).
Chapter 2: Toxin-Antitoxin (TA) Modules 17
Mechanism of Action of Doc (Death on Curing) from Phage P1
When a plasmid containing a functional TA operon is introduced into a bacterial cell low
level expression of both toxin and its partner antitoxin is guaranteed. The cell is thus
protected from toxin action due to the formation of non toxic complex between the toxin
and antitoxin. This non-toxic complex, which acts as a repressor, is also responsible for
transcription autoregulation from the operon. This situation remains stable only if the cell
retains at least one copy of the plasmid. If the plasmid is lost, however, the system is
activated. The antitoxin is continuously degraded by a specific protease and, in the
plasmid-free cell the cell cannot able to produce either fresh toxin or fresh antitoxin, the
toxin is freed. Accordingly, the toxin freely accesses its target and exerts its action in
cells that have lost the plasmid, thus inhibits cell growth and eventually killing the cell.
2.4.3 Stabilization of Mobile Genetic Elements (Transposons)
Integrons are segment of DNA that can move around to different position in the genomic
DNA of prokaryotes. They contain components that able to insert promoter less gene
cassettes into a site of the integron structure that is provided with a promoter, leading to
the expression of the introduced genes. Integrons can create operon like structures by the
sequential introduction of multiple gene cassettes. They are usually found to contain
genes associated with virulence and resistance to antibiotics (Saylers & Whitt, 2002b).
The key function of plasmid-encoded TA loci is to prevent the proliferation of plasmid-
free progeny and thereby increase the maintenance of the plasmid in a cell that segregate
with it. By a similar mechanism, chromosomal genes closely linked to a TA locus could
have a selective advantage. In particular, increased maintenance of specific genes might
have an effect on the stability and spreading of mobile genetic elements (Rowe-Magnus
et al., 2003; Christensen-Dalsgaard & Gerdes, 2006). It is interestingly apparent that
Vibrio cholerae’s all 13 putative TA loci are located in the mega-Integron. Some of these
loci encode active TA loci. It is possible that the multitude of TA loci contribute to the
genetic stability of the mega-integron. Alternatively, the TA loci could function as
adaptive elements that increase the fitness of V. cholera (Gerdes et al., 2005).
Nevertheless, it is also identified that loss of transposable elements, plasmids and
enzymes involved in DNA rearrangements contributed superbly to obligate host-
associated organisms to own stable genome (Gerdes et al., 2005; Pandey & Gerdes,
Chapter 2: Toxin-Antitoxin (TA) Modules 18
Mechanism of Action of Doc (Death on Curing) from Phage P1
2005). In support of the gene stabilization hypothesis, it could be argued that organisms
with highly stable genomes would not need TA loci to accomplish further gene
stabilization that TA loci function as stress-response elements does not in some cases also
may function to stabilize genes, which is certainly the case for plasmid-borne TA loci. In
fact, a gene stabilization effect may accelerate the horizontal spread of the genes (Gerdes
et al., 2005). This is analogous to restriction-modification systems, which can stabilize
DNA segments and plasmids, but whose main function is to reduce invasion of foreign
DNA (Naito et al., 1995).
2.4.4 Selfish Genes
As discussed above, TA loci can stabilize plasmids by reducing the growth or, in some
cases even kill plasmid-free cells. This is a kind of selfish gene behavior and confers a
selective advantage to the TA locus itself rather than to the cells that harbor them.
(Pandey & Gerdes, 2005). Thus it has been proposed that “Chromosomal toxin-antitoxin
systems are genomic junk, acquired from plasmids or other sources and lost in due
course, albeit at an unusually low rate, due to their addictive qualities” (Magnuson, 2007).
This is a null-hypothesis against which any other hypothesis must be compared.
2.4.5 Stress-Response
A study by Pandey & Gerdes (2005) unveiled that almost all free-living organisms often
harbor a large amount of TA loci apparently this might attributed to changing
environments of their niche. Although the cellular role of these chromosomally carried
TA loci is the subject of controversy, they are believed to be involved in stress response
(Butts et al., 2005; Gerdes et al., 2005). Nutritional stress such as amino acid and glucose
starvation activates RelE and MazF in E.coli. These toxins involve in the mRNA
cleavage, in a ribosome dependent and independent way respectively, thereby inhibits
translation and then arrest cell growth (Christensen et al., 2001; Christensen et al., 2003;
Pederson et al., 2003; Zhang et al., 2003; Munoz-Gomez et al., 2004; Takagi et al., 2005;
Zhang et al., 2005). Therefore, they can be regarded as stress response elements that
function in parallel with ppGpp during stringent response (Christensen et al., 2003;
Christensen & Gerdes, 2003; Pedersen et al., 2003; Gerdes et al., 2005). However, there
Chapter 2: Toxin-Antitoxin (TA) Modules 19
Mechanism of Action of Doc (Death on Curing) from Phage P1
are very few fastidious free living bacteria without TA loci. A notable exception to this is
Lactococcus lactis, normally thrives in plants and milk products and seems to contain no
TA modules. Lactococcus lactis, have an obligate requirement for media that contain
nutrients in artificial cultivation. Therefore, L. lactis might not encounter metabolic stress
to the same degree as less fastidious, free-living organisms. In contrast all obligate host-
associated organisms lack TA loci this might be attributed to their constant environment
where they thrive. Indeed, obligate intracellular organisms thrive in constant
environments and are thus expected to encounter minimal metabolic stress. In keeping
with this notion, many obligate intracellular organisms have also lost the relA/spoT gene
that encodes ppGpp synthetase (Pandey & Gerdes, 2005). On the other hand, most of the
organisms that have many TA loci grow in nutrient-limited environments or are
chemolithoautotrophs. These organisms grow very slowly and, intuitively, optimization
of gene expression seems highly important for such organisms (Pandey & Gerdes,
2005).The observed mRNA cleavage following nutritional starvation together with the
abundance of TA modules on free living organisms and their absence in obligate host
associated and fastidious free living microorganisms provides further support to the stress
response role of TA module thus it can be concluded that TA modules may function as
stress response elements that regulate the pace of metabolism in function of a changing
external environment. Thus the phylogenetic pattern of the distribution of TA loci can be
most easily reconciled with the hypothesis that TA loci are stress-response elements that
increase the fitness of free-living prokaryotes (Pandey & Gerdes, 2005).
Chapter 2: Toxin-Antitoxin (TA) Modules 20
Mechanism of Action of Doc (Death on Curing) from Phage P1
2.5 Phd/Doc Toxin-Antitoxin Module from Bacteriophage P1
Bacteriophages are obligate intracellular parasites that multiply inside bacteria by making
use of the host biosynthetic machinery. Based on their life style, bacteriophages are
classified into lytic (or virulent) phages and lysogenic (or temperate) phages. Virulent
phages will always multiply and kill the cell at the end of their life cycle. Temperate
phages on the other hand can also choose to lysogenize (stay in a dormant state) before
entering their, lytic cycle.
Bacteriophage P1 is a temperate phage that lysogenizes E.coli and other enteric bacteria,
has a genome size of 93,601 bp, 117 gene and 45 operons (Lobocka et al., 2004). The
virion of Bacteriophage P1 consists of an icosahedral head attached at one vertex to a tail
that bears six kinked tail fibers. After injection into a host cell, the viral DNA circularizes
by recombination between redundant sequences. An inter play between a number of
environmental factors and complex immunity circuitry (C1 gene) of the bacteriophage
dictates the choice between the lytic and temperate phase of the life cycle (Heinrich et al.,
1995).
Bacteriophage P1 can either be transmitted vertically, as a low copy plasmid prophage, or
horizontally as a viral particle (Ikeda & Tomizawa, 1965). Several P1 genes scattered
throughout the genome are expressed in the lysogenic state. Those of primary importance
are involved in plasmid maintenance functions and in inhibition of lytic development. As
a prophage, P1 is a stable plasmid maintained at about one copy per bacterial
chromosome (Lobocka et al., 2004). Among several genes scattered over the genome of
the prophage phd/doc constitutes TA module and are in part responsible for plasmid
maintenance and hence prophage P1 is inherited as genetically stable, extra chromosomal
plasmids.
The phd/doc locus of bacteriophage P1 is organized in an operon that codes a stable 126
residue (13.6 KDa) toxin, Doc (death on curing) and unstable 73 residue (8.1 KDa)
antitoxin, Phd (Prevent host death). Phd avoids Doc toxicity by direct protein-protein
contact. Bacteriophage P1 encoded TA module ensures the maintenance of the prophage
in its plasmidic form by a post-segregational killing (Koyama et al., 1975; Jensen &
Chapter 2: Toxin-Antitoxin (TA) Modules 21
Mechanism of Action of Doc (Death on Curing) from Phage P1
Gerdes, 1995; Hazan etal., 2001). This stabilization is moderate: only about seven fold
compared to a phd/doc-free version of P1 (Lehnherr et al., 1993). Doc induced growth
arrest is from within in contrast to the action of colicins or antibiotics that are secreted by
bacteria into their environment as inhibitors of neighboring microorganisms (Hayes,
2003). The antitoxin Phd is selectively degraded by the ClpXP preotease machinery.
Consequently, after curing the prophage, the longer-lived Doc remains to attack its target
and arrest cell growth (Lehnherr & Yarmolinsky, 1995). Actually, the name given to the
TA system owned by prophage P1 was derived from the properties of the antitoxin (Phd)
and the toxin (Doc).
Insilico search by homology from a genome of fully sequenced prokaryotes in a year
2005 divulged chromosomal homologues of the phd/doc family in bacteria and a few
Archaea (Table 2.1) (Pandey & Gerdes, 2005). Curiously, there is a similarity between
Phd and YefM of E.coli, (Pomerantsev, 2001; Grady & Hayes, 2003; Cherny & Garzit,
2004) but Doc has no similarity to YoeB or any other known RelE homologue. By
homology it has been discovered that there is low but significant similarity between
yefMyoeB and relBE family TA module. (Grady & Hayes, 2003; Cherny & Garzit, 2004;
Christensen et al., 2004) thus given the name relBE-3 (Gerdes et al., 2005).
2.5.1 Interaction between Phd and Doc
The N-terminal and C-terminal domains of the Phd contain the interaction sites for DNA
and Doc respectively. In common with other TA module N-terminal region of Phd is
mainly responsible for autoregulation. The toxicity of Doc can be neutralized by the C-
terminal domain of the Phd (Smith & Magnuson, 2004; Mcknley & Magnuson, 2005).
Mutational and structural studies uncovered the six α-helical structure of Doc protein and
Phd, intrinsically unstructured in unbound form, bound to Doc (Fig 2.6). This α-helix is
distinct from known structure of the other TA system. The only conserved surface of Doc
shares a significant similarity with a family of protein fic an indication for evolutionary
and functional relationship of these proteins. This conserved surface differs from the
interaction site with antitoxin but adjascent to the Phd binding site (Fig 2.7 A & B)
(Garcia-Pino et al., 2008).
Chapter 2: Toxin-Antitoxin (TA) Modules 22
Mechanism of Action of Doc (Death on Curing) from Phage P1
Experimental evidences demonstrate that Purified Phd and Doc form a hetero trimeric
(P2D) complex which indicates that Phd inhibits Doc through direct protein-protein
contact by binding two separate regions on Doc (Gazit & Sauer 1999). The complex
formation is entirely mediated by side chain atoms (Fig 2.8). The protein-protein
interaction between toxin and antitoxin is stabilized by combination of the underneath
interactions: (i) hydrophobic interaction between a hydrophobic amino acid that compose
the N-terminal segment of Phd in the Doc binding grove, (ii) ionic interaction between
the negatively charged amino acid residues that constitutes the C-teminal segment of the
Phd and positively charged amino acid residues in the Doc binding grove and (iii) some
hydrogen bonding among amino acid residues in the Doc binding groove (Fig 2.6)
(Garcia-Pino et al.,2008). The Doc binding grove is formed by α-helices exclusively of
α1α4α5 (Fig 2.6). Gazit & Sauer (1999) proposed the molecular mechanism through which
Phd blocks the toxic effect of Doc as follows: (i) sterically blocking the Doc from its
cellular target, ribosome, (ii) altering the Doc structure due to the complex formation so
that it holds impaired cellular interaction site. It is interesting; however, complex
formation results in a small change of secondary structure so if this small change in
secondary structure were to involve part of a Doc that could be mechanism of toxin
neutralization. Recent studies on mechanism of toxin neutralization by Phd has lends
further support to the already proposed neutralizing mechanism of antitoxin by Gazit and
Saurer (Garcia-Pino et al., 2008). These kinds of mechanisms of toxin neutralization have
also been suggested for the TA system, yefMyoeB (Kamada & Hanaoka, 2005) and relBE
(Takagi et al., 2005).
The transcription regulation of P1 addiction module is mediated by protein product of the
operon. The protein products of the phd/doc operon repress the transcription from own
promoter (Magnuson et al., 1996). The operon has common promoter for both proteins
and contains 8bp palindromes separated by a region of 13bp, center to center. The Phd
dimer binds cooperatively the palindromes (Magnuson et al., 1996, Gazit & Sauer., 1999)
and the adjacent sites are bound either independently by Phd or cooperatively with Phd
and Doc (Magnuson & Yarmolinsky, 1998). These clearly indicate that the transcription
regulation of bacteriophage P1 toxin-antitoxin module is effected by the Phd alone or
cooperatively with Doc. Doc enhances transcription repression by cooperative binding
Chapter 2: Toxin-Antitoxin (TA) Modules 23
Mechanism of Action of Doc (Death on Curing) from Phage P1
only if the two palindromes are present (Buts et al., 2005). Thus the hetero trimeric
complex formed between two Phd and one Doc is both to avert the poisoning effect of the
toxin, Doc, and to auto regulate the transcription of the toxin-antitoxin system (Magnuson
& Yarmolinsky, 1998; Gazit & Sauer., 1999; Smith & Magnuson, 2004; Mcknley &
Magnuson, 2005).
Figure 2.6: Structure of Doc and Phd bound to Doc. The DocH66Y:Phd52-73Se complex stereo view. The Doc
H66Y α-helices and loops are colored cyan and grey respectively. The α-helices are labeled α 1 to α 6. The highly conserved motifs are found in the α 3 and α 4 that are distinct from the Phd interaction site and the conserved sequences, HXFX(D/E)(A/G)N(K/G)R, are highlighted in red and side chains are made known as sticks. The Phd interaction site is not conserved. The α-helices of bound Phd revealed as yellow in binding groove. Figure reprinted from Garcia-Pino et al., 2008.
Chapter 2: Toxin-Antitoxin (TA) Modules 24
Mechanism of Action of Doc (Death on Curing) from Phage P1
Figure 2.7: Surface representation of DocH66Y in complex with antitoxin partner Phd represented with yellow helical ribbon. Conserved sequences are shown in blue and residues potentially associated with Doc functional activity are shown in red. Figure reprinted from Garcia-Pino et al., 2008.
Chapter 2: Toxin-Antitoxin (TA) Modules 25
Mechanism of Action of Doc (Death on Curing) from Phage P1
Figure 2.8: Phd52-63Se and Doc H66Y interaction: Interacting residues, entirely of side chains, of Doc H66Y (blue) and Phd52-63Se (red and orange). The interaction forces include hydrophobic (arched), hydrogen bonds (dashed lines) and ionic interaction between charged residues not shown. Orange represents the hydrophobic N-terminal segment and the red represents the negatively charged C-terminal segment of the Doc binding C-terminal domain of Phd52-63Se. Figure reprinted from Garcia-Pino et al., 2008.
2.5.2 Cellular Targets of Doc Toxin
To clearly unravel the function of TA loci, it is decisive to realize the cellular targets of
the toxins. Recently phenomena of medical importance like biofilm formation and
bacterial persistence upon antibiotic exposure have already been attributed to
chromosomal TA systems. Knowledge of toxin target are also of pharmaceutical and
biotechnological interest because they could be potential new drug targets in pathogenic
bacteria, and might be useful for creating novel genetic tools (Hayes, 2003; Gerdes et al.,
2005). The toxin component produced by TA cassettes is designed by nature to maim
bacterial cells, which raises the exciting possibility that these factors might be exploited
as novel antibacterial agents in the treatment of infectious diseases (Hayes, 2003).
Though the exact mechanism of toxicity remains to be elucidated, Doc toxicity relies on
the ability of Doc to arrest translation elongation through its association with 30S
ribosomal subunit similar mechanism exhibited by antibiotics hygromycin (Hazan et al.,
2001). Hygromycin, an amino glycoside antibiotic, is known for its action of translation
elongation inhibition (Cabanas et al., 1978; Cabanas et al., 1978; Eustice & Wilhelm,
1984).
Chapter 2: Toxin-Antitoxin (TA) Modules 26
Mechanism of Action of Doc (Death on Curing) from Phage P1
It has been proved that hygromycin B resistant mutant cells are also not affected by Doc
this explain the antibiotics and the toxin, Doc, competes for the similar binding site by
implication binding site of hygromycin B also included in the binding site of Doc on the
small ribosomal subunit, 30S ribosomal subunit (Liu et al., 2008). Fig 2.8 schematically
depicts the general path way of phd/doc toxin-antitoxin system and how Doc act on its
cellular target and shutdown protein synthesis thereafter induce postsegregational growth
arrest.
Figure 2.9: Mechanism of action of Doc. When Doc is freed from Phd due to degradation of the antitoxin by the serine protease, ClpXP shortly after curing of plasmid and no fresh supply of the partner antitoxin is available, the long lived toxin causes poisoning by binding to the 30s subunit so then halting translation elongation marked by “X” finally leading to cell “Postsegragational Killing”. Since stalled ribosomes protect mRNA from degradation, mRNA stabilization by doc can also be imagined. In contrast mRNA destablisation is observed on model mRNAs (lpp & dksA) after Doc induction this might be RelE triggered mRNA cleavage (Garcia-Pino et al., 2008). Picture taken from Liu et al., 2008.
Mechanism of Action of Doc (Death on Curing) from Phage P1
3. Aim of the Work
The phd/doc operon of bacteriophage P1, act as an addiction module. It stabilizes the
phage in plasmidic form and prevents it from being lost during cell division of its host
E.coli. When the plasmid is lost neither the Phd nor Doc will be produced. Phd is
regularly degraded by protease, ClpXP, leaving Doc free inside the cell. The freed toxin,
Doc then binds to the ribosomes and shut down protein synthesis ultimately leading to
plasmid cured cell growth arrest. This is called postsegregational killing. Phd counteract
Doc toxicity by protein-protein contact that either appear as interface between toxin and
cellular target, physical blockage, or introducing secondary structural change on toxin
Doc. However, Doc mutant H66Y, produced by mutation is less toxic to the cell. From
crystal structure of Doc and Phd complex the mutation H66Y found not in the Phd
binding region but adjacent to it. Replacing histidine by tyrosine in Doc renders the
monomeric wild type Doc majorly to purify as a dimer. Two possible reasons can be
forwarded for the reduced toxicity: DocH66Y dimer formation or substitution of histidine
residue by tyrosine. To unravel the intriguing event we want to study the killing
mechanism of Doc toxin and rescuing capacity of partner antitoxin, Phd, in vitro.
Mechanism of Action of Doc (Death on Curing) from Phage P1
4. Materials and Methods
4.1 Materials
4.1.1 Bacterial Growth Media
Lysogeny Broth was made by dissolving 10 g tryptone/peptone, 5 g yeast extract and 10
g Nacl in deionised water, PH adjusted to 7 with NaOH to the final volume of 1 L
solution. The LB agar was supplemented with 100 µg/ml of ampicillin.
4.1.2 Bacterial Strains
Escherichia coli strain BL21(DE3). An E.coli strain preferred for expression from
inducible promoter and contains the λ-prophage DE3 in its genome. The λ-prophage DE3
contains an Isopropyl β-D-1-thiogalactopyranoside (IPTG) inducible gene that code for
T7 RNA polymerase. This gene is under transcriptional control of the L8-UV5 lac
promoter. These cells were used for recombinant expression of wild type Doc, Phd and
mutant Doc.
Escherichia coli strain DH5α. An E.coli strain preferred for high yield plasmid DNA
purification. This strain bears a mutation of φ80lacZ∆M15 and lacks the laqIq gene. DH5
α competent cells were used for plasmid construction and transformation of wild type and
mutant clone.
4.1.3 Cloning and Expression Vector
pET-21b (Novagen, Madison, USA). An expression and cloning vector that contains an
ampicillin resistance gene, T7 promoter, transcription start and terminator, T7-Tag
coding sequence, a multiple cloning site, a His-tag coding sequence and the LacI coding
sequence (Fig 4.1). The expression of the insert is controlled by the T7 RNA polymerase
promoter. This vector was used for cloning and expression of all constructs.
Chapter 4: Materials and Methods 29
Mechanism of Action of Doc (Death on Curing) from Phage P1
Figure 4.1: The pET-21a-d(+) vectors. (A) The pET-21 system comes in four variants (a-d). The map of pET-21b(+),pET-21c(+) and pET-21d(+) are the same as pET-21a(+) (shown) with the following exceptions: pET-21b(+) is a 5442bp plasmid: subtract 1bp from each site beyond BamHI at 198. pET-21c(+) is a 5441bp plasmid: subtract 2bp from each site beyond BamHI at 198. pET-21d(+) is a 5440bp plasmid: the BamHI site is in the same reading frame as in pET-21c(+).
(B) Cloning and expression region of pET-21a-d(+) vectors.
4.1.4 Oligonucleotides
‘FP1’ (Sigma, St.Louis, USA). Forward primer for the amplification and site directed
mutagenesis of wild type doc by PCR. ‘FP1’ contains three nucleotide mismatches which
are bold and underlined in the sequence. This primer was used to change Ala61 to Arg61.
5’-AGTCTCCGCCACCTACCTGGTGCGTACAGCGAGAGGGCATATATTC-3’
Chapter 4: Materials and Methods 30
Mechanism of Action of Doc (Death on Curing) from Phage P1
‘RP1’ (Sigma, St.Louis, USA). Reverse primer for the amplification and site directed
mutagenesis of wild type doc by PCR. ‘RP1’ contains three nucleotide mismatches which
are bold and underlined in the sequence. This primer was used to change Ala61 to Arg61.
5’-GAATATATGCCCTCTCGCTGTACGCACCAGGTAGGTGGCGGAGACT-3’
‘FP2’ (Sigma, St.Louis, USA). Forward primer for the amplification and site directed
mutagenesis of wild type doc by PCR. ‘FP2’ contains three nucleotide mismatches which
are bold and underlined in the sequence. This primer was used to change His66 to Ala66.
5’-CTACCTGGTGGCTACAGCGAGAGGGGCTATATTCAATGATGCCAATAAGCGTAC-3’
‘RP2’ (Sigma, St.Louis, USA). Reverse primer for the amplification and site directed
mutagenesis of wild type doc by PCR. ‘RP2’ contains three nucleotide mismatches which
are bold and underlined in the sequence. This primer was used to change His66 to Ala66.
5’-GTACGCTTATTGGCATCATTGAATATAGCCCCTCTCGCTGTAGCACCAGGTAG-3’
‘FP3’ (Sigma, St.Louis, USA). Forward primer for the amplification and site directed
mutagenesis of wild type doc by PCR. ‘FP3’ contains three nucleotide mismatches which
are bold and underlined in the sequence. This primer was used to change His66 to Asn66.
5’-CTACCTGGTGGCTACAGCGAGAGGGAACATATTCAATGATGCCAATAAGCGTAC-3’
‘RP3’ (Sigma, St.Louis, USA). Reverse primer for the amplification and site directed
mutagenesis of wild type doc by PCR. ‘RP3’ contains three nucleotide mismatches which
are bold and underlined in the sequence. This primer was used to change His66 to Asn66.
5’-GTACGCTTATTGGCATCATTGAATATGTTCCCTCTCGCTGTAGCCACCAGGTAG
‘FP4’ (Sigma, St.Louis, USA). Forward primer for the amplification and site directed
mutagenesis of docH66Y by PCR. ‘FP4’ contains three nucleotide mismatches which are
bold and underlined in the sequence. This primer was used to create a mutant Asn78Trp
in docH66Y background.
5’-GATGCCAATAAGCGTACCGCGCTATGGAGTGCGCTGCTATTTCTACGCCGTAA-3’
Chapter 4: Materials and Methods 31
Mechanism of Action of Doc (Death on Curing) from Phage P1
‘RP4’ (Sigma, St.Louis, USA). Reverse primer for the amplification and site directed
mutagenesis of docH66Y by PCR. ‘RP4’ contains three nucleotide mismatches which are
bold and underlined in the sequence. This primer was used to create a mutant Asn78Trp
in docH66Y background.
5’-TTACGGCGTAGAAATAGCAGCGCACTCCATAGCGCGGTACGCTTATTGGCATC-3’
4.1.5 Used Kits
QIAprep ® Miniprep Plasmid DNA Purification Kit (QIAGEN ®, California, USA).
A kit used for purification of plasmid DNA.
QIAquick® PCR purification Kit (QIAGEN ®, California, USA). A kit used for the
purification of PCR product.
QIAquick® Gel Extraction Kit (QIAGEN ®, California, USA). A kit used for the gel
extraction or cleanup of DNA.
EasyXpressTM protein synthesis kit (QIAGEN®, California, USA). A kit used for cell
free expression of recombinant proteins.
4.1.6 Enzymes and Antibodies
ExTakara (Takara Bio, Shiga, Japan). DNA polymerase used for amplification during
PCR.
PfuTurbo® DNA Polymerase (Stratagene, La Jolla, California, USA). DNA
polymerase used during amplification and mutagenesis.
T4 DNA ligase (Amersham Bioscience, Uppsala, Sweden). T4 DNA ligase is an
enzyme used for ligation of inserts in to a cloning and/or expression vector.
Chapter 4: Materials and Methods 32
Mechanism of Action of Doc (Death on Curing) from Phage P1
DpnI Restriction Enzyme (Fermentas St. Leon-Rot, Germany). This is a Restriction
enzyme that has an optimal activity in buffer Tangotm. This enzyme is used for digesting
the parental methylated DNA and specifically cleaves the sequence:
CH3
5'-G A.T C-3'
3'-C T.A G-5'
CH3
The recognition sites on both strands are indicated by vertical arrows.
NdeI (Fermentas St. Leon-Rot, Germany). This is a Restriction enzyme that has an
optimal activity in buffer orange (O). The specific cleavage sites on both strands are
indicated by vertical arrows.
5'-C A↓↓↓↓T A T G-3'
3'-G T A T↓↓↓↓A C-5'
XhoI (Fermentas St. Leon-Rot, Germany). This is a restriction enzyme with an optimal
activity in buffer red (R). The specific cleavage sites on both strands are indicated by
vertical arrows.
5'-C ↓↓↓↓T C G A G -3' 3'-G A G C T ↓↓↓↓C-5'
Primary antibody (Serotec, Oxford, UK). This is mouse anti-histidine antibody for
western blotting.
Secondary antibody (Sigma, St.Louis, USA).Goat anti-mouse IgG conjugated with an
alkaline phosphatase for western blotting.
4.1.7 Molecular Weight Markers
Page RulerTM Prestained Protein Ladder (Fermentas St. Leon-Rot, Germany).
Protein molecular weight marker used during SDS-PAGE and western blot analysis (Fig
4.2 A)
Chapter 4: Materials and Methods 33
Mechanism of Action of Doc (Death on Curing) from Phage P1
Unstained Protein Molecular Weight Marker (Fermentas St. Leon-Rot, Germany).
Protein molecular weight marker used during SDS-PAGE analysis (Fig 4.2 B).
Bacteriophage λ PstI (Fermentas St. Leon-Rot, Germany). Molecular weight marker
for DNA used during agarose gel analysis (Fig 4.2 C).
Figure 4.2: Molecular Weight Markers used during SDS-PAGE (A &B), Western Blotting (A) and Agarose Gel Electrophoresis (C) analysis.
4.1.8 Stock Solutions
CAPS (10X) (N-cyclohexyl-3-aminopropanesulfonic acid). This buffer consists of 100
mM of CAPS (C9H19NO3S).The PH adjusted to 9 with NaOH.
PBS (10X) (Phosphate Buffered Saline). This buffer comprises137 mM NaCl, 3 mM
KCl, 8 mM Na2HPO4 and 1.75 mM KH2PO4. The PH is adjusted to 7.2 with HCl.
TBE (Tris/Borate/EDTA) . This buffer made of 889.78 mM Tris (C4H11NO3), 31.823
mM EDTA (C10H16N2O8) and 889.535 mM boric acid (H3BO3). The PH is adjusted to 8.3
with NaOH.
Chapter 4: Materials and Methods 34
Mechanism of Action of Doc (Death on Curing) from Phage P1
4.2 Methods
4.2.1 Cloning and Mutagenesis.
4.2.1.1 Purification of Plasmid DNA.
A plasmid carrying the phd/doc of P1 plasmid addiction operon and a plasmid carrying
docH66Y were transformed by the CaCl2 method (Studier et al., 1990) into DH5α cells
(detailed below). Overnight E. coli cultures bearing a plasmid carrying a phd/doc of P1
plasmid addiction operon or a plasmid carrying docH66Y were harvested by
centrifugation for three minute (8500 rpm and 25°C). Plasmid DNA containing wild type
phd/doc or docH66Y gene were then purified from E.coli DH5α cells using the
QIAprep®Spin Miniprep plasmid purification kit according to manufacturer’s instruction
and verified by sequencing. These plasmids were used in cloning, mutagenesis and
expression.
4.2.1.2 Amplification and Cloning of phd/doc to PET-21b Vector.
Wild type phd/doc from bacteriophage P1 was amplified by PCR using the plasmids
bearing it as a template (Mullis, 1990). A PCR reaction with ExTakara polymerase (5
U/µl) was used to amplify the phd/doc segment of the plasmid. The primers were
designed based on the flanking region of this gene. A PCR mix of 1 ng plasmid DNA in 9
µl of milli-Q water, 5 µl of 10X ExTakara buffer, 1 µl of 20 mM forward primer, 1 µl of
20 mM reverse primer, 4 µl of 2.5 mM dNTP mix, 0.2 µl of ExTakara polymerase
enzyme and 28.8 µl of milli-Q water plus negative control lacking template plasmid
DNA were prepared. PCR were performed in thermal cycler (Gen Amp® PCR system
9700) under the PCR condition:
• denaturation at 94oC for 50 seconds,
• 25 cycles of PCR amlification: denaturation at 94oC for 10 seconds, annealing at
55oC for 30 seconds and extension at 68oC for 1 minute,
• Hold at 72oC for 7 minute and
Chapter 4: Materials and Methods 35
Mechanism of Action of Doc (Death on Curing) from Phage P1
• Cool to 4 oC
PCR products were purified using the QIAquick® PCR purification Kit as described on
the hand book (QIAGEN®, California, USA). The purified PCR products and pET21b
vector were digested by the restriction enzymes NdeI and XhoI. The digests were
electrophoresed on a standard 1% agarose gel in TBE buffer and the bands were cut from
the gel. DNA was extracted from the gel cuts using the QIAquick® Gel Extraction kit
following the protocol described on the handbook (QIAGEN®, California, USA). The
digests were hybridized and ligated with T4 DNA ligase to create recombinant plasmid
PAG2-2, and subsequently introduced into E.coli strain DH5α by CaCl2 transformation.
Transformants were selected on LB agar in the presence of 2% glucose and 100 µg/ml
ampicillin. Positive clones were plasmid purified and further characterized by sequencing
elsewhere. Sequence validated recombinant plasmid PAG2-2 was used for cloning and
site directed mutagenesis of phd/doc. Moreover, the constructs were introduced into
E.coli strain BL21(DE3) for expression and purification of recombinant proteins.
4.2.1.3 Site Directed Mutagenesis
Mutants of Doc were created in a doc using QuikChange® site-directed mutagenesis
protocol (Stratagene, La Jolla, California, USA). The following three stapes were
performed:
1. Mutant Strand Synthesis
Syntheses of mutant strands were accomplished using PCR technique (Mullis, 1990). But
in this case the product of the PCR reaction is never used as a template. This means that
this is a linear amplification technique, unlike standard PCR where we get exponential
amplification of the product.
Two complementary oligonucleotides (primers) containing three nucleotides mismatches
flanked by unmodified nucleotides sequences were designed by us and synthesized by
SIGMA (sigma.com/oligos) (Fig 4.3). Two PCR tubes with different reagents were setup.
PCR tube one contained reaction mix (sample test reaction): 5 µl of 10X Pfu turbo
reaction buffer, 4 µl of 2.5 mM dNTP mix, 1 µl of 20 mM forward primer (125 ng), 1 µl
Chapter 4: Materials and Methods 36
Mechanism of Action of Doc (Death on Curing) from Phage P1
of 20 mM reverse primer (125 ng), 2 µl of 50 ng PAG2-2 plasmid DNA template (25
ng/µl) and 36 µl of distilled water. The second PCR tube has also the same mix except it
contains distilled water in lieu the template plasmid PAG2-2. PCR tubes were centrifuged
briefly (short spin), added 1 µl of Pfu turbo polymerase (2.5 U/µl) to both PCR tubes, and
centrifuged again as before. All the tubes were placed in thermal cycler (Gen Amp® PCR
system 9700) and run on the following specified program:
• denaturation at 95oC for 30 seconds,
• 16 cycles of PCR amplification:
o denaturation at 95oC for 30 seconds,
o annealing at 55oC for 1 minute and
o extension at 68oC for 1 minute/kb of plasmid, in our case 6 minute
The two PCR tubes were then briefly cooled to a temperature of ≤ 37 oC on ice. In order
to maximize the success of subsequent experiment PCR products were purified by
QIAquick® PCR purification Kit as described on manufacturer’s instruction (QIAGEN®,
California, USA).
2. Digestion of PCR Amplification Product with DPnI Restriction Enzyme
Following amplification and purification of the reaction mix, the parental DNA was
digested by DpnI restriction enzyme, which selectively digests methylated DNA and
hence leaving the newly synthesized DNA strand intact (Fig 4.3). Restriction digestion
was initiated by adding 1 µl of DPnI restriction enzyme (10 U/µl) in 5 µl of 10X buffer
Tango, mixed gently and thoroughly, centrifuged for 1 min at 13,000 rpm and incubated
for 1 h at 37°C.
3. Transformation of Escherichia coli strain DH5α Competent Cells
In order to make large quantities of plasmid (PAG2-2) with the mutation of interest,
E.coli strain DH5α cells were transformed with DPnI digest by standard CaCl2 method
Chapter 4: Materials and Methods 37
Mechanism of Action of Doc (Death on Curing) from Phage P1
(Studier et al., 1990). 100 µl of E.coli strain DH5α cells were thawed on ice for a few
minute.
The cells were then divided in two equal volumes (50 µl of cells in two separate
eppendrof tubes). To each tube 5 µl of mutagenesis reaction mixtures with and without
template plasmid DNA (PAG2-2) were added. The mixtures were then again incubated
on ice for 10 minute followed by 2 minute at 42oC, diluted in 2 ml of sterile LB medium
and incubated for at least 1 h at 37oC with aeration in water bath. A pair of LB agar plate
supplemented with 2% glucose and 100 µg/ml of ampicillin was prepared. A 100 µl of
these mixture (cells and mutagenesis reaction) were plated on LB agar (2% glucose and
100 µg/ml ampicillin) labeled diluted. The remaining culture mixtures (cell suspensions)
were then pelleted by centrifugation (13,000 rpm, 25oC). The pellet was resuspended in
100 µl of sterile LB broth, and plated on LB agar plate (2% glucose and 100 µg/ml
ampicillin) labeled concentrated. The plates were incubated overnight at 37oC. Plating
was performed under sterile condition. After overnight incubation of cells, positive
clones were colony picked, precultured overnight at 37oC in LB broth (2% glucose and
100 µg/ml ampicillin), plasmid DNAs (PAG2-2) were purified from E.coli strain DH5α
as described above. PAG2-2 constructs were concentrated to a concentration of 20 ng/µl
and sent somewhere else for sequence validation.
Figure 4.3: Schematic representation of Site Directed Mutagenesis. Following PCR reaction, the product is digested with DpnI restriction enzyme. This restriction digest is crucial. DpnI only recognizes methylated sites, so it digests the template plasmid but not the PCR product. To make sure proper annealing of the primer the mismatch should be placed in the middle of the primer.
Chapter 4: Materials and Methods 38
Mechanism of Action of Doc (Death on Curing) from Phage P1
4.2.2 Expression and Purification of Wild Type and Mutant Doc, and Phd
4.2.2.1 Expression
Plasmid PAG2-2 or pD21-5AD-9B was transformed into BL21(DE3) E.coli strain cells
(Hanahan et al., 1991) using the CaCl2 method (Studier et al., 1990).
Transformed cells were then colony picked and replated over night at 37oC on LB plate
containing 2% glucose and 100 µg/ml ampicillin. Before large scale expression was
performed, small-scale expression test was conducted. Single colony bearing recombinant
plasmid (PAG2-2) was grown overnight at 37oC in the LB broth (2% glucose and 100
µg/ml) prepared as described by Sambrook et al. (1989). A 2ml aliquot of this culture
was added to 40 ml of the same fresh medium and the bacteria were grown with aeration
and shaking at 37oC (Innova™ 4430) until the absorbance reached OD600nm of
approximately 0.8. The culture was then induced by addition of 1 mM IPTG (isopropyl-
1-thio-D-galactopyranoside) and cells were further incubated for 2-3 h under the same
condition for over expression. Before and after induction aliquots of each culture were
centrifuged and the pellet was resuspended in SDS-PAGE loading buffer (Sambrook et
al., 1989). The proteins were analysed on a 10% SDS-polyacrylamide gel (Invitrogen,
California, USA) and the gel was stained with Coomassie brilliant blue R-250. Similar
protocol was followed for expression from pD21-5AD-9B plasmid.
To start large scale expression, the above mentioned protocol was followed except that in
this case the culture was 10 L culture each prepared in 1 L flask. The individual 1 L
cultures were finally pooled together after cell harvest. After 2-3 h incubation with
aeration and shaking (37oC, 120 rpm) (New Brunswick Scientific) in the presence of 1
mM IPTG, cells were harvested by centrifugation for 20 minutes (7000 rpm, 4oC)
(Beckman coulter® Avanti® J-26XP), pellets were resuspended in lysis buffer (50 mM
Tris PH 7.5, 250 mM NaCl, 0.1 mg/ml AEBSF, 1 µg/ml leupeptin, 1 mM EDTA),
aliquoted in volume of 50 ml, frozen with liquid nitrogen and stored at -70oC.
Chapter 4: Materials and Methods 39
Mechanism of Action of Doc (Death on Curing) from Phage P1
4.2.2.2 Purification
Purification of Doc, DocA61R, DocH66Y and Phd were performed on Akta Explorer plat
form (Amersham Biosciences,Uppsala, Sweden) by immobilized metal affinity
chromatography (IMAC) (Porath et al., 1975). A nickel-sepharose column (Amersham
Biosciences, Uppsala, Sweden) was packed and equilibrated in buffer A (50 mM Tris PH
7.5, 250 mM NaCl). Prior to purification of His-tagged Doc-Phd, DocH66Y and
DocA61R-Phd, frozen cells were thawed in water at room temperature in the presence of
buffer A (50 mM Tris PH 7.5 and 250 mM NaCl) and the cell suspension was disrupted
by cell cracker. Cell lysate was centrifuged at 12,000 rpm (Beckman coulter® Avanti® J-
26XP) for 45 min at 4oC, supernatant were collected and filtered through 0.45 µM using
60 ml syringe. The filtered supernatant was applied to a nickel-sepharose column
equilibrated with buffer A (50 mM Tris PH 7.5, 250 mM NaCl). Elution of Phd from the
column was performed in step gradient with buffer 1.5 M GdHCl, 0.2 M Tris PH 8.0 and
buffer 3 M GdHCl, 0.2 M Tris PH 8.0 for the first peak and the second peak respectively.
Fractions of elutions from each peak were collected, pooled together and diluted to a final
concentration of approximately 0.3 M GdHCl in Phd refolding buffer 1 (Tris 50 mM PH
8.0, 1 M NaCl) and subsequently dialyzed at 4oC for 3 h against Phd refolding buffer 1,
followed by Phd refolding buffer 2 (Tris 20 mM PH 7.0, 1 M NaCl) overnight. The
overnight dialyzed Phd sample was further dialyzed for 4-6 h against Phd final refolding
buffer (Tris 20 mM PH 7.0, 500 mM NaCl), aliquoted in volume of 1 ml, freezed in
liquid nitrogen and stored at -70 oC.
His tagged Doc was eluted in buffer 3 M GdHCl, 50 mM imidazole, 0.2 M Tris PH 8.0.
Fractions from the last peak were collected , pooled together and diluted to the final
concentration of 0.15 M-0.2 M GdHCl in Doc refolding buffer 1 (Tris 50 mM PH 7.0, 1
M NaCl). This was dialysed overnight against Doc refolding buffer 1 at room
temperature, followed by dialysis in Doc refolding buffer 2 (Tris 20 mM PH 7.0, 500 mM
NaCl) for 4 h. The dialyzed Doc was further dialyzed against Doc stabilization buffer
(Tris 20 mM PH 7.0, 250 mM NaCl) and concentrated at 4oC. This sample was then
loaded onto filtration column (superdex 75HR) for further purification, finally aliquoted
in volume of 1 ml, freezed in liquid nitrogen and stored at -70 oC. Refolding of proteins
Chapter 4: Materials and Methods 40
Mechanism of Action of Doc (Death on Curing) from Phage P1
(Doc, Phd, DocH66Y and DocA61R) and quality were monitored by circular dichroism
(CD) and SDS-PAGE. Samples were kept on ice all the time.
4.2.2.3 SDS-PAGE Analysis
To verify the expression of proteins and visualize the qualities of purification, aliquots of
cells and pooled samples of purification peaks were prepared and subjected to SDS-
PAGE analysis as described by Laemmli, (1970). Aliquots of 200 µl of bacterial cultures
were taken before induction and after induction with 1 mM IPTG. Cell samples were
centrifuged (5,000 rpm, 25oC) for 10 minutes; pellets were resuspended in 20 µl of milli-
Q water (filtered and sterilized ultra pure laboratory water) and boiled at 100oC for 10
minute. Boiled samples were then cooled to room temperature for a few minutes and
further incubated for 10 minute in the presence of DNase I (5 µg/ml). These samples
were boiled for additional 5 minutes in the presence of 10 µl of 4X NuPAGE® LDS
sample buffer (Invitrogen, California, USA). 30 µl of pooled aliquots from all peaks of
purification process were taken and prepared for SDS-PAGE essentially as described
above except that in this case there was no centrifugation and resuspension step.
Basically the same protocol was followed after in vitro translation assay for western blot
analysis.
The samples were then loaded on NuPAGE® 10% Bis-Tris pre-cast gels (Invitrogen,
California, USA). The electrophoresis was performed in 1X NuPAGE® MES running
buffer (50 mM MES PH 7.2, 50 mM Tris, 0.1% SDS, 1 mM EDTA PH 7.3) for 35
minute (I=120 mA, P=25.0, ∆V= 200 V). Size fractionated proteins were then stained
with Coomassie brilliant blue R-250. Molecular weights were determined using the
unstained protein molecular weight marker or the see Blue® and Page RulerTM prestained
molecular weight marker.
Chapter 4: Materials and Methods 41
Mechanism of Action of Doc (Death on Curing) from Phage P1
4.2.3 Growth Assay
Two bottles of 40 ml LB broth supplemented with 2% glucose and 100 µg/ml ampicillin
were prepared as described by Sambrook et al. (1989) and inoculated with 2 ml (each) of
an overnight Preculture of recombinant E.coli strain BL21(DE3) bearing plasmid pD21-
5AD-9B with docH66Y construct. The cultures were grown overnight at 37oC. The
absorbance OD600nm was measured at 0 h, 1 h, 2 h, 3 h, 4 h, 6 h, 8 h and 17 h. One bottle
was induced with 0.5 mM IPTG at absorbance OD600nm approximately 0.5 while the
other bottle kept growing uninduced.
4.2.4 In Vitro Translation Assay/Cell Free Expression System
Purified wild type Doc, DocH66Y and DocA61R were tested for toxicity using cell free
expression system. Purified Phd was also tested for its ability to neutralize or reverse
toxicity of Doc using the same assay. This was conducted after knowing the minimum
concentration of Doc inhibiting in vitro translation. The experiment was performed using
EasyXpress protein synthesis kit following manufacturer’s instruction (QIAGEN®,
California, USA). Each reaction mix contained the following solutions: EasyXpress
E.coli extract, EasyXpress positive-control DNA template, EasyXpress reaction buffer,
RNase free water and toxin or antitoxin or both in a reaction volume of 20µl. The assay
was started by adding purified proteins at increasing concentration (1 pM, 500 pM, 750
pM, 1 nM, 100 nM, 250 nM, 500 nM and 1 µM for Doc and DocA61R; 50 nM, 250 nM,
1 µM, 5 µM, 25 µM, 100 µM and 250 µM for DocH66Y and 1 nM, 50 nM, 125 nM, 250
nM, 500 nM, 1 µM, 10 µM for Phd ) followed by incubation for 1h at 37oC and reaction
was stopped by adding 5 µl of 4X NuPAGE® (Invitrogen, California, USA). After
knowing the minimum concentration of Phd required for neutralizing the toxicity of Doc
the same experiment was repeated, in order determine the minimum time required for
Phd to reverse Doc-mediated translation inhibition. This was conducted by adding the
determined concentration of purified Phd at time 0 h, 0.25 h, 0.5 h, 1 h, 1.5 h and 2 h
posterior to Doc. The reactions were then analyzed using western blotting.
Chapter 4: Materials and Methods 42
Mechanism of Action of Doc (Death on Curing) from Phage P1
4.2.4.1 Western Blotting
The in vitro translation assay was analyzed by Western blotting that was essentially
performed as described by Towbin et al. (1979). In vitro translated proteins were first
subjected to electrophoresis on NuPAGE® 10% Bis-Tris pre-cast gels (Invitrogen,
California, USA) and were then transferred from electrophoretic gel to nitrocellulose
membrane using a constant voltage of 100V during 1 h in CAPS buffer. The
nitrocellulose membrane was then immediately blocked by milk powder in PBS for extra
1 h and subsequently rinsed in PBS + 0.2% Triton X100. The membrane was incubated
for 2 h at room temperature in the mouse anti-histidine antibody (Primary antibody) that
was diluted to a concentration of 1 µg/ml in 5% milk powder in PBS + 0.2% Triton
X100. After rinsing with PBS + 0.2% Triton X100 again, the membrane was further
incubated for 1 h at room temperature in rabbit antimouse-phosphatase (secondary
antibody) that was diluted to a concentration of 5 ng/ml in 5% milk powder in PBS +
0.2% Triton X100 and then rinsed for third time in PBS + 0.2% Triton X100. The blot
was developed by incubating the membrane in the dark for a maximum of 15 minutes at
37oC in 10 ml buffer (0.1 M Tris-HCl PH 9.5, 0.1 M Nacl, 50 mM MgCl2) to which 100
µl of 18.75 mg/ml NBT, 9.4 mg/ml BCIP solution was added.
4.2.5 Circular Dichroism
In order to reveal the impact of mutation on secondary structure of Doc; the CD spectra
of the pure Doc, DocH66Y and DocA61R were taken and compared. Refolding was
monitored by far-UV CD range of 200-260 nm using a cuvette path length of 0.1cm. The
protein concentration used in each case was between 0.1 mg/ml-0.3 mg/ml with the
proteins dissolved in 50 mM Tris PH 7.5, 150 mM NaCl. The CD measurements were
performed on JASCO-J715 spectropolarimeter at room temperature.
Mechanism of Action of Doc (Death on Curing) from Phage P1
5. Results
5.1 Cloning of Phd/doc into pET-21b Vector and Mutagenesis
5.1.1 Construction of PAG2-2 Vector
Over expression of toxic proteins lead to bacterial cell growth inhibition and hence it is
very difficult to obtain large quantities of these toxic proteins. Different strategies are
available to overcome this pitfall:
� Cloning strategy of putting toxin-antitoxin gene as an operon in to a vector
� Introducing mutation in to toxin gene in order to make it less toxic
We used a strategy of cloning phd/doc operon of bacteriophage P1 together to construct
PAG2-2 vector because of the fact that we will be using purified Doc protein for in vitro
toxicity assay and we will need doc as a template for site directed mutagenesis. The
phd/doc of bacteriophage P1 was PCR amplified and ligated in to pET21b vector to
generate PAG2-2 vector. To start cloning of phd/doc in to pET21b, plasmid bearing
phd/doc was purified and PCR amplified (not shown). The amplification product was
double digested with NdeI and XhoI restriction enzymes and cloning/expression vector
pET21b was also digested with these restriction enzymes. The digest was then ligated and
transformed in to E.coli DH5α cells. Positive clones were analyzed, plasmids were
purified from positive clones and sequence verified (data not shown). Sequence
confirmed PAG2-2 plasmids and pET21b vector were digested with NdeI restriction
enzyme for vector validation.
5.1.2 Isolation of Mutations in doc that are Used for In Vitro Toxicity Assay
To investigate mechanism of Doc toxin several different mutations had to be created in
areas believed to be responsible for toxicity and binding region of antitoxin partner. To
identify residues essential for toxicity of Doc we performed site directed mutagenesis
based on the information we obtained from published crystal structures (Garcia-Pino et
al., 2008). Moreover, the previously described less toxic DocH66Y (Magnuson &
Yarmolinsky, 1998) was also used as basis for studying toxicity. This less toxic mutant
was used to generate double mutant assuming that DocH66Y still has in vitro translation
Chapter 5: Results 44
Mechanism of Action of Doc (Death on Curing) from Phage P1
inhibition capacity. DocH66Y purifies as a dimer most of the cases and it is not
established whether reduced toxicity is a consequence of dimer formation or the single
amino acid change.
The following Doc mutants were attempted to be created: DocH66Aand DocH66N in
order to have mutant Doc monomers since the already established less toxic DocH66Y
mostly purifies as a dimer and hence help in establishing the role of residue His66 on Doc
toxicity; double mutants DocA61R/DocH66Y and DocH66Y/DocN78W in the two Phd
binding regions of Doc. These double mutants were to disrupt either of the two Phd
binding sites of Doc. This was assumed to generate toxic mutant that will not be
counteracted by Phd; DocA61R and DocN78W in the Phd binding region of wild type
Doc
We were unable to transform DocH66A, DocH66N and DocN78W mutants after
construction (PCR and DpnI restriction) possibly due to the fact that they are too toxic to
be transformed. Though we were able to construct and transform the double mutants
DocA61R/DocH66Y and DocH66Y/DocN78W, they were not be used for in vitro
toxicity assay because the DocH66Y monomer turned non toxic in vitro (detailed below).
We constructed successfully expression vectors PAG2-2 enabling production of
DocA61R. The codon GCT was replaced by codon CGT in the DocA61R mutant. This
mutant will be used for in vitro toxicity assay (detailed below).
Figure 5.1: The docA61R nucleotide sequence and amino acids sequence. The forward primer used to
generate this mutant is highlighted in green and, the single amino acid change and its codon are shown by
red.
Chapter 5: Results 45
Mechanism of Action of Doc (Death on Curing) from Phage P1
5.2 Expression and Purification of Phd, Doc, DocH66Y and DocA61R
Expression of Phd, Doc and DocA61R from plasmid PAG2-2 and DocH66Y from
plasmid pD21-5AD-9B were first tested at small scale level before going for large scale
expression and purification. Since the operon is under the control of Isopropyl β-D-1-
thiogalactopyranoside (IPTG) inducible promoter, induction of the operon with 1 mM
IPTG led to significant level of expression compared to before induction. This was
evidenced by SDS-PAGE analysis (Fig 5.2 A & B). SDS-PAGE analysis depicts correct
molecular weight of 8 and 13 KDa respectively for Phd and Doc (DocH66Y and
DocA61R) (Fig 5.2 A & B).
Figure 5.2: Small scale expression result of Phd, Doc, DocA61R (A) and DocH66Y (B). SDS-PAGE analysis of small-scale expression as described on material and methods (Expression and Purification). (A) Lane M, Molecular weight marker; Lane 1, Samples before induction; Lane 2, Samples 2 h after induction by 1 mM IPTG; (B) Lane 1; Samples before induction; Lane 2-3, Samples 1 h and 2 h after induction by 1 mM IPTG respectively; Lane M, Molecular weight marker.
After being tested and validated for expression, large scale expression and purification of
Phd, Doc, DocA61R and DocH66Y were performed in order to get enough protein for
further experiment. All proteins were purified from a clone E.coli strain
BL21(DE3)/PAG2-2 for Phd, Doc and DocA61R and BL21(DE3)/pD21-5AD-9B for
DocH66Y, a cell expressing bacteriophage P1 addiction proteins under Plac promoter
control (Blaber, 1998). C-terminally his tagged Doc (wild type and mutant) co expressed
and purified with or without Phd. As can be seen from the chromatogram (Fig 5.3 A) Phd
elutes at two peak step gradients; the first and the second peak that elutes in buffer 1.5 M
Chapter 5: Results 46
Mechanism of Action of Doc (Death on Curing) from Phage P1
GdHCl, 0.2 M Tris PH 8.0 and 3 M GdHCl, 0.2 M Tris PH 8.0 respectively. On the other
hand Doc (both wild type and mutant) elutes in buffer 3 M GdHCl, 50 mM imidazole, 0.2
M Tris PH 8.0. Samples after induction but pre purification and samples of respective
peaks were analyzed by SDS-PAGE, and the result is presented as shown in the Fig 5.3
(B) and confirms induction and identity of each peak.
Figure 5.3: Purification of C-terminally His-tagged Doc (wild type and mutant) and Phd through immobilized metal affinity chromatograph and SDS-PAGE analysis.
(A) Phd elutes at two peaks, Phd1 and Phd2. Step gradient purification was performed. The loosely bound Phd elutes at first peak with the buffer 1.5 M GdHCl, 0.2 M Tris PH 8.0 and the tightly bound Phd elutes at the second peak with the buffer 3 M GdHCl, 0.2 M Tris PH 8.0. Both wild type and mutant Doc elutes at the last peak with the buffer 3 M GdHCl, 50 mM imidazole, 0.2 M Tris PH 8.0.
(B) SDS-PAGE analysis of purification of Phd and Doc (wild type and mutant) from induction of bacterial culture to the elution of the proteins. Lane 1, Samples after induction and cell harvest, Lane 2-3, Samples after two peaks of purified Phd, Lane 4, Samples after peak of purified Doc and Lane M, Unstained Protein Molecular Weight Marker.
Chapter 5: Results 47
Mechanism of Action of Doc (Death on Curing) from Phage P1
5.3 DocH66Y Reduces Cell Growth In Vivo
Plasmid pD21-5AD-9B contains mutated doc, docH66Y, of bacteriophage P1 cloned
downstream of IPTG inducible promoter pET21 of pET21b (Blaber, 1998). E.coli Strain
BL21(DE3)/pD21-5AD-9B was grown exponentially and IPTG added at a point when
absorbance reached OD600nm of approximately 0.5 (Fig 5.4). As seen from the growth
curve, the increase in optical density significantly drops shortly after induction compared
to non-induced culture. Basal level expression of DocH66Y were not found toxic to cell
growth but cells that are experienced DocH66Y over production showed evidence of
reduction in growth (Fig 5.4). The reduction in optical density suggests that either
DocH66Y kills the host cell or promote state in which growth is inhibited. It is very
difficult to transform a plasmid containing doc to pursue expression and toxicity assay in
absence of partner antitoxin, phd.
Figure 5.4: DocH66Y reduces cell growth, Effect of over expression of DocH66Y on cell growth. E.coli strain BL21(DE3) carrying pD21-5AD-9D (pET21b::docH66Y) was grown exponentially in Luria-Bertani (LB) broth plus 2% glucose and 100 µg/ml of ampicillin at 37oC. To induce expression of DocH66Y 0.5 mM IPTG was added when absorbance reached OD600 of approximately 0.5. Point of induction is shown by vertical arrow.
Chapter 5: Results 48
Mechanism of Action of Doc (Death on Curing) from Phage P1
5.4 Doc Inhibits Translation In Vitro
Purified Doc was used to assay if it can inhibits translation in vitro, we used an
EasyXpress E.coli extract. The reaction mixtures were incubated for 1 h at 37oC with
increasing concentration of purified Doc (1 pM, 500 pM, 750 pM, 1 nM, 100 nM, 250
nM, 500 nM, 1 µM). As seen from Fig 5.5 (A), 250 nM Doc inhibited translation . This
in vitro result is in consistent with inhibition of translation observed in vivo (Liu et al.,
2008; Garcia-Pino et al., 2008), and indicates that Doc target may be a component of or
associated with the translation machinery , consistent with the finding that Doc associates
with ribosome’s (Liu et al., 2008).
Chapter 5: Results
Mechanism of Action of Doc (Death on Curing) from Phage
Figure 5.5: In vitro analyses of Doc (A), Phd and against time (E). The reaction mixture was analysed using western blotting post 1h incubation at 37
A. Doc inhibits translation aliquots of EasyXpress reaction mixture.then analysed by western blot
B. Phd neutralizes Doc-mediated inhibition of translation. Increasing concentration of purified Phd was added to 20 µl of aliqThe reaction incubated for 1
C. Doc mutant A61R canwhat is performed for wild type Doc. The reaction was analysed by
D. Doc mutant H66Y canwhat is performed for wild type Doc except that in this case we used higher compared to wild type Doc. The reaction was analysed by
E. Phd can reverse inhibitory action of Doc blotting. “+” indicates positive control.
5.5 Phd Neutralizes Doc
The same assay was used to test if Phd can neutralize the inhibitory action of Doc
and to determine the stoichiometry of the neutralizing complex. The crystal structure of
Doc in complex with Phd indicates two functional Phd binding sites
clear if neutralization by Phd
unpublished results). Here, 250
EasyXpress positive-control DNA template
Chapter 5: Results
Mechanism of Action of Doc (Death on Curing) from Phage P1
analyses of Doc (A), Phd and Doc (B), DocA61R(C), DocH66Y (D) and, Phd and Doc The reaction mixture was analysed using western blotting post 1h incubation at 37
Doc inhibits translation in vitro. Increasing concentration of purified Doc was added to 20aliquots of EasyXpress reaction mixture. The reaction incubated for 1 h at 37then analysed by western blotting.
mediated inhibition of translation. Increasing concentration of purified Phd µl of aliquots of EasyXpress reaction mixture supplemented with 250
The reaction incubated for 1 h at 37oC. The reaction was then analysed by western blottingDoc mutant A61R cannot inhibit translation in vitro. The experimental-set up was very similar to
hat is performed for wild type Doc. The reaction was analysed by western blottingannot inhibit translation in vitro. The experimental-set up was very similar to
what is performed for wild type Doc except that in this case we used higher compared to wild type Doc. The reaction was analysed by western blotting.
inhibitory action of Doc all the time ≤ 2h. The reaction was analysed by . “+” indicates positive control.
eutralizes Doc In Vitro
The same assay was used to test if Phd can neutralize the inhibitory action of Doc
and to determine the stoichiometry of the neutralizing complex. The crystal structure of
Doc in complex with Phd indicates two functional Phd binding sites on Doc, but it is not
clear if neutralization by Phd requires both to be occupied (Garcia
. Here, 250 nM of purified Doc was added before addition of
ontrol DNA template. We then added increasing am
Chapter 5: Results 49
B), DocA61R(C), DocH66Y (D) and, Phd and Doc The reaction mixture was analysed using western blotting post 1h incubation at 37oC.
. Increasing concentration of purified Doc was added to 20 µl of The reaction incubated for 1 h at 37oC. The reaction was
mediated inhibition of translation. Increasing concentration of purified Phd supplemented with 250 nM Doc.
western blotting. set up was very similar to
western blotting. set up was very similar to
what is performed for wild type Doc except that in this case we used higher concentration as
2h. The reaction was analysed by western
The same assay was used to test if Phd can neutralize the inhibitory action of Doc in vitro
and to determine the stoichiometry of the neutralizing complex. The crystal structure of
on Doc, but it is not
requires both to be occupied (Garcia-Pino and loris -
nM of purified Doc was added before addition of
. We then added increasing amounts Phd (1
Chapter 5: Results 50
Mechanism of Action of Doc (Death on Curing) from Phage P1
nM, 50 nM, 125 nM, 250 nM, 500 nM, 1 µM, 10 µM) to Doc-treated reaction mixture in
order to determine whether Phd can neutralize in vitro Doc toxicity or not. As seen from
Fig 5.5 (B), in this assay, Phd neutralized the toxic effect of Doc. Neutralization of
inhibition was achieved at concentration of 250 nM of Phd. This result shows that Phd is
functional in vitro and that Phd in this experimental set-up can neutralize Doc mediated
inhibition of translation. Moreover, the result demonstrate that neutralization of toxicity
is possible at equimolar concentration of Phd with Doc and this result suggests that one
of the two binding site of Phd on Doc is enough to reverse toxicity.
Similar experiment was repeated but this time with equimolar concentration of Doc and
Phd against time, to test if Phd can reverse Doc-toxicity a posterior. Here, 250 nM of
purified Doc was added at the start of the experiment and challenged with 250 nM of
purified Phd at times 0 h, 0.25 h, 0.5 h, 1 h, 1.5 h and 2 h. As seen from Fig 5.5 (E), in
this assay, Phd reverses the inhibitory effect of Doc. Reversal of inhibition was achieved
at all time points in this experimental set-up. This result shows that Phd can reverse Doc
mediated inhibition even after 2 h incubation with the toxin Doc. This result suggests that
Doc blocks translation sterically and probably does not enzymatically modifies the
translation apparatus or the mRNA unlike other TA’s that enzymatically cleaves mRNA
to inhibit translation in ribosome dependent and in dependent manner as in case of RelE
and MazF respectively (Christensen et al., 2001; Christensen et al., 2003; Pederson et al.,
2003; Zhang et al., 2003; Munoz-Gomez et al., 2004; Takagi et al., 2005; Zhang et al.,
2005).
5.6 DocA61R and DocH66Y do not Inhibit Translation In Vitro
Next we tested the Doc mutants A61R and H66Y for their ability to inhibit translation in
vitro. These were the only two single point mutations that we were able to introduce in a
wild-type Doc background. DocA61R has one of its Phd binding sites disrupted while
DocH66Y is a mutant that was previously described (Magnuson & Yarmolinsky, 1998).
Although the mutation is located outside the Phd binding regions, it is located in a
conserved surface loop and significantly reduces the toxicity of the protein in vivo. In
contrast to the wild-type protein, DocH66Y purifies as a domain-swapped dimer (Garcia-
Chapter 5: Results 51
Mechanism of Action of Doc (Death on Curing) from Phage P1
Pino and Loris - unpublished results) and it is not known if its reduced toxicity is a direct
consequence of dimer formation, or whether His66 is a crucial residue for interaction
with the ribosome. The in vitro translation assay was used to test if DocA61R and
DocH66Y (in its monomeric form) can inhibit translation. The reaction mixtures were
incubated for 1 h at 37oC with increasing amounts of purified DocA61R (1 pM, 500 pM,
750 pM, 1 nM, 100 nM, 250 nM, 500 nM and 1 µM) and DocH66Y (50 nM, 250 nM, 1
µM, 5 µM, 25 µM, 100 µM and 250 µM). As seen from Fig 5.5 (C & D), neither of the
Doc mutants can inhibit translation in vitro at all concentration tested. This result shows
that DocA61R and DocH66Y are not toxic at this concentration range in vitro and in
contrast, we observed that over expression DocH66Y reduces growth (Fig 5.4). These
results suggest that His66 and Ala61 are involved in the functional activity of Doc.
5.7 DocH66Y and DocA61R Possesses Definite Secondary Structure
In order to establish that the apparent inactivity of DocA61R and DocH66Y is not due to
(partial) unfolding of the proteins, their secondary structure contents was verified with
CD spectroscopy and compared with that of wild-type Doc. The far UV CD spectra of
both mutants are indistinguishable from the CD spectrum of the wild-type protein,
indicating that they are properly folded (Fig 5.6). The observed similar secondary
structure between the wild type and mutant Doc suggests that the failure to inhibit in vitro
translation is rather due to mutation.
Figure 5.6: Far UV-CD Spectra of Doc, DocA61R and DocH66Y. The far UV CD spectrums of these proteins are identical within experimental error and suggest that all proteins are properly folded.
Mechanism of Action of Doc (Death on Curing) from Phage P1
6. Discussion
TA systems characterize the newly discovered defense mechanisms of free-living
bacteria (Gerdes et al., 2005). They are addition to the already enlisted defense
mechanisms of free-living bacteria. TA’s do their job in one of the following way:
Chromosomally encoded TA toxins confers advantage to the free-living bacterial
population by protecting them from stress by initiating signals to pull cells from an active
growth mode into a quasidormant phase (e.g, mazEF); plasmid-encoded toxins facilitate
postsegregational killing to maintain an extra chromosomal element that conveys a
survival advantage to the cell (e.g, P1 bacteriophage).
The toxin components of TA systems are regarded as intracellular time bombs that
detonate upon accidental release from the complex. This means that their release from
complexes with their partner antitoxins can initiate bacterial cell death or cell cycles
arrest (Hayes, 2003). Understanding the activation and mechanism of killing of toxins
could allow the possibility of exploiting the knowledge for designing novel antibacterial
for pathogens of medical importance. TA’s are absent in eukaryotes (Aizenman et al.,
1996; Gerdes, 2000; Christensen et al., 2001; Pedersen et al., 2003). Their absence in
eukaryotes and ubiquitous presence in prokaryotes including pathogens give the exciting
possibilities to use them as antibacterial agent. One possible approach is to target TA
system by preventing toxin and antitoxin components from interacting in vivo, which
would trigger their inhibitory (or lethal) effect on cell growth. The advantage of using TA
system as antibacterial thus provide the opportunities of avoiding drug associated side
effects to the patient. This is unlike the existing conventional antibiotics that may affect
the patient as well.
Studies over the past couple of decades gradually elucidated the molecular mechanisms
of quasidormancy or cell killing initiated by TA toxins. Up to now TA toxins are known
to interfere with one or more vital processes such as DNA replication, RNA transcription
and protein translation- with DNA gyrase, mRNA and ribosomes serving respectively as
toxin target. Doc has been shown to associate with the 70s ribosome and with the 30s
ribosomal subunit in that it inhibits translation through introducing defects of translation
elongation (Liu et al., 2008). Here we showed that Doc inhibits translation in vitro and
Chapter 6: Discussion 53
Mechanism of Action of Doc (Death on Curing) from Phage P1
Phd can rescue Doc mediated in vitro translation inhibition. Introduction of single amino
acid change at and near Phd binding site of Doc completely abolish in vitro translation
inhibition ability of Doc.
Results from previous work on Doc toxin demonstrate that over expression of Doc
inhibited translation very efficiently (Liu et al., 2008; Garcia-Pino et al., 2008). Doc
binds to ribosomes and interferes with translation the same way as antibiotic Hygromycin
B. This was evidenced by Hygromycin B resistant cells that remain also unaffected by
Doc. Hygromycin B primarily function as an inhibitor of translation elongation; it acts at
translocation step by preventing movement of peptidyl tRNA from the A site to P site
(Cabanas et al., 1978; Cabanas et al., 1978; Eustice & Wilhelm, 1984). It has thus been
suggested that Doc hampers translation elongation, as Hygromycin B does, at
translocation step by averting movement of peptidyl tRNA from the A site to P site (Liu
et al., 2008). This gives a clue on mechanism of action of Doc toxin. These in vivo results
are in agreement with in vitro inhibition of translation observed in our experiment (Fig
5.5 A).
Phd could rescue cells inhibited by Doc (Liu et al., 2008; Garcia-Pino et al., 2008) and
can rescue Doc-mediated in vitro translation inhibition all the time post translation
inhibition activation (Fig 5.5 B & E) showing that cells experiencing Doc synthesis are
not killed. Rather, Doc seems to induce a condition in which cells are permanently
stationary and unable to form a colony. Moreover, our in vitro experiment (Fig 5.5 E)
provide a clue that Doc blocks translation sterically and probably does not enzymatically
modifies the translation apparatus or the mRNA unlike other TA’s that enzymatically
cleaves mRNA to inhibit translation in ribosome dependent and in dependent manner as
in case of RelE and MazF respectively (Christensen et al., 2001; Christensen et al., 2003;
Pederson et al., 2003; Zhang et al., 2003; Munoz-Gomez et al., 2004; Takagi et al., 2005;
Zhang et al., 2005) Further studies are nevertheless required to substantiate these finding.
In P1 lysogens, Phd binding spares the cell from Doc-mediated growth arrest by forming
heterotrimeric complex (P2D; 2 Phd : 1 Doc) (Gazit & Saurer, 1999).This means that the
two Phd binding site on Doc need to be occupied for toxin neutralization to occur. This
Chapter 6: Discussion 54
Mechanism of Action of Doc (Death on Curing) from Phage P1
conclusion is argued by our experimental result that demonstrates neutralization of Doc
toxicity at equimolar concentration (Fig 5.5 B). This shows that it might not be essential
for neutralization of toxicity to occur both Phd binding site on Doc need to be occupied.
Complex formation not only spares the cells from Doc action but also protect Phd from
degradation mediated directly or indirectly by the ClpXP protease, which consists of Clp
protease subunit and regulatory ClpX ATPase subunits (Wawrzynow et al., 1995; Wang
et al., 1997; Griamaund et al., 1998). Phd donates its intrinsically non structured C-
terminal domain to form complex with Doc that in turn assist Phd to possess definite
structure and provide protection from degradation by cellular protease and, at the same
time spares cell from Doc action (Garcia-Pino et al., 2008).
Several lines of independent evidence show that Doc induced inhibition of growth are
caused by interference with protein translation: (i) Doc inhibit translation in vivo (Liu et
al., 2008; Garcia-Pino et al., 2008) and in vitro (Fig 5.5 A); (ii) Doc induces RelE
mediated mRNA cleavage (Garcia-Pino et al., 2008); (iii) mutation A61R and H66Y in
Doc did not inhibit translation in vitro (Fig 5.5 B & C) and showed reduced toxicity in
vivo (DocH66Y)( Magnuson & Yarmolinsky, 1998); (iv) addition of Phd neutralized and
reversed in vitro translation inhibition (Fig 5.5 B & E) and simultaneously reversed
inhibition of translation and cell growth (Liu et al., 2008). These studies clearly indicate
that Doc target may be a component of or associated with the translation machinery.
These results lend solid support for the conclusion that Doc-induced cell stasis is caused
by inhibition of translation.
Our result suggest that His66 and Ala61, located near and on Phd binding site
respectively on one face of Doc α-helix, are strongly involved in the functional activity of
Doc. Further studies on these amino acids and others will provide valuable information
for establishing the molecular mechanism and ribosome-binding activity of the Doc toxin
and also for establishing the indispensable binding site for toxin neutralization from the
two Phd sites on Doc.
Reference 55
Mechanism of Action of Doc (Death on Curing) from Phage P1
7. References
Afif, H., Allali, N., Couturier, M. and van Melderen, L. (2001): The ratio between CcdA and
CcdB modulates the transcriptional repression of the ccd poison-antidote system. Mol
Microbiol. 41 (1), 73-82.
Aizenman, E., Engelberg-Kulka, H. and Glaser, G. (1996): An Escherichia coli chromosomal
“addiction module” regulated by guanosine 3′, 5′-bispyrophosphate: a model for
programmed bacterial cell death. Proc Natl Acad Sci USA. 93 (12), 6059-6063.
Amitai, S., Yassin, Y. and Engelberg-Kulka, H. (2004): MazF-mediated cell death in Escherichia
coli: a point of no return. J Bacteriol. 186 (24), 8295-8300.
Arcus, V.L., Bäckbro, K., Roos, A., Daniel, E.L. and Baker, E.N. (2004): Distant structural
homology leads to the functional characterization of an archaeal PIN domain as an
exonuclease. J Biol Chem. 279 (16), 16471-16478.
Bayles, K.W. (2007): The biological role of death and lysis in biofilm development. Nat Rev
Microbiol. 5 (9), 721-726.
Bravo, A., de Torrontegui, G. and Diaz, R. (1987): Identification of components of a new stability
system of plasmid R1, ParD, that is close to the origin of replication of this plasmid. Mol
Gen Genet. 210 (1), 101-110.
Budde, P.P., Davis, B.M., Yuan, J., and Waldor, M.K. (2007): Characterization of a higBA Toxin-
Antitoxin Locus in Vibrio cholerae. J Bacteriol. 189 (2), 491-500
Buts, L., Lah, J., Dao-Thi, M.H., Wyns, L., and Loris, R. (2005): Toxin-Antitoxin modules as
bacterial metabolic stress managers. Trends Biochem Sci. 30 (12), 672-679
Cabanas, M.J., Vazquez, D. and Modolell, J. (1978): Dual interference of hygromycin B with
ribosomal translocation and with aminoacyl-tRNA recognition. Eur J Biochem. 87 (1),
21-27
Cabanas, M.J., Vazquez, D. and Modolell, J. (1978): Inhibition of ribosomal translocation by
aminoglycoside antibiotics. Biochem Biophys Res Commun. 83 (3), 991-997.
Cherny, I. and Gazit, E. (2004): The YefM antitoxin defines a family of natively unfolded proteins:
implications as a novel antibacterial target. J Biol Chem. 279 (9), 8252-826.
Christensen, S.K. and Gerdes, K. (2003): RelE toxins from bacteria and archaea cleave mRNAs
on translating ribosomes, which are rescued by tmRNA. Mol Microbiol. 48 (5), 1389-
1400
Reference 56
Mechanism of Action of Doc (Death on Curing) from Phage P1
Christensen, S.K., Maenhaut-Michel, G., Mine, N., Gottesman, S., Gerdes, K. and van Melderen,
L. (2004): Overproduction of the Lon protease triggers inhibition of translation in
Escherichia coli: involvement of the yefM-yoeB toxin-antitoxin system. Mol Microbiol.
51 (6), 1705-1717.
Christensen, S.K., Mikkelsen, M., Pedersen, K. and Gerdes, K. (2001): RelE, a global inhibitor of
translation, is activated during nutritional stress. Proc Natl Acad Sci USA. 98 (25),
14328-14333.
Christensen, S.K., Pedersen, K., Hansen, F.G., Gerdes, K. (2003): Toxin-antitoxin loci as stress-
response-elements: ChpAK/MazF and ChpBK cleave translated RNAs and are
counteracted by tmRNA. Mol Biol. 332 (4), 809-819.
Christensen-Dalsgaard, M. and Gerdes, K. (2006): Two higBA loci in the vibrio cholera
superintegron encode mRNA cleaving enzymes and stabilize plasmids. Mol Microbiol.
62 (2), 397-411.
Critchlow, S.E., O'Dea, M.H., Howells, A.J., Couturier, M., Gellert, M. and Maxwell, A. (1997):
The interaction of the F plasmid killer protein, CcdB, with DNA gyrase: induction of
DNA cleavage and blocking of transcription. Mol Biol. 273 (4), 826-839.
Dao-Thi, M.H., Charlier, D., Loris, R., Maes, D. Messens, J., Wyns, L. and Backmann, J. (2002):
Intricate interactions within the ccd plasmid addiction system. J Biol Chem. 277 (5),
3733-3742.
Dao-Thi, M.H., Messens, J., Wyns, L. and Backmann, J. (2000): The thermodynamic stability of
the proteins of the ccd plasmid addiction system. Mol Biol. 299 (5), 1373-1386.
Dao-Thi, M.H., van Melderen, L., De Genst, E., Afif, H., Wyns, L. and Loris, R.(2005):
Molecular basis of gyrase poisoning by the addiction toxin CcdB. Mol Biol. 348 (5),
1091-1102.
de la Hoz, A.B., Ayora, S., Sitkiewicz, I., Fernandez, S., Pankiewicz, R., Alonso, J.C. and
Ceglowski, P. (2000): Plasmid copy-number control and better-than-random segregation
genes of pSM19035 share a common regulator. Proc Natl Acad Sci. USA. 97 (2), 728-
733.
del Solar, G., Hernandez-Arriaga, A.M., Gomis-Ruth, F.X., Coll, M., and Espinosa, M. (2002): A
genetically economical family of plasmid-encoded transcriptional repressors involved in
control of plasmid copy number. J Bacteriol. 184 (18), 4943-4951
Reference 57
Mechanism of Action of Doc (Death on Curing) from Phage P1
Engelberg-Kulka, H. and Glaser, G. (1999): Addiction modules and programmed cell death and
antideath in bacterial cultures. Ann Rev Microbiol. 53, 43-70.
Engelberg-Kulka, H., Amitai, S., Kolodkin-Gal, I. and Hazan, R.(2006): Bacterial Programmed
Cell Death and Muticellular Behavior in bacteria. PLos Genet. 2 (10), e135.
Engelberg-Kulka, H., Hazan, R. and Amitai, S. (2005): mazEF: a chromosomal toxin-antitoxin
module that triggers programmed cell death in bacteria. J Cell Sci. 118 (19), 4327-4332
Eustice, D.C. and Wilhelm, J.M. (1984): Fidelity of the eukaryotic codon–anticodon interaction:
Interference by amino glycoside antibiotics. Biochemistry. 23 (7), 1462-1467.
Garcia-Pino, A., Christensen-Dalsgaard, M., Wyns, L., Yarmolinsky, M., Magnuson, R.D.,
Gerdes, K. and Loris, R. (2008): Doc of prophage P1 is inhibited by its antitoxin partner
Phd though folds complementation. J Biol Chem. 283 (45), 30821-30827.
Gazit, E. and Sauer R.T. (1999): The Doc Toxin and Phd Antidote Proteins of the Bacteriophage
P1 Plasmid Addiction System Form a Heterotrimeric Complex. J Biol Chem. 274 (24),
16813-16818.
Gerdes, K. (2000): Toxin-antitoxin module may regulate synthesis of macromolecules during
nutritional stress. J Bacteriol. 182 (3), 561-572.
Gerdes, K. and Wagner, E.G.H. (2007): RNA antitoxins. Curr.Opin.Microbiol. 10 (2), 117-124.
Gerdes, K., Christensen, S.K. and Løbner-Olesen, A. (2005): Prokaryotic toxin-antitoxin stress
response loci. Nat Rev Microbiol. 3 (5), 371-382
Gerdes, K., Gultyaev, A. P., Franch, T., Pedersen, K. and Mikkelsen, N. D. (1997): Antisense
RNA-Regulated Programmed Cell Death. 31, 1-31
Gerdes, K., Helin, K., Christensen, O.W. and Løbner-Olesen, A. (1988): Translational control and
differential RNA decay are key elements regulating postsegregational expression of the
killer protein encoded by the parB locus of plasmid R1. Mol Biol. 203 (1), 119-129.
Gerdes, K., Rasmusen, P.B. and Molin, S. (1986): unique type of plasmid maintenance function:
postsegregational killing of plasmid-free cells. Proc Natl Acad Sci USA. 83 (10), 3116-
3120.
Gogos , A., Mu, H., Bahna, F., Gomez, C.A. and Shapiro, L. (2003): Crystal structure of YdcE
from Bacillus subtilis. Proteins. 53 (2), 320-322.
Reference 58
Mechanism of Action of Doc (Death on Curing) from Phage P1
Gotfredsen, M. and Gerdes, K. (1998): The Escherichia coli relBE genes belong to a new toxin-
antitoxin gene family. Mol Microbiol. 29 (4), 1065-1076
Grady, R. and Hayes, F. (2003): Axe-Txe, a broad-spectrum proteic toxin-antitoxin system
specified by a multidrug-resistant, clinical isolate of Enterococcus faecium. Mol
Microbiol. 47 (5), 1419-1432.
Grimaud, R., Kessel, M., Beuron, F., Steven, A.C. and Maurizi, M.R. (1998): Enzymatic and
Structural Similarities between the Escherichia coli ATP-dependent Proteases, ClpXP
and ClpAP. J Biol Chem. 273 (20), 12476-12481.
Guglielmini, J., Szpirer, C. and Milinkovitch, M.C. (2008): Automated discovery and
phylogenetic analysis of new toxin-antitoxin systems. BMC Microbiol. 8 (104), 1471-
2180.
Hall-Stoodley, L., Costerton, J.W. and Stoodley, P. (2004): Bacterial biofilms: from the Natural
environment to infectious diseases. Nat Rev Microbiol. 2 (2), 95-108.
Hanahan, D., Jessee, J. and Bloom, F.R. (1991): Plasmid transformation of Escherichia coli and
other bacteria. Methods Enzymol. 204, 63-113.
Hargreaves, D., Santos-Sierra, S., Giraldo, R., Sabariegos-Jareno, R., de la Cueva-Me´ ndez, G.,
Boelens, R., Dı´az-Orejas, R. and Rafferty, J.B. (2002): Structural and functional analysis
of the Kid toxin protein from E. coli plasmid R1. Structure. 10 (10), 1425-1433.
Hayes, F. (2003): Toxins-Antitoxins: Plasmid Maintenance, Programmed Cell Death, and Cell
Cycle Arrest. Science. 301 (5639), 1496-1499.
Hazan, R., Sat, B. and Engelberg-Kulka, H. (2004): Escherichia coli mazEF mediated cell death is
triggered by various stressful conditions. J Bacteriol. 186 (11), 3663-3669.
Hazan, R., Sat, B., Reches, M. and Engelberg-Kulka, H. (2001): The postsegregational killing
mediated by the phage P1 `addiction module': phd-doc requires the Escherichia coli
programmed cell death system mazEF. J Bacteriol. 183 (6), 2046-2050.
Heinrich, J., Velleman, M. and Schuster, H. (1995): The tripartite immunity system of phages P1
and P7. FEMS Microbiol Rev. 17 (1-2), 121-126.
Hentgartner, M.O. (2000): The biochemistry of apoptosis. Nature. 407 (6805), 770-776.
Hunter, P. (2008): The mob response. The importance of biofilm research for combating chronic
disease and tackling contamination. EMBO Rep. 9 (4), 314-317.
Reference 59
Mechanism of Action of Doc (Death on Curing) from Phage P1
Ikeda, H. and Tomizawa, J.I. (1965): Transducing fragments in generalized transduction by phage
P1.3. Studies with small phage particles. Mol Biol. 14 (1), 120-129.
Jacobson, M.D., Weil, L. and Raff, M.C. (1997): Programmed cell death in animal development.
Cell. 88 (3), 347-354.
Jensen, R.B. and Gerdes, K. (1995): Programmed cell death in bacteria: proteic plasmid
stabilization systems. Mol Microbiol. 17 (2), 205-210
Johnson, E.P., Strom, A.R. and Helinski, D.R. (1996): Plasmid RK2 toxin protein ParE:
purification and interaction with the ParD antitoxin protein. J Bacteriol. 178 (5), 1420-
1429.
Kamada, K. and Hanaoka, F. (2005): Conformational change in the catalytic site of the
ribonuclease YoeB toxin by YefM antitoxin. Mol Cell. 19 (4), 497-509.
Kamada, K., Hanaoka, F. and Burley S.K. (2003): Crystal structure of the MazE/MazF complex:
molecular bases of antidote-toxin recognition. Mol Cell. 11 (4), 875-884.
Koyama, A.H., Wada, C., Nagata, T. and Yura, T. (1975): Indirect selection for plasmid mutants:
Isolation of ColVBtrp mutants’ defective in self maintenance in Escherichia coli. J
Bacteriol. 122 (1), 73-79.
Laemmli, U.K. (1970): Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature. 227 (5259), 680-685.
Lane, N. (2008): Marine microbiology: origins of death. Nature. 453 (7195), 583-585.
Lehnherr, H. and Yarmolinsky, M.B. (1995): Addiction protein Phd of plasmid prophage P1 is a
substrate of the ClpXP serine protease of Escherichia coli. Proc Natl Acad Sci USA. 92
(8), 3274-3277.
Lehnherr, H., Maguin, E., Jafri, S. and Yarmolinsky, M.B. (1993): Plasmid addiction genes of
bacteriophage P1: doc, which causes cell death on curing of prophage, and phd, which
prevents host death when prophage is retained. Mol Biol. 233 (3), 414-428.
Lemmonier, M., Santos-Siera, S., Pardo-Abario, C. and Diaz-Orejas, R. (2004): Identification of
Residues of the Kid Toxin Involved in Autoregulation of the parD System. J Bacteriol.
186 (1), 240-243.
Lewis, K. (2000): Programmed Death in Bacteria. Microbiol and Molecul Biol. 64 (3), 503-514.
Reference 60
Mechanism of Action of Doc (Death on Curing) from Phage P1
Liu, M., Zhang, Y., Inouye, M. and Woychik, N.A. (2008): Bacterial addiction module toxin Doc
inhibits translation elongation through its association with the 30S ribosomal subunit.
Proc Natl Acad Sci USA. 105 (15), 5885-5890.
Lobocka, M.B., Rose, D.J., Plunkett, G.III, Rusin, M., Samojedny, A., Lehnherr, H., Yarmolinsky,
M.B. and Blattner, F.R. (2004): Genome of Bacteriophage P1. J Bacteriol. 186 (21),
7032-7068.
Loris, R., Dao-Thi, M.H., Behassi, E.M., van Melderen, L., Poortmans, F., Liddington, R.,
Couturier, M. and Wyns, L. (1999): Crystal structure of CcdB, a topoisomerase poison
from E. coli. Mol Biol. 285 (4), 1667-1677.
Loris, R., Marianovsky, I., Lah, J., Laeremans, T., Engelberg-Kulka, H., Glaser, G., Muyldermans
S. and Wyns, L. (2003): Crystal Structure of the Intrinsically Flexible Addiction Antidote
MazE. J Biol Chem. 278 (30), 28252-28257.
Magnuson, R.D and Yarmolinsky, M.B. (1998): Corepression of the P1 addiction operon by Phd
and Doc. J Bacteriol. 180 (23), 6342-6351.
Magnuson, R.D., (2007): Hypothetical Functions of Toxin-Antitoxin Systems. J Bacteriol. 189
(17), 6089-6092.
Magnuson, R.D., Lehnherr, H., Mukhopadhyay, G. and Yarmolinsky, M.B. (1996):
Autoregulation of the Plasmid Addiction Operon of Bacteriophage P1. J Biol Chem. 271
(31), 18705-18710.
Maki, S., Takiguchi, S., Miki, T. and Horiuchi, T. (1992): Modulation of DNA supercoiling
activity of Escherichia coli DNA gyrase by F plasmid proteins. Antagonistic actions of
LetA (CcdA) and LetD (CcdB) proteins. J Biol Chem. 267 (17), 12244-12251.
Mandl, T., van Melderen, L., Mine, N., Respondek, M., Oberer, M., Keller, W., Khatai, L. and
Zangger, K. (2006): Structural Basis for Nucleic Acid and Toxin Recognition of the
Bacterial Antitoxin CcdA. Mol Biol. 364 (2), 170-185.
Marionovsky, I., Aizenman, E., Engelberg-Kulka, H. and Glaser, G. (2001): The regulations of
Escherichia coli mazEF promoter involve an unusual alternating palindrome. J Biol
chem. 276 (8), 5975-5984.
Mcknley, J.E. and Magnuson, R.D. (2005): Characterization of the Phd repressor-antitoxin
boundary. J Bacteriol. 187 (2), 765-70.
Reference 61
Mechanism of Action of Doc (Death on Curing) from Phage P1
Meinhart, A., Alonso, J.C., Strater, N. and Saenger, W. (2003): Crystal structure of the plasmid
maintenance system ε/ζ: Functional mechanism of toxin ζ and inactivation by ε2ζ2
complex formation. Proc Natl Acad Sci USA. 100 (4), 1661-1666.
Mullis, K.B. (1990): The unusual origin of the Polymerase Chain Reaction. Scientific American.
April: 36-43.
Munoz-Gomez, A.J., Santos-Sierra, S., Berzal-Herranz, A., Lemonnier, M. and Diaz-Orejas, R.
(2004): Insights into the specificity of RNA cleavage by the Escherichia coli MazF toxin.
FEBS Lett. 567 (2-3), 316-320.
Nagata, S. (1997): Apoptosis by death factor. Cell. 88 (3) 355-365.
Naito, T., Kusano, K. and Kobayashi, I. (1995): Selfish behavior of restriction-modification
systems. Science. 267 (5199), 897-899.
Oberer, M., Zangger, K., Gruber, K. and Keller, W. (2007): The solution structure of ParD, the
antidote of the ParDE toxin-antitoxin module, provides the structural basis for DNA and
toxin binding. Protein Sci. 16 (8), 1676-1688.
Ogura, T. and Hiraga, S. (1983): Mini-F plasmid genes that couple host cell division to plasmid
proliferation. Proc Natl Acad Sci USA. 80 (15), 4784-4788.
Pandey, D.P. and Gerdes, K. (2005): Toxin-antitoxin loci are highly abundant in free-living but
lost from host-associated prokaryotes. Nucleic Acids Research. 33 (3), 966-976.
Pedersen, K., Zavialov, A.V., Pavlov, M.Y., Elf, J., Gerdes, K. and Ehrenberg, M. (2003): The
bacterial toxin RelE displays codon-specific cleavage of mRNAs in the ribosomal A site.
Cell. 112 (1), 131-140.
Perry, J.J., Staley, J.T. and Lory, S. (2002): Microbial Life, Chapter 15- Genetic exchange, pages
311-330. Sinauer Associates, Inc., Massacheusetts (MA), USA.
Phillips, S.E. (1994): The β-ribbon DNA recognition motif. Annu Rev Biophys Biomol Struct. 23,
671-701.
Pomerantsev, A.P., Golovliov, I.R., Ohara, Y., Mokrievich, A.N., Obuchi, M., Norqvist, A.,
Kuoppa, K. and Pavlov V.M. (2001): Genetic organization of the Francisella plasmid
pFNL10. Plasmid. 46 (3), 210-222.
Porath, J., Carlsson, J., Olsson, I. and Belfrage, G. (1975): Metal Chelate affinity chromatography,
a new approach to protein fractionation. Nature. 258 (5536), 598-599.
Raff, M. (1998): Cell Suicide for beginners. Nature. 396 (6707), 119-122.
Reference 62
Mechanism of Action of Doc (Death on Curing) from Phage P1
Raumann, B.E., Rould, M.A., Pabo, C.O. and Sauer, R.T. (1994): DNA recognition by β-sheets in
the Arc repressor-operator crystal structure. Nature. 367 (6465), 754-757.
Rice, K.C. and Bayles, K.W. (2008): Molecular control of bacterial death and Lysis. Micro Mol
Biol Rev. 72 (1), 85-109.
Roberts, R.C., Strom, A.R. and Helinski, D.R. (1994): The parDE operon of the broad-host-range
plasmid RK2 specifies growth inhibition associated with plasmid loss. Mol Biol. 237 (1),
35-51.
Rowe-Magnus, D.A., Guerout, A.M., Biskri, L., Bouige, P. and Mazel, D. (2003): Comparative
analysis of super integrons: engineering extensive genetic diversity in the Vibrionaceae.
Genome Res. 13, 428-442.
Sambrook, J., Fritisch, E.F., and Maniatis, T. (1989): ‘‘Molecular Cloning: A Laboratory
Manual.’’ Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Santos-Sierra, S., Pardo-Abarrio, C., Giraldo, R. and Diaz-Orejas, R. (2002): Genetic
identification of two functional regions in the antitoxin of the ParD killer system of
plasmid R1. FEMS Microbiol Lett. 206 (1), 115-119.
Sat, B., Hazan, R., Fisher, T., Khaner, H., Glaser, G. and Engelberg-Kulka, H. (2001):
Programmed cell death in Escherichia coli: some antibiotics can trigger the MazEF
lethality. J Bacteriol. 183 (6), 2041-2045.
Sat, B., Reches, M. and Engelberg-Kulka, H. (2003): The Escherichia coli chromosomal `suicide
module' mazEF is involved in thymine-less death. J Bacteriol. 185 (6), 1803-1807.
Saylers , A.A. and Whitt, D.D. (2002a): Bacterial pathogenesis: A molecular approach, chapter 1-
The un easy Truce : Never underestimate the power of bacteria, Pages 3-18. ASM press,
Maryland (MD), USA, Second edition.
Saylers , A.A. and Whitt, D.D. (2002b): Bacterial pathogenesis: A molecular approach, chapter
11-How bacteria become resistant to Antibiotics, Pages 168-184. ASM press, Maryland
(MD), USA, Second edition.
Schumacher, M.A., Piro, K.M., Xu, W., Hansen, S., Lewis, K. and Brennan, R.G. (2009):
Molecular mechanisms of HipA-mediated multidrug tolerance and its neutralization by
HipB. Science. 323 (5912), 396-401.
Smith, J.A. and Magnuson R.D. (2004): Modular Organization of the Phd Repressor/Antitoxin
Protein. J Bacteriol. 186 (9), 2692-2698.
Reference 63
Mechanism of Action of Doc (Death on Curing) from Phage P1
Studier, F.W., Rosenberg, A.H., Dunn, J.J. and Dubendorff, J.W. (1990): Use of T7 rna
polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89.
Takagi, H., Kakuta, Y., Okada, T., Yao, M., Tanaka, I. and Kimura, M. (2005): Crystal structure
of an archaeal toxin-antitoxin RelE-RelB complex with implications for toxin activity
and antitoxin effects. Nat Struct Mol Biol. 12 (4), 327-331.
Tian, Q.B., Ohnishi, M., Tabuchi, A., Terawaki, Y. (1996): A new plasmid-encoded proteic killer
gene system: cloning, sequencing, and analyzing hig locus of plasmid Rts1. Biochem
Biophys Res Commun. 220 (2), 280–284
Towbin, H., Staehelin, T. and Gordon, J. (1979): Electrophoretic transfer of proteins from
polyaccrylamide gels to nitrocellulose sheets: procedure and some applications. Proc
Natl Acad Sci USA. 76 (9), 4350-4354.
van Melderen, L. and Saavedra De Bast, M. (2009): Bacterial Toxin-Antitoxin systems: More
Than Selfish Entities? PLoS Genet. 5 (3), e1000437.
Vaughn, J.L., Feher, V.A., Bracken, C. and Cavanagh, J. (2001): The DNA-binding domain in the
Bacillus subtilis transition-state regulator AbrB employs significant motion for
promiscuous DNA recognition. Mol Biol. 305 (3), 429-439.
Wang, J., Hartling, J.A. and Flanagan, J.M. (1997): The Structure of ClpP at 2.3 A° Resolution
Suggests a Model for ATP-Dependent Proteolysis. Cell. 91, 447-456.
Wawrzynow, A., Wojtkowiak, D., Marszalek, J., Banecki, B., Jonsen, M., Graves, B.,
Georgopoulos, C. and Zylicz, M. (1995): The ClpX heat-shock protein of Escherichia
coli, the ATP-dependent substrate specificity component of the ClpP-ClpX protease, is a
novel molecular chaperone. EMBO J. 14 (9), 1867-1877.
Zhang, J., Zhang, Y. and Inouye, M. (2003): Characterization of the interactions within the mazEF
addiction module of Escherichia coli. J Biol Chem. 278 (34), 32300-32306.
Zhang, Y., Zhang, J., Hara, H., Kato, I. and Inouye, M. (2005): Insights into the mRNA cleavage
mechanism by MazF, an mRNA interferase. J Biol Chem. 280 (5), 3143-3150.
Zielenkiewicz, U. and Ceglowski, P. (2001): Mechanisms of plasmid stable maintenance with
special focus on plasmid addiction systems. Acta Biochim Pol. 48 (4), 1003-1023.
Recommended