View
3
Download
0
Category
Preview:
Citation preview
The Role of Stretch-Induced Myometrial Cytokines in
Leukocyte Recruitment During Parturition
by
Yu-Hui Lee
A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Physiology
University of Toronto
© Copyright Yu-Hui Lee 2013
ii
The role of stretch-induced myometrial cytokine expression
in leukocyte recruitment during parturition
Master of Science, 2013 Yu-Hui Lee
Department of Physiology, University of Toronto Abstract
Spontaneous term labour is associated with increased inflammatory events in the
myometrium including cytokine production and leukocyte infiltration. We hypothesized that
mechanical stretch of the uterine wall by the growing fetus facilitates peripheral leukocyte
transendothelial migration into the term pregnant myometrium through the release of various
cytokines. The current study demonstrated that static mechanical stretch directly induces
secretion of multiple cytokines and chemokines by human myometrial smooth muscle cells.
Stretch-induced cytokines (1) increased vascular permeability; (2) enhanced leukocyte adhesion
to the endothelium of the surrounding uterine microvasculature by (3) inducing the expression of
endothelial cell adhesion molecules; and (4) directed the transendothelial migration of peripheral
neutrophils. Our data provide a direct proof of mechanical regulation in leukocyte recruitment
from the uterine blood vessels, which represents a putative mechanism for the leukocyte infiltrate
seen in the myometrium during labour and postpartum involution.
iii
ACKNOWLEDGEMENTS
The years spent in Dr. Stephen Lye’s laboratory have been memorable and rewarding.
Not only did I develop many previous relationships with colleagues and professors, I’ve learned
important scientific knowledge and developed many scholarly skills. Special thanks to my
research supervisor, Dr. Stephen Lye, who allowed me to undertake my thesis project in his lab
and supported me all throughout. I would also like to thank Dr. Oksana Shynlova for her
tremendous dedication in mentoring me during my years in the lab. Of course, I wouldn’t be
where I cam now without each member of the Lye and Kingdom Labs during failed experiments,
silly science joke moments and big life direction discussions. I am so grateful for all of you:
Melissa Kwan, Richard Maganga, Dr. Jan Heng, Anna Dorogin, Ela Matysiak-Zablocki, Dr.
Jianhong Zhang, Hala Kufaishi, Tina Nguyen, Dr. Mark Kibschull, Dr. Lubna Nadeem, Dr.
Kristin Connor, Dr. Sascha Drewlo, Khrystyna Levytsky, Dora Bazyk and Farshad Ghasemi.
Also, Bev Bessey, thanks for all the help in scheduling meetings and pulling application
documents together. I’m also grateful for my supervisory committee members: Dr. Mingyao Liu
and Dr. Michelle Letarte. Thank you for the insightful discussions and comments to direct my
project. Also, thanks to Annie Bang for all the guidance and teaching in how to do flow
cytometry.
Thank you to all my family and friends in Taiwan, Vancouver, Calgary and Toronto for
all the love, prayers and support during my journey. I love you all and cannot wait to meet all of
you in the near future! Lastly, thank You Lord for blessing me with all these wonderful people
and for walking with me during my educational pursuits and life journey. I will continue to trust
and follow wherever You lead me to.
iv
CONTRIBUTIORS
The following individuals contributed to results presented in this thesis:
Anna Dorogin performed all the THP-1 experiments (adhesion and migration assays). Figures
3.10 and 3.12 were generated from her data.
Neil Rosen contributed to the MAPK inhibitor study with hTERT-HM cells. His work generated
Figure 3.3.
v
TABLE OF CONTENTS
ABSTRACT .................................................................................................................................... ii
ACKNOWLEDGEMENTS ........................................................................................................... iii
CONTRIBUTORS ......................................................................................................................... iv
TABLE OF CONTENTS ................................................................................................................ v
LIST OF TABLES ........................................................................................................................ vii
LIST OF FIGURES ..................................................................................................................... viii
LIST OF ABBREVIATIONS ........................................................................................................ ix
CHAPTER 1: LITERATURE REVIEW
1.1 OVERVIEW: TERM AND PRETERM LABOUR ............................................................................ 2
1.2 MATERNAL IMMUNE SYSTEM DURING PREGNANCY ........................................................... 3 1.2.1 PREGNANCY AS AN INFLAMMATORY PROCESS ................................................................................. 3 1.2.2 MATERNAL LEUKOCYTE POPULATIONS ............................................................................................ 7 1.2.2.1 Monocytes /Macrophages ................................................................................................................................... 8 1.2.2.2 Neutrophils ............................................................................................................................................................. 10 1.2.2.3 Lymphocytes ........................................................................................................................................................... 12
1.2.3 CYTOKINES AND CHEMOKINES DURING PREGNANCY ..................................................................... 15 1.2.4 PERIPHERAL LEUKOCYTE RECRUITMENT ........................................................................................ 22 1.2.4.1 Endothelial Activation ....................................................................................................................................... 23 1.2.4.2 Leukocyte Activation .......................................................................................................................................... 24
1.3 MECHANISM OF LABOUR ONSET ............................................................................................... 26 1.3.1 ENDOCRINE REGULATION ............................................................................................................... 26 1.3.2 LABOUR AS A PHYSIOLOGIC INFLAMMATORY PROCESS ................................................................. 27 1.3.2.1 Mechanical regulation – Myometrial Inflammation ............................................................................ 28 1.3.2.2 Decidual Inflammation ...................................................................................................................................... 32 1.3.2.3 Cervical ripening at term is not an inflammatory process ................................................................ 33
1.4 RATIONALE AND HYPOTHESIS ................................................................................................... 35 1.4.1 RATIONALE ..................................................................................................................................... 35 1.4.2 HYPOTHESIS AND OBJECTIVES ........................................................................................................ 35
CHAPTER 2: MATERIALS AND METHODS
2.1 MATERIALS ........................................................................................................................................ 37
2.2 METHODS ........................................................................................................................................... 37 2.2.1 HUMAN PERIPHERAL BLOOD COLLECTION ...................................................................................... 37 2.2.2 PRIMARY HUMAN PERIPHERAL NEUTROPHIL ISOLATION ................................................................ 38 2.2.3 CELL CULTURE ................................................................................................................................ 38
vi
2.2.4 APPLICATION OF STATIC STRETCH .................................................................................................. 39 2.2.5 FDA-PI VIABILITY ASSAY ............................................................................................................... 40 2.2.6 MULTIPLEX CYTOKINE ASSAY ....................................................................................................... 41 2.2.7 ENZYME-LINKED IMMUNOSORBENT ASSAY (ELISA) ..................................................................... 44 2.2.8 ENDOTHELIAL CELL ADHESION MOLECULE (CAM) EXPRESSION ................................................... 45 2.2.9 REAL-TIME REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION (QRT-PCR) ANALYSIS .... 45 2.2.10 FLUORESCENCE-ACTIVATED CELL SORTING (FACS) ANALYSIS ................................................. 48 2.2.11 PERMEABILITY ASSAY .................................................................................................................. 50 2.2.12 ADHESION ASSAY ......................................................................................................................... 52 2.2.13 TRANSENDOTHELIAL MIGRATION ASSAY .................................................................................... 53
2.3 STATISTICAL ANALYSIS ................................................................................................................ 54
CHAPTER 3: RESULTS
3.1 INTRODUCTION ................................................................................................................................ 56
3.2 STRETCH-INDUCED MYOMETRIAL CYTOKINE EXPRESSION ......................................... 56 3.2.1 MULTIPLEX ASSAY WITH ELISA VALIDATION OF HUMAN MYOMETRIAL CYTOKINE EXPRESSION 56 3.2.2 SIGNALING PATHWAYS REGULATING STRETCH-INDUCED CYTOKINE EXPRESSION ..................... 60
3.3 EFFECTS OF MYOMETRIAL CYTOKINES ON ENDOTHELIUM AND LEUKOCYTE ACTIVATION ............................................................................................................................................ 64
3.3.1 ENDOTHELIAL CELL ADHESION MOLECULE EXPRESSION ................................................................ 64 3.3.2 LEUKOCYTE ACTIVATION ............................................................................................................... 68 3.3.3 ENDOTHELIAL PERMEABILITY ........................................................................................................ 71
3.4 FUNCTIONAL STUDIES OF STRETCH-INDUCED MYOMETRIAL CYTOKINES ............. 72 3.4.1 LEUKOCYTE ADHESION TO ENDOTHELIAL CELLS .......................................................................... 72 3.4.2 NEUTROPHIL TRANSENDOTHELIAL MIGRATION ............................................................................. 73 3.4.3 ROLE OF BROAD-SPECTRUM CHEMOKINE INHIBITOR (BSCI) ........................................................ 76
CHAPTER 4: DISCUSSION
4.1. STRETCH-INDUCED MYOMETRIAL CYTOKINE SECRETION .......................................... 79
4.2 STRETCH-INDUCED MYOMETRIAL CYTOKINES ENHANCE LEUKOCYTE INFILTRATION VIA ENDOTHELIAL ACTIVATION ...................................................................... 83
CHAPTER 5: FUTURE DIRECTIONS
5.1 FUTURE DIRECTIONS ..................................................................................................................... 93
APPENDIX ................................................................................................................................................. 95
REFERENCES ........................................................................................................................................... 97
vii
LIST OF TABLES
CHAPTER 2
Table 2.1. List of signaling inhibitors used. ................................................................................... 40
Table 2.2. 48 human cytokines analyzed using Bio-Plex Pro™. ................................................... 43
Table 2.3. Human ELISA kit sentitivity and standard range for each analyte. ............................. 44
Table 2.4. Primer pair information for human genes examined using qRT-PCR. ......................... 48
APPENDIX
S.1. Concentrations and relative fold changes of myometrial cytokines in conditioned media detected by Luminex technology. .......................................................................................... 95
S.2. Absolute concentrations and relative fold change of selected human myometrial cytokines in S-CM and NS-CM validated by ELISA. ............................................................................... 96
viii
LIST OF FIGURES
CHAPTER 1
Figure 1.1. Maternal immune system transformation during pregnancy. ........................................ 5
Figure 1.2. Physiologic uterine inflammation model. .................................................................... 34
CHAPTER 2
Figure 2.1. Permeability assay experimental setup. ....................................................................... 51
Figure 2.2. Adhesion assay procedure. .......................................................................................... 52
Figure 2.3. Neutrophil transendothelial migration assay. .............................................................. 54
CHAPTER 3
Figure 3.1. Basal secretion of cytokines by myometrial hTERT-HM cell line. ........................... 58
Figure 3.2. Pro-inflammatory cytokines are upregulated by static stretch in hTERT-HM cells. .. 59
Figure 3.3. MAPK inhibitors did not influence the observed stretch effect on myometrial cytokine gene expression. ...................................................................................................... 62
Figure 3.4. PKC inhibitor downregulated stretch-induced CXCL1 and CXCL8 gene expression. 63
Figure 3.5. S-CM and VEGF potentiate endothelial activation at gene level. ............................... 65
Figure 3.6. S-CM upregulates protein expressions of human myometrial microvascular endothelial cells. .................................................................................................................... 67
Figure 3.7. Treatment with hTERT-HM conditioned media did not elicit activation in neutrophils nor monocytes. ....................................................................................................................... 70
Figure 3.8. Multiple cytokine secreted by stretched myometrial cells influence endothelial permeability. .......................................................................................................................... 71
Figure 3.9. Primary human neutrophils adhere to endothelial cells under S-CM stimulation. ...... 72
Figure 3.10. S-CM induced neutrophil TEM which is mediated by CXCR1 and CXCR2. .......... 75
Figure 3.11. BSCI inhibits S-CM-induced neutrophil TEM. ......................................................... 77
CHAPTER 4
Figure 4.1. Evidence-based model of human labour. .................................................................... 91
ix
LIST OF ABBREVIATIONS
BSCI Broad Spectrum Chemokine Inhibitors CAM Cellular Adhesion Molecule CAP Contraction-Associated Protein CCL Chemokine (C-C motif) Ligand COX-2 Cyclooxygenase-2 CSF Colony Stimulating Factors CTL Cytotoxic T Lymphocyte CXCL Chemokine (C-X-C motif) Ligand DAMP Danger Associated Molecular Pattern DC Dendritic Cell EC Endothelial Cell ERK Extracellular Signal-Regulated Kinase dNK Decidual Natural Killer Cell ECM Extracellular Matrix FMO Fluorescence Minus One GAG Glycosaminoglycan G-CSF Granulocyte Colony Stimulating Factor GM-CSF Granulocyte-Macrophage Colony Stimulating Factor GPCR G-Protein Coupled Receptor HA Hyaluronic Acid hTERT Human telomerase reverse transcriptase hTERT-HM hTERT-Immortalized Human Myometrial Smooth Muscle Cell ICAM Intercellular Adhesion Molecules IFN Interferon IL Interleukin JAM Junctional Adhesion Molecule JNK c-Jun N-terminal Kinase LFA-1 Lymphocyte Function-Associated Antigen LIF Leukemia Inhibitory Factor LPS Lipopolysaccharide Mac-1 Macrophage-1 Antigen MAPK Mitogen-Activated Protein Kinase M-CSF Monocyte-Colony Stimulating Factor MIF Macrophage Migration Inhibitory Factor MMP Metalloproteinase MPO Myeloperoxidase NET Neutrophil Extracellular Trap NF-κB Nuclear Factor kappa-light chain of activated B cells NK Natural Killer (NK)
x
NS-CM Non-Stretch-Conditioned Media PAMP Pathogen-Associated Molecular Pattern PECAM Platelet Endothelial Cell Adhesion Molecule PR Progesterone Receptor PTL Preterm Labour PG Prostaglandin RANTES Regulation Upon Activation Normal T-cell Expressed and Secreted ROS Reactive Oxygen Species S-CM Stretch-Conditioned Media SEM Standard Error of the Mean SF-DMEM Serum-free DMEM SMC Smooth Muscle Cell TEM Transendothelial Migration TGF-β Tranforming Growth Factor-beta TL Term Labour Th T helper TNF Tumor Necrosis Factor Treg Regulatory T Cell VCAM Vascular Cell Adhesion Molecule VEGF Vascular Endothelial Growth Factor WHO World Health Organization
1
CHAPTER 1
Literature Review
Chapter 1: Literature Review
2
1.1 OVERVIEW: TERM AND PRETERM LABOUR
A successful pregnancy and delivery requires the timely coordination of various uterine
tissues. During the most part of pregnancy, an intact cervix and fetal membranes are necessary to
retain the conceptus in utero, while the myometrium undergoes several stages of transformation
to accommodate the developing fetus. Near term, extensive remodeling occurs at the pregnancy-
associated sites to prepare for delivery: rupturing of the fetal membrane, softening and effacing
the cervix for dilation and activating the myometrium for synchronous contractions. Multiple
research groups have suggested the involvement of the maternal immune system in the regulation
of these events during term labour (TL). Premature activation of the uterus leads to preterm
delivery of the fetus; its etiology can include intrauterine infection, multiple pregnancy or
placental abruption. Approximately 50% of preterm labour (PTL) occurs without any apparent
etiology and is termed idiopathic. World Health Organization (WHO) defines preterm birth as
delivery of babies born alive before 37 weeks of gestation. WHO reported that the preterm
delivery percentage across 184 countries ranges from 5% to 18% of all newborn babies.
Although improved with current preventative measures, the prevalence of preterm birth and the
associated neonatal morbidity still pose a huge concern globally. The need for an effective new
therapeutics is apparent, and the focus has increasingly shifted towards the establishment of early
intervention on women with risks of PTL1. To develop new therapeutic approach that is both
cost-effective and efficient at reducing maternal and neonatal mortality and morbidity, a better
understanding in the mechanism of TL is required. This thesis aims to understand the
physiological process in the myometrial activation before labour at term.
Chapter 1: Literature Review
3
1.2 MATERNAL IMMUNE SYSTEM DURING PREGNANCY
1.2.1 Pregnancy as an inflammatory process
The primary purpose of the immune system serves to protect and heal the host body from
foreign invasion and tissue injury. Two arms of the immune system are commonly described: the
innate immunity and the adaptive immunity. The innate immunity mounts a rapid, non-specific
response to a wide range of pathogens with neutrophils and macrophages as the prominent
phagocytes. The adaptive immunity responds much slower yet develops specific defense
mechanism against particular strains of pathogens with B and T lymphocytes as the main players.
Although the two arms of the immune system involve different immune components, much
crosstalk exists between the two during an inflammatory cascade, mainly achieved by T helper
(Th) cells. T cells can differentiate into at least two subtypes of T helper cells: Th1 and Th2
cells2. Th1 cells secrete a variety of cytokines including interferon-gamma (IFN-γ), interleukin
(IL)-2 and tumor necrosis factor (TNF) to elicit cell-mediated response3. On the other hand, Th2
cells elaborate a number of cytokines including IL-4, -5, -6, -10 and -13, which stimulate B cell
maturation into antibody-producing plasma cells, described as the humoral response2,3. Due to the
anti-inflammatory properties of Th2 cytokines, such as IL-10, Th2 cells can dampen and aid in
the resolution of the inflammatory response2.
Pregnancy is a unique stage of life in women where the majority of maternal body
systems undergo modulation to accommodate the growing semi-allogeneic fetus. Specifically,
pregnancy creates an immune paradox in which the maternal immune system tolerates the
presence of the fetal allograft and yet retains the readiness to fight against infections4.
Interestingly, an active inflammation-like process has been observed in the womb of healthy
pregnant women at most stages of gestation, either during implantation, cervical ripening or the
initiation of labour, which all involve localized cytokine secretion, leukocyte infiltration and
Chapter 1: Literature Review
4
extracellular matrix remodeling of the uterus5. However, it is recognized clinically that the
maternal immune response is largely modulated by the feto-placental unit consistent with a
weakened cell-mediated immunity and a strengthened humoral immunity6. This seemingly
paradoxical state in the immunology of pregnancy led to the hypothesis of a dynamic Th1 to Th2
cytokine profile switch during different gestational stages: Th1 dominance during implantation
and parturition, with Th2 dominance during fetal and uterine growth7-9 (Figure1.1).
Consolidating current findings, pregnancy can be categorized into 4 distinct phases that
return the uterus to its non-pregnant state. The first phase, initiation, encompasses implantation
and placental development that resemble an injury-like inflammatory reaction7,9. Trophoblasts,
specialized cells in the outer layer of the developing blastocyst, secrete many pro-inflammatory
Th1 cytokines that stimulate the pregnant endometrium (decidua) to express genes required for
embryo implantation10. During the first trimester, the human decidua is highly immunoactive and
contains a high number of leukocytes, namely macrophages, natural killer (NK) cells and T cells
which primarily accumulate around the invading trophoblast cells5. Chemokines responsible for
leukocyte recruitment are expressed by the human endometrium during the receptive window and
by decidual stromal cells11. These likely provide the chemotactic signals for the accumulation of
the decidual leukocyte population, of which NK cells constitute 65-70% in the first trimester12
and are possibly responsible for adequate uterine vascular remodelling and extravillous
trophoblast invasion13. Macrophages, on the other hand, represent 10-20% of decidual
leukocytes, whereas T cells and dendritic cells comprise 3-10%7,12,14. Depletion of these
leukocytes lead to pregnancy termination, mainly caused by inadequate implantation and
placental development7. Therefore, it has been proposed that the presence of these maternal
leukocytes in the decidua fosters placental development and function14.
Chapter 1: Literature Review
5
Figure 1.1. Maternal immune system transformation during pregnancy. Pregnancy is likened to an inflammatory process with dynamic modulations in the maternal immune system throughout gestation. We have correlated the changes seen in the immune system with corresponding development/process of the uterus: initation with implantation; tolerance with fetal and uterine growth; activation with labour and restoration with postpartum involution. Reproduced with permission from Shynlova et al.7, doi: 10.1177/1933719112446084.
Non$pregnant+
Implantation+
Fetal+Growth++&+Development+
Postpartum+Involution+
Contractile+proteins↑+ICAM11+&+VCAM11+↑+
CAPs+↑++
Apoptosis++ECM+degradation+
MMPs+↑+
Labour+
�for+publication�++
Figure+2+
++++++
COX12+↑+PGs↑+
Oxytocin+↑+OTR↑++
IL$1β++IL$6++
IL$12p40++CXCL1++
CCL2++CCL3++G$CSF+++! "
CCL4+IL$1α+IL$10+
IL$1β+IL$6+CXCL1+CXCL5+CXCL8++
CCL2+CCL20+G$CSF+VEGF++
! IL$3+IL$4+IL$5+IL$10+
!
Tissue+remodeling+Angiogenesis+at+implantation+site+
Menstrual+cycle+
IL$1+IL$6+IL$8+EGF+
G$CSF+GM$CSF+IP$10+LIF+
TRAIL+TNF$α+VEGF+++
!
Uterine+natural+killer+cell+ Neutrophil+ Macrophage+
Progesterone+↑+
Chapter 1: Literature Review
6
With successful embryo implantation, vascular (spiral artery) remodeling of the placenta
ensures sufficient maternal blood flow for nutrient/gas exchange and carries pregnancy into the
second phase, tolerance. Tolerance spans over a large portion of pregnancy where fetal and
myometrium growth, as well as uterine quiescence are predominately regulated by progesterone9.
The promotion of tolerance during pregnancy may partly be mediated by Th2 cytokine
polarization and inhibition of complement activation15. Progesterone, important for maintaining
pregnancy, has been shown to regulate and favor Th2 cell differentiation by inducing the release
of IL-4 and IL-516. In mice, IL-4, IL-5 and IL-10 were detected at the maternal-fetal interface
throughout gestation, with IFN-γ transiently expressed only at early pregnancy17. Additionally,
IL-4, IL-10, macrophage colony-stimulating factor (M-CSF) and leukemia inhibitory factor (LIF)
derived from human decidual T cells have been demonstrated to associate with successful
pregnancy18. A recent study revealed the possible involvement of decidual NK (dNK) cells in
fetal allograft tolerance by dampening Th 17 inflammatory response (important in autoimmune
disease)15. Furthermore, researchers have suggested that regulatory T cells suppress cell-mediated
immunity and interact with antigen presenting cells (macrophages and dendritic cells), and thus
contribute to fetal tolerance19,20.
Parturition marks the third immunological phase, activation9. At term, all uterine tissues
experience substantial remodeling to prepare for delivery, which include cervical ripening, fetal
membrane rupture, decidual and myometrial activation. This last process before the delivery of
the baby is characterized by the reactivation of the Th1 inflammatory response21, along with the
up-regulation of endothelial cell adhesion molecules and the presence of leukocyte infiltration in
multiple pregnancy-associated sites22,23. It is equally important for the uterus to return to its non-
pregnant state for women to remain fertile; postpartum uterine involution represents the last
phase, restoration. Extracellular matrix (ECM) degradation, facilitated by matrix
Chapter 1: Literature Review
7
metalloproteinase (MMP) activity and cellular apoptosis or autophagy, restores the uterus in a
fashion similar to wound healing. Myeloid immune cells, particularly macrophages and
neutrophils, further invade the postpartum decidua and myometrium with elevated
cytokines/chemokines suggesting their participation in this restoration process. Altogether, these
data established a close yet complex interaction between the uterus and the maternal immune
system all throughout normal pregnancy.
1.2.2 Maternal leukocyte populations
Clinically, it is recognized that a gradual increase in total peripheral leukocyte count
occurs in healthy pregnant women throughout gestation, where it is the highest during the third
trimester24. Lurie and colleagues reported that this resulted from the significant increase in
neutrophil count in both second and third trimesters compared to first trimester. Monocyte count
remains constant in the first two trimesters and but is significantly elevated in the third. In
contrast, lymphocytes are significantly decreased in number in the second trimester and return to
first trimester levels in late gestation. Peripherally, circulating monocytes are progressively
activated with advancing gestation with an increase in CD11a, CD54 and CD64. The integrin,
CD11a, along with CD18 forms the lymphocyte function-associated antigen 1 (LFA-1), which is
normally expressed on leukocytes and aid in intercellular adhesion. CD54, or commonly known
as ICAM-1, is a major ligand for leukocyte integrins. The integral membrane glycoprotein CD64
is the Fc receptor on leukocytes that binds to IgG and facilitate leukocyte activation25.
As discussed previously, the presence of higher leukocyte numbers not only is seen in the
peripheral circulation, but also in uterine tissues such as decidua, myometrium and cervix,
causing a localized inflammation. It is likely that these leukocytes participate in the modulation
of uterine tissues during pregnancy. Similarly, the microenvironment created in each specific
Chapter 1: Literature Review
8
uterine compartment also reprograms the infiltrating immune cells into specific phenotypes. In
this section, we will focus our discussion on the potential roles of monocytes/macrophages,
neutrophils, lymphocytes and NK cells during pregnancy.
1.2.2.1 Monocytes /Macrophages
Monocytes originate from myeloid progenitors in the bone marrow and constitute 5-10%
of the circulating leukocyte population in human peripheral blood. Under pro-inflammatory,
metabolic and immune signals, monocytes are recruited into tissues where they differentiate into
macrophages, dendritic cells or osteoblasts of heterogeneous phenotypes26,27. Macrophages are
essential in the processes of host defense, tissue remodeling and repair due to their remarkable
ability to phagocytose pathogens and dead cells, enhance angiogenesis, produce cytokines and
induce immune tolerance27,28. They also facilitate the differentiation/activation of other
leukocytes through secreting cytokines and growth factors12, as well as acting as antigen-
presenting cells29. Activated macrophages are routinely categorized into the classical M1 or the
alternatively activated M2 phenotypes based on their receptor and gene expressions under
cytokine stimulation27,29. These two forms of macrophages display specialized and polarized
functional properties that essentially exert opposite effects, where M1 macrophages provide
cytotoxic activity and M2 macrophages suppress immune functions and focus on tissue
repair27,28. With the rapid expansion of M2 macrophages, another classification proposed by
Mosser and Edwards characterizes macrophage differentiation based on their functions in tissue
homeostasis: 1) classically activated macrophages mediated by IFN-γ and Th1 cells (microbicidal
activity), 2) wound-healing macrophages mediated by IL-4 and Th2 cells (tissue repair) and 3)
regulatory macrophages mediated by IL-10 and regulatory T cells (anti-inflammatory activity)28.
Chapter 1: Literature Review
9
This classification distinctly defines crosstalk between T cells and resident macrophages for each
specific function/activity.
Macrophages represent a resourceful cell population capable of secreting a variety of
cytokines, chemokines, growth factors, reactive oxygen species (ROS) and MMPs. Depending on
their activation state, a dynamic range of factors are released. Classically activated macrophages
are important in cell-mediated immune response, releasing cytokines such as IL-1, IL-6, IL-8 and
IL-12, and ROS to enhance their killing ability as well as amplifying the immune response by
recruiting more immune cells28. Tight regulation of these secretory factors must be in place to
prevent host tissue damages. Conversely, wound-healing macrophages exhibit a higher arginase
activity upon IL-4 stimulation, which is essential for producing collagen precursors and hence
contribute to ECM production30. A recent report demonstrated a novel finding in the ability of
macrophages to secrete proteoglycans and participate in ECM formation31. A variety of signals
promote the differentiation of regulatory macrophages, including glucocorticoids, prostaglandins
and IL-1028. Once activated, these macrophages produce a high amount of IL-10 and down-
regulate the production of pro-inflammatory IL-12, signifying their potency in inhibition of the
inflammatory reaction28.
In pregnancy-associated tissues, macrophages are detected and their density remains
relatively constant throughout gestation peaking around the time of labour12,23. At early
pregnancy, macrophages in the decidua facilitate implantation and tolerance by assisting the
clearance of apoptotic cells32. Further, it has been reported that first trimester decidual
macrophages display markers associated with M2 phenotype33, supporting the fetal tolerance
hypothesis. At term, macrophages massively infiltrate human decidua, cervix and myometrium.
Interestingly, in mice we found that they specifically invade the decidua and myometrium
prepartum followed by a second wave of monocytic invasion postpartum34,35. Not much is known
Chapter 1: Literature Review
10
about the phenotypes of uterine macrophages found in these tissues at late gestation; it was
reported that decidual macrophages display a heterogeneous phenotype encompassing all three
functionalities discussed above36, whether this is a result of a homogeneous population or a
heterogeneous one remains unclear. Uterine macrophages possibly remodel the uterine tissues to
prepare for delivery as well as participate in the restoration of the uterus back to its non-pregnant
form. Macrophages have been demonstrated to be an important population during muscle injury
and regeneration37. Also, it has been speculated that uterine macrophages could contribute to
uterine contractility and cervical ripening during labour.
1.2.2.2 Neutrophils
Neutrophils are important players of the innate immune system and arrive first at sites of
infection or injury. Like monocytes/macrophages, they are derived from the myeloid cell lineage
and represent the most abundant (around 70%) leukocyte subpopulation in human peripheral
circulation. Morphologically, neutrophils appear granular due to the presence of many small
vesicles in the cytoplasm which contain a variety of preformed proteins that participate in many
cellular processes38. Functions of activated neutrophils include tissue remodeling, inflammatory
signal amplification and clearance of pathogens by releasing lytic enzymes and producing ROS39.
Neutrophils possess a specialized mechanism for trapping pathogens through the release of
neutrophil extracellular traps (NETs), a network composed mainly of DNA, as well as proteins
from neutrophil granules40. The extrusion of NETs is a rapid process, which can be detected
within 10 minutes of activation and can kill bacteria even before the microorganisms are engulfed
by neutrophils40.
Terminally differentiated neutrophils were originally regarded purely as short-lived
phagocytic effector cells. However, this view was challenged as more research groups reported
Chapter 1: Literature Review
11
that activated neutrophils in tissues are capable of producing cytokines and chemokines41 and can
delay apoptosis to extend their survival42. Neutrophils engage in extensive cellular crosstalk with
macrophages, dendritic cells (DC), NK cells and lymphocytes, thus contributing to the regulation
of inflammation39. It was reported that interaction with neutrophils promoted monocyte-derived
DC maturation, which subsequently induced T cell proliferation and polarization towards Th1
phenotype43. Also, neutrophil and NK cells interact in a reciprocal fashion where they modulate
each other’s survival, activation marker expression and cytotoxic activity (reviewed in44).
Neutrophils also enhance T cell recruitment to inflammation sites and vice versa. T cells, through
the release of IFN-γ, granulocyte-macrophage colony-stimulating factor (GM-CSF) and TNF,
enhance neutrophil survival and CD11b surface expression39. Furthermore, a recent polarization
property of neutrophils, similar to the M1/M2 classification of macrophages, has been suggested.
In cancer biology, neutrophils acquire a pro-tumorigenic (N2) phenotype in the presence of
transforming growth factor beta (TGF-β), characterized by high levels of arginase expression and
enhanced angiogenesis45. On the other hand, blocking TGF-β induced a switch to an anti-
tumorigenic (N1) phenotype with a higher cytotoxic activity and increased immunoactive
cytokines and chemokine expression45. Therefore, contrary to what was believed, neutrophils
represent a leukocyte subpopulation that exhibits regulatory and dynamic plasticity in response to
its microenvironment.
During pregnancy, neutrophil density stays relatively constant in all uterine
compartments. In early second trimester, a class switch in decidual neutrophils into a pro-
angiogenic phenotype is observed, suggesting their potential role in the final stage of spiral artery
remodeling (Dunk, Lye unpublished data). However by late gestation, neutrophil number
increases markedly in the cervix, fetal membrane, and modestly in myometrium and
decidua12,22,23,34,35. Further, we observed that neutrophils mainly infiltrate the uterus after the
Chapter 1: Literature Review
12
onset of labour, suggesting an emphasis of this subtype during uterine postpartum involution34,35.
Neutrophils are rich source of inflammatory mediators such as plasminogen activators,
collagenase, elastase, MMPs and pro-inflammatory cytokines12. Similar to macrophages, they are
important mediators of muscle injury to facilitate the uptake of cellular debris, although it
remains unclear if neutrophils provide beneficial roles in muscle regeneration37. It is interesting
to note that pregnancy modulates neutrophil marker expression and functionality. It was shown
that neutrophils in pregnant women exhibit temporary changes in their surface markers
(decreased CD16 and increased CD64), which partially mimics an inflammatory response46.
Neutrophils in labouring women demonstrated a greater migratory ability when compared to
those of term non-labouring women47; they also exhibit greater ROS production and phagocytic
activity19. In addition, maternal peripheral neutrophils were found to show delayed apoptosis as
compared to neutrophils derived from non-pregnant women, possibly through CD11b cross-
linkages48. These data together imply that neutrophils, with longer life span, are potentially
involved in activating labour and uterine involution process.
1.2.2.3 Lymphocytes
B lymphocytes
B lymphocytes are an important component of the humoral arm in adaptive immunity.
Upon binding antigens, they are activated to produce specific antibodies and aid in the clearance
of the foreign invader. Some activated B cells become “memory B cells” and remain in the
circulation for a long time to provide protection in case of secondary infection by the same
pathogen. A recent report revealed a novel subset of B cells, the regulatory B cells, which are
characterized by their secretion of IL-10 and their ability to suppress inflammation49. However, B
cell number does not vary during the menstrual cycle nor during pregnancy and their density is
Chapter 1: Literature Review
13
low in comparison to other subtypes50. It was recently discussed that different population of B
cells may either protect or provoke pregnancy disturbances depending on the type of antibodies
produced51.
T lymphocytes
T lymphocytes are important regulators of the inflammatory cascade and can be
differentiated into several subtypes (T helper, cytotoxic, memory and regulatory) as directed by
specific cytokines. T helper cells are characterized by the expression of the CD4 marker at the
cell surface. As discussed previously, several subtypes of T helper cells exist, including Th1, Th2
and Th17. Th1 cells secrete pro-inflammatory cytokines (IFN-γ, TNF-α) and mediate cell-
mediated immunity, whereas Th2 cells secrete anti-inflammatory cytokines (IL-4, IL-10) and
participate in humoral immunity. These two subsets are mutually inhibitory to each other,
attributed to the opposing effect of their secreted cytokine profiles52. Th17 cells, a new class of
the Th cells, were identified with the discovery of IL-17 cytokine family and have been
implicated in the pathogenesis of autoimmune diseases53. They can be differentiated from naïve T
cell under the initiation of TGF-β and IL-653. Mature Th17 cells produce G-CSF and GM-CSF
which stimulate proliferation, maturation and mobilization of neutrophils53. The cytotoxic T
lymphocytes (CTL), are characterized by the presence of CD8 glycoprotein at the cell surface.
They are effective in the clearance of foreign cells and infected host cells. Upon activation with
antigen presenting cells, CTLs release cytotoxins such as perforins, granzymes and granulysins,
and eventually trigger apoptosis in the targeted cells54. CTLs also produce TNF-α and IFN-γ
promoting immunity against intracellular pathogens54. Like B cells, a subset of activated T cells
become “memory T cells” which remain in the system for a long period of time and provide a
faster and stronger immune response on second exposure to the same foreign intruder.
Uncontrolled immune response can lead to fatality of the host; therefore, stringent control must
Chapter 1: Literature Review
14
be in place to provide an effective yet safe fighting mechanism. One of the mechanisms
developed to protect against excessive immune reaction is clonal deletion (negative selection) of
self-reactive T cells in the thymus before they are released in the periphery55. Regulatory T cells
(Treg), characterized by the presence of CD4, CD25 and Foxp3, act to suppress the activation
and proliferation of other T cell subpopulations55.
The proportion of T cells (CD3+) in the decidua during early pregnancy is relatively low,
constituting approximately 6-10% of the decidual leukocyte population; this number increases to
around 30-45%12. As well, T cell number in the lower segment of human myometrium increases
significantly during labour23. It was found that the Treg pool expands during pregnancy and its
depletion leads to gestation failure in mice due to immunological rejection of the fetus,
suggesting the involvement of Treg in fetal tolerance20. Furthermore, Treg and Th2 cells
predominate over Th1 and Th17 cells in normal pregnancy19, which possibly could be attributed
to the down-regulated chemokine (C-X-C motif) ligands CXCL9, CXCL10 and CXCL11
(chemokines recruiting Th1 cells) in the decidual stromal cells56. This correlates well with the
Th1/Th2 paradigm during pregnancy, where Treg could possibly be the main mediator of the
tolerance phase. As well, this shows that the Th1:Th2 ratio is tightly controlled within the uterus
throughout gestation by a dynamic cytokine network. Although their role during labour is
uncertain, it has been proposed that T cells could mediate the inflammatory cascade with each
subset participating in specific and selective events12.
NK cells
Differentiated from lymphoid progenitors in the bone marrow, NK cells show analogy in
their cytotoxic potential with CTLs, except NK cells are classified as part of the innate immunity
due to their ability to recognize target cells independent of antibodies57. In addition to their
cytotoxicity towards virus-infected cells and tumour cells, NK cells are also major producers of
Chapter 1: Literature Review
15
various cytokines such as IFN- γ, IL-10, G-CSF, GM-CSF, CCL2 and CXCL8, giving them
important roles in the regulation of other leukocytes57. The receptor profile on their surface
determines and controls NK cell functions.
A distinct subset of NK cells is found in the uterus during pregnancy, CD56brightCD16-
decidual NK cells (dNK), which are phenotypically different from the majority of the peripheral
CD56dimCD16+ NK cells13. dNK cells comprise 70% of leukocytes in the decidua during first
trimester and decreases to about 3% at term12. Their enrichment at the maternal-fetal interface
during decidualization implicates their possible involvement in vascular remodeling, extravillous
trophoblast invasion and antiviral activity13. The origin of these abundant dNK cells is not well
understood. Researchers have proposed several theories which could work in parallel:
recruitment from the peripheral NK population via decidual chemokine expression58, maturation
from endometrial NK cells in response to pregnancy-associated signals59 and differentiation from
hematopoietic precursors in the decidua upon stimulation60. Additionally, dNK cells possess
different functions from the peripheral NK population. dNK cells show weakened cytotoxicity in
comparison to peripheral NK cells; it was demonstrated in vitro that they fail to kill trophoblast
cells unless IL-2, a cytokine usually absent in pregnant tissue, is present61. dNK cells also display
a transcriptional profile different from peripheral NK cells in that they produce higher levels and
a broader range of cytokines (such as LIF and angiogenic factors)13. Altogether, these data
suggest a distinct and specialized NK subtype during pregnancy that facilitates placental
development and growth.
1.2.3 Cytokines and chemokines during pregnancy
Cytokines comprise an extensive array of multifunctional signaling glycoproteins that are
involved in the regulation of biological processes. Virtually all nucleated cells in the human
Chapter 1: Literature Review
16
body, including smooth muscle and endothelial cells, are the source of these small molecules;
notably, immune cells represent the major source of cytokines. Cytokines operate as parts of a
highly complex and integrated network that exhibits numerous stimulatory/antagonistic
interactions, synergies, and functional redundancies (where several different cytokines exert the
same effect on a cell type via a common receptor complex)62. In reproductive science, cytokines
are known as important regulators of menstruation and pregnancy. Tight control of these
signaling molecules, both in concentration and duration of exposure, is of the utmost importance
as their dysregulation result in deleterious conditions such as preeclampsia63, recurrent
miscarriage3 and PTL64. Chemokines are a superfamily of cytokines that exhibit chemotactic
properties to attract cells, especially leukocytes, to the desired tissue site through binding to their
G-protein-coupled receptors (GPCRs). Moreover, chemokines also participate in cellular
proliferation, differentiation, apoptosis, angiogenesis and inflammatory diseases65. Cytokines and
chemokines produced by different uterine compartments play important roles in the progression
of pregnancy: LIF, IL-6 and IL-11 during implantation; IL-4 and IL-10 for in utero fetal survival;
and a plethora of cytokines such as CXCL8, IL-1β, IL-6, TNF-α involved in the initiation of
labour5,62,66.
Mechanical stretch has been widely demonstrated as an inducer of cytokine synthesis. In
experiments mimicking lung injury, human alveolar epithelial cells were subjected to cyclic
stretch, which subsequently increased CXCL8 transcription level67. Another group found that
CCL2 gene and protein expression were increased by stretching human mesangial cells68. In
particular, many reports have shown the ability of various uterine cell types such as fetal
membrane epithelial cells, myometrial myocytes and cervical fibroblasts to secrete cytokines
under the influence of mechanical stretch (summarized in ref69). Our lab has demonstrated that rat
myometrial smooth muscle cells (SMCs) are capable of producing multiple cytokines under the
Chapter 1: Literature Review
17
influence of uterine stretch imposed by the growing fetus around the time of labour70. Using a
unilateral pregnant rat model, we proved that gravidity is associated with the increased cytokine
production (IL-1α, CCL2, CXCL1 and IL-6) in the myometrium during TL9. Others have also
shown the effect of stretch on CXCL8 synthesis in human myometrial cells and fetal
membranes71,72. The involvement of stretch during labour and the associated cytokine network is
discussed in detail in section 1.3.2. Here, we focus our discussion on the roles of selected
cytokines and chemokines, which have been associated with pregnancy.
Pro-inflammatory:
IL-1
IL-1α and IL-1β are the founding members of the IL-1 superfamily and the major
mediators of innate immunity. IL-1 can be secreted by many cell types including macrophages,
monocytes, endothelial cells and fibroblasts. IL-1α and IL-1β activate target cells to increase
mRNA expression of IL6, CXCL8, CCL2 and cyclooxygenase-2 (COX-2)73. They can amplify
the IL-1 response by stimulating their own gene expression in the effector cells. In addition, IL-1
can enhance leukocyte recruitment to the sites of inflammation by inducing adhesion molecules
on endothelial cells74. Both IL-1α and IL-1β bind to the same type I IL-1 receptor. A third ligand,
IL-1 receptor antagonist (IL-1RA) that does not elicit downstream activities, functions to control
the potent inflammatory activities of these two cytokines through competing with receptor
binding73. At the implantation site, the IL-1 system regulates MMP activity62, which also occurs
during cervical ripening to enhance collagen breakdown75. Additionally, treating human
myometrial cells with IL-1β was shown to increase intracellular calcium concentration, COX-2
and various chemokine (CCL2, CXCL1, CXCL8 etc.) expression, implicating a role in
myometrial contractility76,77.
Chapter 1: Literature Review
18
TNF-α
TNF-α is one of the major pro-inflammatory cytokines involved in systemic inflammation
and acute phase reaction. It is mainly produced by macrophages, but also by other cell types such
as endothelial cells, fibroblasts, lymphoid cells and mast cells. Upon binding to its receptor, TNF-
α can activate three different pathways, which include nuclear factor κ-light chain enhancer of
activated B cells (NF-κB), mitogen-activated protein kinase (MAPK) and apoptosis, regulating
cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation78. In addition,
TNF-α is a potent chemoattractant for neutrophils and promotes the expression of endothelial cell
adhesion molecules (CAM)79. It also increases endothelial permeability through proteolysis of
hyaluronic acid80. TNF-α levels are down-regulated in normal pregnancy81. In fact, the presence
of TNF-α has been linked to pregnancy failures in rat models of LPS-induced maternal
inflammation due to alterations in placental perfusion82. Further, it was recently demonstrated
that TNF-α level increased in the decidua of labouring women compared to those not in labour,
which possibly contributes to functional progesterone withdrawal83.
IL-6
IL-6 is a well-established marker of systemic activation, and along with TNF-α and IL-1
stand as the first responders of the inflammatory cascade84. It is a multifunctional cytokine that
supports the differentiation of B cells, stimulates thrombopoiesis, and the synthesis of acute
phase proteins85. It can exert both pro- and anti-inflammatory actions based on the signaling
components at the target cell membrane86. IL-6 also plays a critical role in the maturation of the
inflammatory response from a neutrophil-dominated phase to a monocyte-dominated phase87, as
well as in the polarization of naïve Th cell to effector Th2 cells3. Furthermore, IL-6-/- mice
showed impaired leukocyte accumulation associated with a reduced local chemokine production,
suggesting its role in leukocyte recruitment85. The actions of IL-6 are integrated throughout
Chapter 1: Literature Review
19
pregnancy, as its presence was detected in uterine tissues throughout the course of pregnancy87.
IL-6 protein and mRNA are abundant in the decidua, fetal membrane and amniotic fluid in early
pregnancy, likely mediating implantation and placental development5,87. Levels of IL-6 increase
in uterine tissues and amniotic fluid during labour, indicating its involvement in parturition87.
Although it is not essential for successful pregnancy, recent evidence in mice showed that IL-6
determines the timing of delivery and influences gene expression associated with myometrial
activation (oxytocin receptor and prostaglandin receptors)86.
IL-12
IL-12 is a heterodimeric cytokine with two subunits (p35 and p40), each encoded by
genes located on separate chromosomes. As a result, their transcription is independently
regulated. Different forms of IL-12 exist: monomeric IL-12p40, homodimer of p40 subunits (IL-
12p80) and heterodimer IL-12p70. Monocytes, macrophages, dendritic cells and neutrophils are
major producers of IL-12, which target T and NK cells to promote their proliferation, IFN-γ
synthesis, increase cytotoxic activity and stimulate T cell polarization towards Th1 phenotype88.
While IL-12p70 is considered the biologically active form of IL-12, IL-12p80 has been suggested
as an antagonist that competes for receptor binding with IL-12p70, hence offering a layer of
regulation to IL-12 functionality89. In addition, it was reported that IL-12p80 can function as a
chemoattractant for macrophages90. Contrasting cytokine profiles exist between mid- and late
gestation (Th2 to Th1); in mice, this transition is likely regulated by changes in IL-12p40 to IL-
12p70 ratio91.
Anti-inflammatory:
IL-10
IL-10 is the most important anti-inflammatory cytokine of the human immune response
due its potent immunosuppressive effect in various inflammatory events. Primarily synthesized
Chapter 1: Literature Review
20
by Th2 cells, monocytes and B cells, it deactivates pro-inflammatory cytokine production of
macrophages, neutrophils and NK cells, while also inhibiting the actions of Th1 cytokines. Not
only that, it also inhibits the translocation of NF-κB, a major nuclear transcription factor, after
lipopolysaccharide (LPS) stimulation. IL-10 protects the host from systemic inflammation after
toxin-induced injury61,84, demonstrating its importance in preventing over-activation of the
inflammatory response. In human placenta explants, IL-10 concentration persisted in the first two
trimesters of pregnancy and dropped in third trimester before the onset of labour92. This could be
attributed to the presence of progesterone during pregnancy, as it can stimulate the production of
IL-1092. Knockout studies showed that IL-10 is not essential for normal pregnancy outcome, but
provides protection against LPS-induced PTL in IL-10 null mice through down-regulating LPS-
induced pro-inflammatory cytokine profile63,93. It has recently been demonstrated that IL-10
potentially facilitates angiogenesis through inducing vascular endothelial growth factor (VEGF)
production in trophoblast cells94. Interestingly, IL-10 inhibited stretch-induced cytokine release in
fetal lung fibroblasts94,95, illustrating its strong anti-inflammatory property in mechanical
stimulatory conditions.
Growth Factors
Colony-stimulating factors (CSF)
Colony-stimulating factors (CSF) are a family of proteins (M-CSF, GM-CSF and
granulocyte-CSF (G-CSF)) that stimulate the cellular proliferation and induction of terminal
differentiation of hematopoietic progenitor cells. They also have important effects on mature
myeloid cell functions, including activation and enhanced cell survival. M-CSF, also known as
CSF1, is produced by endothelial cells, fibroblasts, bone marrow stromal cells, SMCs, and
macrophages; it targets mainly monocytes and macrophages. The production of GM-CSF, or
CSF2, usually requires stimulation, such as an infection, and it targets monocytes, macrophages,
Chapter 1: Literature Review
21
neutrophils, eosinophils and basophils64,96. G-CSF, also known as CSF3, is synthesized by the
endothelium, monocytes, macrophages and fibroblasts and primarily targets neutrophils to
stimulate integrin expression (CD11b) as well as to induce chemotaxis97. All three CSFs have
been implicated in pregnancy, especially at the maternal-fetal interface, likely influencing growth
and differentiation of the placenta98,99.
VEGF
VEGF is a key regulator of angiogenesis in many physiological processes including
embryogenesis, skeletal growth and reproductive functions. A microarray study revealed that
VEGF-stimulated human myometrial ECs showed an up-regulation of various MMPs and
collagen100, suggesting a role for VEGF in ECM remodeling. As the name suggests, VEGF exerts
its function primarily on endothelial cells; however, it can also enhance B cell and immature
myeloid cell production and promote neutrophil and monocyte transendothelial migration via
inducing endothelial secretion of CXCL8101 and increasing monocyte integrin expression102.
Furthermore, it is an important vascular permeability factor103.
Chemokines
CXC chemokines
CXC chemokines act as chemoattractants for neutrophils and also exhibit angiogenic
properties. Two major CXC chemokines are CXCL8 (also known as IL-8) and CXCL1 (also
known as growth related oncogene alpha, GRO-α), with CXCL8 being more potent at its actions.
Neutrophils themselves can be stimulated to secrete both chemokines, as for other cell types
(monocytes, endothelial cells and fibroblasts). The secretion of these two chemokines is induced
by LPS and inflammatory mediators such as IL-1β, TNF-α, and by mechanical stretch71,104,105.
CXCL8 interacts with two receptors, CXCR1 and CXCR2, whereas CXCL1 only binds to
CXCR2. Not only do they attract neutrophils to the site of inflammation, they also induce
Chapter 1: Literature Review
22
neutrophil degranulation41. CXCL8 has been implicated in a wide range of pregnancy-associated
events: implantation, cervical ripening and myometrial contraction. At term, CXCL8 expression
is increased significantly in the lower segment of the human myometrium, in addition to decidua
and fetal membrane22. Our lab has recently demonstrated that in murine decidua and
myometrium, CXCL1 expression is increased during labour and specifically in postpartum
decidua, indicating its importance during uterine involution34,35.
CC chemokines
CC chemokines exert chemotactic effects on monocytes, lymphocytes, basophils,
eosinophils and dendritic cells. Monocyte chemotactic protein-1 (also known as CCL2) is the
main chemokine regulating monocyte recruitment to the site of inflammation. It is expressed by
neutrophils, monocytes, endothelial cells and SMCs41. Similar to CXCL8 expression during
pregnancy, CCL2 expression has been reported by several groups to be markedly up-regulated in
labouring women106, and by our work in murine myometrium and decidua during term labour
with a further increase postpartum34,35. We also showed that myometrial stretch induces CCL2
expression and the concurrent macrophage infiltration in rat myometrial SMCs. CCL5, also
known as RANTES, represents another important CC chemokine responsible for the recruitment
of monocytes, T cells, eosinophils and basophils65. RANTES is expressed in the uterus in early
pregnancy and late gestation, where it possibly contributes to the recruitment of monocytes65,107.
1.2.4 Peripheral leukocyte recruitment
Under normal circumstances, circulating peripheral leukocytes do not extravasate into the
underlying tissues. However, they infiltrate when signals of danger (pathogen-associated
molecular patterns (PAMPs) from foreign invaders, or danger-associated molecular patterns
(DAMPs) from tissue injury) are detected during their surveillance throughout the body108. Upon
Chapter 1: Literature Review
23
activation, peripheral leukocytes undergo a series of actions termed tethering, rolling, firm
adhesion and transendothelial migration (TEM) in response to chemotactic gradients to sites of
inflammation. Tethering and rolling are mediated by the selectins, which slow down the free
flowing leukocytes. Chemokines activate the endothelium of blood vessels and the immune cells
initiating conformational changes in leukocyte integrins, which mediate their firm adhesion to
endothelial cells and subsequent TEM109.
1.2.4.1 Endothelial Activation
Endothelial cells (ECs) play an important role in facilitating leukocyte TEM into tissues
as they form the primary physical barrier between blood and the underlying tissues. Vascular
permeability is tightly regulated to selectively allow the passage of macromolecules and blood
cells. Endothelial activation, characterized by increased expression of CAMs on the surface of
vascular ECs, regulates the adhesion and entry of circulating peripheral leukocytes109,110. Major
endothelial CAMs involved include intercellular adhesion molecule-1 (ICAM-1), E-selectin,
platelet endothelial cell adhesion molecule-1 (PECAM-1) and vascular cell adhesion molecule-1
(VCAM-1). E-selectin and VCAM-1 usually are not expressed on quiescent ECs; however, their
expression is up-regulated by cytokines released in the surroundings. On the other hand, ICAM-1
and PECAM-1 are constitutively expressed on ECs; however, ICAM-1 expression can be
upregulated upon cytokine stimulation whereas PECAM-1 expression remains steady110. More
recently, junctional adhesion molecules (JAMs) have been implicated in leukocyte adhesion and
TEM. Under cytokine stimulation, JAM-A was observed to redistribute from intercellular
junctions to the apical surface of the endothelium, making it accessible to support neutrophil and
monocyte recruitment111.
Chapter 1: Literature Review
24
There has been increasing evidence relating endothelial glycosaminoglycans (GAGs) and
leukocyte recruitment. GAGs are involved in the immobilization of chemokines on the surface of
ECs, which renders them accessible to the circulating leukocytes and creates a chemotactic
gradient112,113. In addition, binding of chemokines to GAGs increases their retention in tissues
and protects them from proteolysis109. Several forms of GAGs exist including hyaluronic acid
(HA) whose expression can be induced by cytokines such as TNF-α, IL-1 or the bacterial
component LPS. CD44 on leukocytes is the best described ligand for HA. It was reported that
endothelial HA increased efficiency of neutrophil adhesion, while neutrophil CD44-HA
interaction enhanced TEM of adherent cells112. HA also can act as a DAMP to initiate the
inflammatory cascade108. The detailed role of CD44 in leukocyte recruitment is discussed in
section 1.2.4.2.
1.2.4.2 Leukocyte Activation
Leukocytes need to be activated to transmigrate into the underlying tissues. Leukocyte
activation, triggered upon ligation with chemokines, is characterized by increased integrin
adhesiveness114, chemotaxis, respiratory burst, degranulation and enhanced phagocytosis. Two
major types of integrins have been shown to participate in the interaction with the inflamed
endothelium: CD11a/CD18 complex (LFA-1) and CD11b/CD18 complex (Mac-1). Both
integrins bind to endothelial ICAM-1, and are mainly responsible for the firm adhesion step in
the TEM process. Circulating leukocytes are slowed down via selectin interactions, bringing
them in proximity with the endothelium and subsequently binding cytokines/chemokines to their
respective receptors on immune cell surface. This engagement triggers leukocyte activation
conferring an enhanced integrin adhesiveness that enables stable attachment of leukocytes to the
Chapter 1: Literature Review
25
vascular endothelium via ICAM-1; the leukocytes are then guided by chemotactic signals
towards the site of inflammation108.
CD44 is a transmembrane glycoprotein that is constitutively expressed by various cell
types including leukocytes, ECs and SMCs115. It is also a multifunctional signaling molecule
mediating a variety of cellular process such as cell-cell adhesion, migration, proliferation and
tissue remodeling. As discussed previously, CD44 binds to HA, participates in leukocyte
adhesion/recruitment and neutrophil extravasation towards chemotactic signal116. Interestingly, to
switch from low-affinity to high-affinity binding to HA, CD44 requires an inflammatory stimulus
(eg. TNF-α, CXCL8 and CCL5)115. This represents a protective regulatory mechanism from
perpetuating inflammation leading to excessive host damage. Ligation of CD44 on leukocytes
with HA provokes activation of macrophages, neutrophils, NK cells and T cells, which then
release inflammatory mediators such as pro-inflammatory cytokines, ROS, growth factors and
MMPs115,117. The ability of CD44 to elicit leukocyte activation as well as to facilitate leukocyte
adhesive interaction with the endothelium suggests a crucial role of this molecule during
inflammation.
Chapter 1: Literature Review
26
1.3 MECHANISM OF LABOUR ONSET
1.3.1 Endocrine regulation
Pregnancy and uterine quiescence is maintained by the presence of progesterone. Early in
human pregnancy, corpus luteum serves as the main site of progesterone secretion, which later is
taken over by the placenta. The actions of progesterone include its ability to relax the
myometrium through inhibiting the expression of cytokines70, contraction associated proteins
(CAP)118, and estrogen receptor119, and by desensitizing myometrial responsiveness towards
oxytocin and prostaglandins120. On the other hand, estrogen has a stimulatory effect on
myometrial contractility by increasing the expression of CAP genes such as connexin-43 and
oxytocyin receptors121. In most mammalian species, the initiation of labour coincides with a
decline in the progesterone plasma level. However, this is not the case in human parturition.
Circulating progesterone does not fall in term pregnant women, yet the administration of
mifepristone (RU486, a progesterone antagonist) induces the initiation of labour121. These
paradoxical observations have led to the development of a functional withdrawal of progesterone
in human parturition. Several models of progesterone withdrawal in humans have been proposed,
which include altered expression of progesterone receptor (PR) isoforms, progesterone
metabolism and the antagonism of NF-κB with progesterone122. The functional removal of
progesterone lifts off the inhibitory effect on estrogen-to-estrogen receptor binding, which then
increases myometrium sensitivity towards its stimulatory effect on uterine contraction119.
Therefore, a careful balance of the ratio between these two opposing hormonal actions in
myometrial activation needs to be maintained and altered at the correct time for successful
pregnancy and delivery. It was further suggested that corticotropin-releasing hormone (CRH)
preceded the shift in estrogen/progesterone changes and acted as a placental time-determinant for
labour onset123. CRH is released from the hypothalamus and regulates the hypothalamic-
Chapter 1: Literature Review
27
pituitary-adrenal axis involved in the stress response. In humans, CRH placental concentration
rises at term, resulting in estrogen synthesis and reduction of progesterone production which
along with stretch-induced myometrial adaptations (described in details in section 1.3.2.1)
increase uterine responsiveness123.
Prostaglandins (PGs) are important mediators of many physiological processes including
the relaxation and contraction of SMCs. Cell membrane phospholipids are cleaved by
phospholipases to produce arachidonic acid, which is converted to prostaglandin H2 (PGH2,
precursor for various functional PGs) by the actions of primary PG synthases including COX-1
and COX-2. Terminal PG synthases subsequently produce functionally diverse PGs that mediate
various reproductive processes124. Interestingly, PGs can exert differential functions based on the
type of receptors they are bound to. This is best demonstrated by the functional divergence of
PGE2 receptors: EP1 and EP3 are stimulatory, EP2 and EP4 are relaxatory125. In pregnant
myometrium, PGD2 and PGI2 promote relaxation whereas PGE2 and PGF2α promote contraction
through mobilizing calcium reservoir in SMCs125; this was partly mediated by the distribution of
different PG receptors in the uterus126. In a sheep model, it was found that intrauterine PGF2α
increased with the onset of labour with a steady level of PGE2127. As well, human parturition is
associated with a rise in PGE2 and PGF2α in the amniotic fluid and the increase of in PG synthase
expression that could be regulated by pro-inflammatory cytokines124,128, suggesting integration
between inflammatory and endocrine signaling.
1.3.2 Labour as a physiologic inflammatory process
Human parturition is recognized as a localized inflammatory reaction9, which is
characterized by 1) the activation of maternal peripheral leukocytes47,129,204, 2) the increased
expression of cytokines/chemokines by gestational tissues, and 3) up-regulation of CAMs on
Chapter 1: Literature Review
28
uterine vascular ECs110,130. Our groups recently proposed a new labour model that inflammation
of the uterus is a physiological process that involves the myometrium, decidua and cervix to
bring about the successful delivery of the baby9. Although hormonal regulation in labour is
evident in animal models, human parturition does not seem to be dependent on the withdrawal of
progesterone, nor on the increase in estrogen. It has been proposed that human labour is a
culmination of interlinked physiological processes that are dominated by the inflammatory
system to switch from a quiescent state of the uterus to an activated one121,131. This hypothesis is
confirmed by correlating several potential mechanisms of labour onset using a retrospective
computational approach, which revealed inflammation as the most likely initiating event in
comparison to functional progesterone withdrawal and oxytocin receptor-mediated pathway132.
1.3.2.1 Mechanical regulation – Myometrial Inflammation
The effect of mechanical stretch on the initiation of labour stemmed from the observation
that women presenting with polyhydramnios, multifetal pregnancy, singleton pregnancy with a
larger than average fetus or pregnancy in a unicornuate uterus undergo higher risk of PTL133-135;
all partly attributed to the increased distension on the uterine wall. The myometrium undergoes
several stages of development (proliferative, synthetic, contractile, labour and involution)
throughout pregnancy to accommodate the growing fetus. We previously demonstrated that this
modulation is largely regulated under integrated hormonal and mechanical control using a
unilateral pregnant rat model136. By late gestation, the uterus stops growing while fetal growth
continues, resulting in an increase in uterine distension that coincides with myometrial transition
to the labour phase. During this terminal phase, uterine stretch is accompanied by the increased
expression of CAP genes, oxytocin receptor and prostaglandin F receptor136. Together with the
Chapter 1: Literature Review
29
reduced progesterone signaling, the myometrium becomes fully committed to synchronized
contractions that facilitate in the delivery of the fetus.
The physiological inflammation observed in the myometrium around the time of
parturition could partly be regulated by mechanical stretch. As discussed previously in section
1.2.3, we speculate that mechanical stretch imposed by the growing fetus on the myometrium
might locally stimulate the increase in cytokine levels. Our lab established an in vivo stretch
model using a unilateral pregnant rat and demonstrated the association between the increased
production of various cytokines and chemokines (IL-1α, IL-6, CCL2 and CXCL1) in term
myometrium and uterine occupancy, as well as concurrent influx of neutrophils and
macrophages70, suggesting that mechanical signals regulate physiological myometrial
inflammation and the initiation of labour. To prove that these effects were due to stretch, we
inserted a 2-mm expandable cylinder of laminaria (a dried seaweed stem used in obstetrics for
cervical dilatation) into the non-gravid horn of the unilateral pregnant rat. We found that cytokine
expression in the laminaria horn matched the gravid horn cytokine profile with even higher
concentrations, as well as higher macrophage and neutrophil infiltration into the rat
myometrium9. We also showed the ability of isolated rat myometrial SMCs to synthesize CCL2
upon static mechanical stretch and that this stretch-induced effect was attenuated by progesterone
treatment70. Progesterone has anti-inflammatory effect on cytokine expression. With the decline
in plasma progesterone level (or function) before labour onset, it is likely that possible
antagonism exists between mechanical stretch and progesterone in the local release of cytokines.
However, it was recently reported that progesterone failed to reduce stretch-induced CXCL8
mRNA expression in human myometrial SMCs120, which revealed the complexity in the
mechanism of labour onset between different species. With these results, we demonstrated the
central contribution of stretch alone to uterine inflammation during labour.
Chapter 1: Literature Review
30
Similar observations were found in human myometrium. Thomson et al showed that
leukocytes, mainly macrophages and neutrophils massively infiltrate the human myometrium
during active labour when compared to samples obtained before the onset of labour23. It was also
reported that moderate to marked inflammation indicated by the presence of leukocytes in
myometrial samples was detected more in women after the onset of labour compared to before
the onset (20.4% vs. 2.8%); and this inflammation correlated well with cervical dilatation and
fetal membrane rupture137. In parallel, up-regulation of pro-inflammatory cytokines mRNA
expression of IL-1β, IL-6, CXCL8 and CCL2 was observed in the myometrium of healthy
labouring women9. Recent data in our lab confirmed these published findings and revealed a
more extensive list of up-regulated cytokines and chemokines (CXCL8, CXCL1, CCL2, CCL7,
IL-6 and G-CSF) in healthy term-in-labour myometrial samples, while also detecting a higher
number of macrophage and neutrophil infiltrate9. In addition, the presence of ICAM-1, PECAM-
1 and VCAM-1 has been qualitatively detected on the myometrial vascular endothelium prior to
and during labour, with E-selectin being up-regulated only during labour110. Recent genomic
studies have further confirmed the involvement of a physiologic inflammation in the
myometrium during labour. Specifically, genes involved in the pathway of inflammation and
leukocyte trafficking were significantly up-regulated in labouring myometrial samples21,138. As
CAMs facilitate the adhesion of leukocytes to the underlying endothelium and chemokines
provide directional signals for immune cell homing, these findings collectively associate
cytokine/chemokine induction and leukocyte infiltration with labour.
The source of the elevated cytokines in the myometrium of healthy women during labour
remains largely elusive. As seen in the rat model, uterine stretch by the growing fetus potentially
triggers the production of multiple cytokines and chemokines during human parturition. It is also
likely that the infiltrated leukocytes contribute to the increase in cytokine levels since they are
Chapter 1: Literature Review
31
rich sources of these inflammatory molecules. Static stretch exerted on isolated human term-not-
in-labour myometrial cells increased CXCL8, CCL2, CXCL1, CCL5, CXCL5 and CCL20
mRNA and protein synthesis, an effect that may be mediated by NF-κB and MAPK77. Activation
of the NF-κB transcription factor is a key regulatory event of the production of inflammatory
signals and its activity has been detected in the human myometrium at the time of labour onset123.
The data from Hua et al suggested that uterine stretch is an activator of NF-κB-regulated
cytokine synthesis. Aside from up-regulating inflammatory mediators, NF-κB also participates in
the expression of COX-2 in human myometrium before the initiation of labour139. Due to the
wide range of cellular effects, many research groups have investigated MAPK signaling pathway
in stretch-induced effects during labour. The three most extensively studied MAPKs include
extracellular-regulated kinase (ERK) 1/2, c-Jun N-terminal kinase (JNK) and p38 MAPK. A
variety of stimuli activate MAPKs, which in return exert different cellular functions. In general,
ERK1/2 respond to growth factors for cell proliferation, division and differentiation, whereas
JNK and p38 respond to stress stimuli such as oxidative stress and inflammatory cytokines for
apoptosis and inflammatory reactions140. It was shown that stretch-induced increase in COX-2
and CXCL8 gene expression in human myometrial SMCs operates in a MAPK-dependent
pathway, specifically through ERK1/2 and p38 activation104. Additionally, uterine contraction
force was strengthened by stretch-induced activation of focal adhesions, which are important
mechanotransduction sites connecting cytoskeleton to extracellular matrix, and of downstream
ERK signaling141. These findings suggest that myometrial function (contractility and
enhancement of local inflammatory milieu) during labour may be regulated by mechanical stretch
via MAPK and/or NF-κB pathways.
Chapter 1: Literature Review
32
1.3.2.2 Decidual Inflammation
It has long been proposed that decidual activation, associated with elevated cytokine
output and PG production, is an early event in labour142. Decidual inflammation was detected in
up to 29% of non-infected term labouring women without ruptured membranes137. Furthermore,
the number of decidual macrophages was significantly higher in women who had undergone
labour at term in comparison to term pregnant women not in labour143. Neutrophils were also
detected but in very low numbers in the absence of infection compared to macrophage levels143,
indicating the importance of macrophages versus neutrophils in decidual inflammation during
labour. It appears that decidual inflammation precedes myometrial activation, since it was
observed that 99.3% of decidual samples contained leukocyte infiltrate when myometrial
inflammation was present137. Using a rat model, we were able to observe and detect the timing of
macrophage infiltration in the decidua. Macrophage recruitment into the decidua began
approximately 12h before labour and was followed by myometrial infiltration143. This suggests
that decidual inflammation is an early event in parturition that may facilitate myometrial
activation. Decidual cells are capable of producing various cytokines and chemokines. As
demonstrated by our recent data, various pro-inflammatory cytokine and chemokine mRNA and
protein levels (eg. IL-1β, IL-6, CCL2, CXCL1) were increased in the mouse decidua at TL
concomitant with recruitment of macrophages and neutrophils, which all were further up-
regulated in early postpartum34. In addition, PGF2α protein concentrations was increased in TL
decidua samples, as well as MMP-2 and MMP-9 protein levels and activity144. The leukocyte
infiltrate in the decidua possibly secretes these molecules, which subsequently contribute to
myometrial contractility at labour and the shedding of placenta and restoration of the
endometrium postpartum.
Chapter 1: Literature Review
33
1.3.2.3 Cervical ripening at term is not an inflammatory process
Cervical ripening is characterized by the breakdown and the remodeling of the ECM of
the cervix during labour. The result of these cervical changes is a distensible and/or dilated
vaginal opening to facilitate the passage of the baby during forceful labour contractions. Invasion
of immune cells and the increase in cytokines in the human cervical connective tissue at term was
proposed to be important events in the process of cervical remodeling22. However, this view has
recently been challenged as animal work revealed that immune cells are not key players in
cervical ripening at term but instead participate in postpartum involution145,146. A new hypothesis
states that not all aspects of labour involved inflammatory processes, and that the pro-
inflammatory cascade in the cervix occurs postpartum to quickly recover and repair the cervix to
protect it from environmental insults as well as enabling subsequent pregnancies145. The initiation
of cervical ripening is stimulated by progesterone withdrawal, while columnar epithelial cells and
fibroblasts in the cervix represent as the source of MMP for collagen breakdown146.
Chapter 1: Literature Review
34
Figure 1.2. Physiologic uterine inflammation model. Decidual and myometrial inflammation both contribute to the progression of labour and the subsequent postpartum involution. It is suggested that decidual inflammation occurs first, which may activate the nearby myometrium. Another trigger for myometrial inflammation is the mechanical stretch imposed on the uterine wall by the growing fetus. A series of actions occurs in both uterine compartments during labour and amplifies the physiologic inflammation. 1) An increase in chemokine (and cytokine) secretion that establishes a chemotactic gradient. 2) These chemokines/cytokines then activate the circulating peripheral leukocytes and the endothelium to express cell adhesion molecules respectively. 3) Subsequently, leukocyte adhesion and extravasation in the tissues are enhanced, leading to 4) an amplification of the inflammatory signal. The physiologic uterine inflammation then contributes to the increased PG synthesis, CAP gene expression and oxytocin level that culminate in the enhancement of uterine contractility for the successfully delivery of the fetus. Figure adapted and modified with permission from Shynlova et al, 201334; Journal of Cellular and Molecular Medicine.
3"
Neutrophil"Monocyte" Macrophage" Cytokines""Myometrial"
cell"Decidual""""""""cell"
PGs"synthesis ↑ Oxytocin"↑"
"
In?lammatory"signal"
ampli?ication"Chemokine"secretion""
Uterine"contractility"↑"!CAP"genes"↑""
Leukocyte"adhesion"&"extravasation"
Leukocyte""activation"
Chemokine"secretion""
MYOMETRIUM"
DECIDUA"Endothelial""
cell"
CAPILLARY"
CAM↑""
1"
2"
4" 5"
3"
6"
1"
Chapter 1: Literature Review
35
1.4 RATIONALE AND HYPOTHESIS
1.4.1 Rationale
The specific details behind the mechanism of labour onset remain elusive. Spontaneous
labour at term is associated with massive infiltration of macrophages and neutrophils, up-
regulation of cell adhesion molecules and increased local levels of cytokines and chemokines in
the pregnant myometrium. It has been demonstrated that myometrial SMCs can be triggered by
mechanical stretch to secrete pro-inflammatory cytokines. It is likely that a potential correlation
exists between uterine stretch by the growing fetus and the observed leukocyte invasion in the
myometrium at late gestation. The development of a localized uterine inflammation prior to
labour onset suggests the potential regulatory roles of the maternal immune system in labour
initiation.
1.4.2 Hypothesis and Objectives
We hypothesize that mechanical stretch of the myometrial smooth muscle cells facilitates
peripheral leukocyte transendothelial migration into the myometrium via up-regulation of
endothelial cell adhesion molecules and enhancement of the local chemotactic environment.
The three main objectives of this thesis work include: 1) the characterization of cytokines
secreted by human myometrial SMCs upon static stretch; 2) the influence of these stretch-
induced cytokines on human endothelial and leukocyte activation, and 3) the effect of the stretch-
induced cytokines on peripheral leukocyte recruitment.
36
CHAPTER 2 Materials and Methods
Chapter 2: Materials and Methods
37
2.1 MATERIALS
All buffers used in the course of the studies (phosphate buffered saline (PBS) and Hank’s
buffered salt (HBSS) solution) were prepared and autoclaved in-house by the sterilization
department at the Samuel Lunenfeld Research Institute. The Human IL-6 and IL-8 (CXCL8)
Ready-SET-Go!® and VEGF-A Platinum ELISA kits were purchased from eBioscience (CA,
USA). Human CXCL1 Single-Analyte ELISArray Kit was purchased from SABiosciences (ON,
Canada) whereas human G-CSF ELISA kits was purchased from RayBiotech, Inc. (GA, USA).
Intracellular signaling inhibitors included: PD98059, SP600125, SB203580 and Ro31-8220, all
purchased from Sigma-Aldrich (MO, USA). Fluorochrome-conjugated mouse anti-human
antibodies were purchased from BD Pharmingen for FACS analysis: CD54-APC, CD62E-PE-
Cy™5 (PC5), CD106-PE, CD11b-PE-Cy™5, CD44-PE, CD45-APC-H7, CD14-PerCP and
CD15-APC, CD15-FITC.
2.2 METHODS
2.2.1 Human peripheral blood collection
The study design was approved by the Institutional Review Board of Mount Sinai
Hospital, University of Toronto. Healthy pregnant women with a singleton pregnancy presenting
for regular obstetric care at the hospital were recruited with the help from The Research Centre
for Women’s and Infants’ Health BioBank. Written consent to participate in the study was
obtained from each patient. Peripheral blood were collected in Gel and Lithium Heparin
vacutainers (BD Diagnostics, NJ, USA) and processed within 1 hour of collection.
Chapter 2: Materials and Methods
38
2.2.2 Primary human peripheral neutrophil isolation
Primary human neutrophils were isolated based on the different densities of the immune
cell populations. A double gradient consisting of 3 ml of HISTOPAQUE®-1119 (bottom layer)
and 3 ml of HISTOPAQUE®-1077 (top layer; Sigma-Aldrich, MO, USA) was prepared freshly in
a 15 ml Falcon™ conical tube (BD Biosciences, CA, USA). 6 ml of fresh whole blood was
carefully layered on top of the double gradient and centrifuged at 700x g for 30 min at room
temperature without brake. After centrifugation, mononuclear cells (lymphocytes and
monocytes), granulocytes (neutrophils, basophils and eosinophils) and RBC were separated at
different interphases. Granucolytes (referred as neutrophils hereafter) were collected after
removing the plasma and monoculear layers and washed twice with SF-DMEM (200x g, 10 min,
room temperature). Next, primary human neutrophil pellet was resuspended in SF-DMEM and
counted on CASY®Cell Counter (Roche Applied Science, QC, Canada) based on distinct sizes of
cells as they are aspirated through a 150 µm measuring capillary one by one. Neutrophils were
counted with the evaluation cursor set at 7.5 µm. Isolated neutrophils were > 90% pure with some
red blood cell (RBC) contamination and > 95% viable as determined later by flow cytometry and
trypan blue respectively. In instances where RBC contamination exceeded 10%, RBC lysis was
performed by adding 1 ml of cold sterile water and immediately diluted with 9 ml of DMEM/F12
to stop the lysis.
2.2.3 Cell culture
Human myometrial smooth muscle cell line immortalized with human telomerase reverse
transcriptase (hTERT-HM, a gift from Dr. Jennifer Condon147) was cultured in phenol red-free
DMEM/F12 (Gibco, ON, Canada) supplemented with 10% fetal bovine serum (FBS, Gibco, ON,
Chapter 2: Materials and Methods
39
Canada), 15 mM HEPES, 100 U/ml penicillin/streptomycin and 0.25 µg/ml amphotericin B
(Lonza Walkersville Inc., MD, USA). Human uterine microvascular endothelial cell line
(UtMVEC-Myo) was purchased from Lonza Walkersville Inc. (MD, USA).
UtMVEC-Myo were grown in endothelial growth media (EGMTM-2MV, Lonza
Walkersville Inc., MD, USA) supplemented with supplier-recommended concentrations of
human epidermal growth factor, hydrocortisone, gentamicin, VEGF, human basic fibroblast
growth factor, insulin-like growth factor ascorbic acid and 5% FBS. Both cell lines were cultured
and used from passages 4 to 8 in a 37oC incubator with 5% CO2. Media was changed every 2 to 3
days. Cell detachment was achieved using 1X Trypsin-EDTA (Gibsco, ON, Canada).
2.2.4 Application of static stretch
The impact of mechanical stretch on myometrial cytokine secretion was investigated in
vitro using hTERT-HM cells and a vacuum-driven Flexcell computer system (FX-5000, Flexcell
International Corp., NC, USA). We seeded hTERT-HM cells at a density of 300,000 cells/well
into the flexible-bottom Collagen-I-coated 6-well Flexcell culture plates with 1.5 ml complete
growth media each. Once the cells reached approximately 75% confluence, complete growth
media was replaced with 5 ml of serum-free DMEM/F12 (SF-DMEM) supplemented with 1X
Insulin-Transferrin-Selenium-Sodium Pyruvate Solution (ITS-A, Gibco, ON, Canada). hTERT-
HM cells were serum-starved overnight to ensure every cell was halted at G0 phase at the
beginning of the stretch protocol. Static stretch up to a maximum of 25% was applied for 24
hours inside a humidified incubator with 5% CO2 at 37oC. Also, we investigated the possible
mechanisms behind the stretch-induced cytokine production using specific inhibitors of
intracellular signaling (Table 2.1). Each inhibitor was reconstituted in DMSO, diluted to a
suitable working concentration to limit DMSO percentage within 0.02% in the culture wells. For
Chapter 2: Materials and Methods
40
the inhibitor experiments, hTERT-HM cells were pretreated with inhibitor or vehicle (DMSO)
for 1 hour in a 37oC incubator and subsequently stretched for 1 hour. The conditioned media,
both from control non-stretched (NS-CM) and stretched plates (S-CM) were collected,
centrifuged (10 min at 1000x g, 4oC) and filtered through 0.22-µm Millex® syringe filter units
(EMD Millipore Corp., MA, USA) to remove cellular debris. Processed conditioned media was
aliquoted into smaller portions and kept in -20oC until protein content analysis. In addition,
hTERT-HM cells were collected and extracted for total RNA after the stretch regimen.
Table 2.1. List of signaling inhibitors used. Inhibitor Target Concentration used (µM) PD98059 ERK 25 SP600125 JNK 20 SB203580 p38 20 Ro31-8220 PKC 10
2.2.5 FDA-PI viability assay
Viability of hTERT-HM cells following the stretch protocol was assessed using
fluorescein diacetate-propidium iodide (FDA-PI) stain (Sigma-Aldrich, MO, USA). FDA is a
non-fluorescent molecule; however when taken up by live cells, it is converted to the green
fluorescent dye, fluorescein, by non-specific esterases148. On the other hand, PI enters into
compromised membranes of dead cells and stains red. After conditioned media had been
collected, stretched plates were washed and stained with FDA and PI (both at 20 µg/ml) for 3 min
at room temperature. Next, the flexible membranes of the Flexcell plates were carefully cut out
with a blade and immediately placed on to a glass slide (Fisher Scientific, ON, Canada) to view
under a fluorescent microscope using a 520 nm filter.
Chapter 2: Materials and Methods
41
2.2.6 Multiplex Cytokine Assay
We screened a total of 48 different human cytokines in the collected conditioned media
using the 27-plex and 21-plex Panels of the Bio-Plex Pro™ Human Cytokine Assays (Bio-Rad
Laboratories Inc., CA, USA) following manufacturer’s instruction manual. The assay principle is
similar to that of an enzyme-linked immunosorbent assay (ELISA), except Bio-Plex allows for
simultaneous detection for different analytes in a single well using a selection of magnetic beads
that have been coupled to specific monoclonal antibody individually. During manufacturing,
these beads are labeled with varying ratios of two fluorophores and subsequently assigned
specific spectral signatures (bead region), which permit the identification of each specific target
(xMAP Technology, Luminex Corporation, USA). After the analytes are bound to the coupled
beads, biotin-labeled detection antibodies and a fluorescent streptavidin reporter are added to
quantify the amount of analytes present in the samples.
Conditioned media were thawed on ice and kit reagents were brought to room temperature
prior to usage. The list of human cytokines analyzed is described in Table 2.2. The assay protocol
is summarized briefly in the following. Lyophilized standard was reconstituted with 500 µl of SF-
DMEM and incubated on ice for 30 min. When ready, the reconstituted standards were diluted
four-fold with SF-DMEM to create an 8-point standard curve. Meanwhile, the supplied coupled
magnetic beads were diluted as instructed in the manual, added to each well and washed twice
with wash buffer. Next, 50 µl of either samples or the diluted standards were loaded into each
well and incubated on a shaker for 30 min at room temperature. Subsequently, detection
antibodies and streptavidin-PE were diluted and pipetted into each well. At the end of the
protocol, the assay plate was read on the Bio-Plex® 200 System with High-Throughput Fluidics.
Washing steps were facilitated using the HydroFlex™ microplate washer (Tecan Group Ltd.,
Switzerland) with a magnetic base plate. Standards and samples were run in duplicates and
Chapter 2: Materials and Methods
42
analyzed using the Bio-Plex Manager™ 5.0. During each run, SF-DMEM was assayed together
as blank controls. Standard curves for each cytokine were generated on the five-parameter
logistic regression model. Next, standard validity was assessed using the % Recovery formula
(Observed/Expected)*100; standards whose % Recovery fell outside the 70-130% range were
excluded.
Chapter 2: Materials and Methods
43
Table 2.2. 48 human cytokines analyzed using Bio-Plex Pro™. Symbol Name Alias Sensitivity (pg/ml) 27-plex IL-1β† Interleukin 1 beta 0.6 IL-1rα Interleukin 1 receptor antagonist 5.5 IL-2† 1.6 IL-4† 0.7 IL-5† 0.6 IL-6 2.6 IL-7† 1.1 IL-8 CXCL8 1.0 IL-9 2.5 IL-10 0.3 IL-12p70 Interleukin 12 subunit p70 3.5 IL-13† 0.7 IL-15† 2.4 IL-17† 3.3 Basic FGF Basic fibroblast growth factor 1.9 Eotaxin† 2.5 G-CSF Granulocyte colony-stimulating factor CSF3 1.7 GM-CSF Granulocyte macrophage colony-stimulating factor CSF2 2.2 IFN-γ Interferon gamma 6.4 IP-10 Interferon gamma-induced protein 10 CXCL10 6.1 MCP-1 Monocyte chemotactic protein-1 CCL2 1.1 MIP-1α† Macrophage inflammatory protein-1 alpha CCL3 1.6 MIP-1β† Macrophage inflammatory protein-1 beta CCL4 2.4 PDGF-BB Platelet derived growth factor subunit B 2.9 RANTES† Regulated and normal T cell expressed and secreted CCL5 1.8 TNF-α† Tumor necrosis factors alpha 6.0 VEGF Vascular endothelial growth factor 3.1 21-plex IL-1α† Interleukin 1 alpha 0.5 IL-2Rα Interleukin 2 receptor antagonist 2.1 IL-3 4.8 IL-12p40 Interleukin 12 subunit p40 23.3 IL-16 0.4 IL-18 0.2 CTACK† Cutaneous T-cell attracting chemokine CCL27 3.4 GRO-α Growth regulated oncogene-alpha CXCL1 6.3 HGF Hepatocyte growth factor 4.9 IFN-α2 Interferon alpha-2 4.3 LIF Leukemia inhibitory factor 5.5 MCP-3 Monocyte chemotactic protein-3 CCL7 1.0 M-CSF Macrophage colony-stimulating factor CSF2 0.9 MIF Macrophage migration inhibitory factor 1.5 MIG Monokine induced by gamma interferon CXCL9 1.2 Β-NGF Nerve growth factor beta 0.2 SCF Stem cell factor 1.0 SCGF-β Stem cell growth factor-beta 45.4 SDF-1α Stromal cell-derived factor-1 alpha CXCL12 8.7 TNF-β† Tumor necrosis factor beta 0.3 TRAIL† TNF-related apoptosis-inducing ligand 2.1
IL: Interleukin; CXCL: Chemokine (C-X-C motif) ligand; CCL: Chemokine (C-C motif) ligand † Cytokines excluded from statistical analysis; either not detected or n < 4 after exclusion.
Chapter 2: Materials and Methods
44
2.2.7 Enzyme-linked immunosorbent assay (ELISA)
ELISA was performed to validate the multiplex assay screening results. Based on literature
review, we focused our validation on individual cytokines significantly up-regulated by static
stretch in multiplex analysis and highly expressed cytokines that are reported to be involved in
endothelial activation and leukocyte recruitment. These included IL-6, CXCL8, VEGF, CXCL1
and G-CSF. Depending on the standard range of the ELISA kit, samples were diluted with SF-
DMEM accordingly to ensure the absorbance readings stayed within the linear range of the
standard curve. Standard range and sensitivity of each ELISA kit is summarized in Table 2.3.
Protocols of individual ELISA kits were carried out following manufacturer’s instruction manual.
All kit reagents and samples were brought to room temperature prior to usage. Duplicates of 100
µl samples and standards were loaded into individual wells. Standard curves for each ELISA kit
in this study were generated using linear regression. Washing steps were all performed using the
Tecan HydroFlex™ microplate washer. ELISA plates were all measured using µQuantTM
(BioTek® Instruments, Inc., VT, USA) with wavelength settings specified by the ELISA kit
manufacturer.
Table 2.3. Human ELISA kit sentitivity and standard range for each analyte.
ELISA Name Sensitivity (pg/ml) Assay Standard Range (pg/ml)
CXCL1 45.5 31.25 - 2000 G-CSF 1 0.69 - 500
IL-6 2 3.125 - 200 IL-8 5 7.8125 - 500
VEGF 7.9 15.6 - 1000
Chapter 2: Materials and Methods
45
2.2.8 Endothelial cell adhesion molecule (CAM) expression
Experimental plates were set up first by pre-coating 12-well culture plates for one hour
with 0.1% gelatin in sterile water (Millipore, MA, USA) at 37oC. Human UtMVEC-Myo cells
were plated onto the coated 12-well plates with a seeding density of 100,000 cells per 1.5 ml of
EGMTM-2MV. Once an endothelial monolayer was formed (about 48 hours), it was serum-
starved with endothelial basal medium supplemented with ITS-A overnight. The next day, 500 µl
of either SF-DMEM, NS-CM, S-CM or selected individual cytokines was added to the
monolayer and incubated for 1, 2 and 4 hours for qRT-PCR analysis or incubated for 6 hours for
flow cytometry analysis.
2.2.9 Real-time reverse transcription polymerase chain reaction (qRT-PCR) Analysis
We examined CXCL1 and IL8 gene expression levels in hTERT-HM cells after treatment
with various kinase inhibitors. In the endothelial CAM expression study, we investigated the
effect of S-CM on the gene expression of E-selectin (SELE), vascular cell adhesion molecule-1
(VCAM1), intercellular cell adhesion molecule-1 (ICAM1) and platelet endothelial cell adhesion
molecule-1 (PECAM1). Gene expression levels in both studies were normalized against three
housekeeping genes: YWHAZ, TBP and SDHA. To extract total RNA, hTERT-HM or UtMVEC-
Myo cells were washed twice with ice-cold PBS, scraped and lysed by adding 100 µl of RLT
lysis buffer (Qiagen, MD, USA). RNA purification was performed using the RNeasy Mini Elute
Kit (Qiagen, MD, USA) with the use of genomic DNA Eliminator columns prior loading to the
Mini Elute spin columns. Purified RNA was eluted with 14 µl of RNase-free water. RNA
concentration was measured by the NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific
Inc., DE, USA).
Chapter 2: Materials and Methods
46
Activation of genes encoding surface markers relating to neutrophil extravasation was
also investigated. Fresh human neutrophils were washed in SF-DMEM and incubated with either
NS-CM or S-CM for 3 hours, and subsequently lysed with 1ml of TRIzol® Reagent (Life
Technologies, CA, USA) using 27G½ syringe needle (Becton Dickinson & Co., NJ, USA). RNA
was isolated according to the manufacturer’s instructions. Isolated RNA was subjected to DNase
I digestion for 15 min at room temperature and immediately processed by RNeasy MinElute
Cleanup Kit (Qiagen, MD, USA). Specific primers were designed for ICAM1, CD44 (HA
receptor), and CD181 (IL-8 receptor). Gene expression levels were normalized against three
housekeeping genes: YWHAZ, HPRT1 and SDHA.
RNA quality was assessed using the Experion™ RNA StdSens Analysis Kit (Bio-Rad
Laboratories Inc., CA, USA) following manufacturer’s instructions. The Experion™ utilizes
LabChip microfluidic technology (Caliper Life Sciences, Inc., MA, USA) to perform automated
nucleic acid electrophoresis and data analysis to assess RNA quality and concentration all in one
run. The software generates and reports a virtual gel, RNA concentration and RNA quality
represented by a RNA Quality Indicator (RQI) value. The software contains a built-in RQI
algorithm that compares electrophoregram of the sample to that of a series of standardized
degraded RNA to return a number between 1 (degraded) and 10 (intact). Both the virtual gel and
RQI were used to examine for any degradation in the sample. Samples with a RQI value greater
than 7.5 and a clean separated gel image were accepted as intact RNA.
Stock cDNA solutions of 50 ng/µl were generated with iScript reverse transcription (RT)
supermix (Bio-Rad Laboratories Inc., CA, USA) following the recommended reaction protocol.
cDNA was diluted further to a working concentration at 5 ng/µl and stored at -20oC until qRT-
PCR analysis. Specific primers of genes in study were designed using Primer-BLAST on the
NCBI website (Table 2.4) using the following criteria: product size of 80 to 120 base pairs;
Chapter 2: Materials and Methods
47
minimum melting temperature (Tm) of 57oC, optimal of 60 oC and maximum of 63 oC with
maximum Tm difference of 2oC; and primers must span exon-exon junction. Primer pairs were
customized in lyophilized form by Eurofins MWG Operon (AL, USA) and reconstituted in
molecular-grade sterile water (Sigma-Aldrich, MO, USA) to a master stock concentration of 100
µM. Primer specificity and efficiency were tested using pooled cDNA generated from a
combination of representative samples of each treatment condition. Standard curves were created
with 4-fold serial dilutions of the pooled cDNA from 50 ng/µl to 0.195 ng/µl. Primers with
efficiencies from 80-100% were accepted. A list of six housekeeping genes (YWHAZ, B2M,
ACTΒ, TBP, HPRT1 and SDHA; see Table 2.4 for sequence) was tested using the geNorm
algorithm149 to select the top 3 stable housekeeping genes for each qRT-PCR study. All qRT-
PCR reactions were carried out on the CFX96 or CFX384 Touch™ Real-Time PCR Detection
Systems (Bio-Rad Laboratories Inc., CA, USA). Each reaction (10 µl reaction volume for 96-
well; 5 µl for 384-well) contained 5 ng of cDNA, LuminoCt® SYBR® Green qPCR ReadyMix™
(Sigma-Aldrich, MO, USA), forward and reverse primers at a final concentration of 300 nM. The
cycling protocol used is described as follows: initial denaturation 95oC for 30 sec, then 40 cycles
of denaturation 95 oC for 5 sec and annealing/extension 60oC for 20 sec. Each qRT-PCR run was
followed by a melting curve analysis to confirm the specificity of the primers used; reaction was
heated slowly from 65oC to 95oC (0.1oC/sec). Gene expression values were analyzed using the
ΔΔCq mode on the CFX ManagerTM software 2.0 (Bio-Rad Laboratories Inc., CA, USA). Every
cDNA samples were run in triplicates with the cut-off quantification cycle standard deviation
(ΔCq) ≤ 0.3. Sample replicates with a Cq value greater than 35 cycles were excluded from data
analysis. With every run, a no template control of each primer mastermix was also loaded on the
plate to detect any contaminations in the reagents.
Chapter 2: Materials and Methods
48
Table 2.4. Primer pair information for human genes examined using qRT-PCR.
Symbol AcessionNumber Name Forward Primer Reverse Primer Alias
CD11a NM_001114380
Integrin, alpha L
AGCATTTTGGCCTGTGACCCTGG
GCAGCATGGGACCCTGCAGAT
ITGAL, LFA-1
CD44 NM_000610
CD44 molecule
ACTGTACACCCCATCCCAGACGA
ACTGTACACCCCATCCCAGACGA
CXCL1 NM_001511
Chemokine (C-X-C motif) ligand 1
CGCAGCAGGAGCGTCCG
AGTGGGGTCCGGGGGACTTCA GRO-α
CXCR1 NM_000634
Chemokine (C-X-C motif) receptor 1
ACCTGGCCGGTGCTTCAGTTAGA
AGGGCATAGGCGATGATCACAACA CD181
ICAM1 NM_000201
Intercellular adhesion molecule 1
GACCGCAGAGGACGAGGGCA
TTGGGCGCCGGAAAGCTGTAG CD54
IL8 NM_000584 Interleukin 8 AAACATGACTTCCAA
GCTGGCCGT GCAAAACTGCACCTTCACACAGAGC CXCL8
PECAM1 NM_000442
Platelet/ endothelial cell adhesion molecule 1
TCCACCAGCGTCATTGGCGT
TGCCCTTGCGGTGTTAGGCA CD31
SELE NM_000450 E-selectin TCTGCTGCTGGACTCT
CCCTCC GCAGCTCTGGCAGGAACAAA CD62E
VCAM1 NM_001078
Vascular cell adhesion molecule 1
TCCAGGTGGAGCTCTACTCATTCC
CGGTCAAGGGGGTACACGCT CD106
Housekeeping gene primer sequences (ACTB, B2M, HPRT1, SDHA, TBP, YWHAZ) are as described in149.
2.2.10 Fluorescence-Activated Cell Sorting (FACS) Analysis
We utilized FACS to analyze the expression of E-selectin (CD62E), VCAM-1 (CD106)
and ICAM-1 (CD54) on the cell surface of stimulated UtMVEC-Myo monolayer. Antibody
titrations were performed and the optimal staining antibody volume per test was determined: 5 µl
for CD106-PE, and 3 µl for both CD54-APC and CD62E-PC5 for each well. All incubations
were done with 300 µl of PBS in each well, except for the 30 min fluorochrome-conjugated
antibody staining where 300 µl of PBS with 0.1% of bovine serum albumin (BSA) was used
instead. Experimental protocol was modified from Grabner et al150. Briefly, after stimulation with
NS-CM or S-CM, the monolayers were carefully washed with PBS and stained with
LIVE/DEAD® Fixable Violet Stain (LDVio, Molecular Probes Inc., OR, USA) for 20 minutes in
Chapter 2: Materials and Methods
49
the dark to exclude the dead cell population during analysis. Next, UtMVEC-Myo monolayers
were fixed with 0.5% formaldehyde in cold PBS for 3 min and stained for specific cell adhesion
molecules for 30 min at 4oC. To detach cells, UtMVEC-Myo monolayers were treated with
trypsin/EDTA for 3 min at 37oC. Trypsin activity was blocked by the addition of DMEM/10%
FBS to each well and cells were separated mechanically by repeated pipetting. Finally, stained
UtMVEC-Myo cells were collected and washed with PBS at 400x g and 4oC for 6 min. The cell
pellets were resuspended with 350 µl of BD™ Stabilizing Fixative (BD Biosciences, CA, USA)
in 5 ml polystyrene tubes (SARSTEDT, QC, Canada) and kept at 4oC until data acquisition.
To study the protein expressions of CD44 and CD11b on the surface of monocytes and
neutrophils, we collected peripheral blood from healthy first-trimester pregnant women (11-12
weeks of gestation). Whole blood was stimulated for 1 hour with NS-CM, S-CM or SF-DMEM
(negative control) followed by FACS analysis. Granulocytes were identified as CD45+CD15+ and
monocytes as CD45+CD14+. A lyse/no-wash procedure was adapted to minimize artificial
activation of leukocytes. Briefly, equal volumes of whole blood and conditioned media (NS-CM
or S-CM) were mixed gently by pipetting to produce whole blood-conditioned media mixture
(WB-CM) and placed into a CO2 incubator at 37oC for 1 hour. Staining for specific antigens was
done by mixing 100 µl of WB-CM with staining antibodies in the last 30 min of incubation.
Basal expression of surface antigens was established by staining the time zero SF-DMEM tube
immediately after making WB-CM. All stained samples were transferred into 450 µl of Fix/Lyse
Solution (BD Biosciences, CA, USA) to lyse RBCs at room temperature for 15 min and kept at
4oC until analysis.
Fluorescence minus one control (FMO) tubes were also prepared for every treatment to
set appropriate gates during analysis. Data acquisition was run using the 10-colour Gallios Flow
Cytometer (Beckman Coulter, Inc., ON, Canada) with at least 5000 UtMVEC-Myo cells or 1500
Chapter 2: Materials and Methods
50
monocytes as a stop mark. Data analysis was performed using Kaluza Analysis Software v.1.2
(Beckman Coulter, Inc.). Compensation beads (Anti-mouse Ig, κ and Negative Control (FBS)
from BD Biosciences, CA, USA) stained with each staining antibody (10 min, room temperature,
dark) were prepared and run with the samples in each experiment. To standardize fluorescent
readings of individual experimental runs, the instrument was calibrated using Flow-Set™ Pro
Fluorospheres (Beckman Coulter, Inc., CA, USA) prior to the actual sample data acquisition each
time. The voltage setting of each parameter was adjusted to align the mean fluorescence intensity
(MFI) values within ± 0.5 unit with the previous experiment.
2.2.11 Permeability Assay
To examine whether stretch-induced cytokines/chemokines influence vascular
permeability in vivo to facilitate leukocyte extravasation into the tissue, we performed a specific
in vitro assay using UtMVEC-Myo cells. Firstly, BD FalconTM 3.0-µm cell culture inserts for 24-
well plate (BD Biosciences, CA, USA) were pre-coated with 0.1% gelatin for 1 hour at 37oC.
Next, UtMVEC-Myo cells were seeded in the insert (75,000 cells per 500 µl), and allowed to
form a monolayer for 72 hours. The cell culture inserts create a 2-compartment model: the inner
space of the insert is designated as the upper chamber, whereas the space formed between the
outside of the insert and the culture well is designated as the bottom chamber (Figure 2.1).
Monolayer confluence was tested measuring its permeability to trypan blue/BSA, a protocol
adapted from Fiuza et al151. Inserts were washed and transferred into clean wells containing 1 ml
HBSS. Briefly, 500 µl of trypan blue/BSA complex (0.036%/0.8%, w/v in HBSS) was added to
the inserts and incubated for 5 min at 37oC. Absorbance at 590 nm of the lower well was
measured to quantify the amount of trypan blue-BSA diffused across the monolayer. An intact
Chapter 2: Materials and Methods
51
endothelial monolayer was assumed if the absorbance reading was <0.1% of the original trypan-
blue BSA complex. Confluent monolayers on the insert were serum-starved overnight with SF-
DMEM. The next day, UtMVEC-Myo cells were stimulated with NS-CM or S-CM on both sides
of the insert for 4 hours at 37oC. During stimulation, 1 mg/ml fluorescein isothiocyanate-dextran
(FITC-dex, average molecular weight 3000-5000 g/mol; Sigmal-Aldrich, MO, USA) was
prepared in HBSS buffer and kept in dark until usage. After stimulation, the inserts were placed
into a new 24-well plate, 275 µl of FITC-dex solution was loaded inside each insert with 500 µl
of HBSS outside the well. The plate was incubated for 1.5 hours to examine the change in
endothelial monolayer permeability. The assay was stopped by removing the inserts from the
plate wells. Two 150 µl aliquots of the well solution were transferred to a 96-well black reading
plate for fluorescence measurement at 490/520 nm. A 10-point standard curve was generated
from a 1:2 dilution series with 1 mg/ml FITC-dex as the starting concentration. A non-coated
insert without UtMVEC-Myo cells was used as a control for maximum leakage in each
experiment. Additionally, two inserts with confluent monolayers incubated with endothelial
growth media only (no stimulation) were used as a negative control for minimal leakage of an
intact monolayer.
Figure 2.1. Permeability assay experimental setup.
1.5h%Incuba,on%
HBSS+/+
FITC-dextran
3.0-µm inserts
NSM/SCM for 4 hours
Intact monolayer
Upper Chamber
Fluorescence Reading
Lower Chamber
Chapter 2: Materials and Methods
52
2.2.12 Adhesion Assay
The effect of stretch-induced myometrial cytokines/chemokines on the adherent
characteristics of vascular endothelium was studied by in vitro adhesion assay (Figure 2.2). The
protocol was adapted and modified from Fiuza et al151. Human UtMVEC-Myo cells were seeded
in 96-well culture plates (10,000 cells/well) pre-coated with 0.1% gelatin and allowed to form a
monolayer for 48 hours. Confluent UtMVEC-Myo cells were serum-starved overnight and
subsequently incubated with NS-CM or S-CM for 3 hours. Primary human neutrophils isolated
from healthy pregnant women (second trimester or term) were labeled with 2.5 µM calcein-AM
(eBiosciences, CA, USA) for 30 min. After endothelial cell stimulation, calcein-labeled human
neutrophils (100,000 neutrophils in 150 µl of SF-DMEM) were added to each well and allowed
to adhere for 1 hour at 37oC. Non-adherent cells were removed by careful washing with warm
PBS three times. Next, we recorded fluorescence of the remaining adherent cells on Infinite®
200 (Tecan Group Ltd., Switzerland) at 490/520 nm. Number of adherent cells was calculated
against a standard curve generated from 1:2 serial dilutions of calcein-AM-labeled leukocytes
(from 100,000 to 3,125 neutrophils).
Figure 2.2. Adhesion assay procedure.
Endothelial cells
NSM/SCM for 3 hours
Human Neutrophils
1 hour adhesion Remove non-adherent cells
Chapter 2: Materials and Methods
53
2.2.13 Transendothelial Migration Assay
To investigate the effect of mechanical stretch on the transendothelial migration (TEM) of
human leukocytes in the myometrium, we performed an in vitro assay using human UtMVEC-
Myo cels and primary human neutrophils as a model. Endothelial cell-coated inserts were
performed according to what was described in section 2.2.11. Confluent inserts were placed into
new plate and 500 µl aliquot of NS-CM/S-CM or individual chemokines at varying
concentrations (CXCL8, CXCL1, R&D Systems, Inc., MN, USA) in SF-DMEM was added into
the bottom chambers to stimulate the endothelial monolayer for 3 to 4 hours (Figure 2.3). Isolated
primary human neutrophils were stained with calcein-AM as described previously, and
subsequently loaded to the upper chamber (2.0 x 105 cells in 150 µl of SF-DMEM). The
experimental plate was incubated at 37oC for 1 hour. In some experiments, neutralizing
antibodies against CXCR1, CXCR2 or both receptors (10 µg/ml; R&D Systems, Inc., MN, USA)
were incubated with the isolated neutrophils 30 min prior to the actual migration incubation step.
Neutrophils that transmigrated to the lower chamber were collected and measured for
fluorescence at 490/520 nm (Figure 2.3). Standard curve was generated each time by serial
dilutions (1:2 series) of calcein-labeled primary human neutrophils.
We also explored the inhibitory effect of BN83470, a broad-spectrum chemokine
inhibitor (BSCI; Funxional Therapeutics, Cambridge, UK) on primary human neutrophil TEM
towards S-CM. The experimental design was as described above in terms of neutrophil and
endothelium-coated insert preparations. Prior to endothelial stimulation, S-CM was pretreated
with 2 nM of BSCI in DMSO for 1 hour at 37oC, with another well of S-CM pretreated with
vehicle (DMSO) as a negative control. Neutrophil transmigration towards S-CM and S-
CM+BSCI was compared to assess the potential effect of BN83470 on leukocyte recruitment.
Chapter 2: Materials and Methods
54
Figure 2.3. Neutrophil transendothelial migration assay.
2.3 Statistical Analysis
Data normality was assessed first by the Kolmogorov-Smirnov test. For analysis of two
groups, unpaired t-test was done for normally distributed data and Mann-Whitney U test for
nonparametric data. For comparison between more than two groups, either one-way ANOVA for
normally distributed data, or Wilcoxon test for nonparametric data was employed. Post-tests such
as Dunnet’s test or Tukey’s test were used after one-way ANOVA and is specified in each
specific analysis section. Significance level was set at p<0.05 (*), p<0.01 (**) and p<0.001
(***). All statistical analyses were done using Prism 5 (GraphPad Software, Inc., CA, USA).
55
CHAPTER 3
Results
Chapter 3: Results
56
3.1 Introduction
It is reported by many researchers that spontaneous labour represents a localized
inflammatory process where infiltration of leukocytes, in particular macrophages and neutrophils,
was seen in the myometrium prior to the onset of and during labour9,21,23. Our lab previously
demonstrated an association between uterine occupancy, the increased myometrial production of
CCL2, concurrent macrophage influx into the rat myometrium and the initiation of labour in
vivo70. The ability of mechanical stretch to provoke a release of cytokines has been demonstrated
in a variety of cell types including airway SMCs152, vascular SMCs153, amniotic epithelial cells69
and myometrial myocytes71. Therefore, we proposed that the increase in uterine distension by the
growing fetus at late gestation activates myometrial cells to synthesize and secrete pro-
inflammatory cytokines and chemokines, which in turn contribute to peripheral leukocyte
recruitment in the myometrium. This thesis work aims to prove the link between mechanical
stretch and the infiltration of peripheral leukocytes into the myometrium during labour.
3.2 Stretch-induced myometrial cytokine expression
3.2.1 Multiplex assay with ELISA validation of human myometrial cytokine expression
Seven different sets of conditioned media from non-stretched and stretched hTERT-HM
cell cultures (NS-CM and S-CM) were collected after undergoing 24 hours of 25% static stretch.
We analyzed a total of 48 cytokines using multiplex assay. Eight analytes (IL-1β, -2, -4, -5, -7, -
15, MIP-1α and -1β) were not detected in the conditioned media. Data sets with extrapolated
values outside the standard curves were excluded from further analysis. Based on this criterium,
nine cytokines with less than four data sets (CTACK, Eotaxin, IL-1α, -13, -17, TRAIL,
RANTES, TNF-α, and –β) were excluded. Figure 3.1 shows the basal levels of myometrial
cytokines identified by the Luminex assay. Interestingly, stem cell growth factor beta (SCGF-b)
Chapter 3: Results
57
exhibited the highest concentration in both NS-CM and S-CM (7999.6 ± 1905.1 and 8040.6 ±
1334.2 pg/ml respectively). SCGF-b supports the growth hematopoietic progenitor cells, which in
combination with erythropoietin or GM-CSF promotes the proliferation of erythroid and myeloid
progenitor cells154. Although mechanical stretch did not alter its expression, SCGF-b might
provide a suitable microenvironment for the differentiation and growth of the infiltrated
leukocytes.
Out of the 48 cytokines screened in the hTERT-HM conditioned media, a total of 31
cytokines underwent statistical analysis. The concentrations and the relative fold change of the
analyzed cytokines can be found in the attached appendix (supplemental table 1). Individual
ELISA was also performed to validate multiplex results. We selected five cytokines affecting
neutrophil recruitment (CXCL8, CXCL1 and G-CSF), along with IL-6 and VEGF, which have
been found to be important in endothelial permeability and CAM stimulation (supplemental table
2). Based on data normality, either unpaired t test or Mann-Whitney U-test was employed; this
generated a list of 9 cytokines whose expression was significantly increased by 24-hour static
stretch (Figure 3.2). These include IL-6, CXCL8, CXCL1, macrophage migration inhibitory
factor (MIF), VEGF, G-CSF, IL-12p70, basic fibroblast growth factor (bFGF), and platelet-
derived growth factor subunit B (PDGF-bb). Among these cytokines, IL-6, CXCL8 and CXCL1
had the highest stretch-induced increase in S-CM as compared to NS-CM controls, with fold
changes of 6.2, 15.7 and 16.1 respectively. All identified cytokines in our study function as pro-
inflammatory agents or growth factors affecting leukocytes (IL-12p70, MIF, IL-6, CXCL1,
CXCL8, G-CSF) or endothelium (VEGF), essential players during leukocyte extravasation.
Interestingly, two highly expressed cytokines (CXCL1 and CXCL8) belong to the same CXC
family, which could indicate that static stretch likely influences chemotaxis of peripheral
leukocytes.
Chapter 3: Results
58
Figure 3.1. Basal secretion of cytokines by myometrial hTERT-HM cell line. Protein concentrations detected in the serum-free supernatants of hTERT-HM culture collected from static (non-stretched) plates after 24 hours of incubation (n=7). Values are presented as mean ± SEM on a logarithmic scale, arranged by decreasing concentration to show the basal level of secreted myometrial cytokines. For the expanded name of each cytokine, please refer to Chapter 2, Table 2.1.
SC
GF-
bC
XCL8 IL-6
VE
GF
CC
L2H
GF
MIF
CXC
L1G
M-C
SF
SD
F-1a
IL-1
2p40
IL-1
raM
IGIP
-10
G-C
SF
IL-2
Ra
IL-1
2p(7
0)M
-CS
FIL
-3IF
N-a
2IF
N-g
SC
FIL
-9 LIF
MC
P-3
FGF
basi
cIL
-16
b-N
GF
PD
GF-
bbIL
-10
IL-1
8
1
10
100
1000
10000
Con
cent
ratio
n (p
g/m
l) [lo
g]
Chapter 3: Results
59
Figure 3.2. Pro-inflammatory cytokines are upregulated by static stretch in hTERT-HM cells. Cytokines released by hTERT-HM cells are upregulated upon 24 hours of 25% static stretch in culture (n=7). White bars represent the NS-CM group, whereas black bars represent the S-CM group. Absolute concentration values are presented as mean ± SEM on a logarithmic scale in the top graph, with fold change representation in the bottom. Significance was set at p<0.05 (*) comparing each S-CM group to its corresponding NS-CM group.
IL-6
CXCL8
CXCL1 MIFVEGF
G-CSF
IL-12
p(70
)
FGF basic
PDGF-bb
1
10
100
1000
10000
* *
*
* *
*Con
cent
ratio
n (p
g/m
l) [lo
g]
******
**
IL-6
CXCL8
CXCL1 MIFVEGF
G-CSF
IL-12
p(70
)
FGF basic
PDGF-bb
0
5
10
15
20
25
Rel
ativ
e Fo
ld C
hang
e
Chapter 3: Results
60
3.2.2 Signaling Pathways Regulating Stretch-Induced Cytokine Expression
There are multiple studies indicating that MAPKs are involved in the stretch-induced
expression of cytokines in different cell types152,153,155. We hypothesized that MAPK pathways
mediate the synthesis of myometrial cytokines upon mechanical stretch stimulus. To investigate
possible mechanisms responsible for the observed stretch-induced increase in the expression of
two major neutrophil chemoattractants in myometrial cells (CXCL1 and CXCL8), we pretreated
hTERT-HM cells with or without ERK, JNK or p38 inhibitors (Chapter 2, Table 2.3) and
subsequently stretched for 1 hour. RNA was extracted and analyzed by qRT-PCR. Static
mechanical stretch caused a transient induction of both cytokines (Fold change relative to NS
vehicle control; CXCL1: 4.77 ± 2.54 fold, p=0.2158; CXCL8: 7.27 ± 2.82 fold, p=0.0915;
unpaired t test). The upregulation of cytokine gene expression was not altered in the presence of
specific MAPK inhibitors (Figure 3.3). Therefore, contrary to our original hypothesis, MAPKs
are not involved in the stretch-induced production of CXCL1 nor CXCL8. However, further
validation of inhibitor effectiveness is required to reach a firm conclusion.
It was also reported that stretch activates protein kinase C (PKC) which in turn induces
the production of CXCL8 in alveolar epithelial cells67. Therefore, we tested whether PKC is
involved in the stretch-induced expression of CXCL1 and CXCL8 in myometrial SMCs. One-way
ANOVA with Dunnett’s test revealed that both CXCL1 and CXCL8 mRNA expression were
significantly increased in stretched cells when compared to non-stretched cells (p=0.0062 and
p=0.0220 respectively; Figure 3.4). Static mechanical stretch increased CXCL8 expression by
3.86 fold, and this effect was decreased to control level in the presence of PKC inhibitor.
Similarly, stretch induced CXCL1 expression by 5.14 fold, which was significantly decreased in
Chapter 3: Results
61
the presence of 10 µM Ro31-8220, suggesting PKC as a potential regulator in the stretch-induced
production of CXCL1 and CXCL8 by hTERT-HM cells.
Chapter 3: Results
62
Figure 3.3. MAPK inhibitors did not influence the observed stretch effect on myometrial cytokine gene expression. hTERT-HM cells were pretreated with or without specific inhibitors of MAPKs: ERK (PD98059, 50 µM), JNK (SP600125, 20 µM) and p38 (SB203580, 20 µM) and subjected to 1-hour static stretch. White bars indicate the non-stretch control group and black bars represent the stretch group. All data represented fold change relative to NS vehicle control; mean ± SEM, n=3.
Vehicl
e
PD9805
9
SP6001
25
SB2035
800
5
10
15
Rel
ativ
e E
xpre
ssio
n
Vehicl
e
PD9805
9
SP6001
25
SB2035
800
5
10
15
Rel
ativ
e E
xpre
ssio
n
CXCL1
CXCL8
Chapter 3: Results
63
Figure 3.4. PKC inhibitor downregulated stretch-induced CXCL1 and CXCL8 gene expression. hTERT-HM cells were pretreated with or without PKC inhibitor (Ro31-8220, 10 µM) and subjected to 1-hour static stretch. White bars indicate the non-stretch control group and black bars represent the stretch group. All data represented fold change relative to NS vehicle control; mean ± SEM, n=3.
Vehicl
e
Ro31-8
220
0
2
4
6
8
Rel
ativ
e E
xpre
ssio
n
Vehicl
e
Ro31-8
220
0
2
4
6
8
Rel
ativ
e E
xpre
ssio
n
*
*
CXCL1
CXCL8
Chapter 3: Results
64
3.3 Effects of Myometrial Cytokines on Endothelium and Leukocyte Activation
3.3.1 Endothelial cell adhesion molecule expression
To initiate leukocyte extravasation, it is important to first activate the expression of
adhesion molecules on the endothelium neighboring the inflammation site109. We hypothesized
that multiple (or individual) cytokines induced by static stretch in myometrial cells may activate
the expression of CAMs on endothelial cells in term uterine vasculature, which can then
stimulate the infiltration of peripheral leukocyte in preparation for labour. Therefore, we first
investigated the effects of S-CM and individual cytokines on the expressions of CAM genes in
human myometrial microvascular endothelial cells. Confluent hUtMVEC-Myo cells were
incubated with either NS-CM or S-CM for 4 hours and analyzed for the expression of VCAM1,
ICAM1, PECAM1 and SELE genes. mRNA levels of SELE, VCAM1 and ICAM1 were
significantly up-regulated by S-CM treatment when compared to NS-CM (17.2-, 8.5- and 3.6-
fold increase respectively), whereas PECAM1 expression remained unaffected (Figure 3.5A).
From the list of stretch-induced cytokines, we tested the activating effect of VEGF on
hUtMVEC-Myo cells and found that VEGF (30 ng/mL) significantly induced VCAM1 expression
by 2.80 fold (p<0.001), whereas ICAM1, PECAM1 and SELE expression were not affected. This
result may indicate VEGF as a potential endothelial activator (Figure 3.5B).
Chapter 3: Results
65
Figure 3.5. S-CM and VEGF potentiate endothelial activation at gene level. Confluent hUtMVEC-Myo cells were incubated with NS-CM/S-CM (A), or VEGF (B) for 4 hours and analyzed from the expressions of VCAM1, ICAM1, PECAM1 and SELE (unpaired t test, mean ± SEM, n=3). White bars represent the negative control whereas black bars represent the experimental stimuli. Data are presented as relative expression to corresponding negative control.
VCAM1 ICAM1 PECAM1 SELE
0
10
20
30
***
***
**
S-CMNS-CM
Rel
ativ
e E
xpre
ssio
n
VCAM1 ICAM1 PECAM1 SELE
0
1
2
3
4
Control
VEGF (30ng/ml)
***
Rel
ativ
e E
xpre
ssio
n
A
B
Chapter 3: Results
66
Next we examined the protein expression of three CAMs (E-selectin, VCAM-1 and
ICAM-1) whose gene expression was found to be up-regulated by S-CM. In flow cytometry
analysis, a shift in the population distribution towards the right of the histogram overlay plot is
taken as an indication of up-regulation in the protein of interest. As seen in Figure 3.6A, ICAM-1
expression on endothelial cells was progressively shifted towards the right after treatment with
NS-CM and S-CM in comparison to SF-DMEM control, with S-CM being the most potent
stimulator. The median MFI value, indicative of ICAM-1 protein expression, significantly
increased from 49.90 ± 8.91 (NS-CM) to 65.80 ± 13.83 (S-CM), with a relative fold change of
1.32 (Figure 3.6B). Since E-selectin (CD62E) and VCAM-1 (CD106) are usually absent on the
surface of resting hUtMVEC-Myo cells, we focused on percentage of positive cells for data
analysis. After stimulation with NS-CM, we detected 2.23 ± 1.18% of hUtMVEC-Myo cells
expressing E-selectin. S-CM stimulation further increased E-selectin-positive endothelial cells by
2.8-fold to 6.25 ± 1.91%. VCAM-1 expression on hUtMVEC-Myo cells was also augmented by
S-CM treatment. NS-CM treatment induced VCAM-1 expression on 3.38 ± 1.53% of hUtMVEC-
Myo cells, whereas S-CM treatment increased the expression to 8.78 ± 3.24% by 2.60-fold.
These results suggest the potential role of stretch-induced cytokines in the activation of
myometrial microvascular endothelial cells.
Chapter 3: Results
67
Figure 3.6. S-CM upregulates protein expressions of human myometrial microvascular endothelial cells. Representative FACS histogram plots (A) compare surface protein expression of ICAM-1, E-selectin and VCAM-1 between 6-hour incubation with SF-DMEM (blue), NS-CM (green) and S-CM (red). Fluorescence minus one (FMO) controls (gray) were used to determine the boundary of individual gates. Summary of the endothelial CAM MFI and % gated values of all six separate experiments were presented in panel B with NS-CM as white bars and S-CM as black bars. Values are presented as mean ± SEM.
FL6: ICAM-‐1-‐APC Logicle
FL4: E-‐selectin-‐PC5 Logicle
FL2: VCAM-‐1-‐PE Logicle
A
ICAM-1 E-selectin VCAM-1
0
20
40
60
80
100
MFI
*
ICAM-1 E-selectin VCAM-1
0
50
100
* *
% G
ated
B
Chapter 3: Results
68
3.3.2 Leukocyte Activation
To transmigrate into tissue, peripheral leukocytes must be activated to express integrin
molecules on their surface to interact with the endothelium109. We observed that CD44
expression involved in the recruitment of monocytes and neutrophils116 was progressively
increased in pregnant women towards term204. Also, since we found that CXCL8 was up-
regulated in S-CM, it would be of interest to study the gene expression of its receptor on
leukocyte, CD181. ICAM-1 is an important adhesion molecule both on endothelial cells and
immune cells mediating the process of leukocyte extravasation. Based on these findings, we
decided to study the gene expression of CD44, CD181 and ICAM-1 on the surface of primary
human neutrophils. After 3-hour stimulation with NS-CM and S-CM, the transcript levels of
CD44, CD181 and ICAM1 increased in the S-CM-treated neutrophils; however the difference did
not reach significance (Figure3.7A). Among these genes, CD44 demonstrated the highest
increase of 2.58-fold after S-CM stimulation in comparison to NS-CM stimulation (p=0.0911,
n=8, paired t test), whereas CD181 and ICAM1 had 1.93-fold (p=0.2031, n=8, Wilcoxon matched
pairs test) and 1.43-fold (p=0.2175, n=8, paired t test) increase.
We also explored the activation status of primary human neutrophils following
stimulation with NS-CM and S-CM using flow cytometry. Together with CD44, we included
CD11b in our investigation since it is an important mediator of leukocyte recruitment, and its
surface expression is upregulated on peripheral monocytes and neutrophils of term pregnant
women47. Five peripheral blood samples collected from pregnant women were analyzed for the
expressions of CD11b and CD44 after 1 hour of incubation with S-CM. Each data point was
normalized to the basal expression from time 0 treatment. Granulocytes were gated as CD45+CD15+
and monocytes as CD45+CD14+. Median MFI values for each protein of interest were obtained after
Chapter 3: Results
69
gating quadrants against the FMO controls (Chapter 2, section 2.3.5.2). Our results showed that
treatment with NS-CM and S-CM elicited significant CD11b activation on the surfaces of both
leukocyte subpopulations when compared to treatment with negative control (SF-DMEM). However,
no difference was observed between NS-CM and S-CM stimulation. These data indicate that multiple
cytokines secreted by myometrial cells, irrespective of the mechanical stretching, were able to
activate the expression or the translocation of the integrin molecule to the surface of white blood
cells. On the other hand, CD44 expression remained constant between all treatments on both subtypes
(Figure3.7B).
Chapter 3: Results
70
Figure 3.7. Treatment with hTERT-HM conditioned media did not elicit activation in neutrophils nor monocytes. Isolated neutrophils from first trimester women were subjected to 3-hour incubation with NS-CM or S-CM (A, n=8). White bars represent NS-CM-treated group and black bars represent S-CM-treated group. Representative FACS histogram overlay plots (B) of surface protein expression on granulocytes (Grans) and monocytes (Monos) following 1-hour incubation with SF-DMEM (blue, negative control), NS-CM (green) and S-CM (red). Fluorescence minus one (FMO) controls (gray) were used to determine the boundary of individual gates. SF-DMEM. Basal expression levels of both markers are represented by SF-DMEM t0 (magenta).
ICAM1 IL8 CD44 CD181 CD11a0
1
2
3
4
Rel
ativ
e N
orm
aliz
ed F
old
Exp
ress
ion
A
B
ICAM1 IL8 CD44 CD181 CD11a0
1
2
3
4
Rel
ativ
e N
orm
aliz
ed F
old
Exp
ress
ion
A
BCD11b CD44
Grans
Monos
ICAM1 CD44 CD1810
1
2
3
4
Rel
ativ
e Ex
pres
sion
Chapter 3: Results
71
3.3.3 Endothelial Permeability
To explore if in parallel with activating endothelial cells, multiple cytokines in S-CM also
influence vascular permeability, we performed in vitro assay to measure the amount of FITC-
dextran dye leakage through an undisturbed endothelial monolayer (Chapter 2, section 2.3.6). To
check the intactness of the monolayer, some monolayer-coated inserts were kept in endothelial
growth media during the 4-hour stimulation period and used as a negative control. The insert
without an endothelial cell monolayer was designated as 100% (maximum) dye leakage in each
experiment (Figure 3.8). Analysis of the fluorescent dye revealed significant increase of FITC-
dextran leakage through the endothelial monolayer treated with S-CM (p=0.0248, n=4) compared
to the negative control. No difference in leakage was observed between cells treated with NS-CM
and S-CM. Our data indicate that multiple cytokines secreted by cultured myometrial SMCs were
able to influence the integrity of the vasculature in the myometrium, possibly mediated by altered
intercellular junctions between endothelial cells.
Figure 3.8. Multiple cytokine secreted by stretched myometrial cells influence endothelial permeability. Confluent hUtMVEC-Myo monolayer grown on 3.0-µm cell culture inserts were subjected to conditioned media treatments (NS-CM/S-CM) or endothelial growth media (negative control) for 4 hours. Bar graphs represent the leakage percentage (mean ± SEM) of each treatment (stripe, negative control; white, NS-CM; black, S-CM) relative to the maximum leakage control. # indicates significant difference (p<0.05) compared to negative control. One-way ANOVA with Tukey’s post-test; n = 4.
Neg Control NS-CM S-CM0
20
40
60
80
#
% L
eaka
ge
Chapter 3: Results
72
3.4 Functional Studies of Stretch-Induced Myometrial Cytokines
3.4.1 Leukocyte Adhesion to Endothelial Cells
Human primary neutrophils
We postulate that the increase in the expression of CAM on uterine microvascular
endothelial cells by stretch-induced cytokines will enhance TEM of peripheral leukocytes. The
first step in the process of leukocyte TEM is adhesion to the activated vasculature. To mimic the
effect of mechanical stretch of the myometrium on the adhesion of white blood cells to the
nearby endothelium, we stimulated human myometrial microvascular endothelial monolayer with
NS-CM or S-CM and examined the ability of primary human neutrophils to adhere. Our data
indicate that NS-CM did not influence the adherent ability of neutrophils as compared to the
negative control, whereas S-CM significantly increased the amount of bound neutrophils by 1.41
± 0.30 fold (p=0.0260, n=4; Figure 3.9). This suggests that cytokines secreted by stretched
myometrial SMCs are functionally active and participate in peripheral leukocyte recruitment.
Figure 3.9. Primary human neutrophils adhere to endothelial cells under S-CM stimulation. Confluent hUtMVEC-Myo monolayer were stimulated with SF-DMEM (negative control, stripe bar), NS-CM (white bar) or S-CM (black bar) for 3 hours and subsequently incubated with calcein-labeled primary human neutrophils for 1 hour. Bar graphs represent fold changes of adherent neutrophil number relative to the negative control. Unpaired t test; n=4; *, p <0.05.
Neg Control NS-CM S-CM0
1
2
3
Rel
ativ
e Fo
ld C
hang
e
*
Chapter 3: Results
73
3.4.2 Neutrophil Transendothelial Migration
After demonstrating that cytokines produced by myometrial cells are capable of inducing
leukocyte adhesion to the uterine endothelium, we performed TEM assay to explore leukocyte
diapedesis in the presence of these myometrial cytokines. Freshly isolated human peripheral
neutrophils from second trimester pregnant and term pregnant women were allowed to
transmigrate towards NS-CM or S-CM. We found that S-CM significantly induced TEM of
neutrophils measured as percentage of cells detected in the bottom chamber when compared to
NS-CM group (1.69-fold, p=0.0096, Figure 3.10A). Two chemokines (CXCL1 and CXCL8)
were present in the hTERT-HM conditioned media and were significantly up-regulated by
stretch. We speculate that they could be responsible for the chemotactic effect of S-CM. To test
this hypothesis, we performed as set of experiments where we blocked CXC chemokine receptor
1 (CXCR1) and CXCR2 on peripheral neutrophils prior to TEM assay. Receptor neutralization
significantly reduced stretch-induced neutrophil TEM from 59.87% to 23.80% and 23.04%
respectively. Simultaneous neutralization of both receptors further decreased TEM percentage to
11.88% (Figure 3.10A, shown are the representative of two independent TEM experiments).
To further test our hypothesis, we tested individual neutrophil chemoattractant, CXCL1
and CXCL8 at various concentrations for their ability to trigger TEM of primary human
neutrophils, mimicking the effect of S-CM. Neutrophils from pregnant women exhibited dose-
dependent increase in TEM ability (from 9.55% to 50.80%) in response to increasing
concentrations of CXCL8 (from 1 to 100 ng/ml; Figure 3.10B). Chemotactic activity was blocked
by neutralizing CXCR1, whereas neutralization of CXCR2 showed no effect on percentage of
transmigrated neutrophils. This likely suggests that CXCL8 mainly exerted chemotactic signaling
via CXCR1 but not CXCR2. CXCL1 also enhanced neutrophil TEM in a dose-dependent
Chapter 3: Results
74
manner, although less effective comparing to CXCL8 (3.80% to 10.46%, control to 300ng/ml,
Figure 3.10C). Receptor neutralization assay with antibodies showed that CXCL1-induced
neutrophil TEM was likely mediated by CXCR2.
Chapter 3: Results
75
Figure 3.10. S-CM induced neutrophil TEM which is mediated by CXCR1 and CXCR2. TEM assay was set up with a layer of confluent hUtMVEC-Myo cells on 3.0−µm inserts and isolated primary human neutrophils with stimuli of NS-CM, S-CM (A), CXCL8 (B) or CXCL1 (C) at various concentrations for one hour. SF-DMEM served as negative controls in B and C. Neutrophils pretreated with either anti-CXC chemokine receptor 1 (CXCR1), anti-CXCR2 or both antibodies (each administered at 10 µg/ml) were loaded into designated inserts in some experiments. White bars represent the control group and black bars represent the treatment groups. Graphs are representative of two independent experiments with three replicates in each treatment group.
NS-CM0
20
40
60
80
Anti-CXCR1:
Anti-CXCR2:
-
-
-
-
+
- +
-
+
+
***
S-CM
Neu
troph
il TE
M %
Control 1ng/ml 10ng/ml 100ng/ml 100ng/ml 100ng/ml0
20
40
60
CXCL8
Anti-CXCR1:
Anti-CXCR2:
-
-
-
-
+
- +
--
-
-
-
*** **
Neu
troph
il TE
M %
A
B
Control 10ng/ml 100ng/ml 300ng/ml 300ng/ml 300ng/ml0
5
10
15
CXCL1
Anti-CXCR1:
Anti-CXCR2:
-
-
-
-
+
- +
--
-
-
-
Neu
troph
il TE
M %
NS-CM0
20
40
60
80
Anti-CXCR1:
Anti-CXCR2:
-
-
-
-
+
- +
-
+
+
***
S-CM
Neu
troph
il TE
M %
Control 1ng/ml 10ng/ml 100ng/ml 100ng/ml 100ng/ml0
20
40
60
CXCL8
Anti-CXCR1:
Anti-CXCR2:
-
-
-
-
+
- +
--
-
-
-
*** **
Neu
troph
il TE
M %
A
B
C
Chapter 3: Results
76
3.4.3 Role of Broad-Spectrum Chemokine Inhibitor (BSCI)
Our data established that leukocyte recruitment is regulated by multiple cytokines and
chemokines that in turn are induced by myometrial stretch. Since we believe that the recruitment
of leukocytes to the myometrium is an important step in the initiation of labour, this suggests that
peripheral leukocytes may represent a potential target to inhibit myometrial activation. Since
parturition represents an interplay of multiple body systems131 and a cytokine network156 that
displays considerable redundancy, pharmaceutical agents which target multiple inflammatory
cytokines rather than one single cytokine would likely be more efficient at delaying myometrial
activation. BSCI blocks the actions of multiple chemokines in directing leukocyte chemotaxis
simultaneously. Due to its potential as an anti-inflammatory agent to prevent leukocyte
infiltration, we investigated the influence of BSCI on leukocyte migration in vitro. Pretreating S-
CM with 2 nM of BSCI one hour prior to the TEM assay (Chaper 2, section 2.4.2) significantly
reduced neutrophil TEM percentage by 70.4% (p<0.05) in comparison to the S-CM group, with a
level similar to the negative control (Figure 3.11). Our result suggests that BSCI presents as a
potential inhibitor to stretch-induced neutrophil extravasation.
Chapter 3: Results
77
Figure 3.11. BSCI inhibits S-CM-induced neutrophil TEM. Neutrophil TEM assay was performed with NS-CM (white bar), S-CM (with vehicle, black bar) or S-CM in the presence of BSCI (checkered bar). SF-DMEM was used as the negative control and is presented as striped bar. Values are presented as mean ± SEM; one-way ANOVA followed by Tukey’s multiple comparison test. Different letter indicates statistical difference between groups at p <0.05.
Neg C
ontro
lNSM
SCM
SCM+BSCI 2
nM
0
2
4
6
8
TEM
%
a a
a,b
b
Neg C
ontro
lNSM
SCM
SCM+BSCI 2
nM
0
2
4
6
8
TEM
%
a a
a,b
b
78
CHAPTER 4
Discussion
Chapter 4: Discussion
79
4.1. Stretch-Induced Myometrial Cytokine Secretion
Cytokines are pleiotropic glycoproteins important in many biological processes; in
particular chemotactic cytokines (chemokines) are known to direct immune cells to the sites of
inflammation. Human parturition is associated with an up-regulation of pro-inflammatory
cytokines and chemokines in the myometrium9,22, implicating a physiologic inflammation as a
putative mechanism responsible for the transition of the uterus from a quiescent to a contractile
state. Our previous work in the rat has suggested that the myometrium is an immunoregulatory
tissue able to secrete cytokines and that this process may be induced by mechanical stretch70. In
the current study, we first investigated the effect of static stretch (mimicking late gestation) on
the secretion of cytokines by human myometrial SMCs. We found that mechanical stretch
significantly up-regulated the expression of IL-6, IL-12p70, CXCL1, CXCL8, G-CSF, VEGF,
MIF, bFGF and PDGF-bb in human myometrial SMCs. Noticeably, our in vitro data directly
matched the cytokine profile which we previously detected in vivo in human labouring
myometrial samples, particularly in the expression of IL-6, CXCL8, CXCL1 and G-CSF9. This
concordance suggests that the up-regulated cytokines in labouring myometrium can be partially
attributed to biological uterine stretch. The stretch-induced myometrial cytokines found in the
current study can be categorized into three main groups: pro-inflammatory cytokines (IL-6, IL-
12p70, MIF), chemokines important in leukocyte recruitment (CXCL1, CXCL8), and growth
factors (G-CSF, VEGF, bFGF and PDGF-bb). Interestingly, all three groups exhibit important
roles in the activation of uterine vascular endothelium and peripheral leukocytes to promote their
survival, differentiation and extravasation from the blood vessels into the underlying tissues (i.e.
myometrium). Our findings suggest that mechanical stretch can regulate leukocyte infiltration
into the uterus during labour through the release of myometrial cytokines.
Chapter 4: Discussion
80
We previously proposed that the onset of labour at term is characterized by a maximum
level of myometrial uterine stretch imposed by the fetus which coincides with an activation of the
maternal immune system that is dominated by pro-inflammatory cytokine production9. Our
present findings support this theory in that stretch induces myometrial cells to synthesize higher
amounts of pro-inflammatory IL-6, IL-12p70 and MIF. These cytokines may act in concert to
initiate labour by contributing to the inflammatory signaling. A recent knockout study in mice
showed that IL-6 determines the timing of delivery and influences gene expressions associated
with myometrial activation86. As well, an increase in maternal serum IL-6 level enhances the
likelihood of term women entering spontaneous labour157. In parallel, changes in IL-12p40 to IL-
12p70 ratio was postulated to cause the transition of Th2 to Th1 cytokine profile in murine
pregnancy due to the putative antagonism by IL-12p40 homodimers of IL-12p70 bioactivity91,158
in the differentiation of naïve T cells into Th1 cells88. MIF was demonstrated to promote the
expression of a large panel of inflammatory mediators such as TNF-α, IFN-γ, IL-1β, IL-2, IL-6,
IL-8, MMPs, nitric oxide, and products of the arachidonic acid pathway159. Interestingly, MIF is
also capable of recruiting monocytes and T cells through ligation with CXCR2 or CXCR4
respectively160 while it can also enhance neutrophil trafficking161. MIF levels in amniotic fluids
of women with singleton uncomplicated pregnancies are higher at term when compared to mid-
trimester162,163. It is not clear what roles IL-12p70 and MIF play in myometrial activation but it is
plausible that they may contribute to the amplification of the inflammatory reaction in the
myometrium given their pro-inflammatory nature. On the other hand, the actions of IL-6 have
been closely associated with labour progression. IL-6 mRNA level is increased in term
myometrium and further up-regulated after the onset of labour22,164. IL-6 stimulates myometrial
contraction via promoting PG synthesis22,156, increases myometrial secretion of oxytocin and
expression of its receptor, and promotes the binding of these two components for synchronous
Chapter 4: Discussion
81
uterine contractions165,166. Furthermore, IL-6-/- mice showed impaired leukocyte accumulation
associated with a reduced local chemokine production, suggesting that IL-6 plays a role in
leukocyte recruitment85.
Sehringer et al showed that IL-6 and CXCL8 are the two major cytokines detected in
myometrial tissues extracted from term labouring women with uncomplicated pregnancies,
whereas IL-1β and TNF-α were expressed in very low levels164. This correlates well with our
data on the basal cytokine levels from non-stretched cultured human myometrial SMCs (Figure
3.1), where IL-6 and CXCL8 ranked among the top three expressed proteins while IL-1β and
TNF-α were expressed below the standard range. The lack of IL-1β and TNF-α in our stretch-
induced cytokine profile may be due to the fact that their localization is confined to leukocytes in
the myometrium130. Therefore, these two cytokines may arise from the uterine leukocyte infiltrate
rather than the myometrial SMCs in term labouring women.
Two chemokines (CXCL1 and CXCL8), both from the same CXC chemokine family,
represent the second group of molecules markedly up-regulated by mechanical stretch in human
myometrial SMCs. CXCL1 and CXCL8 are well known for their strong chemoattractant activity
on neutrophils and their expression in human myometrium during spontaneous labour was
reported and confirmed by many research groups21,167,168. Further, recent reports of transcriptome
data in spontaneous human labouring myometrial samples identified the following highly
expressed genes: IL-6, CXCL1 and CXCL8, with CXCL8 exhibiting the highest fold change in
TL compared to term not-in-labour samples21,138. In line with our observations, Hua et al showed
that mechanical stretch augmented the expression of various chemokines in primary human
myometrial myocytes including CCL2, CXCL8 and CXCL177. It was shown that this observed
stretch-induced chemokine expression was mediated by MAPK (specifically ERK and p38) and
NF-κB77,104. In our experiments, however, inhibition of MAPKs did not influence the expression
Chapter 4: Discussion
82
of CXCL1 and CXCL8 genes induced by mechanical stretch. This may be attributed to the
differences in stretch regimen employed between Hua and our studies. Additionally, we found
that protein kinase C (PKC) could regulate the myometrial chemokine expressions by static
stretch. PKC belongs to a large family of serine/threonine kinases that modify the activities of
numerous targets169. Our data indicate that mechanical stretch may induce chemokine gene
expression via PKC pathway that is independent of MAPKs. However, further studies are
required to clarify and confirm the participation of these signaling pathways.
The third category of stretch-induced molecules represents growth factors acting on a
variety of cell types, in particular neutrophils and endothelial cells. Growth factors can act as
chemoattractants and play a role during ECM remodeling and cytokine release170. G-CSF
stimulates the proliferation and differentiation of neutrophils and enhances their inflammatory
function. In addition, G-CSF and MIF enhance neutrophil survival by inhibiting proapoptotic
events171. It was shown that G-CSF increased neutrophil TEM across unstimulated endothelium
in vitro but not a chemotactic effect as it was not dose-dependent97. Furthermore, G-CSF was
able to promote the mobilization of neutrophils out of bone marrow172, suggesting that
myometrial cytokine secretion may partially contribute to the neutrophilia seen in healthy
pregnant women. Interestingly, the other stretch-induced growth factors, VEGF, bFGF and
PDGF-bb, all have been shown to participate in the wound healing process by inducing
angiogenesis103,170,170. Angiogenesis is imperative in the early stage of wound healing for
delivering nutrients and inflammatory cells, as well as facilitating the clearance of senescent cells
and debris within the wound173. It appears that bFGF and VEGF are more important for the
development of new blood vessels, whereas PDGF-bb stimulates the chemotaxis of neutrophils,
macrophages, fibroblasts and SMCs to the site of wound repair174. Furthermore, bFGF regulates
synthesis and deposition of ECM while PDGF-bb helps in old ECM degradation by up-regulating
Chapter 4: Discussion
83
MMP activity174173. A microarray study revealed that VEGF-stimulated human myometrial ECs
showed an up-regulation of various MMPs and collagen, suggesting a role for VEGF in ECM
remodeling100,100. VEGF has also been shown to enhance neutrophil and monocyte TEM via
inducing endothelial secretion of CXCL8101 and increasing monocyte integrin expression102.
4.2 Stretch-Induced Myometrial Cytokines Enhance Leukocyte Infiltration via Endothelial Activation
The massive infiltration of neutrophils and macrophages in the human myometrium
during TL could be attributed to the release of chemokines induced by stretch as well as the up-
regulated CAM expression within the uterine microvasculature. The first step in the peripheral
leukocyte extravasation cascade involves contact of free-circulating leukocytes to the chemokine-
activated vascular endothelium expressing CAMs (selectins and integrins). Next, chemokines
trigger a conformational change in leukocyte integrins that allows high-affinity binding to the
endothelial ligands and enhance firm leukocyte adhesion31. Importantly, chemokines released
from the tissue (i.e. myometrium or decidua) could be immobilized by binding to endothelial
proteoglycans to prevent them from being washed away by blood flow31. Ledingham et al
detected increased ICAM-1 mRNA levels in labouring myometrial samples110. Winkler et al also
revealed higher myometrial expression of ICAM-1, VCAM-1 and E-selectin during
parturition175. Both reported that CAMs were mainly localized to the endothelium, and to the
infiltrating leukocytes to a lesser extent. Our data indicate the capability of stretch-induced
myometrial cytokines and chemokines to up-regulate gene and protein expression of E-selectin,
VCAM-1 and ICAM-1 on human uterine microvascular ECs. It is likely that this observed
enhancement is a synergistic effect of multiple inflammatory mediators, since incubation with
individual cytokines did not reveal any significant elevation in CAM expression (data not shown)
Chapter 4: Discussion
84
with the exception of VEGF, which induced only VCAM-1 expression in our current study.
ICAM-1 is a major ligand for leukocyte integrins LFA-1 and Mac-1, whereas E-selectin binds to
P-selectin glycoprotein ligand (PSGL)-1, CD44 and Mac-1 on leukocytes114. The α4β1 integrin is
the ligand for VCAM-1 and is found on the surface of monocytes, lymphocytes, eosinophils and
basophils175,175. It was recently elucidated that the α4β1 integrin expression is increased on
neutrophils during chronic inflammation33. With the enhanced CAM expression on ECs, the
likelihood of circulating leukocytes to interact with the activated endothelium greatly increases.
Given this, we demonstrated that the capacity of neutrophil adhesion to the underlying
endothelial monolayer was significantly enhanced after ECs were stimulated with stretch-
conditioned media containing multiple cytokines and chemokines. Interestingly, cytokine-
stimulated CAM expression in human umbilical vein ECs was augmented by estrogen, PG and
PR antagonist treatments, suggesting that endocrine regulation co-exists with mechanical
signaling during leukocyte recruitment at labour175. It is likely that both mechanical and
endocrine factors regulate neutrophil-endothelial interactions.
In this study, we demonstrated that multiple myometrial cytokines and chemokines
augment vascular permeability, an effect that possibly is attributable to the presence of VEGF103,
IL-6176, CXCL1177 and CXCL8178. Cell junctions (such as PECAM-1, JAMs and cadherins)
linking adjacent ECs are important modulators of vascular permeability179. Vascular permeability
is tightly controlled during homeostasis to allow selective yet specific passage of blood cells and
macromolecules. Leukocytes can undertake two routes during TEM: transcellular or paracellular
pathways. When the transcellular pathway is followed, leukocytes pass through the endothelial
cytoplasm. On the other hand, paracellular pathway is defined as the passage of leukocytes
between adjacent ECs, resulting in a temporal disruption of endothelial junctional complexes180.
Chapter 4: Discussion
85
It is thought that leukocytes transmigrate predominately through the paracellular route. Binding
of vasoactive factors or the adhesion of leukocytes to endothelial CAMs initiate intracellular
signaling pathways that increase permeability and facilitate the TEM of leukocytes179,180.
Interestingly, it was revealed that CXCR1 and CXCR2 expressed on ECs influence vascular
permeability178. Specifically, ligation of endothelial CXCR1 to CXCL8 resulted in actin
polymerization and the formation of stress fibers that led to EC retraction (mediated by CXCR2)
to create gaps between adjacent ECs178. It is possible that the same mechanism regulates the
stretch-induced increase of vascular permeability in this study.
Studies have shown that as pregnancy proceeds towards term, maternal peripheral
leukocytes experience increasing activation demonstrated by the up-regulated CD11b integrin
expression on both circulating neutrophils and monocytes47,129. Monocytes and neutrophils have
intracellular pools of CD11b that translocate to the cell surface upon activation with different
chemotactic factors181,182. The process of releasing CD11b to the leukocyte surface is rapid and
can be easily affected based on how leukocytes are manipulated during experiments183. Our lab
recently observed an increase in CD44 expression on neutrophils and monocytes obtained from
pregnant women at term204. CD44 is constitutively expressed on leukocytes with HA as its best-
described ligand. CD44-HA interaction is tightly regulated and needs to be induced by
inflammatory stimuli such as cytokines115. Given its crucial role in leukocyte-endothelial
interaction, we suggest that CD44 may mediate the process of leukocyte recruitment during
labour. Furthermore, CD44 was revealed to be a crucial component of the CD74 receptor
complex (MIF receptor) leading to signal transduction, particularly in MIF-induced protection
from apoptosis160. Despite these findings, the trigger for the CD11b and CD44 leukocyte
activation during pregnancy is not yet clear. Normal pregnancy is characterized by progressive
inflammatory responsiveness that involves an increased expression of various maternal serum
Chapter 4: Discussion
86
cytokines184, which may lead to the activation of peripheral leukocytes at term. Therefore, we
hypothesized that stretch of the myometrium by the growing fetus may contribute to leukocyte
activation at term through the release of multiple cytokines. Contrary to our expectation, short-
term exposure of immune cells to stretch-induced myometrial cytokines did not amplify the
surface protein expression of CD11b nor CD44 on either monocytes or neutrophils in comparison
to non-stretched control. We observed, however, that cytokines present in the media conditioned
by human myometrial SMCs were able to enhance CD11b expression on both leukocyte
subtypes, irrespective of stretch effect. We speculate that the differential CD11b expression may
be masked by nonspecific CD11b activation during sample handling as we observed that CD11b
expression progressively increased when they were cultured longer in negative control condition
(data not shown). Although our study showed that myometrial cytokines did not induce CD44
up-regulation on monocytes and neutrophils, these immune cells derived from the pregnant
women displayed very high levels of CD44, which could facilitate leukocyte adhesion to the
endothelium204. Interestingly, it was shown that CD44 crosslinking in cancer cells augmented
their LFA-1-mediated adhesion to the endothelium185. It is possible that similar events occur in
leukocytes. Furthermore, CD44 was reported to participate in the redistribution of neutrophil
adhesion molecules when bound with E-selectin on ECs186 and mediate secondary recruitment of
neutrophils into tissues187. Secondary neutrophil capture is an alternative means of recruitment
whereby the adherent neutrophils “capture” free-flowing neutrophils187. With E-selectin elevated
in the uterine microvasculature, constitutive CD44 expression on bound leukocytes may aid in
secondary capture.
As leukocytes interact with the activated endothelium, they undertake intraluminal
crawling to search for an optimal anatomical site for transmigration109. During this process,
leukocytes collect and integrate multiple signals from selectin ligands and GAG-bound
Chapter 4: Discussion
87
chemokines which eventually result in firm arrest and subsequent transmigration directed by a
chemotactic gradient187. We hypothesized that mechanical stretch directly influences leukocyte
recruitment into the myometrium through the release of various chemotactic factors. In this
present study, we confirmed our hypothesis where we detected increased primary human
neutrophil TEM towards S-CM, which we attribute to the presence of CXCL1 and CXCL8.
Furthermore, both ligands were biologically active since blocking either of CXCR1 and CXCR2
receptors on primary human neutrophils resulted in significant reduction of neutrophil TEM.
CXCR1 and CXCR2 are both GPCRs that recognize multiple chemokines including CXCL1 and
CXCL8. CXCR1 binds specifically to CXCL8, whereas CXCR2 binds to all CXC chemokines
including CXCL1 and CXCL8188. When both receptors were blocked on primary human
neutrophils, neutrophil TEM was further diminished to the control level. This indicates a
synergistic effect of multiple chemokines, and also demonstrates the possibility of both receptors
working together to affect neutrophil TEM through the endothelium. We further confirmed that
CXCL8 induced human neutrophil TEM via CXCR1, whereas CXCL1-induced TEM was
mediated by CXCR2 ligation. It has been shown that CXC chemokines (such as CXCL1 and
CXCL8) exert chemotactic effect on monocytes as these cells do express CXCRs189. In addition,
these CXC chemokines are partly responsible for the monocytic infiltration in atherosclerotic
lesions189. Although CCL2, the major monocyte chemoattractant was not significantly stimulated
by stretch in our current study, we and others reported that myometrial SMCs produce CCL2 in
great amounts under the influence of stretch70,77. We previously demonstrated increased
macrophage infiltration before labour that is followed by neutrophil infiltration postpartum into
the mouse myometrium35 and decidua34. The temporal relationship in the influx of these two
subpopulations suggests different roles of macrophages and neutrophils in the progression of
parturition. In particular, the early presence of macrophages implicates their participation in
Chapter 4: Discussion
88
labour onset, whereas neutrophils mainly contribute to postpartum uterine involution. However,
neutrophils may partially participate in labour progression as recent preliminary findings in a
mouse neutrophil depletion study suggested that neutrophils coordinate inflammatory cytokine
profile prior to labour205. Activated macrophages are rich sources of pro-inflammatory cytokines
and chemokines that govern local cellular processes and orchestrate the recruitment of other
leukocyte subpopulations such as neutrophils28. Additionally, macrophages in term myometrium
have been implicated to play a role in contractile activity12, as they release cytokines (eg. IL-1β)
which activate NF-κB-regulated COX-2 synthesis and the subsequent production of
prostaglandin128,190. Therefore, uterine macrophages potentially contribute to the synchronous
myometrial contraction and the amplification of inflammatory signals during TL. It was
suggested that macrophages polarize into M1 and M2 phenotypes after extravasation and then
facilitate the removal of matrix debris while ensuring adequate inflammation suppression to
avoid excessive tissue damage145. Recruited macrophages may also contribute to the postpartum
neutrophil infiltration. Therefore, the involvement of macrophages in postpartum involution
should be considered as these immune cells also function in tissue remodeling and phagocytosis
of senescent cells.
Our finding that stretch induces the release of multiple myometrial factors with
chemotactic and remodeling functionalities indicates the potential contribution of uterine stretch
to further postpartum involution, a process that resembles wound healing. Uterine involution is
characterized by substantial tissue remodeling including rapid resorption and synthesis of ECM,
cell proliferation and apoptosis191 along with infiltration of macrophages and neutrophils to the
uterine compartments: myometrium35, decidua25 and cervix145. The role of neutrophils in this
process is poorly understood. However, Mahendroo and colleagues observed an increase in
Chapter 4: Discussion
89
myeloperoxidase (MPO) activity of neutrophils in the cervix that may also occur in the
myometrium145. MPO is the most abundant enzymes stored in neutrophils important for
generating ROS and is associated with killing of bacteria and oxidative tissue injury192. It is likely
that the oxidative activity of neutrophils induces myometrial SMC lysis to allow for phagocytosis
of debris by macrophages or other types of neutrophils that eventually contribute to muscle
regeneration in a similar fashion to that proposed for skeletal muscle repair37. In line with this
theory, we had shown previously that myometrial proliferation during the postpartum period
contributes to the return of the uterus to its non-pregnant state136.
The importance of multiple stretch-induced myometrial chemokines in leukocyte TEM
was emphasized as the application of a novel anti-inflammatory agent, BSCI, significantly
reduced human neutrophil TEM. BSCI possibly exerts its inhibitory actions by converting
chemokine receptors into inactive docking sites that bind to chemokines without eliciting
downstream signaling/effects193. Interestingly, BSCI does not affect migration induced by non-
chemokine stimuli and have minimal side effects193. Investigations in pathologies that involve the
actions of chemokines such as endometriosis194 and cerebral ischemia-reperfusion injury195 have
shown therapeutic effects of BSCI in animal models attributed to reduced leukocyte trafficking. It
was suggested that targeting early stages of leukocyte extravasation cascade might be more
effective as later stages become reinforced by multiple overlapping pathways109. Preliminary
results within our lab have revealed promising usage of BSCI for its anti-inflammatory effect on
reducing the preterm delivery rate in LPS-induced PTL mice model206.
The initiation of TL remains largely unclear. However, recent scientific discoveries
provide additional insights to the established model of labour onset52,196. During normal
gestation, traces of fetal red cells and fetal DNA can be detected in the maternal circulation52.
Some portion of the fetal DNA may result from the increased shedding of term placenta in the
Chapter 4: Discussion
90
form of syncytial knots197. Importantly, during pregnancy the placental debris actually promote
fetal tolerance as it was shown that macrophages produce and secrete more IL-10 and less IL-1β
secretion after phagocytosis of these apoptotic fetal cells198. However, as TL approaches, a shift
towards a Th1 pro-inflammatory cytokine profile was detected in the uterus9,199. In addition, our
data showed that stretching the uterus at late gestation contributes to the Th1 cytokine profile
seen at labor through the release of multiple pro-inflammatory cytokines and chemokines. These
inflammatory mediators provide signals for endothelial activation to promote peripheral maternal
leukocyte adhesion to the myometrial microvascular ECs, as well as offer directional signals for
monocyte and neutrophil recruitment. Therefore, we suggest that mechanical stretch imposed by
the growing fetus on the uterine wall represents one of the initial signals for leukocyte infiltrate in
the myometrium at term (Figure 4.1). We also showed that stretch-induced cytokines increased
vascular permeability, which may facilitate the entry of amniotic fluid in the maternal tissue.
Specifically, it was reported by Leong et al that prior to the onset of TL, multiple components of
amniotic fluid including squames, mucoid materials and hair were detected in human myometrial
samples (tissue and vessel lumen) accompanied by altered vascular morphology that were prone
to damage196. It was proposed that these fetal components in the maternal uterine tissue could
result from pre-labour uterine contractions and act as DAMPs to enhance a localized uterine
inflammation in parallel with physiologic uterine stretch effect52,196. As a result, the leukocyte
infiltrate amplifies the inflammatory cascade by secreting more pro-inflammatory cytokines that
promote PG synthesis to increase uterine responsiveness for forceful contraction. Our results in
the enhanced human neutrophil trafficking towards stretch-induced chemokines in combination
with the temporal leukocyte recruitment in the myometrium support the proposal that leukocyte
infiltrates contribute to labour progression and uterine tissue repair during postpartum period.
Chapter 4: Discussion
91
Figure 4.1. Evidence-based model of human labour. Our data suggested that (1) mechanical stretch of the myometrium by the growing fetus induces the secretion of multiple cytokines and chemokines near term. We also demonstrated that stretch-induced chemokines increase (2) vascular permeability and (3) the expression of endothelial cell adhesion molecules (CAMs). This resulted in enhanced (4) peripheral leukocyte adhesion to myometrial vascular endothelial cells, which subsequently promote their (5) transendothelial migration into the uterine muscle. Within the muscle immune cells differentiate, producing more cytokines/chemokines. As shown by others, increased vascular leakage allows the entry of amniotic fluid into the myometrium; the fetal components in the amniotic fluid are recognized as danger-associated molecular patterns (DAMPs), which together with the recruited leukocytes contribute to the amplification of inflammatory signal that ultimately leads to the onset of labor and facilitates the process of postpartum involution.
Uterine''Stretch'
Postpartum''Involution'
Chemokine'secretion''
Leukocyte)ac+va+on)
1'
Neutrophil'Monocyte' Macrophage' Chemokines' 'Myometrial'cell'
Endothelial''cell'CAMs'
Vascular'Permeability'
Entry)of)amnio+c)fluid)
Labour'
''Adhesion'4'
'''''CAM'3'
DAMP)
2'Transendothelial'
Migration'
5'
InGlammatory'Signal''AmpliGication'
92
CHAPTER 5
Future Directions
Chapter 5: Future Directions
93
5.1 Future Directions
Our specific in vitro cell model mimics the continuous static uterine stretch on the
myometrium imposed by the growing fetus at late gestation. Another type of stretch observed
during active labour process is the repetitive forceful contractions aimed to expel the baby. As
inflammatory events are integral to the labour process, it would be of interest to examine if a
differential effect exists between the cytokine and chemokine profile produced by human
myometrial SMCs under cyclic stretch as compared to static stretch. To the best of our
knowledge, only one group explored the influence of cyclic stretch on the cytokine secretion by
primary human myometrial SMCs; they reported that CXCL1, CXCL8 and pro-MMP-1
(precursor to MMP-1 which degrades collagen) were up-regulated by stretch and promoted
neutrophil chemotaxis200. Importantly, these data perfectly correlate with our finding in the
production of two CXC chemokines. In addition, another group found that cyclic stretch
selectively augmented the secretion of prostacyclin in cultured human myometrial SMCs,
potentially to protect myometrial cells from extremely strong contractions and maintain oxygen
supply via vasodilation201. Using the high-throughput Luminex technology, we can further
elucidate myometrial immune microenvironment under the influence of cyclic stretch.
We can also expand our understanding in the mechanism behind stretch-induced
myometrial cytokine production. In the current study, we revealed that PKC potentially involves
in the stretch-regulated expression of CXCL1 and CXCL8. Recent evidence demonstrates the
association between activation of NF-κB and human parturition, particularly its participation in
the regulation of pro-inflammatory cascade and PR activation77,120,121,123. It was shown that in
vascular SMCs, PKC is involved in NF-κB activation202. It would be of interest to delineate the
Chapter 5: Future Directions
94
participation of NF-κB in the PKC-dependent myometrial cytokine production by mechanical
stretch.
We demonstrated that uterine stretch can promote leukocyte recruitment into the tissue
and therefore can potentially contribute to ECM remodeling and angiogenesis in the postpartum
period by producing multiple growth factors in human myometrial SMCs. It would be interesting
to perform wound-healing assays with human uterine ECs and investigate if presence of stretch-
induced factors helps in EC reconstruction. Wound-healing assays can also be applied to
myometrial SMCs203 as they are also damaged by uterine distension at late gestation and during
forceful labour contractions196. In addition, it is possible that macrophages and neutrophils
contribute to myometrium repair based on their ability to phagocytose cellular debris and to
secrete a wide spectrum of inflammatory mediators and proteolytic enzymes (i.e. MMPs). To
investigate if leukocyte recruitment in the myometrium promotes muscle repair, we can modify
our TEM assay by growing a monolayer of myometrial SMCs in the bottom chamber and
introduce a wound by scratching the monolayer prior to leukocyte loading in the upper chamber.
Next, we can incubate the wounded SMCs with stretch-conditioned media, load isolated
monocytes and neutrophils to the top and allow them to transmigrate. We will examine if the
presence of leukocytes in the bottom chamber with the stretch-induced cytokines facilitates in
myometrial myocyte regeneration.
Appendix
95
APPENDIX
S.1. Concentrations and relative fold changes of myometrial cytokines in conditioned media detected by Luminex technology.
Cytokine NS-CM (pg/ml) S-CM (pg/ml) Relative
Fold Change (S-CM/NS-CM)
p value
SCGF-β 7999.6 ± 1905.1 8084.6 ± 1334.2 1.0 0.9863 CXCL8 775.3 ± 293.0 2543.1 ± 849.3 3.3 0.0973 IL-6 461.8 ± 174.6 4611.0 ± 3289.3 10.0 0.0728 VEGF* 306.7 ± 23.6 434.1 ± 47.6 1.4 0.0335 CCL2 297.7 ± 52.3 486.7 ± 148.3 1.6 0.3176 HGF 210.6 ± 39.8 353.8 ± 124.7 1.7 0.8048 MIF* 151.0 ± 18.8 539.2 ± 203.8 3.6 0.0500 CXCL1 118.6 ± 28.1 476.0 ± 251.1 4.0 0.0728 GM-CSF 114.3 ± 10.4 119.1 ± 7.6 1.0 0.7166 SDF-1α 57.2 ± 14.1 50.5 ± 12.3 0.9 0.7286 IL-12p40 39.9 ± 3.4 61.6 ± 14.0 1.5 0.1570 IL-1rα 35.1 ± 12.3 46.4 ± 14.6 1.3 0.3829 MIG 29.3 ± 3.9 25.4 ± 5.0 0.9 0.5437 IP-10 22.6 ± 6.7 28.3 ± 6.4 1.3 0.4496 G-CSF* 22.2 ± 5.3 82.8 ± 26.0 3.7 0.0416 IL-2Rα 19.9 ± 1.7 20.8 ± 4.1 1.0 0.4557 IL-12p70* 16.8 ± 1.4 22.3 ± 1.5 1.3 0.0182 M-CSF 17.7 ± 1.9 25.5 ± 5.3 1.4 0.1899 IL-3 13.4 ± 1.2 17.2 ± 3.8 1.3 0.9489 IFN-α2 10.7 ± 0.9 10.3 ± 1.2 1.0 0.8301 IFN-γ 10.6 ± 1.4 15.9 ± 2.8 1.5 0.1110 SCF 10.6 ± 1.1 11.6 ± 2.1 1.1 0.6644 IL-9 7.4 ± 0.7 8.8 ± 0.8 1.2 0.2491 LIF 7.3 ± 0.7 9.9 ± 1.9 1.4 0.2345 MCP-3 6.9 ± 1.3 9.5 ± 2.8 1.4 0.2969 FGF basic* 5.7 ± 1.2 16.7 ± 7.0 2.9 0.0376 IL-16 4.4 ± 0.9 7.2 ± 2.3 1.7 0.7483 Β-NGF 3.1 ± 0.5 4.2 ± 0.8 1.4 0.2517 PDGF-bb* 2.3 ± 0.4 3.8 ± 0.6 1.7 0.0491 IL-10 2.0 ± 0.2 2.3 ± 0.1 1.2 0.1632 IL-18 1.7 ± 0.3 1.3 ± 0.2 0.8 0.6200 *Statistically significant different (p<0.01) between NS-CM and S-CM.
Appendix
96
S.2. Absolute concentrations and relative fold change of selected human myometrial cytokines in S-CM and NS-CM validated by ELISA.
Cytokine NS-CM (pg/ml) S-CM (pg/ml) Relative
Fold Change (S-CM/NS-CM)
p value
IL-6 482.2 ± 46.5 2904.7 ± 472.4 6.2 0.0002 VEGF 761.0 ± 50.4 1199.6 ± 123.9 1.5 0.01 CXCL8 100.8 ± 18.0 1113.8 ± 178.8 15.7 0.0001 CXCL1 47.3 ± 15.5 759.3 ± 183.7 16.1 0.0017 G-CSF 5.5 ± 1.0 34.1 ± 9.1 6.2 0.0073
Reference
97
REFERENCES
1. Velez Edwards, D. R. et al. Progestogens for preterm birth prevention: a systematic review and meta-analysis by drug route. Arch. Gynecol. Obstet. (2013).doi:10.1007/s00404-013-2789-9
2. Libby, P. Inflammatory Mechanisms: The Molecular Basis of Inflammation and Disease. Nutrition Reviews 65, S140–S146 (2007).
3. Raghupathy, R. Pregnancy: success and failure within the Th1/Th2/Th3 paradigm. Semin. Immunol. 13, 219–227 (2001).
4. MacIntyre, D. A., Sykes, L., Teoh, T. G. & Bennett, P. R. Prevention of preterm labour via the modulation of inflammatory pathways. J Matern Fetal Neonatal Med 25, 17–20 (2012).
5. Jabbour, H. N., Sales, K. J., Catalano, R. D. & Norman, J. E. Inflammatory pathways in female reproductive health and disease. Reproduction 138, 903–919 (2009).
6. Wegmann, T. G., Lin, H., Guilbert, L. & Mosmann, T. R. Bidirectional cytokine interactions in the maternal-fetal relationship: is successful pregnancy a TH2 phenomenon? Immunol. Today 14, 353–356 (1993).
7. Mor, G., Cardenas, I., Abrahams, V. & Guller, S. Inflammation and pregnancy: the role of the immune system at the implantation site. Ann. N. Y. Acad. Sci. 1221, 80–87 (2011).
8. Sykes, L. et al. Changes in the Th1:Th2 cytokine bias in pregnancy and the effects of the anti-inflammatory cyclopentenone prostaglandin 15-deoxy-Δ(12,14)-prostaglandin J2. Mediators Inflamm. 2012, 416739 (2012).
9. Shynlova, O., Lee, Y.-H., Srikhajon, K. & Lye, S. Physiologic Uterine Inflammation and Labor Onset: Integration of Endocrine and Mechanical Signals. Reproductive Sciences (2012).doi:10.1177/1933719112446084
10. Hess, A. P. et al. Decidual stromal cell response to paracrine signals from the trophoblast: amplification of immune and angiogenic modulators. Biology of Reproduction 76, 102–117 (2007).
11. Jones, R. L., Hannan, N. J., Kaitu'u, T. J., Zhang, J. & Salamonsen, L. A. Identification of chemokines important for leukocyte recruitment to the human endometrium at the times of embryo implantation and menstruation. J. Clin. Endocrinol. Metab. 89, 6155–6167 (2004).
12. Gomez-Lopez, N., Guilbert, L. J. & Olson, D. M. Invasion of the leukocytes into the fetal-maternal interface during pregnancy. J. Leukoc. Biol. 88, 625–633 (2010).
13. Tabiasco, J. et al. Human decidual NK cells: unique phenotype and functional properties -- a review. Placenta 27 Suppl A, S34–9 (2006).
14. Erlebacher, A. Immunology of the maternal-fetal interface. Annu. Rev. Immunol. 31, 387–411 (2013).
15. Fu, B. et al. Natural killer cells promote immune tolerance by regulating inflammatory TH17 cells at the human maternal-fetal interface. Proc. Natl. Acad. Sci. U.S.A. 110, E231–40 (2013).
16. Piccinni, M. P. et al. Progesterone favors the development of human T helper cells producing Th2-type cytokines and promotes both IL-4 production and membrane CD30 expression in established Th1 cell clones. J. Immunol. 155, 128–133 (1995).
17. Lin, H., Mosmann, T. R., Guilbert, L., Tuntipopipat, S. & Wegmann, T. G. Synthesis of T helper 2-type cytokines at the maternal-fetal interface. J. Immunol. 151, 4562–4573
Reference
98
(1993). 18. Piccinni, M.-P. T cell tolerance towards the fetal allograft. Journal of Reproductive
Immunology 85, 71–75 (2010). 19. Svensson-Arvelund, J. et al. The Placenta in Toxicology. Part II: Systemic and Local
Immune Adaptations in Pregnancy. Toxicol Pathol (2013).doi:10.1177/0192623313482205
20. Aluvihare, V. R., Kallikourdis, M. & Betz, A. G. Regulatory T cells mediate maternal tolerance to the fetus. Nat. Immunol. 5, 266–271 (2004).
21. Bollopragada, S. et al. Term labor is associated with a core inflammatory response in human fetal membranes, myometrium, and cervix. YMOB 200, 104.e1–104.e11 (2009).
22. Osman, I. et al. Leukocyte density and pro-inflammatory cytokine expression in human fetal membranes, decidua, cervix and myometrium before and during labour at term. Molecular Human Reproduction 9, 41–45 (2003).
23. Thomson, A. J. et al. Leukocytes infiltrate the myometrium during human parturition: further evidence that labour is an inflammatory process. Hum. Reprod. 14, 229–236 (1999).
24. Lurie, S., Rahamim, E., Piper, I., Golan, A. & Sadan, O. Total and differential leukocyte counts percentiles in normal pregnancy. Eur. J. Obstet. Gynecol. Reprod. Biol. 136, 16–19 (2008).
25. Luppi, P. et al. Monocytes are progressively activated in the circulation of pregnant women. J. Leukoc. Biol. 72, 874–884 (2002).
26. Gordon, S. & Taylor, P. R. Monocyte and macrophage heterogeneity. Nat Rev Immunol 5, 953–964 (2005).
27. Mor, G. & Koga, K. Macrophages and pregnancy. Reprod Sci 15, 435–436 (2008). 28. Mosser, D. M. & Edwards, J. P. Exploring the full spectrum of macrophage activation.
Nat Rev Immunol 8, 958–969 (2008). 29. Murray, P. J. & Wynn, T. A. Obstacles and opportunities for understanding macrophage
polarization. J. Leukoc. Biol. 89, 557–563 (2011). 30. Van Dyken, S. J. & Locksley, R. M. Interleukin-4- and interleukin-13-mediated
alternatively activated macrophages: roles in homeostasis and disease. Annu. Rev. Immunol. 31, 317–343 (2013).
31. Adams, D. H. & Lloyd, A. R. Chemokines: leucocyte recruitment and activation cytokines. Lancet 349, 490–495 (1997).
32. Abrahams, V. M., Kim, Y. M., Straszewski, S. L., Romero, R. & Mor, G. Macrophages and apoptotic cell clearance during pregnancy. Am. J. Reprod. Immunol. 51, 275–282 (2004).
33. Canalli, A. A. et al. Participation of Mac-1, LFA-1 and VLA-4 integrins in the in vitro adhesion of sickle cell disease neutrophils to endothelial layers, and reversal of adhesion by simvastatin. Haematologica 96, 526–533 (2011).
34. Shynlova, O. et al. Infiltration of myeloid cells into decidua is a critical early event in the labour cascade and post-partum uterine remodelling. J. Cell. Mol. Med. 17, 311–324 (2013).
35. Shynlova, O., Nedd-Roderique, T., Li, Y., Dorogin, A. & Lye, S. J. Myometrial immune cells contribute to term parturition, preterm labour and post-partum involution in mice. J. Cell. Mol. Med. n/a–n/a (2012).doi:10.1111/j.1582-4934.2012.01650.x
36. McIntire, R. H., Ganacias, K. G. & Hunt, J. S. Programming of human monocytes by the uteroplacental environment. Reprod Sci 15, 437–447 (2008).
Reference
99
37. Tidball, J. G. Inflammatory processes in muscle injury and repair. Am. J. Physiol. Regul. Integr. Comp. Physiol. 288, R345–53 (2005).
38. Fox, S., Leitch, A. E., Duffin, R., Haslett, C. & Rossi, A. G. Neutrophil apoptosis: relevance to the innate immune response and inflammatory disease. J Innate Immun 2, 216–227 (2010).
39. Mantovani, A., Cassatella, M. A., Costantini, C. & Jaillon, S. Neutrophils in the activation and regulation of innate and adaptive immunity. Nat Rev Immunol 11, 519–531 (2011).
40. Brinkmann, V. et al. Neutrophil extracellular traps kill bacteria. Science 303, 1532–1535 (2004).
41. Pliyev, B. K. Chemotactically active proteins of neutrophils. Biochemistry Moscow 73, 970–984 (2008).
42. Colotta, F., Re, F., Polentarutti, N., Sozzani, S. & Mantovani, A. Modulation of granulocyte survival and programmed cell death by cytokines and bacterial products. Blood 80, 2012–2020 (1992).
43. Megiovanni, A. M. et al. Polymorphonuclear neutrophils deliver activation signals and antigenic molecules to dendritic cells: a new link between leukocytes upstream of T lymphocytes. J. Leukoc. Biol. 79, 977–988 (2006).
44. Costantini, C. & Cassatella, M. A. The defensive alliance between neutrophils and NK cells as a novel arm of innate immunity. J. Leukoc. Biol. 89, 221–233 (2011).
45. Fridlender, Z. G. et al. Polarization of tumor-associated neutrophil phenotype by TGF-beta: "N1" versus “N2” TAN. Cancer Cell 16, 183–194 (2009).
46. Elghetany, M. T. Physiologic variations in granulocytic surface antigen expression: impact of age, gender, pregnancy, race, and stress. J. Leukoc. Biol. 75, 157–162 (2003).
47. Yuan, M., Jordan, F., McInnes, I. B., Harnett, M. M. & Norman, J. E. Leukocytes are primed in peripheral blood for activation during term and preterm labour. Molecular Human Reproduction 15, 713–724 (2009).
48. Dadelszen, von, P. et al. Maternal neutrophil apoptosis in normal pregnancy, preeclampsia, and normotensive intrauterine growth restriction. YMOB 181, 408–414 (1999).
49. Mizoguchi, A., Mizoguchi, E., Takedatsu, H., Blumberg, R. S. & Bhan, A. K. Chronic intestinal inflammatory condition generates IL-10-producing regulatory B cell subset characterized by CD1d upregulation. Immunity 16, 219–230 (2002).
50. Gomez-Lopez, N., Vadillo-Ortega, F. & Estrada-Gutierrez, G. Combined Boyden-Flow Cytometry Assay Improves Quantification and Provides Phenotypification of Leukocyte Chemotaxis. PLoS ONE 6, e28771 (2011).
51. Muzzio, D., Zenclussen, A. C. & Jensen, F. The role of B cells in pregnancy: the good and the bad. Am. J. Reprod. Immunol. 69, 408–412 (2013).
52. Kobayashi, H. The entry of fetal and amniotic fluid components into the uterine vessel circulation leads to sterile inflammatory processes during parturition. Front Immunol 3, 321 (2012).
53. Weaver, C. T., Hatton, R. D., Mangan, P. R. & Harrington, L. E. IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu. Rev. Immunol. 25, 821–852 (2007).
54. Chiang, S. C. C. et al. Comparison of primary human cytotoxic T-cell and natural killer cell responses reveal similar molecular requirements for lytic granule exocytosis but differences in cytokine production. Blood 121, 1345–1356 (2013).
Reference
100
55. Sakaguchi, S. et al. Immunologic tolerance maintained by CD25+ CD4+ regulatory T cells: their common role in controlling autoimmunity, tumor immunity, and transplantation tolerance. Immunol. Rev. 182, 18–32 (2001).
56. Nancy, P. et al. Chemokine gene silencing in decidual stromal cells limits T cell access to the maternal-fetal interface. Science 336, 1317–1321 (2012).
57. Vivier, E. et al. Innate or Adaptive Immunity? The Example of Natural Killer Cells. Science 331, 44–49 (2011).
58. Carlino, C. et al. Recruitment of circulating NK cells through decidual tissues: a possible mechanism controlling NK cell accumulation in the uterus during early pregnancy. Blood 111, 3108–3115 (2008).
59. Manaster, I. et al. Endometrial NK cells are special immature cells that await pregnancy. J. Immunol. 181, 1869–1876 (2008).
60. Vacca, P. et al. CD34+ hematopoietic precursors are present in human decidua and differentiate into natural killer cells upon interaction with stromal cells. Proc. Natl. Acad. Sci. U.S.A. 108, 2402–2407 (2011).
61. Sivori, S. et al. Triggering receptors involved in natural killer cell-mediated cytotoxicity against choriocarcinoma cell lines. Hum. Immunol. 61, 1055–1058 (2000).
62. Orsi, N. M. & Tribe, R. M. Cytokine Networks and the Regulation of Uterine Function in Pregnancy and Parturition. J Neuroendocrinol 20, 462–469 (2008).
63. Szarka, A., Rigó, J., Lázár, L., Bekő, G. & Molvarec, A. Circulating cytokines, chemokines and adhesion molecules in normal pregnancy and preeclampsia determined by multiplex suspension array. BMC Immunology 11, 59 (2010).
64. Vrachnis, N. et al. Intrauterine inflammation and preterm delivery. Ann. N. Y. Acad. Sci. 1205, 118–122 (2010).
65. Kayisli, U. A., Mahutte, N. G. & Arici, A. Uterine chemokines in reproductive physiology and pathology. Am. J. Reprod. Immunol. 47, 213–221 (2002).
66. Piccinni, M. P., Scaletti, C., Vultaggio, A., Maggi, E. & Romagnani, S. Defective production of LIF, M-CSF and Th2-type cytokines by T cells at fetomaternal interface is associated with pregnancy loss. Journal of Reproductive Immunology 52, 35–43 (2001).
67. Yamamoto, H., Teramoto, H., Uetani, K., Igawa, K. & Shimizu, E. Cyclic stretch upregulates interleukin-8 and transforming growth factor-beta1 production through a protein kinase C-dependent pathway in alveolar epithelial cells. Respirology 7, 103–109 (2002).
68. Gruden, G. et al. Mechanical stretch induces monocyte chemoattractant activity via an NF-kappaB-dependent monocyte chemoattractant protein-1-mediated pathway in human mesangial cells: inhibition by rosiglitazone. J. Am. Soc. Nephrol. 16, 688–696 (2005).
69. Kendal-Wright, C. E., Hubbard, D., Gowin-Brown, J. & Bryant-Greenwood, G. D. Stretch and inflammation-induced Pre-B cell colony-enhancing factor (PBEF/Visfatin) and Interleukin-8 in amniotic epithelial cells. Placenta 31, 665–674 (2010).
70. Shynlova, O., Tsui, P., Dorogin, A. & Lye, S. J. Monocyte chemoattractant protein-1 (CCL-2) integrates mechanical and endocrine signals that mediate term and preterm labor. J. Immunol. 181, 1470–1479 (2008).
71. Loudon, J. A. Z. Mechanical stretch of human uterine smooth muscle cells increases IL-8 mRNA expression and peptide synthesis. Molecular Human Reproduction 10, 895–899 (2004).
72. Maehara, K. et al. Mechanical stretching induces interleukin-8 gene expression in fetal membranes: a possible role for the initiation of human parturition. Eur. J. Obstet.
Reference
101
Gynecol. Reprod. Biol. 70, 191–196 (1996). 73. Weber, A., Wasiliew, P. & Kracht, M. Interleukin-1 (IL-1) pathway. Sci Signal 3, cm1
(2010). 74. Bochner, B. S. et al. Adhesion of human basophils, eosinophils, and neutrophils to
interleukin 1-activated human vascular endothelial cells: contributions of endothelial cell adhesion molecules. J. Exp. Med. 173, 1553–1557 (1991).
75. Yoshida, M. et al. Prostaglandin F(2alpha), cytokines and cyclic mechanical stretch augment matrix metalloproteinase-1 secretion from cultured human uterine cervical fibroblast cells. Molecular Human Reproduction 8, 681–687 (2002).
76. Tribe, R. M., Moriarty, P., Dalrymple, A., Hassoni, A. A. & Poston, L. Interleukin-1beta induces calcium transients and enhances basal and store operated calcium entry in human myometrial smooth muscle. Biology of Reproduction 68, 1842–1849 (2003).
77. Hua, R. et al. Stretch and inflammatory cytokines drive myometrial chemokine expression via NF-κB activation. Endocrinology 153, 481–491 (2012).
78. Wajant, H., Pfizenmaier, K. & Scheurich, P. Tumor necrosis factor signaling. Cell Death Differ. 10, 45–65 (2003).
79. Walsh, L. J., Trinchieri, G., Waldorf, H. A., Whitaker, D. & Murphy, G. F. Human dermal mast cells contain and release tumor necrosis factor alpha, which induces endothelial leukocyte adhesion molecule 1. Proc. Natl. Acad. Sci. U.S.A. 88, 4220–4224 (1991).
80. Mehta, D. Signaling Mechanisms Regulating Endothelial Permeability. Physiological Reviews 86, 279–367 (2006).
81. Luppi, P. How immune mechanisms are affected by pregnancy. Vaccine 21, 3352–3357 (2003).
82. Renaud, S. J. et al. Spontaneous pregnancy loss mediated by abnormal maternal inflammation in rats is linked to deficient uteroplacental perfusion. J. Immunol. 186, 1799–1808 (2011).
83. Jiang, Z. Y. et al. Tumor necrosis factor (TNF)-α upregulates progesterone receptor-A by activating the NF-κB signaling pathway in human decidua after labor onset. Placenta 33, 1–7 (2012).
84. Opal, S. M. & DePalo, V. A. Anti-inflammatory cytokines. Chest 117, 1162–1172 (2000).
85. Romano, M. et al. Role of IL-6 and its soluble receptor in induction of chemokines and leukocyte recruitment. Immunity 6, 315–325 (1997).
86. Robertson, S. A. et al. Interleukin-6 Is an Essential Determinant of On-Time Parturition in the Mouse. Endocrinology 151, 3996–4006 (2010).
87. Prins, J. R., Gomez-Lopez, N. & Robertson, S. A. Interleukin-6 in pregnancy and gestational disorders. Journal of Reproductive Immunology 95, 1–14 (2012).
88. Watford, W. T., Moriguchi, M., Morinobu, A. & O’Shea, J. J. The biology of IL-12: coordinating innate and adaptive immune responses. Cytokine Growth Factor Rev. 14, 361–368 (2003).
89. Cooper, A. M. & Khader, S. A. IL-12p40: an inherently agonistic cytokine. Trends in Immunology 28, 33–38 (2007).
90. Russell, T. D. et al. IL-12 p40 homodimer-dependent macrophage chemotaxis and respiratory viral inflammation are mediated through IL-12 receptor beta 1. J. Immunol. 171, 6866–6874 (2003).
91. Orsi, N. M., Gopichandran, N., Bulsara, H., Ekbote, U. V. & Walker, J. J. Regulation of
Reference
102
maternal serum and amniotic fluid cytokine profiles in the mouse: possible roles in the onset of labour. Journal of Reproductive Immunology 75, 97–105 (2007).
92. Hanna, N. et al. Gestational age-dependent expression of IL-10 and its receptor in human placental tissues and isolated cytotrophoblasts. J. Immunol. 164, 5721–5728 (2000).
93. Robertson, S. A., Skinner, R. J. & Care, A. S. Essential Role for IL-10 in Resistance to Lipopolysaccharide-Induced Preterm Labor in Mice. (2006).
94. Thaxton, J. E. & Sharma, S. Interleukin-10: a multi-faceted agent of pregnancy. Am. J. Reprod. Immunol. 63, 482–491 (2010).
95. Hawwa, R. L. et al. IL-10 inhibits inflammatory cytokines released by fetal mouse lung fibroblasts exposed to mechanical stretch. Pediatr. Pulmonol. 46, 640–649 (2011).
96. Hamilton, J. A. Colony-stimulating factors in inflammation and autoimmunity. Nat Rev Immunol 8, 533–544 (2008).
97. Yong, K. L. Granulocyte colony-stimulating factor (G-CSF) increases neutrophil migration across vascular endothelium independent of an effect on adhesion: comparison with granulocyte-macrophage colony-stimulating factor (GM-CSF). Br. J. Haematol. 94, 40–47 (1996).
98. Shorter, S. C., Vince, G. S. & Starkey, P. M. Production of granulocyte colony-stimulating factor at the materno-foetal interface in human pregnancy. Immunology 75, 468–474 (1992).
99. Robertson, S. A. GM-CSF regulation of embryo development and pregnancy. Cytokine Growth Factor Rev. 18, 287–298 (2007).
100. Weston, G. C., Haviv, I. & Rogers, P. A. W. Microarray analysis of VEGF-responsive genes in myometrial endothelial cells. Molecular Human Reproduction 8, 855–863 (2002).
101. Lee, T.-H., Avraham, H., Lee, S.-H. & Avraham, S. Vascular endothelial growth factor modulates neutrophil transendothelial migration via up-regulation of interleukin-8 in human brain microvascular endothelial cells. J. Biol. Chem. 277, 10445–10451 (2002).
102. Heil, M. et al. Vascular endothelial growth factor (VEGF) stimulates monocyte migration through endothelial monolayers via increased integrin expression. Eur. J. Cell Biol. 79, 850–857 (2000).
103. Ferrara, N., Gerber, H.-P. & LeCouter, J. The biology of VEGF and its receptors. Nature Medicine 9, 669–676 (2003).
104. Sooranna, S. R. et al. The mitogen-activated protein kinase dependent expression of prostaglandin H synthase-2 and interleukin-8 messenger ribonucleic acid by myometrial cells: the differential effect of stretch and interleukin-1{beta}. J. Clin. Endocrinol. Metab. 90, 3517–3527 (2005).
105. Groves, D. T. & Jiang, Y. Chemokines, a Family of Chemotactic Cytokines. Critical Reviews in Oral Biology & Medicine 6, 109–118 (1995).
106. Esplin, M. S. et al. Monocyte chemotactic protein-1 expression is increased in human gestational tissues during term and preterm labor. Placenta 26, 661–671 (2005).
107. Wood, G. W., Hausmann, E. & Choudhuri, R. Relative role of CSF-1, MCP-1/JE, and RANTES in macrophage recruitment during successful pregnancy. Mol. Reprod. Dev. 46, 62–9; discussion 69–70 (1997).
108. Williams, M. R., Azcutia, V., Newton, G., Alcaide, P. & Luscinskas, F. W. Emerging mechanisms of neutrophil recruitment across endothelium. Trends in Immunology 32, 461–469 (2011).
109. Sadik, C. D., Kim, N. D. & Luster, A. D. Neutrophils cascading their way to
Reference
103
inflammation. Trends in Immunology 32, 452–460 (2011). 110. Ledingham, M. A. et al. Cell adhesion molecule expression in the cervix and
myometrium during pregnancy and parturition. Obstetrics & Gynecology 97, 235–242 (2001).
111. Weber, C., Fraemohs, L. & Dejana, E. The role of junctional adhesion molecules in vascular inflammation. Nat Rev Immunol 7, 467–477 (2007).
112. Butler, L. M., Rainger, G. E. & Nash, G. B. A role for the endothelial glycosaminoglycan hyaluronan in neutrophil recruitment by endothelial cells cultured for prolonged periods. Experimental Cell Research 315, 3433–3441 (2009).
113. Speyer, C. L. & Ward, P. A. Role of Endothelial Chemokines and Their Receptors during Inflammation. J Invest Surg 24, 18–27 (2011).
114. Zarbock, A. & Ley, K. Neutrophil adhesion and activation under flow. Microcirculation 16, 31–42 (2009).
115. Puré, E. & Cuff, C. A. A crucial role for CD44 in inflammation. Trends Mol Med 7, 213–221 (2001).
116. Khan, A. I. et al. Role of CD44 and hyaluronan in neutrophil recruitment. J. Immunol. 173, 7594–7601 (2004).
117. Hodge-Dufour, J. et al. Induction of IL-12 and chemokines by hyaluronan requires adhesion-dependent priming of resident but not elicited macrophages. J. Immunol. 159, 2492–2500 (1997).
118. Ou, C. W., Orsino, A. & Lye, S. J. Expression of connexin-43 and connexin-26 in the rat myometrium during pregnancy and labor is differentially regulated by mechanical and hormonal signals. Endocrinology 138, 5398–5407 (1997).
119. Kamel, R. M. The onset of human parturition. Arch. Gynecol. Obstet. 281, 975–982 (2010).
120. Lei, K. et al. Uterine Stretch and Progesterone Action. J. Clin. Endocrinol. Metab. 96, E1013–E1024 (2011).
121. Golightly, E., Jabbour, H. N. & Norman, J. E. Endocrine immune interactions in human parturition. Molecular and Cellular Endocrinology 335, 52–59 (2011).
122. Vrachnis, N., Malamas, F. M., Sifakis, S., Tsikouras, P. & Iliodromiti, Z. Immune Aspects and Myometrial Actions of Progesterone and CRH in Labor. Clinical and Developmental Immunology 2012, 1–10 (2012).
123. Khanjani, S. et al. NF-κB regulates a cassette of immune/inflammatory genes in human pregnant myometrium at term. J. Cell. Mol. Med. 15, 809–824 (2011).
124. Phillips, R. J., Al-Zamil, H., Hunt, L. P., Fortier, M. A. & López Bernal, A. Genes for prostaglandin synthesis, transport and inactivation are differentially expressed in human uterine tissues, and the prostaglandin F synthase AKR1B1 is induced in myometrial cells by inflammatory cytokines. Molecular Human Reproduction 17, 1–13 (2011).
125. Blanks, A. M., Shmygol, A. & Thornton, S. Preterm labour. Myometrial function in prematurity. Best Pract Res Clin Obstet Gynaecol 21, 807–819 (2007).
126. Myatt, L. & Lye, S. J. Expression, localization and function of prostaglandin receptors in myometrium. Prostaglandins, Leukotrienes and Essential Fatty Acids 70, 137–148 (2004).
127. Palliser, H. K. et al. Changes in the expression of prostaglandin E and F synthases at induced and spontaneous labour onset in the sheep. J. Endocrinol. 180, 469–477 (2004).
128. Keelan, J. A. et al. Cytokines, prostaglandins and parturition--a review. Placenta 24 Suppl A, S33–46 (2003).
Reference
104
129. Luppi, P., Irwin, T. E., Simhan, H. & Deloia, J. A. CD11b Expression on circulating leukocytes increases in preparation for parturition. Am. J. Reprod. Immunol. 52, 323–329 (2004).
130. Young, A. et al. Immunolocalization of proinflammatory cytokines in myometrium, cervix, and fetal membranes during human parturition at term. Biology of Reproduction 66, 445–449 (2002).
131. Mitchell, B. F. & Taggart, M. J. Are animal models relevant to key aspects of human parturition? Am. J. Physiol. Regul. Integr. Comp. Physiol. 297, R525–45 (2009).
132. Bisits, A. M. et al. Inflammatory aetiology of human myometrial activation tested using directed graphs. PLoS Comput. Biol. 1, 132–136 (2005).
133. Kendal-Wright, C. E. Stretching, mechanotransduction, and proinflammatory cytokines in the fetal membranes. Reproductive Sciences 14, 35–41 (2007).
134. Reichman, D., Laufer, M. R. & Robinson, B. K. Pregnancy outcomes in unicornuate uteri: a review. Fertil. Steril. 91, 1886–1894 (2009).
135. Gardner, M. O. et al. The origin and outcome of preterm twin pregnancies. Obstetrics & Gynecology 85, 553–557 (1995).
136. Shynlova, O., Tsui, P., Jaffer, S. & Lye, S. J. Integration of endocrine and mechanical signals in the regulation of myometrial functions during pregnancy and labour. Eur. J. Obstet. Gynecol. Reprod. Biol. 144 Suppl 1, S2–10 (2009).
137. Keski-Nisula, L. T., Aalto, M.-L., Kirkinen, P. P., Kosma, V.-M. & Heinonen, S. T. Myometrial inflammation in human delivery and its association with labor and infection. Am. J. Clin. Pathol. 120, 217–224 (2003).
138. Mittal, P. et al. Characterization of the myometrial transcriptome and biological pathways of spontaneous human labor at term. Journal of Perinatal Medicine 38, 617–643 (2010).
139. Lindstrom, T. M. & Bennett, P. R. The role of nuclear factor kappa B in human labour. Reproduction 130, 569–581 (2005).
140. Roux, P. P. & Blenis, J. ERK and p38 MAPK-activated protein kinases: a family of protein kinases with diverse biological functions. Microbiol. Mol. Biol. Rev. 68, 320–344 (2004).
141. Li, Y. et al. Stretch Activates Human Myometrium via ERK, Caldesmon and Focal Adhesion Signaling. PLoS ONE 4, e7489 (2009).
142. Casey, M. L. & MacDonald, P. C. Biomolecular Processes in the Initiation of Parturition: Decidual Activation. Clinical Obstetrics and Gynecology 31, 533 (1988).
143. Hamilton, S. et al. Macrophages infiltrate the human and rat decidua during term and preterm labor: evidence that decidual inflammation precedes labor. Biology of Reproduction 86, 39 (2012).
144. Makino, S., Zaragoza, D. B., Mitchell, B. F., Yonemoto, H. & Olson, D. M. Decidual activation: abundance and localization of prostaglandin F2alpha receptor (FP) mRNA and protein and uterine activation proteins in human decidua at preterm birth and term birth. Placenta 28, 557–565 (2007).
145. Mahendroo, M. Cervical remodeling in term and preterm birth: insights from an animal model. Reproduction 143, 429–438 (2012).
146. Gonzalez, J. M., Romero, R. & Girardi, G. Comparison of the mechanisms responsible for cervical remodeling in preterm and term labor. Journal of Reproductive Immunology 97, 112–119 (2013).
147. Condon, J. et al. Telomerase immortalization of human myometrial cells. Biology of
Reference
105
Reproduction 67, 506–514 (2002). 148. Boyd, V., Cholewa, O. M. & Papas, K. K. Limitations in the Use of Fluorescein
Diacetate/Propidium Iodide (FDA/PI) and Cell Permeable Nucleic Acid Stains for Viability Measurements of Isolated Islets of Langerhans. Curr Trends Biotechnol Pharm 2, 66–84 (2008).
149. Vandesompele, J. et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3, RESEARCH0034 (2002).
150. Gräbner, R., Till, U. & Heller, R. Flow cytometric determination of E-selectin, vascular cell adhesion molecule-1, and intercellular cell adhesion molecule-1 in formaldehyde-fixed endothelial cell monolayers. Cytometry 40, 238–244 (2000).
151. Fiuza, C., Salcedo, M., Clemente, G. & Tellado, J. M. Granulocyte colony-stimulating factor improves deficient in vitro neutrophil transendothelial migration in patients with advanced liver disease. Clin. Diagn. Lab. Immunol. 9, 433–439 (2002).
152. Kumar, A. CCAAT/Enhancer-binding Protein and Activator Protein-1 Transcription Factors Regulate the Expression of Interleukin-8 through the Mitogen-activated Protein Kinase Pathways in Response to Mechanical Stretch of Human Airway Smooth Muscle Cells. Journal of Biological Chemistry 278, 18868–18876 (2003).
153. Zampetaki, A., Zhang, Z., Hu, Y. & Xu, Q. Biomechanical stress induces IL-6 expression in smooth muscle cells via Ras/Rac1-p38 MAPK-NF-kappaB signaling pathways. Am. J. Physiol. Heart Circ. Physiol. 288, H2946–54 (2005).
154. Hiraoka, A. et al. Cloning, expression, and characterization of a cDNA encoding a novel human growth factor for primitive hematopoietic progenitor cells. Proc. Natl. Acad. Sci. U.S.A. 94, 7577–7582 (1997).
155. Li, L.-F. et al. Stretch-induced IL-8 depends on c-Jun NH2-terminal and nuclear factor-kB-inducing kinases. Am. J. Physiol. Lung Cell Mol. Physiol. 285, L464–L475 (2003).
156. Keelan, J. A. et al. Cytokines, Prostaglandins and Parturition—A Review. Placenta 24, S33–S46 (2003).
157. Unal, E. R., Cierny, J. T., Roedner, C., Newman, R. & Goetzl, L. Maternal inflammation in spontaneous term labor. American Journal of Obstetrics and Gynecology 204, 223.e1–5 (2011).
158. Leemans, J. C., Wieland, C. W., Florquin, S., Van Der Poll, T. & Vervoordeldonk, M. J. B. M. Mice overexpressing p40 in lungs have reduced leucocyte influx and slightly impaired resistance during tuberculosis. Immunology 117, 409–418 (2006).
159. Calandra, T. & Roger, T. Macrophage migration inhibitory factor: a regulator of innate immunity. Nat Rev Immunol 3, 791–800 (2003).
160. Bernhagen, J. et al. MIF is a noncognate ligand of CXC chemokine receptors in inflammatory and atherogenic cell recruitment. Nature Medicine 13, 587–596 (2007).
161. Santos, L. L. et al. Macrophage migration inhibitory factor regulates neutrophil chemotactic responses in inflammatory arthritis in mice. Arthritis Rheum. 63, 960–970 (2011).
162. Chaiworapongsa, T. et al. Macrophage migration inhibitory factor in patients with preterm parturition and microbial invasion of the amniotic cavity. J Matern Fetal Neonatal Med 18, 405–416 (2005).
163. Ietta, F. et al. Macrophage migration inhibitory factor in human pregnancy and labor. Am. J. Reprod. Immunol. 48, 404–409 (2002).
164. Sehringer, B. et al. Formation of proinflammatory cytokines in human term myometrium
Reference
106
is stimulated by lipopolysaccharide but not by corticotropin-releasing hormone. J. Clin. Endocrinol. Metab. 85, 4859–4865 (2000).
165. Friebe-Hoffmann, U., Chiao, J. P. & Rauk, P. N. Effect of IL-1beta and IL-6 on oxytocin secretion in human uterine smooth muscle cells. Am. J. Reprod. Immunol. 46, 226–231 (2001).
166. Rauk, P. N., Friebe-Hoffmann, U., Winebrenner, L. D. & Chiao, J. P. Interleukin-6 up-regulates the oxytocin receptor in cultured uterine smooth muscle cells. Am. J. Reprod. Immunol. 45, 148–153 (2001).
167. Osmers, R. G. W., Blaser, J., Kuhn, W. & Tschesche, H. Interleukin-8 synthesis and the onset of labor. Obstetrics & Gynecology 86, 223–229 (1995).
168. Elliott, C. L., Slater, D. M., Dennes, W., Poston, L. & Bennett, P. R. Interleukin 8 expression in human myometrium: changes in relation to labor onset and with gestational age. Am. J. Reprod. Immunol. 43, 272–277 (2000).
169. Li, C. & Xu, Q. Mechanical stress-initiated signal transductions in vascular smooth muscle cells. Cell. Signal. 12, 435–445 (2000).
170. Greenhalgh, D. G., Sprugel, K. H., Murray, M. J. & Ross, R. PDGF and FGF stimulate wound healing in the genetically diabetic mouse. Am. J. Pathol. 136, 1235–1246 (1990).
171. Baumann, R. et al. Macrophage migration inhibitory factor delays apoptosis in neutrophils by inhibiting the mitochondria-dependent death pathway. FASEB J. 17, 2221–2230 (2003).
172. Wengner, A. M., Pitchford, S. C., Furze, R. C. & Rankin, S. M. The coordinated action of G-CSF and ELR + CXC chemokines in neutrophil mobilization during acute inflammation. Blood 111, 42–49 (2007).
173. Nissen, N. N. et al. Vascular endothelial growth factor mediates angiogenic activity during the proliferative phase of wound healing. Am. J. Pathol. 152, 1445–1452 (1998).
174. Barrientos, S., Stojadinovic, O., Golinko, M. S., Brem, H. & Tomic-Canic, M. Growth factors and cytokines in wound healing. Wound Repair Regen 16, 585–601 (2008).
175. Winkler, M., Kemp, B., Fischer, D. C., Ruck, P. & Rath, W. Expression of adhesion molecules in the lower uterine segment during term and preterm parturition. Microsc. Res. Tech. 60, 430–444 (2003).
176. Maruo, N., Morita, I., Shirao, M. & Murota, S. IL-6 increases endothelial permeability in vitro. Endocrinology 131, 710–714 (1992).
177. Lei, X., Hossain, M., Qadri, S. M. & Liu, L. Different microvascular permeability responses elicited by the CXC chemokines MIP-2 and KC during leukocyte recruitment: Role of LSP1. Biochemical and Biophysical Research Communications 423, 484–489 (2012).
178. Schraufstatter, I. U., Chung, J. & Burger, M. IL-8 activates endothelial cell CXCR1 and CXCR2 through Rho and Rac signaling pathways. Am. J. Physiol. Lung Cell Mol. Physiol. 280, L1094–103 (2001).
179. Aghajanian, A., Wittchen, E. S., Allingham, M. J., Garrett, T. A. & Burridge, K. Endothelial cell junctions and the regulation of vascular permeability and leukocyte transmigration. J. Thromb. Haemost. 6, 1453–1460 (2008).
180. Dejana, E. Endothelial cell-cell junctions: happy together. Nat. Rev. Mol. Cell Biol. 5, 261–270 (2004).
181. Lundahl, J., Hallden, G. & Skold, C. Human blood monocytes, but not alveolar macrophages, reveal increased CD11b/CD18 expression and adhesion properties upon receptor-dependent activation. European Respiratory Journal 9, 1188–1194 (1996).
Reference
107
182. Klugewitz, K. et al. Activation of the beta2 integrin Mac-1 (CD11b/CD18) by an endogenous lipid mediator of human neutrophils and HL-60 cells. J. Cell. Sci. 110 ( Pt 8), 985–990 (1997).
183. Conklyn, M. J., Neote, K. & Showell, H. J. Chemokine-dependent upregulation of CD11b on specific leukocyte subpopulations in human whole blood: effect of anticoagulant on rantes and MIP-1 beta stimulation. Cytokine 8, 762–766 (1996).
184. Brewster, J. A. et al. Gestational effects on host inflammatory response in normal and pre-eclamptic pregnancies. European Journal of Obstetrics & Gynecology and Reproductive Biology 140, 21–26 (2008).
185. Fujisaki, T. et al. CD44 stimulation induces integrin-mediated adhesion of colon cancer cell lines to endothelial cells by up-regulation of integrins and c-Met and activation of integrins. Cancer Research 59, 4427–4434 (1999).
186. Hidalgo, A., Peired, A. J., Wild, M. K., Vestweber, D. & Frenette, P. S. Complete identification of E-selectin ligands on neutrophils reveals distinct functions of PSGL-1, ESL-1, and CD44. Immunity 26, 477–489 (2007).
187. Zarbock, A. & Ley, K. Mechanisms and consequences of neutrophil interaction with the endothelium. Am. J. Pathol. 172, 1–7 (2008).
188. Rajagopalan, L. & Rajarathnam, K. Ligand Selectivity and Affinity of Chemokine Receptor CXCR1: ROLE OF N-TERMINAL DOMAIN. Journal of Biological Chemistry 279, 30000–30008 (2004).
189. Quehenberger, O. Thematic review series: the immune system and atherogenesis. Molecular mechanisms regulating monocyte recruitment in atherosclerosis. J. Lipid Res. 46, 1582–1590 (2005).
190. Lee, Y. et al. Interactions between inflammatory signals and the progesterone receptor in regulating gene expression in pregnant human uterine myocytes. J. Cell. Mol. Med. 16, 2487–2503 (2012).
191. Salamonsen, L. A. Tissue injury and repair in the female human reproductive tract. Reproduction 125, 301–311 (2003).
192. Kebir, El, D., József, L., Pan, W. & Filep, J. G. Myeloperoxidase delays neutrophil apoptosis through CD11b/CD18 integrins and prolongs inflammation. Circ. Res. 103, 352–359 (2008).
193. Grainger, D. J. & Reckless, J. Broad-spectrum chemokine inhibitors (BSCIs) and their anti-inflammatory effects in vivo. Biochemical Pharmacology 65, 1027–1034 (2003).
194. Kayisli, U. A., Berkkanoglu, M., Zhang, L., Kizilay, G. & Arici, A. The broad-spectrum chemokine inhibitor NR58-3.14.3 suppresses the implantation and survival of human endometrial implants in the nude mice endometriosis model. Reprod Sci 14, 825–835 (2007).
195. Beech, J. S. et al. Neuroprotection in ischemia-reperfusion injury: an antiinflammatory approach using a novel broad-spectrum chemokine inhibitor. J. Cereb. Blood Flow Metab. 21, 683–689 (2001).
196. Leong, A. S.-Y., Norman, J. E. & Smith, R. Vascular and myometrial changes in the human uterus at term. Reproductive Sciences 15, 59–65 (2008).
197. Pantham, P., Askelund, K. J. & Chamley, L. W. Trophoblast deportation part II: a review of the maternal consequences of trophoblast deportation. Placenta 32, 724–731 (2011).
198. Abumaree, M. H., Stone, P. R. & Chamley, L. W. The effects of apoptotic, deported human placental trophoblast on macrophages: possible consequences for pregnancy. Journal of Reproductive Immunology 72, 33–45 (2006).
Reference
108
199. Sykes, L., MacIntyre, D. A., Yap, X. J., Teoh, T. G. & Bennett, P. R. The Th1:Th2 Dichotomy of Pregnancy and Preterm Labour. Mediators Inflamm. 2012, 1–12 (2012).
200. Zhao, Y. et al. Cyclic stretch augments production of neutrophil chemokines and matrix metalloproteinase-1 in human uterine smooth muscle cells. Am. J. Reprod. Immunol. 69, 240–247 (2013).
201. Korita, D. et al. Cyclic mechanical stretch augments prostacyclin production in cultured human uterine myometrial cells from pregnant women: possible involvement of up-regulation of prostacyclin synthase expression. J. Clin. Endocrinol. Metab. 87, 5209–5219 (2002).
202. Ramana, K. V., Friedrich, B., Srivastava, S., Bhatnagar, A. & Srivastava, S. K. Activation of nuclear factor-kappaB by hyperglycemia in vascular smooth muscle cells is regulated by aldose reductase. Diabetes 53, 2910–2920 (2004).
203. Goetsch, K. P. & Niesler, C. U. Optimization of the scratch assay for in vitro skeletal muscle wound healing analysis. Anal. Biochem. 411, 158–160 (2011).
204. Sabra S, Shynlova O, Lye S. Immunophenotyping of maternal peripheral blood detects activated leukocyte subpopulations associated with preterm labor editor. Reprod Sci. 18; 3 (suppl), 269A (2011).
205. Rinfaldi, S. F., Catalano, R. D., Wade, J., Rossi, A.G. & Norman, J. E. Investigating the role of neutrophils in a mouse model of infection-induced preterm labour. Reprod Sci. 20; 3 (suppl), 299A (2013).
206. Shynlova, O., Dorogin, A., Li, Y., Lye, T. & Lye, S. Broad spectrum chemokine inhibitor delays infection-induced preterm delivery in mice. Reprod Sci. 19; 3(suppl), 104A (2013).
Recommended