Syllabus Notes 3.4

Syllabus Notes 3.4

3.4.1 State that PCR (polymerase chain reaction) copies and amplifies minute quantities of nucleic acid.

3.4.2 State that gel electrophoresis involves the separation of fragmented pieces of DNA according to their charge and size.

3.4.3 State that gel electrophoresis of DNA is used in DNA profiling.

Samurai Pizza CatsHour 2’s Random Show of the Day

Gel Electrophoresis, DNA Technology:More than police justice

DNA Technology

ForensicsGene TherapyGenetic Engineering

Rabbit, mice and fish with the firefly ‘glow gene’ luciferase added.

Old fashioned methods of genetic engineering yielded things like the liger, male lion + female tiger:

Before Electrophoresis: Mate Crosses

1978-Invitro-Fertilization led to a baby

Genetically engineered insulin used/approved-1982

Genetically engineered organisms began to be patented in 1981

Before Electrophoresis: Landmarks

Before Electrophoresis: More Landmarks

1992: FlavrSavr tomato, engineered to ripen/rot slower. Company is now with Monsanto.

1997: First mammal cloned (Dolly the sheep)

1998: Cloning of stem cells (cells that are not differentiated yet) led to tissue regeneration, and organ culture

1986: DNA fingerprinting developed by Alec Jeffreys

1989: Bacteria with plasmids that can digest oil are used to clean up the Exxon Valdez oil spill.

1990: Human Genome Project launched. Goal: code the entire human genome by 2005 (done way ahead of schedule – 2000.)

Before Electrophoresis: More Landmarks

Electrophoresis: The Basics

Procedure used to separate molecules – most commonly proteins and nucleic acids.

Uses a gel and an electric current to separate molecules by size or charge.

http://learn.genetics.utah.edu/units/biotech/gel/

Electrophoresis: How & why it works

Phosphate groups make nucleic acids negatively charged.

In an electric field, the negative anode repels them and the positive cathode attracts them.

Smaller fragments move farther and faster than slower, larger fragments.

( – )

( – )

( – ) ( – )

Electrophoresis: Good to know

kb = kilobase-pairs, or 1,000 base pairs

It is used to describe the number of base-pairs in the DNA fragments.

Example:4.36 kb = 4,360 base-pairs

Smaller fragments are further down than large fragments.

Electrophoresis: Restriction Enzymes

If someone’s DNA is cut with a restriction enzyme, it will make fragments specific to that individual.

EcorI, a commonly used restriction enzyme, cuts where ever GAATTC is found.

We may find this region:5 times in an earthworm; or15 times in a bacteria.

We get different lengths between individuals as well as different numbers of fragments.

Ecor I Restriction Enzyme cuts between the ‘G’ and the ‘A’ Whenever the sequence is ‘GAATTC’

Makes ‘sticky ends’

Electrophoresis: Restriction Enzymes

This is the concept behind adding a gene from one organism into another one. If you cut out a gene using a restriction enzyme, you can make an opening in the DNA of the new organism with the same restriction enzyme.

Electrophoresis: Restriction Enzymes

SmaI cuts between the ‘C’ and the ‘G’ whenever ‘CCC|GGG’ are in a sequence. How does this make a ‘blunt’ end?

AATTGGAACCCGGGTTCCAAG

TTAACCTTGGGCCCAAGGTTC

Electrophoresis: Restriction Enzymes

There are a bunch of different enzymes we can use, each cutting in their own unique way.

If we cut with the same DNA with different enzymes, we’ll get a picture like this one.

Electrophoresis: Restriction Enzymes

Electrophoresis: RFLPs

“Restriction Fragment Length Polymorphism”

Definition: a technique in which organisms may be differentiated by analysis of patterns by the cleavage of their DNA.

Two organisms differing in distances between cleavage sites will produce different length fragments!

Similarities in patterns generated can be used to differentiate the two.

Electrophoresis: CSI SW

We can match identities by putting multiple people on the same gel.

Electrophoresis: CSI SW – Ain’t yo daddy…

In each of these cases, is the alleged father really the father? (These gel have been simplified.)

Remember: each parent donates ½ the genes!

Electrophoresis: Activity

Carefully follow the instructions to the restriction enzyme activity. Only do Part One!

Turn in:

• Answers to the lab questions• Your labeled and cut DNA slips (staple them to your answer sheet)

Reminder:

• Make-up point work is due tomorrow (Friday)