View
212
Download
0
Category
Preview:
Citation preview
Acc
epte
d A
rtic
le
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/exd.12452
This article is protected by copyright. All rights reserved.
Received Date : 04-Nov-2013
Accepted Date : 16-May-2014
Article type : Regular Article
Title
SMAD inhibition attenuates epithelial to mesenchymal transition by primary keratinocytes in
vitro
Authors and institutions –
Donal O’Kane1, Megan V Jackson1, Adrien Kissenpfennig1, Shaun Spence1, Lindsay
Damkat-Thomas2, Julia P Tolland3, Anita E Smyth4, Christopher P Denton5, J Stuart Elborn1,
Daniel F McAuley1, Cecilia M O’Kane1
1Centre For Infection and Immunity, Queen’s University Belfast, Belfast, UK, BT9 7BL,
Departments of 2Plastic Surgery, 3Dermatology and 4Rheumatology, Ulster Hospital,
Dundonald, Belfast, UK, BT16 1RH, 5Centre for Rheumatology and Connective Tissue
Disease, University College London, University Street, London, UK, WC1E 6JF
Corresponding author -
Dr Cecilia O’Kane,
Centre for Infection and Immunity, Queen’s University Belfast, Belfast, UK, BT9 7BL
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Tel – +44 28 90972039
Fax – +44 28 90972671
Email – c.okane@qub.ac.uk
Short title –
SMAD inhibition attenuates EMT in keratinocytes
Abbreviations –
Epithelial to mesenchymal transition (EMT); transforming growth factor-β (TGF-β); tumour
necrosis factor-α (TNF-α); normal human epidermal keratinocytes (NHEK); matrix
metalloproteinase (MMP); tissue inhibitors of metalloproteinases (TIMP);
Key words –
Epithelial to mesenchymal transition; EMT; keratinocyte; TGF-β; TNF-α;
Abstract
Epithelial to mesenchymal transition (EMT) is a process whereby epithelial cells undergo
transition to a mesenchymal phenotype and contribute directly to fibrotic disease. Recent
studies support a role for EMT in cutaneous fibrotic diseases including scleroderma and
hypertrophic scarring, though there is limited data on the cytokines and signalling
mechanisms regulating cutaneous EMT. We investigated the ability of TGF-β and TNF-α,
both over-expressed in cutaneous scleroderma and central mediators of EMT in other
epithelial cell types, to induce EMT in primary keratinocytes and studied the signalling
mechanisms regulating this process. TGF-β induced EMT in normal human epidermal
keratinocytes (NHEK cells) and this process was enhanced by TNF-α. EMT was
characterised by changes in morphology, proteome (down-regulation of E-cadherin and Zo-1,
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
and up-regulation of vimentin and fibronectin), MMP secretion and COL1α1 mRNA
expression. TGF-β and TNF-α in combination activated SMAD and p38 signalling in NHEK
cells. P38 inhibition with SB203580 partially attenuated EMT, whereas SMAD inhibition
using SB431542 significantly inhibited EMT and also reversed established EMT. These data
highlight the retained plasticity of adult keratinocytes and support further studies of EMT in
clinically relevant in vivo models of cutaneous fibrosis, and investigation of SMAD inhibition
as a potential therapeutic intervention.
Introduction
Epithelial to mesenchymal transition (EMT) is a process whereby polarised epithelial cells
undergo transition into motile mesenchymal cells. EMT is characterised by a loss in
epithelial cell-cell adhesion and polarity, and a gain in mesenchymal cell morphology and
proteome, with decreased epithelial markers including E-cadherin, Zo-1, and increased
mesenchymal markers such as vimentin and fibronectin (1,2). There is accompanying
increased secretion of matrix metalloproteinases (MMPs), including MMP-2 and -9, which
degrade collagen IV, the main component of the basement membrane, and aid the
development of a migratory phenotype (3,4).
Although initially described in embryogenesis (5), there is increasing evidence that epithelial
cells retain their plasticity into adulthood and that EMT is a pathogenic mechanism in organ
fibrosis. In animal models of renal, hepatic, and pulmonary fibrosis, 36%, 45%, and over
80% of fibroblasts within fibrotic foci, respectively, originated in the epithelium and EMT
has been demonstrated in vivo in human pulmonary and hepatic fibrotic disease (6-9). A
greater understanding of the molecular and cellular mechanisms that regulate EMT in fibrotic
disease could therefore identify novel therapeutic targets.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
A role for EMT in cutaneous fibrotic disease is supported by mesenchymal protein
expression in the basal epidermis of human hypertrophic scars (10). In addition, increased
expression of SNAI1 and TWIST, transcription factors integral in the EMT process, has been
observed within scleroderma skin (11). There are however, limited data on the cytokines and
signalling pathways regulating cutaneous EMT. TGF-β induced an EMT-like phenotype in
the HaCaT skin epithelial cell line only when transfected with mutant-Ras in one study (12)
and induced partial EMT (loss of epithelial markers, but no gain in mesenchymal markers) in
another (13). More recently, stimulation of normal human keratinocytes and skin explants
with TGF-β and TNF-α independently was shown to induce features of EMT (10).
TGF-β and TNF-α interact to induce EMT in primary human bronchial epithelial cells in a
synergistic manner (4). This could have implications for the pathogenesis of cutaneous
scleroderma where both cytokines are over-expressed (14,15). This synergy cannot be
assumed to occur in the cutaneous epithelium however, as the regulation of EMT appears to
be tissue-specific. For instance, bone morphogenic protein (BMP)-7, a member of the TGF-β
superfamily, attenuates EMT and Endothelial-MT in mouse models of liver (7) and cardiac
(16) fibrosis, respectively, but does not attenuate murine bleomycin-induced pulmonary or
cutaneous fibrosis (17).
In this study, we investigated whether TGF-β and TNF-α interacted to drive EMT in primary
skin keratinocytes. We report for the first time that TNF-α potentiates TGF-β-induced
cutaneous EMT. We demonstrate that this interaction is dependent on SMAD-2/-3 and less
so p38 signalling and that SB431542, an inhibitor of TGFβRI activation, can prevent EMT.
More importantly, we have shown for the first time that targeted SMAD-2/-3 inhibition with
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
SB431542 can reverse established EMT. These data provide important insight into the
retained plasticity of keratinocytes into adulthood and identifies SMAD inhibition as a
potential therapeutic strategy for both prevention and treatment of cutaneous fibrotic disease.
Methods
Reagents
Recombinant human TGF-β and TNF-α were purchased from Peprotech EC (London, UK).
SB431542 and SB203580 were obtained from Sigma Aldrich (Dorset, UK). Antibodies to E-
cadherin, fibronectin, vimentin, α-smooth muscle actin (α-SMA), and β-actin were purchased
from Abcam (Cambridge, UK). The antibody to Zo-1 and fluorescent-conjugated secondary
antibodies (Alexa Fluor 488 and 594) were purchased from Invitrogen (Paisley, UK).
SMAD2/3, p38, JNK, and ERK antibodies were obtained from Cell Signaling Technologies
(New England Biolabs UK Ltd., Hertfordshire, UK) as were HRP-linked goat anti-mouse and
goat anti-rabbit IgG secondary antibodies.
Cell culture
NHEK cells at passage 2-4 were cultured in supplemented keratinocyte growth media-gold
(KGM-Gold) (both Lonza, Slough, UK), at 37°C and 5% CO2. Cells were grown to 70-80%
confluence and then stimulated with 10 ng/ml TGF-β and/or TNF-α for 96 hours for
investigation of protein changes of EMT. This concentration and timeframe was chosen
following a period of optimisation (cells were stimulated with 1-100 ng/ml of each cytokine
for 48-120 hours). Concentrations of TGF-β and TNF-α were also informed by previous
studies in other epithelial cell types (4,18,19). Of note, TGF-β concentrations were
comparable to those seen in vivo in scleroderma (20). NHEK cells were stimulated with
TGF-β and TNF-α in the presence or absence of SB431542 and SB203580, both of which
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
were used at a concentration of 10 μM, informed by previous studies and following a period
of optimisation (4,21). For reversal of EMT experiments, NHEK cells were stimulated with
TGF-β + TNF-α for 96 hours, then washed and incubated for a further 48 hours with fresh
KGM-Gold +/- 10 µM SB431542. For SMAD and MAP kinase phosphorylation
experiments, NHEK cells were stimulated with TGF-β and TNF-α for 0-8 hours in the
presence or absence of SB431542 or SB203580.
Western blotting
Western blots were carried out as previously described (22). NHEK cells were lysed with
pre-chilled SDS lysis buffer (62.5mM Tris pH 6.8, 2% SDS, 10% glycerol, 50mM DDT,
0.002% bromphenol blue). Lysates containing 50µg of protein (as calculated using a
Bradford assay) were heat-inactivated (1000C for 5 minutes) and loaded onto 6% (for Zo-1
and fibronectin) or 12% (for E-cadherin, vimentin, α-SMA, β-actin, and SMAD blots)
polyacrylamide gels, before resolving and transferring to nitrocellulose. After blocking in 1%
BSA (Sigma Aldrich, Dorset, UK) membranes were incubated overnight at 40C with primary
antibody (vimentin, α-SMA, and β-actin 1:500, Zo-1 and fibronectin 1:2000, E-cadherin
1:25000, total SMAD2/3, P38,ERK and JNK 1:1000, phospho-SMAD2/3, p38, ERK, and
JNK 1:2000), washed, and then incubated with secondary antibody for 1 hour at room
temperature. HRP-conjugated anti-mouse or rabbit antibody was added at 1/1000, before
developing with Supersignal West Pico chemiluminescent substrate (Piercenet, Rockford,
Illinois) as per manufacturer’s instructions. Membranes were visualised using UVP bio-
imaging software (UVP Ltd, Cambridge, UK). Images were quantified using Photoshop 5.5
(Adobe Systems, San Jose, California) and expressed as relative intensity compared to
unstimulated cells.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Gelatin zymography
Supernatants collected at 96 hours were analysed by gelatin zymography for MMP-2/-9 as
previously described (23). For reversal experiments, media and stimulus was refreshed 48
hours into the 96 hour incubation period and MMP secretion measured in the 48-96 hour
samples versus the 48 hours post removal of TGF-β + TNF-α, so that the comparison of
MMP secretion could be made over the same time period. Standard aliquots of MMP-2/-9
were run on each gel to allow for relative quantification, which was performed using
Photoshop 5.5 (Adobe Systems, San Jose, California).
Immunofluorescence
The immunofluorescence protocol was adapted from those previously described (24,25).
NHEK cells were grown to 70-80% confluence in Nunc® glass 4-well chamber slides (Fisher
Scientific, Leicestershire, UK) and stimulated with TGF-β and/or TNF-α for 96 hours. Cells
were washed with PBS, fixed in 4% paraformaldehyde (PFA) for 15 minutes, and incubated
in PBS containing 3% BSA and 0.1% saponin for 30 minutes to permeabilise cells and block
non-specific antibody binding. Primary antibody was added for two hours (E-cadherin 1/500,
fibronectin 1/400) followed by washing and incubation for 1 hour with the appropriate
secondary antibody (Alexa Fluor 488 goat anti-mouse IgG and Alexa Fluor 594 goat anti-
rabbit IgG, Invitrogen, Paisley, UK). The cells were fixed and counter-stained using
Vectashield® with DAPI (Vector Laboratories, Peterborough, UK) and a coverslip was
mounted. A Zeiss microscope and camera was used to visualise and image fluorescence
(Carl Zeiss Ltd, Hertfordshire, UK).
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
ELISAs
TIMP-1 and TIMP-2 levels in cell culture supernatants (1:50 dilution) were measured by
ELISA as per manufacturer’s instructions and as previously published (22). The range of
detection for both TIMP-1 and -2 was 30-2000 pg/ml.
RT-PCR
Epithelial cells were lysed 24 hours after stimulation using Tri-Reagent (Sigma Aldrich,
Dorset, UK), and total RNA was extracted as previously described (26). cDNA was
synthesised using the First-Strand cDNA synthesis kit (Roche Diagnostics Ltd, West Sussex,
UK) as per manufacturer’s instructions. Collagen type 1, alpha 1 (COL1α1, forward primer –
CAGCCGCTTCACCTACAGC, reverse primer – TTTTGTATTCAATCACTGTCTTGCC)
gene expression was quantified by RT-PCR using the FastStart Universal SyberGreen-Rox
Mastermix (Roche Diagnostics Ltd, West Sussex, UK) and analysing samples with
Stratagene Mx3005P PCR system (Agilent Technologies, Ltd, Cheshire, UK). Gene
expression, calculated using Ct values for gene of interest (COL1α1) and house-keeping gene
(GAPDH, forward primer - GAAGGTGAAGGTCGGAGT, reverse primer -
GAGATGGTGATGGGATTTC), was represented as log-fold change compared to
unstimulated NHEK cells.
Statistical analysis
In vitro experiments were repeated a minimum of 3 times in triplicate. Using GraphPad
Prism 5, data were tested for normality: inter-group comparisons were made by t test or
ANOVA (with post-hoc Bonferroni method) for parametric data, and Mann-Whitney U or
Kruskall-Wallis tests for non-parametric data. A p value < 0.05 was considered statistically
significant.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Results
TGF-β +/- TNF-α induce EMT in NHEK cells
Unstimulated NHEK cells in culture were closely adherent and cuboidal in colonies with a
classical cobblestone appearance (Fig 1 a). When stimulated with TGF-β (10 ng/ml), cells
separated from each other; however, it was only when cells were co-stimulated with TGF-β
and TNF-α (both 10 ng/ml) that they developed an elongated spindle-shaped morphology
characteristic of a fibroblast-like cell. TNF-α alone had no effect on cellular morphology.
Changes in morphology with TGF-β + TNF-α were accompanied by protein changes
consistent with EMT. As evident in representative immunofluorescence images,
unstimulated epithelial cells stained positive for the membrane-bound protein E-cadherin, but
not the mesenchymal protein fibronectin (Fig 1 b-c). In response to TGF-β alone, there was
reduced E-cadherin and increased fibronectin. These changes were enhanced by the addition
of TNF-α, with cells staining predominantly for fibronectin with a marked decrease in E-
cadherin. These protein changes were confirmed by western blotting of cell lysates (Fig 1 d-
h). There was no statistically significant change in E-cadherin or Zo-1 with TGF-β and TNF-
α alone, but when NHEK cells were stimulated with TGF-β and TNF-α in combination, E-
cadherin and Zo-1 reduced by 58% and 44% , respectively (both p<0.05). TGF-β alone
induced a 2.1-fold and 4.3-fold rise in vimentin and fibronectin, respectively (both p<0.01)
and in combination with TNF-α induced a 2.3-fold and 5.4-fold rise in vimentin (p<0.01) and
fibronectin (p<0.001), respectively. No detectable α-SMA expression was observed in
NHEK cells following TGF-β and/or TNF-α stimulation for 96 hours (data not shown).
TGF-β and TNF-α drive MMP-2/-9 secretion and collagen expression by NHEK cells
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Following stimulation of NHEK cells for 96 hours with TGF-β and/or TNF-α (both 10 µg/ml)
cell supernatants were collected and analysed by gelatin zymography as described in
Methods. Unstimulated NHEK cells secreted minimal amounts of MMP-2 and -9 as
measured by gelatin zymography (Fig 2 a-c). TGF-β induced a 2.2-fold (p<0.05) increase in
MMP-2 secretion, which was unaffected by the addition of TNF-α (2.1 fold increase versus
unstimulated, p<0.05). TGF-β and TNF-α alone increased MMP-9 secretion by 4-fold (not
statistically significant) and 5-fold (p<0.05), respectively, whereas TGF-β and TNF-α in
combination increased MMP-9 in a synergistic manner (14-fold, p<0.001). TIMP-1 and -2
secretion by NHEK cells was measured to ensure that the increased MMP-2 and -9 activity in
response to TGF-β and TNF-α was functionally unopposed (data not shown). Basal TIMP-1
secretion was approximately 10-fold higher than TIMP-2 secretion. No change in TIMP-1 or
-2 levels were observed in stimulated cells versus controls. In addition, COL1α1 gene
expression was increased by 4.5-fold (p<0.01) and 4.4-fold (p<0.05) in response to TGF-β
alone and in combination with TNF-α, respectively (Fig 2 d).
TGF-β + TNF-α induced EMT in NHEK cells is dependent on SMAD and p38 signalling
Having demonstrated TGF-β + TNF-α-induced EMT in NHEK cells we studied the
intracellular signalling regulating this process. The combination of TGF-β + TNF-α (both 10
ng/ml) induced phosphorylation of SMAD-2, -3, and p38, all peaking at 60-120 minutes and
declining thereafter. There was no significant change in phosphorylation of ERK while
phosphorylated JNK was not detectable basally or upon stimulation (data not shown).
To identify if EMT was dependent on SMAD and p38 signalling, NHEK cells were pre-
treated with SB431542, a competitive ATP binding site kinase inhibitor that potently
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
attenuates TGFβRI activation (27), or SB203580, a chemical inhibitor of the p38 mitogen-
activated protein kinase (MAPK) pathway (28), for two hours prior to stimulation with TGF-
β + TNF-α. The effectiveness and specificity of SB431542 and SB203580 to inhibit SMAD
and p38 signalling respectively was measured by western blotting (data not shown).
SB431542 (10µM) completely attenuated TGF-β + TNF-α-mediated SMAD signalling but
also partially attenuated TGF-β + TNF-α-mediated p38 signalling. SB203580 (10µM)
completely attenuated p38 phosphorylation but had no effect on SMAD signalling. TGF-β +
TNF-α-mediated morphological changes in NHEK cells at 96 hours were completely
inhibited by SB431542 (10 µM), while SB203580 (10µM) only partially attenuated these
changes, with distinct areas of both classical epithelial colonies and fibroblast-like cells
evident within the same wells (Fig 3 a). An inhibition of E cadherin loss and fibronectin gain
with SB431542 was evident with immunofluorescence. SB203580 attenuated the fibronectin
gain but not the loss of E cadherin (Fig 3 b-c). These findings were also supported by
western blotting (Fig 3 d-h). The loss of E-cadherin (48%, p<0.001) and Zo-1 (32%, p<0.05)
induced by TGF-β + TNF-α was attenuated by 79 and 84%, respectively in the presence of
10μM SB431542. SB431542 also attenuated the gain in vimentin and fibronectin by 90 and
87%, respectively. In contrast, 10μM SB203580 did not inhibit TGF-β + TNF-α-mediated
loss of E-cadherin and Zo-1 or gain of vimentin, but did attenuate the gain of fibronectin by
62% (p<0.01).
SB431542 reverses established TGF-β + TNF-α-induced EMT in NHEK cells
Having shown that TGF-β + TNF-α-mediated EMT in keratinocytes can be attenuated by
SB431542, we next investigated whether SB431542 can reverse established EMT. EMT was
induced in keratinocytes by stimulation with TGF-β + TNF-α (both 10 ng/ml) for 96 hours at
which point the transformed cells were incubated with fresh media +/- 10 µM SB431542.
Morphological changes at 96 hours were partially reversed by removing the cytokine
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
stimulus and adding fresh media only for 48 hours (Fig 4 a). The majority of cells retained a
fibroblastic appearance, but distinct epithelial colonies also reformed. No significant reversal
of the E cadherin loss or fibronectin gain was evident with immunofluorescence (Fig 4 b, c).
A partial reversal of TGF-β + TNF-α-mediated Zo-1 loss was evident with fresh media using
western blotting (Fig 4 d, f); however, no reversal of the E-cadherin loss or fibronectin or
vimentin gain was observed (Fig 4 d, e, g, h). In contrast, when the TGF-β + TNF-α
stimulus was removed after 96 hours and SB431542 added for 48 hours complete reversal of
TGF-β + TNF-α-mediated EMT resulted. All cells redeveloped an epithelial cell morphology
and formed typical epithelial colonies (Fig 4 a). This was accompanied by a reversal of the
TGF-β + TNF-α-mediated protein changes, evident on immunofluorescence (Fig 4 b, c) and
western blotting (Fig 4 d-h). SB431542 reversed E-cadherin and Zo-1 loss by 70% (p<0.05)
and 88% (p<0.01), respectively, and fibronectin and vimentin gain by 56% and 57% (both
p<0.05), respectively).
TGF-β + TNF-α-mediated increases in MMP-9 but not MMP-2 were reversed by removing
the TGF-β + TNF-α stimulus and incubating the transformed cells for another 48 hours in
fresh media (50% decrease in MMP-9, p<0.01) (Fig 4 i-k). The addition of SB431542
significantly reversed TGF-β + TNF-α-mediated increases in MMP-9 and MMP-2 (55 and
66% decrease respectively, both p<0.01).
Discussion
The retained plasticity of pulmonary and renal epithelial cells and their ability to contribute
directly to human fibrotic disease via EMT is well defined over recent years (6-9). There is
however a paucity of data on the ability of keratinocytes to undergo EMT and in particular
the cytokines and signalling regulating this process, a greater understanding of which could
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
identify novel therapeutic targets for cutaneous fibrotic disease. The present study describes
for the first time the interaction of TGF-β and TNF-α in driving EMT in primary
keratinocytes. We have also shown that this process is dependent on SMAD signalling and
that inhibiting this pathway with SB431542 can prevent EMT, but more importantly can also
reverse established EMT. These findings provide novel insight into the plasticity of
keratinocytes and identify SMAD inhibition as a plausible therapeutic strategy for cutaneous
fibrotic disorders including scleroderma and hypertrophic scarring.
Previously, there was limited data demonstrating EMT in keratinocytes. Proliferation and
EMT of murine keratinocytes was observed with N-acetylglucosaminyltransferase, a
glycosyltransferase implicated in cancer metastasis (29,30). Partial EMT was observed in
the HaCaT keratinocyte cell line in response to TGF-β (13), changes enhanced following
transfected with mutant-Ras (12). TGF-β-induced EMT in NHEK cells only when the cells
were retrovirally transduced with ΔNp63α (31). A recent study reported a significant
increase in vimentin expression and MMP-9 secretion by NHEK cells with TGF-β or TNF-α
alone, but did not investigate their interaction of these cytokines (10). Increased MMP-9
secretion was also observed in the present study with TGF-β or TNF-α, but increased
vimentin was only observed with TGF-β. Importantly, complete transition from epithelial to
mesenchymal phenotype (defined by the development of a mesenchymal cell morphology
and protein expression, and increased MMP-2/9 secretion, and COL1α1) was only observed
when NHEK cells were stimulated with both cytokines in combination.
α-SMA expression is characteristic of myofibroblasts, which are phenotypically intermediate
between fibroblasts and smooth muscle cells. Co-expression on α-SMA and epithelial cell
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
markers has been observed in vivo in IPF (32) and in vitro in in primary bronchial epithelial
cells in response to TGF-β (19). In contrast, in the present study we did not observe α-SMA
expression following stimulation of NHEK cells with TGF-β and/or TNF-α for 96 hours.
This supports previous evidence in NHEK cells stimulated with TGF-β or TNF-α
independently (10). Importantly, as α-SMA is not expressed by normal fibroblasts, its
presence is not essential to define EMT. Nevertheless, this is an example of the difference in
EMT phenotype according to the organ of origin of the epithelial cells.
Despite a diverse range of implicated cytokines and signalling pathways in EMT, TGF-β-
mediated SMAD signalling is common to all the described processes (19,33). This is
supported by TGF-β-mediated murine models of lung and renal fibrosis where SMAD
knockout prevented EMT and subsequent fibrosis (31,32). TGF-β also activates other EMT-
relevant pathways, via both direct phosphorylation of non-SMAD proteins, and through the
interaction between SMADs and other signalling intermediates (34). The ability of TNF-α to
enhance TGF-β-mediated EMT has previously been reported in pulmonary epithelial cells
(4,26) and is likely to reflect a convergence on common signalling pathways. For instance,
p38 signalling is activated by both TGF-β (27) and TNF-α (28) and we found that inhibition
of this pathway with the specific chemical inhibitor SB203580 partially attenuated EMT in
NHEK cells in response to the combination of these cytokines.
In the present study, a significant attenuation and reversal of TGF-β and TNF-α-mediated
EMT in keratinocytes was observed with the inhibitor of TGFβRI activation SB431542.
SB431542 has been reported to be highly selective for SMAD signalling and did not inhibit
the activity of over 20 other studied protein kinases in one study; however, there is previous
evidence that it can partially attenuate p38 signalling at concentration comparable to those
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
used here (27,35-37). In the present study, we observed partial attenuation of p38 signalling
with SB431542 in addition to complete attenuation of SMAD signalling. This partial
inhibition of p38 may have contributed to the inhibitory effects of SB431542 on EMT;
however, the SMAD inhibition is still central, as complete inhibition of p38 with SB203580
only partially attenuates EMT.
Overexpression of TGF-β and TNF-α and activation of SMAD signalling is observed in
scleroderma skin (14,15,38) and cutaneous hypertrophic scarring (10,39,40). The
mechanisms by which these cytokines contribute to disease are unclear; however, the
induction of EMT in keratinocytes by TGF-β and TNF-α demonstrated here highlights EMT
as a plausible pathogenic mechanism. This suggests a potential therapeutic role for TGF-β
and/or TNF-α inhibition in the treatment of both disorders. This suggests a potential
therapeutic role for TGF-β and/or TNF-α inhibition in the treatment of both disorders.
Interestingly, although TGF-β inhibition prevented skin fibrosis in the graft-versus-host
disease and bleomycin-induced mouse models of scleroderma (41,42) a placebo-controlled
clinical trial evaluating a human antibody to TGF-β in scleroderma showed no evidence of
efficacy (43).
The reversibility of EMT described here supports previous observations in other epithelial
cell types that cell plasticity is retained following EMT. For instance, TGF-β-mediated EMT
in human airway epithelial cells is reversed by a TGF-β neutralising antibody (19). Hypoxia-
induced EMT in breast cancer epithelial cells is reversed by re-oxygenation (44). The present
study is the first to demonstrate reversal of established EMT (including cell morphology,
protein expression, and MMP secretion) with SB431542 in any epithelial cell type. This has
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
potentially important implications clinically, as it highlights SMAD inhibition as a plausible
therapeutic strategy for the prevention of cutaneous fibrosis, and possibly also the reversal of
established fibrotic disease.
The gelatinases (MMP-2 and -9) degrade collagen IV, the predominant component of the
basement membrane promoting cellular invasion into the mesenchyme as supported by the
over-expression of both in invasive cancers in vivo (45). This increased secretion of MMP-2
and -9 is an integral mechanism in EMT and has been demonstrated in vitro in numerous
epithelial cell types (4,10,46). In the present study, we observed a 14-fold increase in MMP-
9 secretion by NHEK cells stimulated with TGF-β and TNF-α accompanied by a more
modest increase in MMP-2 secretion (2-fold). Interestingly, in an animal model of renal
fibrosis, MMP-9 knockout alone prevented EMT and subsequent fibrosis suggesting that
increased MMP-9 secretion may be more important than MMP-2 in the EMT process (47).
Findings in the present study have some limitations. We studied keratinocyte monolayers
which do not address the contribution of other cell types and extracellular matrices to EMT.
We observed significant attenuation and reversal of EMT with SB431542 predominantly via
its effect on SMAD signalling; however, due to the complexity of signal transduction in
EMT, including crosstalk between pathways, it may be unrealistic to expect as dramatic a
response in vivo. In clinical practice, the simultaneous inhibition of several signalling
intermediates may be required to optimise therapeutic benefit (48). The contribution of EMT
to the pathogenesis of cutaneous fibrotic disorders such as scleroderma and hypertrophic
scarring also requires further investigation in vivo (in animal models and human) before the
role of SMAD inhibition as a therapeutic strategy can be explored.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
In conclusion, this study demonstrates that TGF-β and TNF-α interact to drive SMAD, and
less so p38, dependent EMT in primary keratinocytes. Furthermore, SB431542, a small
molecule which completely and partially attenuates SMAD and p38 signalling, respectively
can inhibit this process and reverse established EMT. These data highlight the retained
plasticity of adult keratinocytes and support further studies of EMT in clinically relevant in
vivo murine and human studies of cutaneous fibrosis, and investigation of SMAD inhibition
in particular as a potential therapeutic intervention.
Conflict of interest -
The authors of this manuscript have no conflicts of interest to disclose
Acknowledgements -
This work was funded by Health and Social Care, Research and Development Division,
Northern Ireland (D O’Kane, Research Training Fellowship, and CM O’Kane, Clinician
Scientist Fellowship) and Belfast Health and Social Care Trust
Author Contributions –
D O’Kane designed and performed the experiments, analysed the data and prepared the
manuscript along with C O’Kane. M Jackson performed optimisation work with inhibitors.
A Kissenpfennig assisted with cell culture. S Spence and L Damkat-Thomas assisted with
laboratory assays. J Tolland assisted with cell culture and provided guidance on clinical
relevance with A Smyth. C Denton provided expert advice on study design. D McAuley and
J Elborn contributed to design and manuscript preparation.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Figure legends
Figure 1. NHEK cells morphology and protein expression in response to TGF-β and/or
TNF-α. NHEK cells were stimulated for 96 hours with TGF-β and/or TNF-α (both 10 ng/ml).
(a) Changes in cell morphology were analysed by light microscopy. Cells were then fixed in
4% PFA or lysed in SDS lysis buffer for analysis by immunofluorescence or western blotting,
respectively. Representative immunofluorescence images demonstrate E-cadherin (b, red)
and fibronectin (c, green) protein expression in response to TGF-β and/or TNF-α.
Representative western blots (e) and quantification (f-i) demonstrate expression of E-
cadherin, Zo-1, vimentin and fibronectin. (Scale bar = 50 μm, ‘Both’ = TGF-β + TNF-α,
nuclei counter-stained with DAPI, error bars represent mean +/- SD, *p<0.05, **p<0.01,
***p<0.001, all n=6)
Figure 2. Effect of TGF-β and/or TNF-α on MMP-2/-9 secretion and COL1α1 gene
expression by NHEK cells. (a) NHEK cells were stimulated for 96 hours with TGF-β and/or
TNF-α (both 10 ng/ml). Supernatants were analysed by gelatin zymography to measure
secretion of MMP-2 and MMP-9 (representative zymograms, n=4) (b, c) Densitometric
quantification was carried out as described in Methods (d) COL1α1 gene expression was
measured by RT-PCR following stimulation of NHEK cells with TGF-β and/or TNF-α for 24
hours (n=3). (‘Both’ = TGF-β + TNF-α, error bars represent mean +/- SD, *p<0.05,
***p<0.001)
Figure 3. The ability of SB431542 and SB203580 to inhibit TGF-β + TNF-α mediated
EMT in NHEK cells. NHEK cells were stimulated with TGF-β + TNF-α (both 10 ng/ml) for
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
96 hours in the presence or absence of SB431542 and SB203580 (both 10 µM). (a)
Morphological changes at 96 hours were analysed by light microscopy. Representative
immunofluorescence images demonstrate E-cadherin (b, red) and fibronectin (c, green)
protein expression at 96 hours. Protein expression of E-cadherin, Zo-1, vimentin and
fibronectin was also measured by western blotting (d, representative blots and e-h
quantification). (Scale bar = 100 μm, nuclei counter-stained with DAPI, error bars represent
mean +/- SD, *p<0.05, **p<0.01, ***p<0.001, all n=4)
Figure 4. Reversibility of TGF-β + TNF-α-induced EMT in NHEK cells. EMT was
induced in NHEK by stimulation with TGF-β + TNF-α (both 10 ng/ml) for 96 hours. EMT
reversibility was assessed by removing the stimulus and incubating for a further 48 hours in
fresh media (M) only or media supplemented with 10 µM SB431542 (SB). (a) Morphological
changes were analysed by light microscopy. Representative immunofluorescence images
demonstrate E-cadherin (b, red) and fibronectin (c, green) protein expression. Changes in
protein expression of E-cadherin, Zo-1, vimentin and fibronectin are shown by (d)
representative western blots and (e-h) quantification. Changes in secretion of MMP-2 and -9
are shown by (i) representative zymogram and (j) quantification (all n=4, scale bars = 100
μm, ‘Both’ = TGF-β + TNF-α, nuclei counter-stained with DAPI, error bars represent mean
+/- SD)
References
(1) Kalluri R, Neilson EG. Epithelial-mesenchymal transition and its implications for fibrosis.
J Clin Invest 2003 Dec;112(12):1776-1784.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
(2) Lee JM, Dedhar S, Kalluri R, et al. The epithelial-mesenchymal transition: new insights in
signaling, development, and disease. J Cell Biol 2006 Mar 27;172(7):973-981.
(3) Nagase H, Woessner JF,Jr. Matrix metalloproteinases. J Biol Chem 1999 Jul
30;274(31):21491-21494.
(4) Camara J, Jarai G. Epithelial-mesenchymal transition in primary human bronchial
epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis
Tissue Repair 2010 Jan 5;3(1):2.
(5) Greenburg G, Hay ED. Epithelia suspended in collagen gels can lose polarity and express
characteristics of migrating mesenchymal cells. J Cell Biol 1982 Oct;95(1):333-339.
(6) Iwano M, Plieth D, Danoff TM, et al. Evidence that fibroblasts derive from epithelium
during tissue fibrosis. J Clin Invest 2002 Aug;110(3):341-350.
(7) Zeisberg M, Yang C, Martino M, et al. Fibroblasts derive from hepatocytes in liver
fibrosis via epithelial to mesenchymal transition. J Biol Chem 2007 Aug 10;282(32):23337-
23347.
(8) Kim KK, Kugler MC, Wolters PJ, et al. Alveolar epithelial cell mesenchymal transition
develops in vivo during pulmonary fibrosis and is regulated by the extracellular matrix. Proc
Natl Acad Sci U S A 2006 Aug 29;103(35):13180-13185.
(9) Robertson H, Kirby JA, Yip WW, et al. Biliary epithelial-mesenchymal transition in
posttransplantation recurrence of primary biliary cirrhosis. Hepatology 2007 Apr;45(4):977-
981.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
(10) Yan C, Grimm WA, Garner WL, et al. Epithelial to mesenchymal transition in human
skin wound healing is induced by tumor necrosis factor-alpha through bone morphogenic
protein-2. Am J Pathol 2010 May;176(5):2247-2258.
(11) Nakamura M, Tokura Y. Epithelial-mesenchymal transition in the skin. J Dermatol Sci
2011 Jan;61(1):7-13.
(12) Davies M, Robinson M, Smith E, et al. Induction of an epithelial to mesenchymal
transition in human immortal and malignant keratinocytes by TGF-beta1 involves MAPK,
Smad and AP-1 signalling pathways. J Cell Biochem 2005 Aug 1;95(5):918-931.
(13) Rasanen K, Vaheri A. TGF-beta1 causes epithelial-mesenchymal transition in HaCaT
derivatives, but induces expression of COX-2 and migration only in benign, not in malignant
keratinocytes. J Dermatol Sci 2010 May;58(2):97-104.
(14) Higley H, Persichitte K, Chu S, et al. Immunocytochemical localization and serologic
detection of transforming growth factor beta 1. Association with type I procollagen and
inflammatory cell markers in diffuse and limited systemic sclerosis, morphea, and Raynaud's
phenomenon. Arthritis Rheum 1994 Feb;37(2):278-288.
(15) Gruschwitz MS, Albrecht M, Vieth G, et al. In situ expression and serum levels of tumor
necrosis factor-alpha receptors in patients with early stages of systemic sclerosis. J
Rheumatol 1997 Oct;24(10):1936-1943.
(16) Zeisberg M, Tarnavski O, Zeisberg M, et al. Endothelial-to-mesenchymal transition
contributes to cardiac fibrosis. Nat Med 2007 Aug;13(8):952-961.
(17) Murray LA, Hackett TL, Warner SM, et al. BMP-7 does not protect against bleomycin-
induced lung or skin fibrosis. PLoS One 2008;3(12):e4039.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
(18) Yamauchi Y, Kohyama T, Takizawa H, et al. Tumor necrosis factor-alpha enhances both
epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar
epithelial cells by transforming growth factor-beta1. Exp Lung Res 2010 Feb;36(1):12-24.
(19) Hackett TL, Warner SM, Stefanowicz D, et al. Induction of epithelial-mesenchymal
transition in primary airway epithelial cells from patients with asthma by transforming
growth factor-beta1. Am J Respir Crit Care Med 2009 Jul 15;180(2):122-133.
(20) Matsushita T, Hasegawa M, Hamaguchi Y, et al. Longitudinal analysis of serum
cytokine concentrations in systemic sclerosis: association of interleukin 12 elevation with
spontaneous regression of skin sclerosis. J Rheumatol 2006 Feb;33(2):275-284.
(21) Sebe A, Leivonen SK, Fintha A, et al. Transforming growth factor-beta-induced alpha-
smooth muscle cell actin expression in renal proximal tubular cells is regulated by p38beta
mitogen-activated protein kinase, extracellular signal-regulated protein kinase1,2 and the
Smad signalling during epithelial-myofibroblast transdifferentiation. Nephrol Dial Transplant
2008 May;23(5):1537-1545.
(22) Elkington PT, Nuttall RK, Boyle JJ, et al. Mycobacterium tuberculosis, but not vaccine
BCG, specifically upregulates matrix metalloproteinase-1. Am J Respir Crit Care Med 2005
Dec 15;172(12):1596-1604.
(23) O'Kane CM, McKeown SW, Perkins GD, et al. Salbutamol up-regulates matrix
metalloproteinase-9 in the alveolar space in the acute respiratory distress syndrome. Crit Care
Med 2009 Jul;37(7):2242-2249.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
(24) Parker J, Sarlang S, Thavagnanam S, et al. A 3-D well-differentiated model of pediatric
bronchial epithelium demonstrates unstimulated morphological differences between
asthmatic and nonasthmatic cells. Pediatr Res 2010 Jan;67(1):17-22.
(25) Liu X, Lu L, Yang Z, et al. The neonatal FcR-mediated presentation of immune-
complexed antigen is associated with endosomal and phagosomal pH and antigen stability in
macrophages and dendritic cells. J Immunol 2011 Apr 15;186(8):4674-4686.
(26) Chomczynski P. A reagent for the single-step simultaneous isolation of RNA, DNA and
proteins from cell and tissue samples. BioTechniques 1993 Sep;15(3):532-4, 536-7.
(27) Inman GJ, Nicolas FJ, Callahan JF, et al. SB-431542 is a potent and specific inhibitor of
transforming growth factor-beta superfamily type I activin receptor-like kinase (ALK)
receptors ALK4, ALK5, and ALK7. Mol Pharmacol 2002 Jul;62(1):65-74.
(28) Badger AM, Cook MN, Lark MW, et al. SB 203580 inhibits p38 mitogen-activated
protein kinase, nitric oxide production, and inducible nitric oxide synthase in bovine
cartilage-derived chondrocytes. J Immunol 1998 Jul 1;161(1):467-473.
(29) Terao M, Ishikawa A, Nakahara S, et al. Enhanced epithelial-mesenchymal transition-
like phenotype in N-acetylglucosaminyltransferase V transgenic mouse skin promotes wound
healing. J Biol Chem 2011 Aug 12;286(32):28303-28311.
(30) Kimura A, Terao M, Kato A, et al. Upregulation of N-acetylglucosaminyltransferase-V
by heparin-binding EGF-like growth factor induces keratinocyte proliferation and epidermal
hyperplasia. Exp Dermatol 2012 Jul;21(7):515-519.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
(31) Oh JE, Kim RH, Shin KH, et al. DeltaNp63alpha protein triggers epithelial-
mesenchymal transition and confers stem cell properties in normal human keratinocytes. J
Biol Chem 2011 Nov 4;286(44):38757-38767.
(32) Willis BC, Liebler JM, Luby-Phelps K, et al. Induction of epithelial-mesenchymal
transition in alveolar epithelial cells by transforming growth factor-beta1: potential role in
idiopathic pulmonary fibrosis. Am J Pathol 2005 May;166(5):1321-1332.
(33) Kasai H, Allen JT, Mason RM, et al. TGF-β1 induces human alveolar epithelial to
mesenchymal cell transition (EMT). Respir Res 2005 Jun 9;6:56.
(34) Moustakas A, Heldin CH. Non-Smad TGF-beta signals. J Cell Sci 2005 Aug
15;118(16):3573-3584.
(35) Laping NJ, Grygielko E, Mathur A, et al. Inhibition of transforming growth factor
(TGF)-beta1-induced extracellular matrix with a novel inhibitor of the TGF-beta type I
receptor kinase activity: SB-431542. Mol Pharmacol 2002 Jul;62(1):58-64.
(36) Eyers PA, Craxton M, Morrice N, et al. Conversion of SB 203580-insensitive MAP
kinase family members to drug-sensitive forms by a single amino-acid substitution. Chem
Biol 1998 Jun;5(6):321-328.
(37) Davies SP, Reddy H, Caivano M, et al. Specificity and mechanism of action of some
commonly used protein kinase inhibitors. Biochem J 2000 Oct 1;351(Pt 1):95-105.
(38) Mori Y, Chen SJ, Varga J. Expression and regulation of intracellular SMAD signaling in
scleroderma skin fibroblasts. Arthritis Rheum 2003 Jul;48(7):1964-1978.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
(39) Xia W, Phan TT, Lim IJ, et al. Complex epithelial-mesenchymal interactions modulate
transforming growth factor-beta expression in keloid-derived cells. Wound Repair Regen
2004 Sep-Oct;12(5):546-556.
(40) Xie JL, Qi SH, Pan S, et al. Expression of Smad protein by normal skin fibroblasts and
hypertrophic scar fibroblasts in response to transforming growth factor beta1. Dermatol Surg
2008 Sep;34(9):1216-24; discussion 1224-5.
(41) Yamamoto T, Takagawa S, Katayama I, et al. Anti-sclerotic effect of transforming
growth factor-beta antibody in a mouse model of bleomycin-induced scleroderma. Clin
Immunol 1999 Jul;92(1):6-13.
(42) McCormick LL, Zhang Y, Tootell E, et al. Anti-TGF-β treatment prevents skin and
lung fibrosis in murine sclerodermatous graft-versus-host disease: a model for human
scleroderma. J Immunol 1999 Nov 15;163(10):5693-5699.
(43) Denton CP, Merkel PA, Furst DE, et al. Recombinant human anti-transforming growth
factor beta1 antibody therapy in systemic sclerosis: a multicenter, randomized, placebo-
controlled phase I/II trial of CAT-192. Arthritis Rheum 2007 Jan;56(1):323-333.
(44) Jo M, Lester RD, Montel V, et al. Reversibility of epithelial-mesenchymal transition
(EMT) induced in breast cancer cells by activation of urokinase receptor-dependent cell
signaling. J Biol Chem 2009 Aug 21;284(34):22825-22833.
(45) Kruger A, Fata JE, Khokha R. Altered tumor growth and metastasis of a T-cell
lymphoma in Timp-1 transgenic mice. Blood 1997 Sep 1;90(5):1993-2000.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
(46) Li Y, Yang J, Dai C, et al. Role for integrin-linked kinase in mediating tubular epithelial
to mesenchymal transition and renal interstitial fibrogenesis. J Clin Invest 2003
Aug;112(4):503-516.
(47) Wang X, Zhou Y, Tan R, et al. Mice lacking the matrix metalloproteinase-9 gene reduce
renal interstitial fibrosis in obstructive nephropathy. Am J Physiol Renal Physiol 2010
Nov;299(5):973-82.
(48) Faivre S, Djelloul S, Raymond E. New paradigms in anticancer therapy: targeting
multiple signaling pathways with kinase inhibitors. Semin Oncol 2006 Aug;33(4):407-420.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Recommended