SMAD inhibition attenuates epithelial to mesenchymal transition by primary keratinocytes in vitro

Acc

epte

d A

rtic

le

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/exd.12452

This article is protected by copyright. All rights reserved.

Received Date : 04-Nov-2013

Accepted Date : 16-May-2014

Article type : Regular Article

Title

SMAD inhibition attenuates epithelial to mesenchymal transition by primary keratinocytes in

vitro

Authors and institutions –

Donal O’Kane1, Megan V Jackson1, Adrien Kissenpfennig1, Shaun Spence1, Lindsay

Damkat-Thomas2, Julia P Tolland3, Anita E Smyth4, Christopher P Denton5, J Stuart Elborn1,

Daniel F McAuley1, Cecilia M O’Kane1

1Centre For Infection and Immunity, Queen’s University Belfast, Belfast, UK, BT9 7BL,

Departments of 2Plastic Surgery, 3Dermatology and 4Rheumatology, Ulster Hospital,

Dundonald, Belfast, UK, BT16 1RH, 5Centre for Rheumatology and Connective Tissue

Disease, University College London, University Street, London, UK, WC1E 6JF

Corresponding author -

Dr Cecilia O’Kane,

Centre for Infection and Immunity, Queen’s University Belfast, Belfast, UK, BT9 7BL

Acc

epte

d A

rtic

le


Tel – +44 28 90972039

Fax – +44 28 90972671

Email – [email protected]

Short title –

SMAD inhibition attenuates EMT in keratinocytes

Abbreviations –

Epithelial to mesenchymal transition (EMT); transforming growth factor-β (TGF-β); tumour

necrosis factor-α (TNF-α); normal human epidermal keratinocytes (NHEK); matrix

metalloproteinase (MMP); tissue inhibitors of metalloproteinases (TIMP);

Key words –

Epithelial to mesenchymal transition; EMT; keratinocyte; TGF-β; TNF-α;

Abstract

Epithelial to mesenchymal transition (EMT) is a process whereby epithelial cells undergo

transition to a mesenchymal phenotype and contribute directly to fibrotic disease. Recent

studies support a role for EMT in cutaneous fibrotic diseases including scleroderma and

hypertrophic scarring, though there is limited data on the cytokines and signalling

mechanisms regulating cutaneous EMT. We investigated the ability of TGF-β and TNF-α,

both over-expressed in cutaneous scleroderma and central mediators of EMT in other

epithelial cell types, to induce EMT in primary keratinocytes and studied the signalling

mechanisms regulating this process. TGF-β induced EMT in normal human epidermal

keratinocytes (NHEK cells) and this process was enhanced by TNF-α. EMT was

characterised by changes in morphology, proteome (down-regulation of E-cadherin and Zo-1,

Acc

epte

d A

rtic

le


and up-regulation of vimentin and fibronectin), MMP secretion and COL1α1 mRNA

expression. TGF-β and TNF-α in combination activated SMAD and p38 signalling in NHEK

cells. P38 inhibition with SB203580 partially attenuated EMT, whereas SMAD inhibition

using SB431542 significantly inhibited EMT and also reversed established EMT. These data

highlight the retained plasticity of adult keratinocytes and support further studies of EMT in

clinically relevant in vivo models of cutaneous fibrosis, and investigation of SMAD inhibition

as a potential therapeutic intervention.

Introduction

Epithelial to mesenchymal transition (EMT) is a process whereby polarised epithelial cells

undergo transition into motile mesenchymal cells. EMT is characterised by a loss in

epithelial cell-cell adhesion and polarity, and a gain in mesenchymal cell morphology and

proteome, with decreased epithelial markers including E-cadherin, Zo-1, and increased

mesenchymal markers such as vimentin and fibronectin (1,2). There is accompanying

increased secretion of matrix metalloproteinases (MMPs), including MMP-2 and -9, which

degrade collagen IV, the main component of the basement membrane, and aid the

development of a migratory phenotype (3,4).

Although initially described in embryogenesis (5), there is increasing evidence that epithelial

cells retain their plasticity into adulthood and that EMT is a pathogenic mechanism in organ

fibrosis. In animal models of renal, hepatic, and pulmonary fibrosis, 36%, 45%, and over

80% of fibroblasts within fibrotic foci, respectively, originated in the epithelium and EMT

has been demonstrated in vivo in human pulmonary and hepatic fibrotic disease (6-9). A

greater understanding of the molecular and cellular mechanisms that regulate EMT in fibrotic

disease could therefore identify novel therapeutic targets.

Acc

epte

d A

rtic

le


A role for EMT in cutaneous fibrotic disease is supported by mesenchymal protein

expression in the basal epidermis of human hypertrophic scars (10). In addition, increased

expression of SNAI1 and TWIST, transcription factors integral in the EMT process, has been

observed within scleroderma skin (11). There are however, limited data on the cytokines and

signalling pathways regulating cutaneous EMT. TGF-β induced an EMT-like phenotype in

the HaCaT skin epithelial cell line only when transfected with mutant-Ras in one study (12)

and induced partial EMT (loss of epithelial markers, but no gain in mesenchymal markers) in

another (13). More recently, stimulation of normal human keratinocytes and skin explants

with TGF-β and TNF-α independently was shown to induce features of EMT (10).

TGF-β and TNF-α interact to induce EMT in primary human bronchial epithelial cells in a

synergistic manner (4). This could have implications for the pathogenesis of cutaneous

scleroderma where both cytokines are over-expressed (14,15). This synergy cannot be

assumed to occur in the cutaneous epithelium however, as the regulation of EMT appears to

be tissue-specific. For instance, bone morphogenic protein (BMP)-7, a member of the TGF-β

superfamily, attenuates EMT and Endothelial-MT in mouse models of liver (7) and cardiac

(16) fibrosis, respectively, but does not attenuate murine bleomycin-induced pulmonary or

cutaneous fibrosis (17).

In this study, we investigated whether TGF-β and TNF-α interacted to drive EMT in primary

skin keratinocytes. We report for the first time that TNF-α potentiates TGF-β-induced

cutaneous EMT. We demonstrate that this interaction is dependent on SMAD-2/-3 and less

so p38 signalling and that SB431542, an inhibitor of TGFβRI activation, can prevent EMT.

More importantly, we have shown for the first time that targeted SMAD-2/-3 inhibition with

Acc

epte

d A

rtic

le


SB431542 can reverse established EMT. These data provide important insight into the

retained plasticity of keratinocytes into adulthood and identifies SMAD inhibition as a

potential therapeutic strategy for both prevention and treatment of cutaneous fibrotic disease.

Methods

Reagents

Recombinant human TGF-β and TNF-α were purchased from Peprotech EC (London, UK).

SB431542 and SB203580 were obtained from Sigma Aldrich (Dorset, UK). Antibodies to E-

cadherin, fibronectin, vimentin, α-smooth muscle actin (α-SMA), and β-actin were purchased

from Abcam (Cambridge, UK). The antibody to Zo-1 and fluorescent-conjugated secondary

antibodies (Alexa Fluor 488 and 594) were purchased from Invitrogen (Paisley, UK).

SMAD2/3, p38, JNK, and ERK antibodies were obtained from Cell Signaling Technologies

(New England Biolabs UK Ltd., Hertfordshire, UK) as were HRP-linked goat anti-mouse and

goat anti-rabbit IgG secondary antibodies.

Cell culture

NHEK cells at passage 2-4 were cultured in supplemented keratinocyte growth media-gold

(KGM-Gold) (both Lonza, Slough, UK), at 37°C and 5% CO2. Cells were grown to 70-80%

confluence and then stimulated with 10 ng/ml TGF-β and/or TNF-α for 96 hours for

investigation of protein changes of EMT. This concentration and timeframe was chosen

following a period of optimisation (cells were stimulated with 1-100 ng/ml of each cytokine

for 48-120 hours). Concentrations of TGF-β and TNF-α were also informed by previous

studies in other epithelial cell types (4,18,19). Of note, TGF-β concentrations were

comparable to those seen in vivo in scleroderma (20). NHEK cells were stimulated with

TGF-β and TNF-α in the presence or absence of SB431542 and SB203580, both of which

Acc

epte

d A

rtic

le


were used at a concentration of 10 μM, informed by previous studies and following a period

of optimisation (4,21). For reversal of EMT experiments, NHEK cells were stimulated with

TGF-β + TNF-α for 96 hours, then washed and incubated for a further 48 hours with fresh

KGM-Gold +/- 10 µM SB431542. For SMAD and MAP kinase phosphorylation

experiments, NHEK cells were stimulated with TGF-β and TNF-α for 0-8 hours in the

presence or absence of SB431542 or SB203580.

Western blotting

Western blots were carried out as previously described (22). NHEK cells were lysed with

pre-chilled SDS lysis buffer (62.5mM Tris pH 6.8, 2% SDS, 10% glycerol, 50mM DDT,

0.002% bromphenol blue). Lysates containing 50µg of protein (as calculated using a

Bradford assay) were heat-inactivated (1000C for 5 minutes) and loaded onto 6% (for Zo-1

and fibronectin) or 12% (for E-cadherin, vimentin, α-SMA, β-actin, and SMAD blots)

polyacrylamide gels, before resolving and transferring to nitrocellulose. After blocking in 1%

BSA (Sigma Aldrich, Dorset, UK) membranes were incubated overnight at 40C with primary

antibody (vimentin, α-SMA, and β-actin 1:500, Zo-1 and fibronectin 1:2000, E-cadherin

1:25000, total SMAD2/3, P38,ERK and JNK 1:1000, phospho-SMAD2/3, p38, ERK, and

JNK 1:2000), washed, and then incubated with secondary antibody for 1 hour at room

temperature. HRP-conjugated anti-mouse or rabbit antibody was added at 1/1000, before

developing with Supersignal West Pico chemiluminescent substrate (Piercenet, Rockford,

Illinois) as per manufacturer’s instructions. Membranes were visualised using UVP bio-

imaging software (UVP Ltd, Cambridge, UK). Images were quantified using Photoshop 5.5

(Adobe Systems, San Jose, California) and expressed as relative intensity compared to

unstimulated cells.

Acc

epte

d A

rtic

le


Gelatin zymography

Supernatants collected at 96 hours were analysed by gelatin zymography for MMP-2/-9 as

previously described (23). For reversal experiments, media and stimulus was refreshed 48

hours into the 96 hour incubation period and MMP secretion measured in the 48-96 hour

samples versus the 48 hours post removal of TGF-β + TNF-α, so that the comparison of

MMP secretion could be made over the same time period. Standard aliquots of MMP-2/-9

were run on each gel to allow for relative quantification, which was performed using

Photoshop 5.5 (Adobe Systems, San Jose, California).

Immunofluorescence

The immunofluorescence protocol was adapted from those previously described (24,25).

NHEK cells were grown to 70-80% confluence in Nunc® glass 4-well chamber slides (Fisher

Scientific, Leicestershire, UK) and stimulated with TGF-β and/or TNF-α for 96 hours. Cells

were washed with PBS, fixed in 4% paraformaldehyde (PFA) for 15 minutes, and incubated

in PBS containing 3% BSA and 0.1% saponin for 30 minutes to permeabilise cells and block

non-specific antibody binding. Primary antibody was added for two hours (E-cadherin 1/500,

fibronectin 1/400) followed by washing and incubation for 1 hour with the appropriate

secondary antibody (Alexa Fluor 488 goat anti-mouse IgG and Alexa Fluor 594 goat anti-

rabbit IgG, Invitrogen, Paisley, UK). The cells were fixed and counter-stained using

Vectashield® with DAPI (Vector Laboratories, Peterborough, UK) and a coverslip was

mounted. A Zeiss microscope and camera was used to visualise and image fluorescence

(Carl Zeiss Ltd, Hertfordshire, UK).

Acc

epte

d A

rtic

le


ELISAs

TIMP-1 and TIMP-2 levels in cell culture supernatants (1:50 dilution) were measured by

ELISA as per manufacturer’s instructions and as previously published (22). The range of

detection for both TIMP-1 and -2 was 30-2000 pg/ml.

RT-PCR

Epithelial cells were lysed 24 hours after stimulation using Tri-Reagent (Sigma Aldrich,

Dorset, UK), and total RNA was extracted as previously described (26). cDNA was

synthesised using the First-Strand cDNA synthesis kit (Roche Diagnostics Ltd, West Sussex,

UK) as per manufacturer’s instructions. Collagen type 1, alpha 1 (COL1α1, forward primer –

CAGCCGCTTCACCTACAGC, reverse primer – TTTTGTATTCAATCACTGTCTTGCC)

gene expression was quantified by RT-PCR using the FastStart Universal SyberGreen-Rox

Mastermix (Roche Diagnostics Ltd, West Sussex, UK) and analysing samples with

Stratagene Mx3005P PCR system (Agilent Technologies, Ltd, Cheshire, UK). Gene

expression, calculated using Ct values for gene of interest (COL1α1) and house-keeping gene

(GAPDH, forward primer - GAAGGTGAAGGTCGGAGT, reverse primer -

GAGATGGTGATGGGATTTC), was represented as log-fold change compared to

unstimulated NHEK cells.

Statistical analysis

In vitro experiments were repeated a minimum of 3 times in triplicate. Using GraphPad

Prism 5, data were tested for normality: inter-group comparisons were made by t test or

ANOVA (with post-hoc Bonferroni method) for parametric data, and Mann-Whitney U or

Kruskall-Wallis tests for non-parametric data. A p value < 0.05 was considered statistically

significant.

Acc

epte

d A

rtic

le


Results

TGF-β +/- TNF-α induce EMT in NHEK cells

Unstimulated NHEK cells in culture were closely adherent and cuboidal in colonies with a

classical cobblestone appearance (Fig 1 a). When stimulated with TGF-β (10 ng/ml), cells

separated from each other; however, it was only when cells were co-stimulated with TGF-β

and TNF-α (both 10 ng/ml) that they developed an elongated spindle-shaped morphology

characteristic of a fibroblast-like cell. TNF-α alone had no effect on cellular morphology.

Changes in morphology with TGF-β + TNF-α were accompanied by protein changes

consistent with EMT. As evident in representative immunofluorescence images,

unstimulated epithelial cells stained positive for the membrane-bound protein E-cadherin, but

not the mesenchymal protein fibronectin (Fig 1 b-c). In response to TGF-β alone, there was

reduced E-cadherin and increased fibronectin. These changes were enhanced by the addition

of TNF-α, with cells staining predominantly for fibronectin with a marked decrease in E-

cadherin. These protein changes were confirmed by western blotting of cell lysates (Fig 1 d-

h). There was no statistically significant change in E-cadherin or Zo-1 with TGF-β and TNF-

α alone, but when NHEK cells were stimulated with TGF-β and TNF-α in combination, E-

cadherin and Zo-1 reduced by 58% and 44% , respectively (both p<0.05). TGF-β alone

induced a 2.1-fold and 4.3-fold rise in vimentin and fibronectin, respectively (both p<0.01)

and in combination with TNF-α induced a 2.3-fold and 5.4-fold rise in vimentin (p<0.01) and

fibronectin (p<0.001), respectively. No detectable α-SMA expression was observed in

NHEK cells following TGF-β and/or TNF-α stimulation for 96 hours (data not shown).

TGF-β and TNF-α drive MMP-2/-9 secretion and collagen expression by NHEK cells

Acc

epte

d A

rtic

le


Following stimulation of NHEK cells for 96 hours with TGF-β and/or TNF-α (both 10 µg/ml)

cell supernatants were collected and analysed by gelatin zymography as described in

Methods. Unstimulated NHEK cells secreted minimal amounts of MMP-2 and -9 as

measured by gelatin zymography (Fig 2 a-c). TGF-β induced a 2.2-fold (p<0.05) increase in

MMP-2 secretion, which was unaffected by the addition of TNF-α (2.1 fold increase versus

unstimulated, p<0.05). TGF-β and TNF-α alone increased MMP-9 secretion by 4-fold (not

statistically significant) and 5-fold (p<0.05), respectively, whereas TGF-β and TNF-α in

combination increased MMP-9 in a synergistic manner (14-fold, p<0.001). TIMP-1 and -2

secretion by NHEK cells was measured to ensure that the increased MMP-2 and -9 activity in

response to TGF-β and TNF-α was functionally unopposed (data not shown). Basal TIMP-1

secretion was approximately 10-fold higher than TIMP-2 secretion. No change in TIMP-1 or

-2 levels were observed in stimulated cells versus controls. In addition, COL1α1 gene

expression was increased by 4.5-fold (p<0.01) and 4.4-fold (p<0.05) in response to TGF-β

alone and in combination with TNF-α, respectively (Fig 2 d).

TGF-β + TNF-α induced EMT in NHEK cells is dependent on SMAD and p38 signalling

Having demonstrated TGF-β + TNF-α-induced EMT in NHEK cells we studied the

intracellular signalling regulating this process. The combination of TGF-β + TNF-α (both 10

ng/ml) induced phosphorylation of SMAD-2, -3, and p38, all peaking at 60-120 minutes and

declining thereafter. There was no significant change in phosphorylation of ERK while

phosphorylated JNK was not detectable basally or upon stimulation (data not shown).

To identify if EMT was dependent on SMAD and p38 signalling, NHEK cells were pre-

treated with SB431542, a competitive ATP binding site kinase inhibitor that potently

Acc

epte

d A

rtic

le


attenuates TGFβRI activation (27), or SB203580, a chemical inhibitor of the p38 mitogen-

activated protein kinase (MAPK) pathway (28), for two hours prior to stimulation with TGF-

β + TNF-α. The effectiveness and specificity of SB431542 and SB203580 to inhibit SMAD

and p38 signalling respectively was measured by western blotting (data not shown).

SB431542 (10µM) completely attenuated TGF-β + TNF-α-mediated SMAD signalling but

also partially attenuated TGF-β + TNF-α-mediated p38 signalling. SB203580 (10µM)

completely attenuated p38 phosphorylation but had no effect on SMAD signalling. TGF-β +

TNF-α-mediated morphological changes in NHEK cells at 96 hours were completely

inhibited by SB431542 (10 µM), while SB203580 (10µM) only partially attenuated these

changes, with distinct areas of both classical epithelial colonies and fibroblast-like cells

evident within the same wells (Fig 3 a). An inhibition of E cadherin loss and fibronectin gain

with SB431542 was evident with immunofluorescence. SB203580 attenuated the fibronectin

gain but not the loss of E cadherin (Fig 3 b-c). These findings were also supported by

western blotting (Fig 3 d-h). The loss of E-cadherin (48%, p<0.001) and Zo-1 (32%, p<0.05)

induced by TGF-β + TNF-α was attenuated by 79 and 84%, respectively in the presence of

10μM SB431542. SB431542 also attenuated the gain in vimentin and fibronectin by 90 and

87%, respectively. In contrast, 10μM SB203580 did not inhibit TGF-β + TNF-α-mediated

loss of E-cadherin and Zo-1 or gain of vimentin, but did attenuate the gain of fibronectin by

62% (p<0.01).

SB431542 reverses established TGF-β + TNF-α-induced EMT in NHEK cells

Having shown that TGF-β + TNF-α-mediated EMT in keratinocytes can be attenuated by

SB431542, we next investigated whether SB431542 can reverse established EMT. EMT was

induced in keratinocytes by stimulation with TGF-β + TNF-α (both 10 ng/ml) for 96 hours at

which point the transformed cells were incubated with fresh media +/- 10 µM SB431542.

Morphological changes at 96 hours were partially reversed by removing the cytokine

Acc

epte

d A

rtic

le


stimulus and adding fresh media only for 48 hours (Fig 4 a). The majority of cells retained a

fibroblastic appearance, but distinct epithelial colonies also reformed. No significant reversal

of the E cadherin loss or fibronectin gain was evident with immunofluorescence (Fig 4 b, c).

A partial reversal of TGF-β + TNF-α-mediated Zo-1 loss was evident with fresh media using

western blotting (Fig 4 d, f); however, no reversal of the E-cadherin loss or fibronectin or

vimentin gain was observed (Fig 4 d, e, g, h). In contrast, when the TGF-β + TNF-α

stimulus was removed after 96 hours and SB431542 added for 48 hours complete reversal of

TGF-β + TNF-α-mediated EMT resulted. All cells redeveloped an epithelial cell morphology

and formed typical epithelial colonies (Fig 4 a). This was accompanied by a reversal of the

TGF-β + TNF-α-mediated protein changes, evident on immunofluorescence (Fig 4 b, c) and

western blotting (Fig 4 d-h). SB431542 reversed E-cadherin and Zo-1 loss by 70% (p<0.05)

and 88% (p<0.01), respectively, and fibronectin and vimentin gain by 56% and 57% (both

p<0.05), respectively).

TGF-β + TNF-α-mediated increases in MMP-9 but not MMP-2 were reversed by removing

the TGF-β + TNF-α stimulus and incubating the transformed cells for another 48 hours in

fresh media (50% decrease in MMP-9, p<0.01) (Fig 4 i-k). The addition of SB431542

significantly reversed TGF-β + TNF-α-mediated increases in MMP-9 and MMP-2 (55 and

66% decrease respectively, both p<0.01).

Discussion

The retained plasticity of pulmonary and renal epithelial cells and their ability to contribute

directly to human fibrotic disease via EMT is well defined over recent years (6-9). There is

however a paucity of data on the ability of keratinocytes to undergo EMT and in particular

the cytokines and signalling regulating this process, a greater understanding of which could

Acc

epte

d A

rtic

le


identify novel therapeutic targets for cutaneous fibrotic disease. The present study describes

for the first time the interaction of TGF-β and TNF-α in driving EMT in primary

keratinocytes. We have also shown that this process is dependent on SMAD signalling and

that inhibiting this pathway with SB431542 can prevent EMT, but more importantly can also

reverse established EMT. These findings provide novel insight into the plasticity of

keratinocytes and identify SMAD inhibition as a plausible therapeutic strategy for cutaneous

fibrotic disorders including scleroderma and hypertrophic scarring.

Previously, there was limited data demonstrating EMT in keratinocytes. Proliferation and

EMT of murine keratinocytes was observed with N-acetylglucosaminyltransferase, a

glycosyltransferase implicated in cancer metastasis (29,30). Partial EMT was observed in

the HaCaT keratinocyte cell line in response to TGF-β (13), changes enhanced following

transfected with mutant-Ras (12). TGF-β-induced EMT in NHEK cells only when the cells

were retrovirally transduced with ΔNp63α (31). A recent study reported a significant

increase in vimentin expression and MMP-9 secretion by NHEK cells with TGF-β or TNF-α

alone, but did not investigate their interaction of these cytokines (10). Increased MMP-9

secretion was also observed in the present study with TGF-β or TNF-α, but increased

vimentin was only observed with TGF-β. Importantly, complete transition from epithelial to

mesenchymal phenotype (defined by the development of a mesenchymal cell morphology

and protein expression, and increased MMP-2/9 secretion, and COL1α1) was only observed

when NHEK cells were stimulated with both cytokines in combination.

α-SMA expression is characteristic of myofibroblasts, which are phenotypically intermediate

between fibroblasts and smooth muscle cells. Co-expression on α-SMA and epithelial cell

Acc

epte

d A

rtic

le


markers has been observed in vivo in IPF (32) and in vitro in in primary bronchial epithelial

cells in response to TGF-β (19). In contrast, in the present study we did not observe α-SMA

expression following stimulation of NHEK cells with TGF-β and/or TNF-α for 96 hours.

This supports previous evidence in NHEK cells stimulated with TGF-β or TNF-α

independently (10). Importantly, as α-SMA is not expressed by normal fibroblasts, its

presence is not essential to define EMT. Nevertheless, this is an example of the difference in

EMT phenotype according to the organ of origin of the epithelial cells.

Despite a diverse range of implicated cytokines and signalling pathways in EMT, TGF-β-

mediated SMAD signalling is common to all the described processes (19,33). This is

supported by TGF-β-mediated murine models of lung and renal fibrosis where SMAD

knockout prevented EMT and subsequent fibrosis (31,32). TGF-β also activates other EMT-

relevant pathways, via both direct phosphorylation of non-SMAD proteins, and through the

interaction between SMADs and other signalling intermediates (34). The ability of TNF-α to

enhance TGF-β-mediated EMT has previously been reported in pulmonary epithelial cells

(4,26) and is likely to reflect a convergence on common signalling pathways. For instance,

p38 signalling is activated by both TGF-β (27) and TNF-α (28) and we found that inhibition

of this pathway with the specific chemical inhibitor SB203580 partially attenuated EMT in

NHEK cells in response to the combination of these cytokines.

In the present study, a significant attenuation and reversal of TGF-β and TNF-α-mediated

EMT in keratinocytes was observed with the inhibitor of TGFβRI activation SB431542.

SB431542 has been reported to be highly selective for SMAD signalling and did not inhibit

the activity of over 20 other studied protein kinases in one study; however, there is previous

evidence that it can partially attenuate p38 signalling at concentration comparable to those

Acc

epte

d A

rtic

le


used here (27,35-37). In the present study, we observed partial attenuation of p38 signalling

with SB431542 in addition to complete attenuation of SMAD signalling. This partial

inhibition of p38 may have contributed to the inhibitory effects of SB431542 on EMT;

however, the SMAD inhibition is still central, as complete inhibition of p38 with SB203580

only partially attenuates EMT.

Overexpression of TGF-β and TNF-α and activation of SMAD signalling is observed in

scleroderma skin (14,15,38) and cutaneous hypertrophic scarring (10,39,40). The

mechanisms by which these cytokines contribute to disease are unclear; however, the

induction of EMT in keratinocytes by TGF-β and TNF-α demonstrated here highlights EMT

as a plausible pathogenic mechanism. This suggests a potential therapeutic role for TGF-β

and/or TNF-α inhibition in the treatment of both disorders. This suggests a potential

therapeutic role for TGF-β and/or TNF-α inhibition in the treatment of both disorders.

Interestingly, although TGF-β inhibition prevented skin fibrosis in the graft-versus-host

disease and bleomycin-induced mouse models of scleroderma (41,42) a placebo-controlled

clinical trial evaluating a human antibody to TGF-β in scleroderma showed no evidence of

efficacy (43).

The reversibility of EMT described here supports previous observations in other epithelial

cell types that cell plasticity is retained following EMT. For instance, TGF-β-mediated EMT

in human airway epithelial cells is reversed by a TGF-β neutralising antibody (19). Hypoxia-

induced EMT in breast cancer epithelial cells is reversed by re-oxygenation (44). The present

study is the first to demonstrate reversal of established EMT (including cell morphology,

protein expression, and MMP secretion) with SB431542 in any epithelial cell type. This has

Acc

epte

d A

rtic

le


potentially important implications clinically, as it highlights SMAD inhibition as a plausible

therapeutic strategy for the prevention of cutaneous fibrosis, and possibly also the reversal of

established fibrotic disease.

The gelatinases (MMP-2 and -9) degrade collagen IV, the predominant component of the

basement membrane promoting cellular invasion into the mesenchyme as supported by the

over-expression of both in invasive cancers in vivo (45). This increased secretion of MMP-2

and -9 is an integral mechanism in EMT and has been demonstrated in vitro in numerous

epithelial cell types (4,10,46). In the present study, we observed a 14-fold increase in MMP-

9 secretion by NHEK cells stimulated with TGF-β and TNF-α accompanied by a more

modest increase in MMP-2 secretion (2-fold). Interestingly, in an animal model of renal

fibrosis, MMP-9 knockout alone prevented EMT and subsequent fibrosis suggesting that

increased MMP-9 secretion may be more important than MMP-2 in the EMT process (47).

Findings in the present study have some limitations. We studied keratinocyte monolayers

which do not address the contribution of other cell types and extracellular matrices to EMT.

We observed significant attenuation and reversal of EMT with SB431542 predominantly via

its effect on SMAD signalling; however, due to the complexity of signal transduction in

EMT, including crosstalk between pathways, it may be unrealistic to expect as dramatic a

response in vivo. In clinical practice, the simultaneous inhibition of several signalling

intermediates may be required to optimise therapeutic benefit (48). The contribution of EMT

to the pathogenesis of cutaneous fibrotic disorders such as scleroderma and hypertrophic

scarring also requires further investigation in vivo (in animal models and human) before the

role of SMAD inhibition as a therapeutic strategy can be explored.

Acc

epte

d A

rtic

le


In conclusion, this study demonstrates that TGF-β and TNF-α interact to drive SMAD, and

less so p38, dependent EMT in primary keratinocytes. Furthermore, SB431542, a small

molecule which completely and partially attenuates SMAD and p38 signalling, respectively

can inhibit this process and reverse established EMT. These data highlight the retained

plasticity of adult keratinocytes and support further studies of EMT in clinically relevant in

vivo murine and human studies of cutaneous fibrosis, and investigation of SMAD inhibition

in particular as a potential therapeutic intervention.

Conflict of interest -

The authors of this manuscript have no conflicts of interest to disclose

Acknowledgements -

This work was funded by Health and Social Care, Research and Development Division,

Northern Ireland (D O’Kane, Research Training Fellowship, and CM O’Kane, Clinician

Scientist Fellowship) and Belfast Health and Social Care Trust

Author Contributions –

D O’Kane designed and performed the experiments, analysed the data and prepared the

manuscript along with C O’Kane. M Jackson performed optimisation work with inhibitors.

A Kissenpfennig assisted with cell culture. S Spence and L Damkat-Thomas assisted with

laboratory assays. J Tolland assisted with cell culture and provided guidance on clinical

relevance with A Smyth. C Denton provided expert advice on study design. D McAuley and

J Elborn contributed to design and manuscript preparation.

Acc

epte

d A

rtic

le


Figure legends

Figure 1. NHEK cells morphology and protein expression in response to TGF-β and/or

TNF-α. NHEK cells were stimulated for 96 hours with TGF-β and/or TNF-α (both 10 ng/ml).

(a) Changes in cell morphology were analysed by light microscopy. Cells were then fixed in

4% PFA or lysed in SDS lysis buffer for analysis by immunofluorescence or western blotting,

respectively. Representative immunofluorescence images demonstrate E-cadherin (b, red)

and fibronectin (c, green) protein expression in response to TGF-β and/or TNF-α.

Representative western blots (e) and quantification (f-i) demonstrate expression of E-

cadherin, Zo-1, vimentin and fibronectin. (Scale bar = 50 μm, ‘Both’ = TGF-β + TNF-α,

nuclei counter-stained with DAPI, error bars represent mean +/- SD, *p<0.05, **p<0.01,

***p<0.001, all n=6)

Figure 2. Effect of TGF-β and/or TNF-α on MMP-2/-9 secretion and COL1α1 gene

expression by NHEK cells. (a) NHEK cells were stimulated for 96 hours with TGF-β and/or

TNF-α (both 10 ng/ml). Supernatants were analysed by gelatin zymography to measure

secretion of MMP-2 and MMP-9 (representative zymograms, n=4) (b, c) Densitometric

quantification was carried out as described in Methods (d) COL1α1 gene expression was

measured by RT-PCR following stimulation of NHEK cells with TGF-β and/or TNF-α for 24

hours (n=3). (‘Both’ = TGF-β + TNF-α, error bars represent mean +/- SD, *p<0.05,

***p<0.001)

Figure 3. The ability of SB431542 and SB203580 to inhibit TGF-β + TNF-α mediated

EMT in NHEK cells. NHEK cells were stimulated with TGF-β + TNF-α (both 10 ng/ml) for

Acc

epte

d A

rtic

le


96 hours in the presence or absence of SB431542 and SB203580 (both 10 µM). (a)

Morphological changes at 96 hours were analysed by light microscopy. Representative

immunofluorescence images demonstrate E-cadherin (b, red) and fibronectin (c, green)

protein expression at 96 hours. Protein expression of E-cadherin, Zo-1, vimentin and

fibronectin was also measured by western blotting (d, representative blots and e-h

quantification). (Scale bar = 100 μm, nuclei counter-stained with DAPI, error bars represent

mean +/- SD, *p<0.05, **p<0.01, ***p<0.001, all n=4)

Figure 4. Reversibility of TGF-β + TNF-α-induced EMT in NHEK cells. EMT was

induced in NHEK by stimulation with TGF-β + TNF-α (both 10 ng/ml) for 96 hours. EMT

reversibility was assessed by removing the stimulus and incubating for a further 48 hours in

fresh media (M) only or media supplemented with 10 µM SB431542 (SB). (a) Morphological

changes were analysed by light microscopy. Representative immunofluorescence images

demonstrate E-cadherin (b, red) and fibronectin (c, green) protein expression. Changes in

protein expression of E-cadherin, Zo-1, vimentin and fibronectin are shown by (d)

representative western blots and (e-h) quantification. Changes in secretion of MMP-2 and -9

are shown by (i) representative zymogram and (j) quantification (all n=4, scale bars = 100

μm, ‘Both’ = TGF-β + TNF-α, nuclei counter-stained with DAPI, error bars represent mean

+/- SD)

References

(1) Kalluri R, Neilson EG. Epithelial-mesenchymal transition and its implications for fibrosis.

J Clin Invest 2003 Dec;112(12):1776-1784.

Acc

epte

d A

rtic

le


(2) Lee JM, Dedhar S, Kalluri R, et al. The epithelial-mesenchymal transition: new insights in

signaling, development, and disease. J Cell Biol 2006 Mar 27;172(7):973-981.

(3) Nagase H, Woessner JF,Jr. Matrix metalloproteinases. J Biol Chem 1999 Jul

30;274(31):21491-21494.

(4) Camara J, Jarai G. Epithelial-mesenchymal transition in primary human bronchial

epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis

Tissue Repair 2010 Jan 5;3(1):2.

(5) Greenburg G, Hay ED. Epithelia suspended in collagen gels can lose polarity and express

characteristics of migrating mesenchymal cells. J Cell Biol 1982 Oct;95(1):333-339.

(6) Iwano M, Plieth D, Danoff TM, et al. Evidence that fibroblasts derive from epithelium

during tissue fibrosis. J Clin Invest 2002 Aug;110(3):341-350.

(7) Zeisberg M, Yang C, Martino M, et al. Fibroblasts derive from hepatocytes in liver

fibrosis via epithelial to mesenchymal transition. J Biol Chem 2007 Aug 10;282(32):23337-

23347.

(8) Kim KK, Kugler MC, Wolters PJ, et al. Alveolar epithelial cell mesenchymal transition

develops in vivo during pulmonary fibrosis and is regulated by the extracellular matrix. Proc

Natl Acad Sci U S A 2006 Aug 29;103(35):13180-13185.

(9) Robertson H, Kirby JA, Yip WW, et al. Biliary epithelial-mesenchymal transition in

posttransplantation recurrence of primary biliary cirrhosis. Hepatology 2007 Apr;45(4):977-

981.

Acc

epte

d A

rtic

le


(10) Yan C, Grimm WA, Garner WL, et al. Epithelial to mesenchymal transition in human

skin wound healing is induced by tumor necrosis factor-alpha through bone morphogenic

protein-2. Am J Pathol 2010 May;176(5):2247-2258.

(11) Nakamura M, Tokura Y. Epithelial-mesenchymal transition in the skin. J Dermatol Sci

2011 Jan;61(1):7-13.

(12) Davies M, Robinson M, Smith E, et al. Induction of an epithelial to mesenchymal

transition in human immortal and malignant keratinocytes by TGF-beta1 involves MAPK,

Smad and AP-1 signalling pathways. J Cell Biochem 2005 Aug 1;95(5):918-931.

(13) Rasanen K, Vaheri A. TGF-beta1 causes epithelial-mesenchymal transition in HaCaT

derivatives, but induces expression of COX-2 and migration only in benign, not in malignant

keratinocytes. J Dermatol Sci 2010 May;58(2):97-104.

(14) Higley H, Persichitte K, Chu S, et al. Immunocytochemical localization and serologic

detection of transforming growth factor beta 1. Association with type I procollagen and

inflammatory cell markers in diffuse and limited systemic sclerosis, morphea, and Raynaud's

phenomenon. Arthritis Rheum 1994 Feb;37(2):278-288.

(15) Gruschwitz MS, Albrecht M, Vieth G, et al. In situ expression and serum levels of tumor

necrosis factor-alpha receptors in patients with early stages of systemic sclerosis. J

Rheumatol 1997 Oct;24(10):1936-1943.

(16) Zeisberg M, Tarnavski O, Zeisberg M, et al. Endothelial-to-mesenchymal transition

contributes to cardiac fibrosis. Nat Med 2007 Aug;13(8):952-961.

(17) Murray LA, Hackett TL, Warner SM, et al. BMP-7 does not protect against bleomycin-

induced lung or skin fibrosis. PLoS One 2008;3(12):e4039.

Acc

epte

d A

rtic

le


(18) Yamauchi Y, Kohyama T, Takizawa H, et al. Tumor necrosis factor-alpha enhances both

epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar

epithelial cells by transforming growth factor-beta1. Exp Lung Res 2010 Feb;36(1):12-24.

(19) Hackett TL, Warner SM, Stefanowicz D, et al. Induction of epithelial-mesenchymal

transition in primary airway epithelial cells from patients with asthma by transforming

growth factor-beta1. Am J Respir Crit Care Med 2009 Jul 15;180(2):122-133.

(20) Matsushita T, Hasegawa M, Hamaguchi Y, et al. Longitudinal analysis of serum

cytokine concentrations in systemic sclerosis: association of interleukin 12 elevation with

spontaneous regression of skin sclerosis. J Rheumatol 2006 Feb;33(2):275-284.

(21) Sebe A, Leivonen SK, Fintha A, et al. Transforming growth factor-beta-induced alpha-

smooth muscle cell actin expression in renal proximal tubular cells is regulated by p38beta

mitogen-activated protein kinase, extracellular signal-regulated protein kinase1,2 and the

Smad signalling during epithelial-myofibroblast transdifferentiation. Nephrol Dial Transplant

2008 May;23(5):1537-1545.

(22) Elkington PT, Nuttall RK, Boyle JJ, et al. Mycobacterium tuberculosis, but not vaccine

BCG, specifically upregulates matrix metalloproteinase-1. Am J Respir Crit Care Med 2005

Dec 15;172(12):1596-1604.

(23) O'Kane CM, McKeown SW, Perkins GD, et al. Salbutamol up-regulates matrix

metalloproteinase-9 in the alveolar space in the acute respiratory distress syndrome. Crit Care

Med 2009 Jul;37(7):2242-2249.

Acc

epte

d A

rtic

le


(24) Parker J, Sarlang S, Thavagnanam S, et al. A 3-D well-differentiated model of pediatric

bronchial epithelium demonstrates unstimulated morphological differences between

asthmatic and nonasthmatic cells. Pediatr Res 2010 Jan;67(1):17-22.

(25) Liu X, Lu L, Yang Z, et al. The neonatal FcR-mediated presentation of immune-

complexed antigen is associated with endosomal and phagosomal pH and antigen stability in

macrophages and dendritic cells. J Immunol 2011 Apr 15;186(8):4674-4686.

(26) Chomczynski P. A reagent for the single-step simultaneous isolation of RNA, DNA and

proteins from cell and tissue samples. BioTechniques 1993 Sep;15(3):532-4, 536-7.

(27) Inman GJ, Nicolas FJ, Callahan JF, et al. SB-431542 is a potent and specific inhibitor of

transforming growth factor-beta superfamily type I activin receptor-like kinase (ALK)

receptors ALK4, ALK5, and ALK7. Mol Pharmacol 2002 Jul;62(1):65-74.

(28) Badger AM, Cook MN, Lark MW, et al. SB 203580 inhibits p38 mitogen-activated

protein kinase, nitric oxide production, and inducible nitric oxide synthase in bovine

cartilage-derived chondrocytes. J Immunol 1998 Jul 1;161(1):467-473.

(29) Terao M, Ishikawa A, Nakahara S, et al. Enhanced epithelial-mesenchymal transition-

like phenotype in N-acetylglucosaminyltransferase V transgenic mouse skin promotes wound

healing. J Biol Chem 2011 Aug 12;286(32):28303-28311.

(30) Kimura A, Terao M, Kato A, et al. Upregulation of N-acetylglucosaminyltransferase-V

by heparin-binding EGF-like growth factor induces keratinocyte proliferation and epidermal

hyperplasia. Exp Dermatol 2012 Jul;21(7):515-519.

Acc

epte

d A

rtic

le


(31) Oh JE, Kim RH, Shin KH, et al. DeltaNp63alpha protein triggers epithelial-

mesenchymal transition and confers stem cell properties in normal human keratinocytes. J

Biol Chem 2011 Nov 4;286(44):38757-38767.

(32) Willis BC, Liebler JM, Luby-Phelps K, et al. Induction of epithelial-mesenchymal

transition in alveolar epithelial cells by transforming growth factor-beta1: potential role in

idiopathic pulmonary fibrosis. Am J Pathol 2005 May;166(5):1321-1332.

(33) Kasai H, Allen JT, Mason RM, et al. TGF-β1 induces human alveolar epithelial to

mesenchymal cell transition (EMT). Respir Res 2005 Jun 9;6:56.

(34) Moustakas A, Heldin CH. Non-Smad TGF-beta signals. J Cell Sci 2005 Aug

15;118(16):3573-3584.

(35) Laping NJ, Grygielko E, Mathur A, et al. Inhibition of transforming growth factor

(TGF)-beta1-induced extracellular matrix with a novel inhibitor of the TGF-beta type I

receptor kinase activity: SB-431542. Mol Pharmacol 2002 Jul;62(1):58-64.

(36) Eyers PA, Craxton M, Morrice N, et al. Conversion of SB 203580-insensitive MAP

kinase family members to drug-sensitive forms by a single amino-acid substitution. Chem

Biol 1998 Jun;5(6):321-328.

(37) Davies SP, Reddy H, Caivano M, et al. Specificity and mechanism of action of some

commonly used protein kinase inhibitors. Biochem J 2000 Oct 1;351(Pt 1):95-105.

(38) Mori Y, Chen SJ, Varga J. Expression and regulation of intracellular SMAD signaling in

scleroderma skin fibroblasts. Arthritis Rheum 2003 Jul;48(7):1964-1978.

Acc

epte

d A

rtic

le


(39) Xia W, Phan TT, Lim IJ, et al. Complex epithelial-mesenchymal interactions modulate

transforming growth factor-beta expression in keloid-derived cells. Wound Repair Regen

2004 Sep-Oct;12(5):546-556.

(40) Xie JL, Qi SH, Pan S, et al. Expression of Smad protein by normal skin fibroblasts and

hypertrophic scar fibroblasts in response to transforming growth factor beta1. Dermatol Surg

2008 Sep;34(9):1216-24; discussion 1224-5.

(41) Yamamoto T, Takagawa S, Katayama I, et al. Anti-sclerotic effect of transforming

growth factor-beta antibody in a mouse model of bleomycin-induced scleroderma. Clin

Immunol 1999 Jul;92(1):6-13.

(42) McCormick LL, Zhang Y, Tootell E, et al. Anti-TGF-β treatment prevents skin and

lung fibrosis in murine sclerodermatous graft-versus-host disease: a model for human

scleroderma. J Immunol 1999 Nov 15;163(10):5693-5699.

(43) Denton CP, Merkel PA, Furst DE, et al. Recombinant human anti-transforming growth

factor beta1 antibody therapy in systemic sclerosis: a multicenter, randomized, placebo-

controlled phase I/II trial of CAT-192. Arthritis Rheum 2007 Jan;56(1):323-333.

(44) Jo M, Lester RD, Montel V, et al. Reversibility of epithelial-mesenchymal transition

(EMT) induced in breast cancer cells by activation of urokinase receptor-dependent cell

signaling. J Biol Chem 2009 Aug 21;284(34):22825-22833.

(45) Kruger A, Fata JE, Khokha R. Altered tumor growth and metastasis of a T-cell

lymphoma in Timp-1 transgenic mice. Blood 1997 Sep 1;90(5):1993-2000.

Acc

epte

d A

rtic

le


(46) Li Y, Yang J, Dai C, et al. Role for integrin-linked kinase in mediating tubular epithelial

to mesenchymal transition and renal interstitial fibrogenesis. J Clin Invest 2003

Aug;112(4):503-516.

(47) Wang X, Zhou Y, Tan R, et al. Mice lacking the matrix metalloproteinase-9 gene reduce

renal interstitial fibrosis in obstructive nephropathy. Am J Physiol Renal Physiol 2010

Nov;299(5):973-82.

(48) Faivre S, Djelloul S, Raymond E. New paradigms in anticancer therapy: targeting

multiple signaling pathways with kinase inhibitors. Semin Oncol 2006 Aug;33(4):407-420.

Acc

epte

d A

rtic

le


Acc

epte

d A

rtic

le


Acc

epte

d A

rtic

le


Acc

epte

d A

rtic

le


Documents

SMAD inhibition attenuates epithelial to mesenchymal transition by primary keratinocytes in vitro