View
226
Download
0
Category
Preview:
Citation preview
Secreted phospholipase A2 group X overexpression in asthma and bronchial hyperresponsiveness
Teal S. Hallstrand, Emil Y. Chi, Alan G. Singer, Michael H. Gelb, and William R. Henderson, Jr.
From the Departments of Medicine (TSH, WRH), Pathology (EYC) and Chemistry (AGS,
MHG), University of Washington, Seattle, WA.
Supported by National Institutes of Health grants K23 HL04231(TSH), R01 AI42989 (WRH),
R01 HL36235 (MHG), a American Lung Association Career Investigator Award CI-22138-N
(TSH), and University of Washington General Clinical Research Center Pilot & Feasibility Grant
(TSH).
Corresponding Author: Teal S. Hallstrand, MD, MPH
Division of Pulmonary and Critical Care
Department of Medicine, University of Washington
Box 356522
Seattle, WA 98195
Phone: (206) 543-3166 Fax: (206) 685-8673
Email: tealh@u.washington.edu
Running Title : Secreted PLA2s in Asthma and BHR
Descriptor Number : Asthma : Immunobiology (63)
Word Count: 3,208
This article has an online data supplement, which is accessible from this issue's table of content
online at www.atsjournals.org.
What is the current scientific knowledge on this subject?
Secreted phospholipase A2s (sPLA2)s have recently emerged as critical regulators of eicosanoid
synthesis, but the specific sPLA2 enzymes expressed in human airways and the role of these
enzymes in asthma pathogenesis are not known.
What does this study add to the field?
Group X sPLA2 (sPLA2-X) is overexpressed in airway epithelial cells and bronchial
macrophages of asthmatic subjects, and released in response to exercise challenge, a stimulus
that causes dysregulated eicosanoid synthesis.
AJRCCM Articles in Press. Published on September 27, 2007 as doi:10.1164/rccm.200707-1088OC
Copyright (C) 2007 by the American Thoracic Society.
1
Abstract
Rationale: Secreted PLA2s (sPLA2)s play key regulatory roles in the biosynthesis of eicosanoids
such as the cysteinyl leukotrienes (CysLT)s, but the role of these enzymes in the pathogenesis of
asthma is not known. Objectives: To establish if sPLA2s are overexpressed in the airways of
asthmatics, and determine if these enzymes may play a role in the generation of eicosanoids in
exercise-induced bronchoconstriction (EIB). Methods: Induced sputum samples were obtained
from asthmatic subjects with EIB, and non-asthmatic controls at baseline, and on a separate day
30 min after exercise challenge. The expression of the PLA2s in induced sputum cells and
supernatant was determined by quantitative PCR, immunocytochemistry, and Western blot. Main
Results: The sPLA2s expressed at the highest levels in airway cells of asthmatics were groups X
and XIIA. Group X sPLA2 (sPLA2-X) was differentially overexpressed in asthma and localized
to airway epithelial cells and bronchial macrophages. The gene expression, immunostaining in
airway epithelial cells and bronchial macrophages, and the level of the extracellular sPLA2-X
protein in the airways increased in response to exercise challenge in the asthma group, while the
levels were lower and unchanged following challenge in non-asthmatic controls. Conclusions:
Increased expression of sPLA2-X may play a key role in the dysregulated eicosanoid synthesis in
asthma.
Abstract Word Count: 207
Key Words: Asthma, Eicosanoid, Epithelial Cell, Leukotriene, and Macrophage.
2
INTRODUCTION
The biosynthesis of eicosanoids in the airways is a key component of asthma
pathogenesis (1). Eicosanoids are the products of arachidonic acid (AA), including the
leukotrienes (LT)s, hydroxyeicosatetraenoic acids (HETE)s, and prostaglandins (PG)s. LTs such
as the cysteinyl leukotrienes (CysLT)s are produced at increased levels in the airways of
asthmatics (2), and inhalation of CysLTs reproduces many of the features of asthma (3).
Members of the PG family include PGD2 that serves as a bronchoconstrictor (4), and PGE2 that
has a bronchodilatory and bronchoprotective role in the airways (5). A major manifestation of
asthma is exercise-induced bronchoconstriction (EIB) that reflects the degree of indirect
bronchial hyperresponsiveness (BHR) (6). Dysregulated eicosanoid synthesis is prominent in
indirect BHR (7-9). The levels of CysLTs in the airways, measured in exhaled breath condensate
(10) or in induced sputum (11), are higher in asthmatics with EIB than asthmatics without EIB.
In particular, the ratio of CysLTs to PGE2 is increased in induced sputum of asthmatics with EIB
(11). Based on our prior work (8) and the results of Mickleborough and colleagues (9)
demonstrating a sustained increase in CysLTs and PGD2 in the airways, and concurrent decrease
in the level of PGE2 (8) following exercise challenge, we undertook this investigation to evaluate
the upstream regulators of eicosanoid production in the airways of asthmatics with EIB.
A key regulatory mechanism for eicosanoid biosynthesis is through phospholipase A2
(PLA2) that hydrolyzes the sn-2 position of membrane phospholipids, liberating unesterified AA
the precursor to the eicosanoids (12). Although the well described cytosolic PLA2α (cPLA2α) is
necessary for efficient eicosanoid biosynthesis (13), a group of secreted PLA2s (sPLA2)s has
been identified that coordinate with cPLA2α to augment synthesis of eicosanoids (14-16). The
sPLA2-mediated release of eicosanoids is upregulated by treatment with the pro-inflammatory
3
cytokines, transforming growth factor-α (TGF-α) and IL-1β (17). In cultured cells, sPLA2s are
strongly linked to the generation of the pro-inflammatory eicosanoids such as CysLTs, while
cPLA2α is more closely associated with the generation of PGE2 (18-20). The sPLA2s are small
(14-16 kDa), Ca2+-dependent (KCa ~ µM to mM) enzymes released into the extracellular fluid by
the classical secretory pathway or by degranulation (12). Nine functional human sPLA2s have
been characterized, including human sPLA2 groups V and X that have the highest AA releasing
activities when added to mammalian cells (21, 22). An increase in sPLA2 enzyme activity in
bronchoalveolar lavage (BAL) fluid and nasal lavage fluid was identified following allergen
challenge in patients with asthma and allergic rhinitis respectively, but the identities of the
sPLA2s involved in asthma remain unknown (23-25).
We assessed the expression of the full set of cytosolic and secreted PLA2s in lower
airway cells obtained by induced sputum in a group of asthmatics with EIB. Based on the results,
we determined if selected sPLA2s were differentially expressed in asthmatic subjects compared
to non-asthmatic controls based on gene expression, immunostaining in induced sputum cells,
and Western blots of the secreted protein. We examined levels of these selected enzymes at
baseline and after exercise challenge in both groups. Our goals were to 1) determine the
identities of the sPLA2s expressed in airway cells of asthmatics, and if these enzymes are
overexpressed in asthma, 2) localize the cellular sources of sPLA2s in airway inflammatory and
epithelial cells, and 3) determine if selected sPLA2s may play a role in the dysregulated synthesis
of eicosanoids in response to exercise challenge in asthma.
Some of the results of this study have been previously reported in the form of an abstract
(26).
4
METHODS
Study Subjects and Protocol
A detailed description of these methods can be found in the online supplement. The
University of Washington Institutional Review Board approved the study protocol, and written
informed consent was obtained from all participants. The asthma group consisted of persons 12-
59 years of age who had a physician diagnosis of asthma for ≥ 1 year, used only an inhaled β2-
agonist for asthma, and had ≥ 15% fall in forced expiratory volume in one second (FEV1)
following exercise challenge (8). The control group consisted of persons 18-59 years of age with
no history of asthma or atopy, baseline FEV1 ≥ 80% predicted, and < 7% fall in FEV1 after
exercise challenge. Induced sputum was conducted with 3% saline for 12 min at baseline and on
a separate day 4-20 days later 30 min after exercise challenge. Albuterol (180 µg via MDI) was
administered 15 min prior to the induced sputum.
Induced Sputum Analysis
Induced sputum was placed on ice and processed within 30 min. The sample was
dispersed with an equal volume of DTT 0.1% in a shaking water bath at 37oC for 15 min. Slides
were prepared of the dispersed induced sputum with a cytocentrifuge, and fixed in methanol and
then methyl Carnoy’s solution for immunocytochemistry. The remaining dispersed induced
sputum sample was centrifuged at 250 g for 10 min, and portions of the supernatant treated with
protease inhibitors, and with iced methanol with 0.2% formic acid for protein and eicosanoid
analysis respectively. The cell pellet was resuspended in RLT buffer (Qiagen, Valencia, CA)
with β-mercaptoethanol, and underwent mechanical lysis. Total RNA was extracted from the
lysed cell pellet using the RNeasy protocol (Qiagen, Valencia, CA).
5
First strand cDNA was transcribed from total RNA using oligo(dT)12-18 primers. Initially,
semi-quantitative PCR was conducted using primers for the secreted and cytosolic PLA2s, based
on the PCR product after 23, 27, 31, and 35 cycles of amplification relative to glyceraldehyde-3-
phosphate dehydrogenase (GAPDH). Quantitative real-time PCR was conducted for sPLA2
groups V, X, and XIIA using SYBR green method. Human K-562 cell line cDNA was used for
the standard curve.
Immunostaining for sPLA2 groups V, X, and XIIA was performed on cytocentrifuge
preparations of induced sputum cells using polyclonal rabbit anti-human sPLA2 antibodies that
were raised against the recombinant proteins (27). The immunostaining was co-localized to
specific inflammatory and epithelial cells based on morphological criteria (28).
Western blots were conducted on induced sputum supernatant using polyclonal rabbit
anti-human sPLA2 groups V, X, and XIIA antibodies. The detection of sPLA2-V was confirmed
with a murine monoclonal antibody (Cayman, Ann Arbor, MI).
Statistical Analysis
The PLA2 expression data are reported as the mean +/- SD. Differences between the
baseline and post-exercise gene expression, protein, and eicosanoid products were analyzed with
a paired t test after log transformation. The differences in the percentage of cells immunostaining
for the different sPLA2s at baseline and post-exercise were analyzed with a paired t test.
Comparisons between the groups were made with unpaired t tests.
Methods Word Count: 500
6
RESULTS
Subject Characteristics and Eicosanoid Levels
The studies were conducted on induced sputum samples obtained from a cohort of 25
subjects with asthma and EIB, and a group of 10 non-asthmatic controls. The baseline lung
function, response to short-acting bronchodilator, and severity of EIB were markedly different
between the two groups (Table 1). The severity of EIB in the asthmatic group ranged from a
maximum fall in FEV1 after exercise of 15.1-63.1%. Induced sputum was collected at baseline
and then on a separate day 30 min after dry-air exercise challenge. The average time between
baseline and post-exercise induced sputum visits was 9.3 days (range 4-18) in the asthma group,
and 10.0 days (range 5-19) in the control group. The levels of the eicosanoids CysLTs, 15S-
HETE and PGE2 were previously reported in the asthma group (8, 29), and are compared to
levels of eicosanoids in the control group in Figures E1 and E2 of the online repository.
Expression and Localization of Secreted PLA2s in Induced Sputum Cells
Semi-quantitative PCR analysis of induced sputum cells from asthmatic subjects was
used to assess the expression of all the known cytosolic and secreted PLA2s (Figure 1). Induced
sputum cells from asthmatics expressed sPLA2 groups IB, IIA, IID, IIF, X, and XIIA. Of note,
sPLA2 groups X and XIIA were expressed at high levels, while groups IIE, III, and V were
below the level of detection. Isoenzymes of cPLA2 were also identified including groups IVα,
IVβ, and IVγ.
Based on the results of the semi-quantitative PCR analysis in asthmatics, we determined
differences in selected sPLA2s between asthmatics and controls by quantitative real-time PCR.
The expression of sPLA2-X was increased in asthmatics relative to controls (Figure 2A), while
7
there was no difference in the expression of sPLA2-XIIA between asthmatics and controls
(Figure 2B). The expression of sPLA2-V was above the threshold cycle (Ct) for detection.
Although we did not detect sPLA2-V by PCR, we conducted ICC for sPLA2-V because of its
high AA releasing capacity. The concentrations of leukocytes and epithelial cells in induced
sputum from both of the groups are presented in the online repository (Figure E3).
Immunostaining for sPLA2-V in induced sputum cells at baseline was no different between
asthmatics and controls (Figure 2C). In contrast, the percentages of cells immunostaining for
sPLA2 groups X and XIIA were greater in induced sputum cells of asthmatics compared to
controls (Figures 2D and 2E). Immunostaining for sPLA2 groups V, X, and XIIA localized
predominantly in columnar epithelial cells and bronchial macrophages, and to a lesser extent in
eosinophils (Figure 3 and Figure E4, online repository).
Effects of Exercise Challenge on sPLA2s in the Airways
To assess the potential role of the identified sPLA2s in the marked release of pro-
inflammatory eicosanoids that occurs following exercise in asthmatics with EIB, we evaluated
paired induced sputum samples obtained at baseline and 30 min post-exercise challenge in
asthmatics and normal controls. The gene expression of sPLA2-X in induced sputum cells
increased following exercise challenge in the asthma group, but not in the control group (Figure
4A). The percentage of cells in induced sputum immunostaining for sPLA2-X increased in
asthmatic subjects following challenge, but not in controls (Figure 4B). The increase in
immunostaining for sPLA2-X in asthmatic subjects was in bronchial macrophages and columnar
epithelial cells but not eosinophils (Figure 4C). No changes occurred in these cells following
exercise challenge in the control group (Figure 4D). The secreted sPLA2-X protein measured in
8
induced sputum increased in the asthma group following challenge (Figure 4E), but not in the
control group (Figure 4F). An additional Western blot comparing the levels of sPLA2-X
following exercise challenge in asthmatic subjects to controls found that the level of sPLA2-X
was higher in the asthmatic subjects (Figure 4G). Reprobing the blot with an antibody to the
intracellular protein β-actin did not reveal any β-actin signal indicating that the source of the
sPLA2 was protein secreted from the cells.
Although the sPLA2-XIIA gene expression was no different in the asthma and control
groups at baseline, the gene expression increased after exercise challenge in the asthma group,
but not in controls (Figure 5A). There was a marked increase in the percentage of induced
sputum cells immunostaining for sPLA2-XIIA following exercise challenge that occurred in the
asthma group that was not seen in the control group (Figure 5B). The increase in immunostaining
in the asthma group was predominantly in bronchial macrophages and columnar epithelial cells,
but also occurred in eosinophils, while no similar changes were observed in induced sputum cell
subtypes in the control group (Figure E5A and B, online repository). The level of sPLA2-XIIA
could not be measured accurately by Western blot as the protein was difficult to detect in either
group by this method.
The percentage of cells immunostaining for sPLA2-V did not increase in either of the
groups in response to exercise challenge (Figure 6A). Immunostaining for sPLA2-V in bronchial
macrophages tended to increase in asthmatic subjects following challenge; while no changes
were observed in columnar epithelial cells or eosinophils in asthmatics, and no changes were
identified in any induced sputum cell type in controls (Figure 5C and D, online repository). The
sPLA2-V protein was difficult to detect in induced sputum supernatant of asthmatics by Western
blot, and could not be detected in normal controls. Exercise challenge did not alter the levels of
9
sPLA2-V by Western blot in asthmatic subjects (Figure 6B).
10
DISCUSSION
In this study, we evaluated the expression of the complete set of functional PLA2
enzymes in the lower airways of asthmatic subjects with BHR, and determined if sPLA2 groups
V, X, and XIIA were differentially expressed in asthmatic subjects compared to non-asthmatic
controls. Marked differences in the levels of pro-inflammatory eicosanoids (e.g. CysLTs, and
15S-HETE) in the airways were present between these two groups, particularly following
exercise challenge. Of the two sPLA2 enzymes with high AA releasing capacity (i.e. groups V
and X), only sPLA2-X was overexpressed in asthmatics relative to controls. The gene expression,
immunostaining in airway epithelial cells and bronchial macrophages, and the level of the
sPLA2-X protein in the airways all increased in response to exercise challenge in the asthma
group, while the levels remained constant following challenge in non-asthmatic controls. These
results indicate that sPLA2-X may play a role in regulating the levels of pro-inflammatory
eicosanoids in asthma, particularly in manifestations of indirect bronchial hyperresponsiveness
where increased production of pro-inflammatory eicosanoids is critical (7-9).
The sPLA2s are attractive therapeutic targets because these enzymes may be
preferentially involved in the production of pro-inflammatory AA metabolites (e.g. LTs, HETEs,
and PGD2) that are key for asthma immunopathogenesis (12). Two prior studies identified
increased sPLA2 enzyme activity in bronchoalveolar lavage (BAL) fluid following whole lung
allergen challenge in allergic asthma (23, 24), and nasal lavage fluid after nasal allergen
challenge in subjects with allergic rhinitis (25). The specific sPLA2s involved in asthma have not
been determined. There are 9 distinct functional sPLA2s that have been identified in the human
genome (12). LY333013, a sPLA2 inhibitor that is active predominantly against sPLA2-II (i.e.
IIA, D, E, and F) failed to inhibit either the early or late response to allergen challenge
11
suggesting that sPLA2 group II enzymes may not be the key sPLA2 enzymes in human asthma
(30). The group II enzymes were expressed at relatively low levels in the present study. Among
the two sPLA2s with high AA releasing capacity (22), we found that only sPLA2-X was
differentially overexpressed in asthma, while sPLA2-V was present at low levels and was not
differentially expressed in asthma. The difference in sPLA2-X function may be greater than the
difference in sPLA2-X protein levels identified in this study because sPLA2-X becomes activated
in inflammatory tissues (31). These results, along with the recent demonstration by our research
group that sPLA2-X deficiency significantly inhibits the development of BHR, airway
inflammation and remodeling in acute and chronic murine models of allergen-induced asthma
(32) indicates that sPLA2-X is a potential therapeutic target in asthma.
Although we focused on the sPLA2 enzymes in this study, we also identified the
expression of 3 cPLA2s in asthmatics, including the well-known cPLA2α that has a pivotal role
in eicosanoid production (13), and two other enzymes cPLA2β and cPLA2γ. In cultured cells
sPLA2s coordinate with cPLA2α to augment the production of eicosanoids (15). Relatively little
is known about the two other cPLA2s, but both enzymes function in eicosanoid synthesis (33,
34). cPLA2β is implicated in lipid mediator release in response to cardiac ischemia (35), and
cPLA2γ is involved in peroxide-induced release of eicosanoids (36). The expression of cPLA2γ is
upregulated in macrophages by the adipocyte-derived cytokine leptin, enhancing cellular LT
synthesis (37).
Dysregulated eicosanoid synthesis is prominent in asthma with EIB as indicated by
elevated basal levels of CysLTs in the lower airways (10, 11), and release of CysLTs and PGD2
into the airways during EIB sustaining bronchoconstriction (8, 9). Selective functions of the
different PLA2 enzymes may be involved in this dysregulated eicosanoid synthesis. We found in
12
the present study that the ratio of CysLTs to PGE2 decreased in controls following exercise
challenge, in contrast to our prior findings that the ratio of CysLTs to PGE2 increases following
exercise challenge in asthmatics with EIB (8). This altered balance of eicosanoids is important
because PGE2 serves protective and bronchodilator functions (5), and inhaled PGE2 prior to
exercise and allergen challenge significantly attenuates bronchoconstriction (38-40). In cultured
cells, activation of cPLA2α alone is more closely associated with the generation of PGE2 (18,
19), while sPLA2s have been strongly implicated in the release of pro-inflammatory eicosanoids
such as CysLTs (18, 19) that can occur in the absence of cPLA2α activation (20).
Localization of sPLA2-X to the epithelium was prominent in the present study, consistent
with the upregulation of sPLA2-X in the epithelium identified in a murine model of asthma (32).
Although the epithelium has limited synthetic capacity for the generation of 5-lipoxygenase (5-
LO) products such as CysLTs (41), the epithelium can augment CysLT production in leukocytes
through mechanisms involving sPLA2s. The synthesis of leukotrienes (LT)s in alveolar
macrophages co-cultured with alveolar epithelial cells is augmented by the transfer of free AA
from the epithelium to the macrophages, shunting AA away from PGE2 synthesis (42). Similarly,
release of sPLA2-V from epithelial cells augments CysLT synthesis in eosinophils without
activation of cPLA2α (43, 44). These findings have strong implications for the pathogenesis of
EIB, since the stimulus for EIB may be the transfer of water and resultant osmotic stress in the
epithelium during exercise (45).
The increase in sPLA2-X in bronchial macrophages in asthmatics is important since
bronchial macrophages are the most prevalent cell the airways of asthmatics under most
circumstances, and there are phenotypic alterations in bronchial macrophages in asthma (46, 47).
In rodent models, bronchial macrophages are important in the development of BHR in response
13
to allergen sensitization (48). Upregulation of sPLA2-X in alveolar macrophages was also
identified following allergen sensitization in the murine model of asthma (32). After migration to
the lungs, bronchial macrophages have increased capacity for LT synthesis (49), although
alterations in eicosanoid synthesis between asthmatic and normal macrophages have not been
identified (50). Further study is necessary to determine if increased expression of sPLA2-X in
macrophages alters the production of eicosanoids in asthma.
An unexpected finding of the present study was that the sPLA2 with the highest
expression by quantitative PCR and ICC was sPLA2-XIIA. Although it was unclear if sPLA2-
XIIA is differentially overexpressed in asthma, there was a marked increase in immunostaining
for epithelial cell and bronchial macrophage sPLA2-XIIA in asthmatics that was not seen in the
control group after exercise challenge. sPLA2-XIIA displays homology to other sPLA2s only
over a short stretch in the active site region (51), has low AA releasing capacity (22), and does
not contribute to AA release in cultured cells that express this enzyme (17). Receptor-mediated
effects of human sPLA2-XIIA either through the M-type or N-type receptor are also possible.
Cells transfected with sPLA2-XIIA exhibit morphological alterations in HEK293 cells that are
unique among the sPLA2 transfected cells (52). Among the sPLA2s, sPLA2-XIIA is also unique
as a bactericidal protein that has activity against both gram-positive and gram-negative bacteria
(53).
In summary, we found that sPLA2-X is differentially overexpressed in asthmatics with
EIB, a component of asthma that is a manifestation of indirect BHR. We found strong evidence
of an increase in sPLA2-X in columnar epithelial cells and bronchial macrophages and an
increase in extracellular sPLA2-X protein in response to exercise challenge in asthmatics, but not
in controls. Collectively, these results indicate that sPLA2-X may play a role in the generation of
14
pro-inflammatory eicosanoids in the airways and the development of BHR. Inhibition of sPLA2-
X may represent an important novel therapeutic target in human asthma.
16
REFERENCES
1. Hallstrand, T. S., and W. R. Henderson, Jr. 2002. Leukotriene modifiers. Med Clin North
Am 86:1009-33.
2. Pavord, I. D., R. Ward, G. Woltmann, A. J. Wardlaw, J. R. Sheller, and R. Dworski.
1999. Induced sputum eicosanoid concentrations in asthma. Am J Respir Crit Care Med
160:1905-9.
3. Griffin, M., J. W. Weiss, A. G. Leitch, E. R. McFadden, Jr., E. J. Corey, K. F. Austen,
and J. M. Drazen. 1983. Effects of leukotriene D on the airways in asthma. N Engl J Med
308:436-9.
4. Hardy, C. C., C. Robinson, A. E. Tattersfield, and S. T. Holgate. 1984. The
bronchoconstrictor effect of inhaled prostaglandin D2 in normal and asthmatic men. N Engl J
Med 311:209-13.
5. Mathe, A. A., and P. Hedqvist. 1975. Effect of prostaglandins F2 alpha and E2 on airway
conductance in healthy subjects and asthmatic patients. Am Rev Respir Dis 111:313-20.
6. Joos, G. F., B. O'Connor, S. D. Anderson, F. Chung, D. W. Cockcroft, B. Dahlen, G.
DiMaria, A. Foresi, F. E. Hargreave, S. T. Holgate, M. Inman, J. Lotvall, H. Magnussen, R.
Polosa, D. S. Postma, and J. Riedler. 2003. Indirect airway challenges. Eur Respir J 21:1050-68.
7. Currie, G. P., K. Haggart, D. K. Lee, S. J. Fowler, A. M. Wilson, J. D. Brannan, S. D.
Anderson, and B. J. Lipworth. 2003. Effects of mediator antagonism on mannitol and adenosine
monophosphate challenges. Clin Exp Allergy 33:783-8.
17
8. Hallstrand, T. S., M. W. Moody, M. M. Wurfel, L. B. Schwartz, W. R. Henderson, Jr.,
and M. L. Aitken. 2005. Inflammatory basis of exercise-induced bronchoconstriction. Am J
Respir Crit Care Med 172:679-86.
9. Mickleborough, T. D., M. R. Lindley, and S. Ray. 2005. Dietary salt, airway
inflammation, and diffusion capacity in exercise-induced asthma. Med Sci Sports Exerc 37:904-
14.
10. Carraro, S., M. Corradi, S. Zanconato, R. Alinovi, M. F. Pasquale, F. Zacchello, and E.
Baraldi. 2005. Exhaled breath condensate cysteinyl leukotrienes are increased in children with
exercise-induced bronchoconstriction. J Allergy Clin Immunol 115:764-70.
11. Hallstrand, T. S., M. W. Moody, M. L. Aitken, and W. R. Henderson, Jr. 2005. Airway
immunopathology of asthma with exercise-induced bronchoconstriction. J Allergy Clin Immunol
116:586-93.
12. Triggiani, M., F. Granata, G. Giannattasio, and G. Marone. 2005. Secretory
phospholipases A2 in inflammatory and allergic diseases: not just enzymes. J Allergy Clin
Immunol 116:1000-6.
13. Uozumi, N., K. Kume, T. Nagase, N. Nakatani, S. Ishii, F. Tashiro, Y. Komagata, K.
Maki, K. Ikuta, Y. Ouchi, J. Miyazaki, and T. Shimizu. 1997. Role of cytosolic phospholipase A2
in allergic response and parturition. Nature 390:618-22.
14. Balboa, M. A., Y. Shirai, G. Gaietta, M. H. Ellisman, J. Balsinde, and E. A. Dennis.
2003. Localization of group V phospholipase A2 in caveolin-enriched granules in activated
P388D1 macrophage-like cells. J Biol Chem 278:48059-65.
18
15. Mounier, C. M., F. Ghomashchi, M. R. Lindsay, S. James, A. G. Singer, R. G. Parton,
and M. H. Gelb. 2004. Arachidonic acid release from mammalian cells transfected with human
groups IIA and X secreted phospholipase A2 occurs predominantly during the secretory process
and with the involvement of cytosolic phospholipase A2-α. J Biol Chem 279:25024-38.
16. Satake, Y., B. L. Diaz, B. Balestrieri, B. K. Lam, Y. Kanaoka, M. J. Grusby, and J. P.
Arm. 2004. Role of group V phospholipase A2 in zymosan-induced eicosanoid generation and
vascular permeability revealed by targeted gene disruption. J Biol Chem 279:16488-94.
17. Ni, Z., N. M. Okeley, B. P. Smart, and M. H. Gelb. 2006. Intracellular actions of group
IIA secreted phospholipase A2 and group IVA cytosolic phospholipase A2 contribute to
arachidonic acid release and prostaglandin production in rat gastric mucosal cells and transfected
human embryonic kidney cells. J Biol Chem 281:16245-55.
18. Kessen, U. A., R. H. Schaloske, D. L. Stephens, K. Killermann Lucas, and E. A. Dennis.
2005. PGE2 release is independent of upregulation of Group V phospholipase A2 during long-
term stimulation of P388D1 cells with LPS. J Lipid Res 46:2488-96.
19. Marshall, L. A., B. Bolognese, J. D. Winkler, and A. Roshak. 1997. Depletion of human
monocyte 85-kDa phospholipase A2 does not alter leukotriene formation. J Biol Chem 272:759-
65.
20. Munoz, N. M., Y. J. Kim, A. Y. Meliton, K. P. Kim, S. K. Han, E. Boetticher, E.
O'Leary, S. Myou, X. Zhu, J. V. Bonventre, A. R. Leff, and W. Cho. 2003. Human group V
phospholipase A2 induces group IVA phospholipase A2-independent cysteinyl leukotriene
synthesis in human eosinophils. J Biol Chem 278:38813-20.
19
21. Calabrese, C., M. Triggiani, G. Marone, and G. Mazzarella. 2000. Arachidonic acid
metabolism in inflammatory cells of patients with bronchial asthma. Allergy 55 Suppl 61:27-30.
22. Singer, A. G., F. Ghomashchi, C. Le Calvez, J. Bollinger, S. Bezzine, M. Rouault, M.
Sadilek, E. Nguyen, M. Lazdunski, G. Lambeau, and M. H. Gelb. 2002. Interfacial kinetic and
binding properties of the complete set of human and mouse groups I, II, V, X, and XII secreted
phospholipases A2. J Biol Chem 277:48535-49.
23. Bowton, D. L., M. C. Seeds, M. B. Fasano, B. Goldsmith, and D. A. Bass. 1997.
Phospholipase A2 and arachidonate increase in bronchoalveolar lavage fluid after inhaled antigen
challenge in asthmatics. Am J Respir Crit Care Med 155:421-5.
24. Chilton, F. H., F. J. Averill, W. C. Hubbard, A. N. Fonteh, M. Triggiani, and M. C. Liu.
1996. Antigen-induced generation of lyso-phospholipids in human airways. J Exp Med
183:2235-45.
25. Stadel, J. M., K. Hoyle, R. M. Naclerio, A. Roshak, and F. H. Chilton. 1994.
Characterization of phospholipase A2 from human nasal lavage. Am J Respir Cell Mol Biol
11:108-13.
26. Hallstrand, T. S., E. Y. Chi, M. H. Gelb, and W. R. Henderson, Jr. 2004. Phospholipase
A2 isoenzymes in airway inflammatory cells of patients with mild asthma and exercise-induced
bronchoconstriction. Am J Respir Crit Care Med 169:A569.
27. Degousee, N., F. Ghomashchi, E. Stefanski, A. Singer, B. P. Smart, N. Borregaard, R.
Reithmeier, T. F. Lindsay, C. Lichtenberger, W. Reinisch, G. Lambeau, J. Arm, J. Tischfield, M.
H. Gelb, and B. B. Rubin. 2002. Groups IV, V, and X phospholipases A2s in human neutrophils:
20
role in eicosanoid production and gram-negative bacterial phospholipid hydrolysis. J Biol Chem
277:5061-73.
28. Fahy, J. V., H. A. Boushey, S. C. Lazarus, E. A. Mauger, R. M. Cherniack, V. M.
Chinchilli, T. J. Craig, J. M. Drazen, J. G. Ford, J. E. Fish, E. Israel, M. Kraft, R. F. Lemanske,
R. J. Martin, D. McLean, S. P. Peters, C. Sorkness, and S. J. Szefler. 2001. Safety and
reproducibility of sputum induction in asthmatic subjects in a multicenter study. Am J Respir
Crit Care Med 163:1470-5.
29. Hallstrand, T. S., J. S. Debley, F. M. Farin, and W. R. Henderson, Jr. 2007. Role of
MUC5AC in the pathogenesis of exercise-induced bronchoconstriction. J Allergy Clin Immunol
119:1092-8.
30. Bowton, D. L., A. A. Dmitrienko, E. Israel, B. G. Zeiher, and G. D. Sides. 2005. Impact
of a soluble phospholipase A2 inhibitor on inhaled allergen challenge in subjects with asthma. J
Asthma 42:65-71.
31. Ohtsuki, M., Y. Taketomi, S. Arata, S. Masuda, Y. Ishikawa, T. Ishii, Y. Takanezawa, J.
Aoki, H. Arai, K. Yamamoto, I. Kudo, and M. Murakami. 2006. Transgenic expression of group
V, but not group X, secreted phospholipase A2 in mice leads to neonatal lethality because of lung
dysfunction. J Biol Chem 281:36420-33.
32. Henderson, W. R., Jr., E. Y. Chi, J. G. Bollinger, Y. T. Tien, X. Ye, L. Castelli, Y. P.
Rubtsov, A. G. Singer, G. K. Chiang, T. Nevalainen, A. Y. Rudensky, and M. H. Gelb. 2007.
Importance of group X-secreted phospholipase A2 in allergen-induced airway inflammation and
remodeling in a mouse asthma model. J Exp Med 204:865-77.
21
33. Song, C., X. J. Chang, K. M. Bean, M. S. Proia, J. L. Knopf, and R. W. Kriz. 1999.
Molecular characterization of cytosolic phospholipase A2-β. J Biol Chem 274:17063-7.
34. Underwood, K. W., C. Song, R. W. Kriz, X. J. Chang, J. L. Knopf, and L. L. Lin. 1998.
A novel calcium-independent phospholipase A2, cPLA2-γ, that is prenylated and contains
homology to cPLA2. J Biol Chem 273:21926-32.
35. Mancuso, D. J., D. R. Abendschein, C. M. Jenkins, X. Han, J. E. Saffitz, R. B.
Schuessler, and R. W. Gross. 2003. Cardiac ischemia activates calcium-independent
phospholipase A2β, precipitating ventricular tachyarrhythmias in transgenic mice: rescue of the
lethal electrophysiologic phenotype by mechanism-based inhibition. J Biol Chem 278:22231-6.
36. Asai, K., T. Hirabayashi, T. Houjou, N. Uozumi, R. Taguchi, and T. Shimizu. 2003.
Human group IVC phospholipase A2 (cPLA2γ). Roles in the membrane remodeling and
activation induced by oxidative stress. J Biol Chem 278:8809-14.
37. Mancuso, P., C. Canetti, A. Gottschalk, P. K. Tithof, and M. Peters-Golden. 2004. Leptin
augments alveolar macrophage leukotriene synthesis by increasing phospholipase activity and
enhancing group IVC iPLA2 (cPLA2γ) protein expression. Am J Physiol Lung Cell Mol Physiol
287:L497-502.
38. Melillo, E., K. L. Woolley, P. J. Manning, R. M. Watson, and P. M. O'Byrne. 1994.
Effect of inhaled PGE2 on exercise-induced bronchoconstriction in asthmatic subjects. Am J
Respir Crit Care Med 149:1138-41.
22
39. Gauvreau, G. M., R. M. Watson, and P. M. O'Byrne. 1999. Protective effects of inhaled
PGE2 on allergen-induced airway responses and airway inflammation. Am J Respir Crit Care
Med 159:31-6.
40. Hartert, T. V., R. T. Dworski, B. G. Mellen, J. A. Oates, J. J. Murray, and J. R. Sheller.
2000. Prostaglandin E2 decreases allergen-stimulated release of prostaglandin D2 in airways of
subjects with asthma. Am J Respir Crit Care Med 162:637-40.
41. Jame, A. J., P. M. Lackie, A. M. Cazaly, I. Sayers, J. F. Penrose, S. T. Holgate, and A. P.
Sampson. 2007. Human bronchial epithelial cells express an active and inducible biosynthetic
pathway for leukotrienes B4 and C4. Clin Exp Allergy 37:880-92.
42. Peters-Golden, M., and A. Feyssa. 1993. Transcellular eicosanoid synthesis in cocultures
of alveolar epithelial cells and macrophages. Am J Physiol 264:L438-47.
43. Munoz, N. M., A. Y. Meliton, A. Lambertino, E. Boetticher, J. Learoyd, F. Sultan, X.
Zhu, W. Cho, and A. R. Leff. 2006. Transcellular secretion of group V phospholipase A2 from
epithelium induces β2-integrin-mediated adhesion and synthesis of leukotriene C4 in eosinophils.
J Immunol 177:574-82.
44. Wijewickrama, G. T., J. H. Kim, Y. J. Kim, A. Abraham, Y. Oh, B. Ananthanarayanan,
M. Kwatia, S. J. Ackerman, and W. Cho. 2006. Systematic evaluation of transcellular activities
of secretory phospholipases A2: High activity of group V PLA2 to induce eicosanoid biosynthesis
in neighboring inflammatory cells. J Biol Chem.
45. Anderson, S. D. 2006. How does exercise cause asthma attacks? Curr Opin Allergy Clin
Immunol 6:37-42.
23
46. Plummeridge, M. J., L. Armstrong, M. A. Birchall, and A. B. Millar. 2000. Reduced
production of interleukin 12 by interferon γ primed alveolar macrophages from atopic asthmatic
subjects. Thorax 55:842-7.
47. Alexis, N. E., J. Soukup, S. Nierkens, and S. Becker. 2001. Association between airway
hyperreactivity and bronchial macrophage dysfunction in individuals with mild asthma. Am J
Physiol Lung Cell Mol Physiol 280:L369-75.
48. Careau, E., L. I. Proulx, P. Pouliot, A. Spahr, V. Turmel, and E. Y. Bissonnette. 2006.
Antigen sensitization modulates alveolar macrophage functions in an asthma model. Am J
Physiol Lung Cell Mol Physiol 290:L871-9.
49. Balter, M. S., G. B. Toews, and M. Peters-Golden. 1989. Different patterns of
arachidonate metabolism in autologous human blood monocytes and alveolar macrophages. J
Immunol 142:602-8.
50. Balter, M. S., W. L. Eschenbacher, and M. Peters-Golden. 1988. Arachidonic acid
metabolism in cultured alveolar macrophages from normal, atopic, and asthmatic subjects. Am
Rev Respir Dis 138:1134-42.
51. Gelb, M. H., E. Valentin, F. Ghomashchi, M. Lazdunski, and G. Lambeau. 2000. Cloning
and recombinant expression of a structurally novel human secreted phospholipase A2. J Biol
Chem 275:39823-6.
52. Murakami, M., S. Masuda, S. Shimbara, S. Bezzine, M. Lazdunski, G. Lambeau, M. H.
Gelb, S. Matsukura, F. Kokubu, M. Adachi, and I. Kudo. 2003. Cellular arachidonate-releasing
24
function of novel classes of secretory phospholipase A2s (groups III and XII). J Biol Chem
278:10657-67.
53. Koduri, R. S., J. O. Gronroos, V. J. Laine, C. Le Calvez, G. Lambeau, T. J. Nevalainen,
and M. H. Gelb. 2002. Bactericidal properties of human and murine groups I, II, V, X, and XII
secreted phospholipases A2. J Biol Chem 277:5849-57.
Figure Legends
Figure 1. Expression of PLA2s in induced sputum cells from asthmatics with EIB. Semi-
quantitative PCR was used to assess the expression of the secreted (A) and cytosolic PLA2s (B)
relative to the expression of GAPDH. The bars represent the mean +/- SD.
Figure 2. Baseline differences in sPLA2 groups V, X, and XIIA between asthmatics with EIB
and non-asthmatic controls. The gene expression of sPLA2-X was increased relative to control
(A), while there was no difference in the expression of sPLA2-XIIA (B). The expression of
sPLA2-V was below the level of detection. No difference was detected for immunostaining in
induced sputum cells for sPLA2-V (C). The percentage of cells immunostaining for sPLA2-X (D)
and sPLA2-XIIA (E) was increased in asthmatic subjects relative to controls.
Figure 3. Immunostaining for sPLA2 groups V, X, and XIIA in induced sputum cells.
Representative photomicrographs of immunocytochemistry for sPLA2-V (A, B), sPLA2-X (C,
D), and sPLA2-XIIA (E, F) demonstrate immunostaining predominantly in columnar epithelial
cells (arrows) and macrophages (arrowheads). The representative slides were from asthmatic
subjects following exercise challenge.
Figure 4. Effects of exercise challenge on sPLA2-X in asthmatics with EIB and non-asthmatic
controls. The gene expression (A) and percentage of cells in induced sputum immunostaining
(B) for sPLA2-X increased in asthmatic subjects following challenge, but not in controls.
Immunostaining for sPLA2-X in asthmatic subjects increased in bronchial macrophages (Mac)
and columnar epithelial cells (Epi), but not eosinophils (EOS) (C); while no changes were
observed in the control group (D). Western blots of induced sputum supernatant revealed
an increase in sPLA2-X protein in asthmatic subjects (E), but not in controls (F), resulting
in a higher level of sPLA2-X in asthmatic subjects than controls post-exercise (G).
Figure 5. Effects of exercise challenge on sPLA2-XIIA in asthmatics with EIB and
nonasthmatic controls. The gene expression (A) and percentage of cells in induced
sputum immunostaining (B) for sPLA2-XIIA increased in asthmatic subjects following
challenge, but not in controls.
Figure 6. Effects of exercise challenge on sPLA2-V in asthmatics with EIB and non-
asthmatic controls. The percentage of cells in induced sputum immunostaining for
sPLA2-V was no different post-exercise compared to baseline in either asthmatics or
controls (A). Western blot of induced sputum supernatant had no increase in sPLA2-V
protein in asthmatic subjects (B), and could not be detected in controls.
Table I. Characteristics of Study Participants*
Asthma with EIB (n=25)
Normal Control (n=10)
Age (yrs)(range) 28.1 (14-55) 31.3 (18-57) Gender (M/F) 11/14 6/4 Baseline
FEV1 (% pred)† 84.8 +/- 8.4 102.7 +/- 10.7 FVC (% pred) 100.1 +/- 10.3 105.2 +/- 13.9 FEV1/FVC‡ 0.78 +/- 0.06 0.81 +/- 0.04
Post Bronchodilator ∆ FEV1 (%)‡ 11.0 +/- 6.2 3.4 +/- 2.0
Post Exercise Max ∆ FEV1 (%)† -29.2 +/- 11.9 -0.4 +/- 3.1
* Values reported are mean +/- standard deviation unless otherwise specified † p < 0.001 ‡ p < 0.01
Figure 1.
Figure 2.
Figure 3.
Figure 4.
Figure 5.
Figure 6.
Secreted phospholipase A2 group X overexpression in asthma and bronchial hyperresponsiveness
Teal S. Hallstrand, Emil Y. Chi, Alan G. Singer, Michael H. Gelb, and William R. Henderson, Jr.
ONLINE DATA SUPPLEMENT
1
METHODS
Subjects
The University of Washington Institutional Review Board approved the study protocol,
and written informed consent was obtained from all participants. Induced sputum samples from
asthmatic for this study were obtained from a cohort of 25 patients enrolled in a study on the
pathogenesis of exercise-induced bronchoconstriction (EIB) (E1). Study subjects consisted of
persons 12-59 years of age who had a physician diagnosis of asthma for 1 year, used only an
inhaled 2-agonist for asthma treatment, and had 15% fall in forced expiratory volume in one
second (FEV1) following exercise challenge. Potential participants with asthma were excluded if
baseline FEV1 was 65% predicted, they had received treatment for acute asthma within the
prior month, or hospitalized for asthma within the prior 3 months, or had a history of life-
threatening asthma. In addition, induced sputum samples were obtained from 10 non-asthmatic
controls, consisting of persons 18-59 years of age with no history of asthma or atopy, baseline
FEV1 80% predicted, and < 7% fall in FEV1 after exercise challenge. Potential participants
were excluded if they had a history of smoking cigarettes within the prior year or 7 pack-year
smoking history. Participants were excluded if they had used an inhaled corticosteroid,
leukotriene modifier, long-acting antihistamine, cromone, or long-acting 2-agonist in the 30
days prior to the start of the study.
Study Protocol
The first visit consisted of a physical examination, spirometry, and in the asthma group
an exercise challenge to determine eligibility for the study. Each subject had 2 induced sputums.
One visit consisted of spirometry before and 15 min after administration of 180 μg of albuterol
2
via a metered dose inhaler, followed by induced sputum. On the other visit, conducted at the
same time of day, 4-10 days apart, participants had an exercise challenge followed by induced
sputum 30 min after the end of exercise. Albuterol (180 μg via MDI) was administered 15 min
prior to the induced sputum. Subjects were asked not to exercise, use short-acting antihistamines
for 48 hours, and 2-agonist and caffeinated beverages for 6 hours prior to each study visit.
Spirometry, Exercise Challenge, and Sputum Induction
Spirometry and exercise challenge tests were conducted in accordance with American
Thoracic Society (ATS) standards (E2, E3). Exercise challenge was performed on a motorized
treadmill such that each subject sustained 85% of their maximum heart rate for the final 6 min
of exercise (E2). Subjects wore nose clips and breathed dry air (0% relative humidity, 22oC)
delivered from a weather balloon reservoir through a one-way valve (Hans Rudolph, Kansas
City, MO) during exercise. Spirometry was conducted 20 and 5 min before each exercise
challenge, and repeated at 0, 3, 6, 10, and 15 min after the end of exercise. The better of at least 2
FEV1 maneuvers within 5% of each other was recorded at each time point. Induced sputum was
conducted with 3% hypertonic saline via an ultrasonic nebulizer (DeVilbiss, Somerset, PA) (E4).
At 2-min intervals, subjects were asked to clear saliva from their mouth and then expectorate
sputum. Sputum was collected over 12 min and was pooled into a single sample container. The
induced sputum was placed on ice immediately and processed within 30 min of collection.
Samples were coded with a subject number, visit number, and date.
3
Induced Sputum Processing
Following the addition of an equal volume of DTT 0.1% (Calbiochem, La Jolla, CA), the
induced sputum sample was mixed gently with a vortex mixer and placed in a shaking water bath
at 37oC for 15 min. A plastic transfer pipette was used periodically to further mix and disperse
the sample. A 1 ml portion of the sample was removed for cell counts and cytocentrifuge
preparations. The remaining dispersed induced sputum sample was centrifuged at 250 x g for 10
min and the supernatant removed from the cell pellet. The supernatant was centrifuged a second
time at 4,000 g for 20 min and the supernatant stored for protein analysis with the addition of
PMSF and EDTA, and for eicosanoid analysis by the addition of 4 volumes of methanol with
0.2% formic acid (E5). The cell pellet was resuspended in RLT buffer (Qiagen, Valencia, CA)
with -mercaptoethanol, and passed through an 18g needle 5-6 times. After lysis, the cell pellet
was stored at –80oC. Total RNA was extracted from the lysed cell pellet using the RNeasy
protocol (Qiagen).
Eicosanoid Measurements
The levels of cysteinyl leukotriene (CysLT)s, prostaglandin (PG)D2, 15S-
hydroxyeicosatetraenoic acid (15S-HETE) and PGE2 were measured in the control group for this
study and compared to values previously measured in the asthma group (E1). The samples were
brought to ~13% methanol by the addition of 5 volumes of 0.03% formic acid in high purity
water, and loaded onto a Oasis HLB column (Waters, Milford, MA). The samples were washed
with 0.03% formic acid in water, 0.03% formic acid in 10% ethanol, and hexanes, and then
eluted with 0.2% formic acid in methanol (E6). The samples were evaporated to dryness in a
4
centrifugal concentrator, and resuspended in assay buffer at their original volume. The levels of
CysLTs, PGD2, 15S-HETE, and PGE2 were measured by enzyme immunoassay (Cayman, Ann
Arbor, MI). PGD2 was measured as the stable PGD2-MOX derivative after treatment of the
sample with methoxylamine hydrochloride. Recovery was 78% for 15S-HETE, and 100% for
CysLTs and PGD2 after solid phase extraction.
Semi-quantitative RT-PCR
Semi-quantitative PCR was conducted on 5 representative asthmatic subjects from RNA
isolated from the baseline induced sputum sample. Ribogreen reagent was used to measure the
RNA concentration. The RNA was precipitated with ethanol, and redissolved in nuclease-free
Tris-EDTA buffer to give an RNA concentration of 100 ng/μl. First strand cDNA was
transcribed from 10 μl of this RNA with SuperScript II RT and oligo(dT)12-18 primers
(Invitrogen, Carlsbad, CA). PCR was conducted using primers for the secretory and cytosolic
PLA2s and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) specified in Table EI. The
amount of cDNA solution from each induced sputum sample was determined empirically by the
amount of cDNA solution that was sufficient to give a just perceptible band from the GAPDH
primers after 23 cycles of PCR. PCR was performed with 0.6 U of Qiagen Hotstar Taq
polymerase and 200 μM of each primer under the following conditions: 95oC, 15 min; (94
oC, 45
sec; 60oC, 1 min; 68
oC, 45 sec) for 23 cycles; 68
oC, 5 min. At the end of this program 5 μl of
reaction product was removed for agarose gel analysis and PCR was continued under the
following conditions: (95oC, 45 sec; 60
oC, 1 min; 68
oC, 45 sec) for 4 cycles; 68
oC, 5 min. A 5
μl analytical sample was taken and this modified PCR program was repeated twice more. The
PCR products after 23, 27, 31, and 35 total cycles were run on separate 2% agarose gels with
5
detection by ethidium bromide. The relative amounts of the mRNAs were calculated based on
the observation that four cycles of PCR results in a ten fold increase in PCR product under these
conditions after the band has become perceptible on an agarose gel through at least eight more
cycles of PCR, corresponding to a linear range of 100-fold increase in product.
Quantitative Real-time PCR
Quantitative PCR was conducted on paired samples from 8 representative asthma
subjects and 10 control subjects collected at baseline and 30 min post-exercise. The primers for
human sPLA2 groups V, X, XIIA, and GAPDH were designed using Primer Express Version 1.0
(Applied Biosystems, Foster City, CA) and are specified in Table EII. All primers crossed large
intronic sequences. Human K-562 cell line cDNA was used to make standard curve. All cDNA
samples were diluted to 50 ng/μl. Quantitative real-time PCR was conducted using SYBR Green
master mix, and monitored on an ABI Model 7900 real-time PCR system (Applied Biosystems,
Foster City, CA). Thermal cycler conditions were as follows: Stage 1: 50oC, 2 min; Stage 2:
95oC, 10 min; Stage 3: step 1: 95
oC 0.15 min, step 2: 60
oC 1 min, for 40 cycles.
Immunocytochemistry
The total and differential cell counts were conducted for this study in the control group
and compared to values previously reported in the asthma group (E1). The total cell count was
determined with a hemocytometer on a 1 ml portion of the induced sputum supernatant, and
slides for differential cell counts and immunocytochemistry were prepared with a cytocentrifuge.
Slides were stained (Hema 3, Fisher Diagnostics, Middletown, VA) and at least 400 non-
6
squamous cells counted per slide. The differential cell count of inflammatory and epithelial cells
was based on morphological criteria (E4).
Immunocytochemistry was conducted on 8 representative asthma subjects and 5
representative control subjects from cytospin preparations of induced sputum obtained at
baseline and 30 min post-exercise. The cytospin slides were initially fixed in methanol, and then
methyl Carnoy’s solution. All immunolabeling was conducted at 24oC. Endogenous peroxidase
activity was inactivated by 0.75% hydrogen peroxide for 30 min. Slides were washed and
incubated with polyclonal rabbit antibodies raised against human sPLA2 groups V, X, and XIIA
at a dilution of 1:100 for 30 min (E7). The slides were washed and incubated with a horseradish
peroxidase (HRP) conjugated goat anti-rabbit antibody (Vector Laboratories, Burlingame, CA) at
a dilution of 1:40 for 30 min. Control preparations were prepared with pre-immune rabbit sera.
Detection of peroxidase was with 0.5% 3’,3’-diaminobenzidine tetrachloride and 0.15%
hydrogen peroxide, which stains the cells brown/black. The nuclei were counterstained with
Vector Hematoxylin QS. For each slide, 280-500 cells were counted and the results were
expressed as the percentages of the total cells.
Western Blots
Western blots were conducted on paired induced sputum samples from 5 representative
subjects at baseline and post-exercise from each of the groups. The protein concentration of the
induced sputum supernatant was measured with the Coomassie Plus Braddford assay (Pierce,
Rockford, IL). Between 3 and 5 μg of total protein was loaded into each well. The same amount
of total protein was loaded for each pair of samples. The optimal loading condition for each of
the proteins was determined empirically using the recombinant protein (data not shown). sPLA2-
7
V was prepared under reducing conditions without heating. sPLA2-X was prepared under
reducing conditions and was heated to 70oC for 10 min. sPLA2-XIIA was not reduced or heated.
The proteins were separated on a 12% NuPAGE Bis-Tris gel (Invitrogen, Carlsbad, CA) at 200V
for 28 min. Proteins were transferred by semi-dry transfer to polyvinyldifluoride (PVDF)
membranes at 110 mAmp for 40 min. For sPLA2-X, non-specific binding was blocked with 5%
nonfat milk in Tris-buffered saline with 0.1% tween-20 (TBST) for 2 hours at RT. The
membrane was incubated with rabbit polyclonal anti-sPLA2-X antibody overnight at 4oC, and
then subsequently incubated with goat anti-rabbit HRP-linked antibody (Cell Signaling, Danvers,
MA) for 1 hour at RT (Figures E6A and B). For sPLA2 groups V and XIIA, non-specific binding
was blocked with NETG-buffer (150 mM NaCl, 5 mM EDTA, 50 mM Tris-HCl, pH 7.5, 0.05%
triton-X, 0.25% gelatin) for 30 min at RT. The membrane was incubated with rabbit polyclonal
anti-sPLA2 antibody for 2 hours at RT, and then subsequently incubated with goat anti-rabbit
HRP-linked antibody for 1 hour at RT (Figure E6C). For sPLA2-V, this procedure was repeated
on samples from one subject with a murine monoclonal anti-sPLA2 hG V antibody and a horse
anti-mouse HRP-linked antibody (Figure E6D). The peroxidase activity of the blots was detected
using LumiGLO ECL reagents (Cell Signaling, Danvers, MA). One membrane was reprobed
with a murine monoclonal anti- -actin antibody and horse anti-mouse HRP-linked antibody to
detect evidence of cell lysis releasing this intracellular protein during induced sputum
processing.
Statistical Analysis
The PLA2 expression data are reported as the mean +/- SD. Differences between the
baseline and post-exercise gene expression, protein, and eicosanoid products were analyzed with
8
a paired t test after log transformation. The differences in the percentage of cells immunostaining
for the different sPLA2s at baseline and post-exercise were analyzed with a paired t test.
Comparisons between the groups were made with unpaired t tests. Comparisons of the
concentrations of cells in induced sputum between the groups were made with a Mann-Whitney
U test. Changes in the concentrations of cells in induced sputum between baseline and post-
exercise were made with the Wilcoxon signed-rank test.
9
RESULTS
Comparison of Eicosanoid Levels
At baseline the ratio of CysLTs to PGE2 was elevated in the asthma group compared to
control (p=0.03), and this ratio increased markedly in the asthmatics, while this ratio decreased
following exercise challenge in controls (Figure E1). The geometric mean levels of CysLTs
(167.6 vs. 132.8 pg/ml, p=0.17), PGD2 (486.5 vs. 483.6 pg/ml, p=0.97), 15S-HETE (26.2 vs.
24.4 ng/ml, p=0.50) in the control group did not increase following exercise challenge as had
been observed in the cohort of asthmatics in this study and in other studies (E1, E8, E9). The
geometric mean level of PGE2 did not decline following exercise challenge in the control group
(125.5 vs. 177.7 pg/ml, p=0.26) as had been observed in the asthma group (E1). A comparison of
the mean baseline level of eicosanoids between the asthma and control groups demonstrated a
trend towards higher levels of CysLTs in the asthma group (641.5 vs. 284.0 pg/ml, p=0.06), but
no detectible difference in the basal levels of 15S-HETE (64.9 vs. 33.0 ng/ml, p=0.32) or PGE2
(321.9 vs. 241.0 pg/ml, p=0.54). Following exercise challenge the levels of CysLTs and 15S-
HETE were markedly elevated in the asthma group compared to control (Figures E2A and B),
while the level of PGE2 was no different between the groups (Figure E2C). The level of PGD2
had not been measured in the asthma group and could not be compared between the groups.
Comparison of Cellular Constituents of Induced Sputum
There were no differences in the volume (4.7 vs. 3.8 ml, p=0.18), concentration of lower
airway cells excluding squamous epithelial cells (1.3 x 106 vs. 1.0 x 10
6 cells, p=0.67), or
percentage of squamous epithelial cells (23.4 vs. 24.6 %, p=0.57) in the baseline induced sputum
between asthma and control groups respectively. The median concentration of eosinophils was
10
increased in the asthma group (2.51 x 104 vs. 0.9 x 10
3 cells/ml, p<0.01); however, there were no
differences in the median concentrations of lymphocytes (1.7 x 104 vs. 1.9 x 10
4 cells/ml,
p=0.33), macrophages (4.8 x 105 vs. 5.6 x 10
5 cells/ml, p=0.65), neutrophils (4.6 x 10
5 vs. 3.2 x
105 cells/ml, p=0.32), or columnar epithelial cells (6.2 x 10
4 vs. 1.7 x 10
4 cells/ml, p=0.62)
between the groups. The concentration of epithelial cells in induced sputum increased in both the
asthma and control groups following exercise challenge (Figure E3). In the asthma group, there
were no changes in the concentration of leukocytes following exercise challenge (Figure E3A);
however, in the control group there was a decrease in the concentration of lymphocytes and an
increase in the concentration of neutrophils following exercise challenge (Figure E3B).
Comparison of the median concentrations of induced sputum cells between the groups following
exercise challenge showed that only eosinophils were higher in the asthma group relative to
controls (2.4 x 104 vs. 0.0, p=0.01), but no differences were identified in the concentrations of
lymphocytes, macrophages, neutrophils, or epithelial cells.
Secreted PLA2 Immunocytochemistry
Immunostaining for sPLA2 groups V, X, and XIIA in the baseline induced sputum
samples localized predominantly to columnar epithelial cells and bronchial macrophages, and to
a lesser degree eosinophils (Figure E4). Control slides immunolabeled with pre-immune rabbit
serum did not have any immunostaining (data not shown). The percentage of cells
immunostaining for sPLA2-V did not increase in either of the groups in response to exercise
challenge (Figure 6A). Immunostaining for sPLA2-V in bronchial macrophages tended to
increase in asthmatic subjects following challenge; while no changes were observed in columnar
epithelial cells or eosinophils in asthmatics (Figure E5A), and no changes were identified in any
11
induced sputum cell type in controls (Figure E5B). The percentage of cells in induced sputum
immunostaining for sPLA2-X increased in asthmatic subjects following challenge, but not in
controls (Figure 4B). The increase in immunostaining for sPLA2-X in asthmatic subjects was in
bronchial macrophages and columnar epithelial cells but not eosinophils (Figure 4C). No
changes occurred in these cells following exercise challenge in the control group (Figure 4D).
There was a marked increase in the percentage of induced sputum cells immunostaining for
sPLA2-XIIA following exercise challenge that occurred in the asthma group that was not seen in
the control group (Figure 5B). The increase in immunostaining in the asthma group was
predominantly in bronchial macrophages and columnar epithelial cells, but also occurred in
eosinophils (Figure E5C). No similar changes were observed in induced sputum cell subtypes in
the control group (Figure E5D).
12
Table EI. Primers sequences for semi-quantitative PCR
Group Sense strand primer Antisense strand primer
GIB cgtgtggcagttccgcaaaatgatcaag gcagatagaggtgatgcttttgagaggtg
GIIA tgatctttggcctactgcaggcccatg gaaattcagcactgggtggaaggtttcc
GIID caagatggtcaagcaagtgactgggaaaatg gagtgtttgaaaagccaggctggttcag
GIIE ctgctttcttctgctgccttttatgctc gcttgttgggataatgggcatatttgcg
GIIF ctcaggtctagcctgggtatgaagaag cagactatctcagtgttgttctcgatggtg
GIII cgaggttaccaacatgctttgggagctg gagattcccaaggcttggcatagccatg
GIV tctcaccctgattttccagagaaagggccagagg ctgcaaacatcagctctgaaacgtcaggtttgac
GIV tgagttgctgaagacccaggtgaccaagaacaag ttctaagaagcagatgcgggactcaggaagcctc
GIV ctcggccttctagacactgtgacctacctgagtg caagttggtgcggacgttgacactggtgtaaatg
GIV ttgttgagtaccagctcgcattgtgccagctaag tggccatacacggaggtcatggatcttgttccac
GIV aagcttgctgacacctacactctagatgtggtgg cttcagctccttggacaccttcttctgaatgacg
GIV accaaacaacattgcagaccaccagagtccttgg ctcgaagtcttcctccttgtaggtcatgttggac
GV gatttgaggccaggccaaagagaaccc ggagcagaggatgttgggaaagtattgg
GX gaactggcaggaactgtgggttgtgttg actgagaggacgctttatttccttgtgc
GXIIA accatccggaacggcgttcataagatag tcatctgtcactagctgtcggcatctcc
GXIIB gacttgggcattccagcaatgacaaagtg cttgaaggctgacagctgtggtgtcac
GAPDH ctctccagaacatcatccctgcctctac gggtctctctcttcctcttgtgctcttg
13
Table EII. Primers sequences for quantitative real-time PCR
Group Sense strand primer Antisense strand primer
GV cgttcttccctgtcaccttc gcttggttcctggcttgtag
GX gcaggaactgtgggttgtgtt ccatggcagcaccagtcaat
GXIIA tgtttggtgttcatcttaacattgg catcacagtcattcttgctttt
GAPDH ggagtcaacggatttggtcgt gcaacaatctccactttaccagagttaa
14
Figure E1. Opposing effects of exercise challenge on the CysLT to PGE2 ratio in induced
sputum. Asthmatics with EIB have an increase in the CysLT to PGE2 ratio in response to
exercise (A), while normal controls have a decrease in the CysLT to PGE2 ratio following
exercise challenge (B). The levels of CysLTs and PGE2 in the asthma group were previously
reported (E1).
15
Figure E2. Comparison of the levels of eicosanoids in induced sputum between asthmatics and
normal controls. The level of CyslTs tended to be higher at baseline, while there were no
baseline differences in the levels of 15S-HETE and PGE2 between the groups (see text).
Following exercise challenge, the levels of CysLTs (A) and 15S-HETE (B) were elevated in the
asthma group compared to the control group, while no difference was detected for PGE2 (C). The
levels of CysLTs, 15S-HETE and PGE2 in the asthma group were previously reported (E1, E8).
16
Figure E3. Concentration of leukocytes and epithelial cells in induced sputum at baseline and on
a separate day 30 min after exercise challenge in asthmatics with EIB (A) and non-asthmatic
controls (B). The concentrations of leukocytes and epithelial cells in the asthma group were
previously reported (E1).
17
Figure E4. Comparison of the baseline immunostaining of sPLA2 groups V, X, and XIIA in
induced sputum cells in asthmatics and controls. The figure shows the percentage of induced
sputum cells immunostaining positive for the sPLA2 out of all induced sputum cells.
18
Figure E5. Effects of exercise challenge on the percentage of induced sputum cells
immunostaining for sPLA2 groups V and XIIA. Immunostaining for sPLA2-V in bronchial
macrophages (Mac) tended to increase in asthmatic subjects following challenge (A), while no
changes were observed in columnar epithelial cells (Epi) or eosinophils (EOS) in asthmatics, and
no changes were identified in any cell type in controls (B). Immunostaining for sPLA2-XIIA in
asthmatic subjects increased in bronchial macrophages (Mac) and columnar epithelial cells (Epi),
and tended to increase in eosinophils (EOS) (C); while no changes were observed in the control
group (D).
19
Figure E6. Western blots of sPLA2 groups V and X. Western blots from asthmatic induced
sputum samples were conducted in 5 representative subjects (labeled 1-5) at baseline (left) and
post-exercise (right) for sPLA2-X (A) and sPLA2-V (C). A Western blot was also conducted on 5
representative asthmatic (left) and non-asthmatic (right) induced sputum samples post-exercise
(B). Western blots for sPLA2-X were conducted with a rabbit polyclonal antibody (A, B).
Western blots for sPLA2-V were conducted with the rabbit polyclonal antibody (C) and a murine
monoclonal antibody (D). The recombinant protein (rhG V or rhG X) is to the right of the ladder.
20
REFERENCES
E1. Hallstrand, T. S., M. W. Moody, M. M. Wurfel, L. B. Schwartz, W. R. Henderson, Jr.,
and M. L. Aitken. 2005. Inflammatory basis of exercise-induced bronchoconstriction. Am J
Respir Crit Care Med 172(6):679-86.
E2. Crapo, R. O., R. Casaburi, A. L. Coates, P. L. Enright, J. L. Hankinson, C. G. Irvin, N. R.
MacIntyre, R. T. McKay, J. S. Wanger, S. D. Anderson, D. W. Cockcroft, J. E. Fish, and P. J.
Sterk. 2000. Guidelines for methacholine and exercise challenge testing-1999. Am J Respir Crit
Care Med 161(1):309-29.
E3. Miller, M. R., J. Hankinson, V. Brusasco, F. Burgos, R. Casaburi, A. Coates, R. Crapo, P.
Enright, C. P. van der Grinten, P. Gustafsson, R. Jensen, D. C. Johnson, N. MacIntyre, R.
McKay, D. Navajas, O. F. Pedersen, R. Pellegrino, G. Viegi, and J. Wanger. 2005.
Standardisation of spirometry. Eur Respir J 26(2):319-38.
E4. Fahy, J. V., H. A. Boushey, S. C. Lazarus, E. A. Mauger, R. M. Cherniack, V. M.
Chinchilli, T. J. Craig, J. M. Drazen, J. G. Ford, J. E. Fish, E. Israel, M. Kraft, R. F. Lemanske,
R. J. Martin, D. McLean, S. P. Peters, C. Sorkness, and S. J. Szefler. 2001. Safety and
reproducibility of sputum induction in asthmatic subjects in a multicenter study. Am J Respir
Crit Care Med 163(6):1470-5.
E5. Konstan, M. W., R. W. Walenga, K. A. Hilliard, and J. B. Hilliard. 1993. Leukotriene B4
markedly elevated in the epithelial lining fluid of patients with cystic fibrosis. Am Rev Respir Dis
148(4 Pt 1):896-901.
21
E6. Kita, Y., T. Takahashi, N. Uozumi, and T. Shimizu. 2005. A multiplex quantitation
method for eicosanoids and platelet-activating factor using column-switching reversed-phase
liquid chromatography-tandem mass spectrometry. Anal Biochem 342(1):134-43.
E7. Degousee, N., F. Ghomashchi, E. Stefanski, A. Singer, B. P. Smart, N. Borregaard, R.
Reithmeier, T. F. Lindsay, C. Lichtenberger, W. Reinisch, G. Lambeau, J. Arm, J. Tischfield, M.
H. Gelb, and B. B. Rubin. 2002. Groups IV, V, and X phospholipases A2s in human neutrophils:
role in eicosanoid production and gram-negative bacterial phospholipid hydrolysis. J Biol Chem
277(7):5061-73.
E8. Hallstrand, T. S., J. S. Debley, F. M. Farin, and W. R. Henderson, Jr. 2007. Role of
MUC5AC in the pathogenesis of exercise-induced bronchoconstriction. J Allergy Clin Immunol
119(5):1092-8.
E9. Mickleborough, T. D., M. R. Lindley, and S. Ray. 2005. Dietary salt, airway
inflammation, and diffusion capacity in exercise-induced asthma. Med Sci Sports Exerc
37(6):904-14.
Recommended