View
1
Download
0
Category
Preview:
Citation preview
J. Microbiol. Biotechnol.
J. Microbiol. Biotechnol. (2017), 27(3), 514–523https://doi.org/10.4014/jmb.1608.08048 Research Article jmbReview
Production of Cellulases by Rhizopus stolonifer from Glucose-ContainingMedia Based on the Regulation of Transcriptional Regulator CREYingying Zhang1, Bin Tang1,2*, and Guocheng Du1
1School of Biotechnology, Jiangnan University, Wuxi 214000, P.R. China2College of Biochemical Engineering, Anhui Polytechnic University, Wuhu 241000, P.R. China
Introduction
Cellulases are composed of endoglucanases (E.C. 3.2.1.4),
cellobiohydrolases (E.C. 3.2.1.91; E.C. 3.2.1.176), and β-
glucosidases (E.C. 3.2.1.21) [1, 2]. They are widely applied
in textile processing, printing and dyeing, food and brewery
production, detergent production, and biorefinery [2, 3].
However, a low yield with a poor specific activity is a
bottleneck in the application of cellulases. Generally,
industrial cellulase production relies on cellulosic substrates
that induce the secretion of cellulases from filamentous
fungi, the disadvantage of which is the long production
cycle with lower substrate utilization [4]. Much of the
research has examined that cellulase biosynthesis is mainly
adjusted by the induction and the repression of degradation
products. Cellulose, cellobiose, sophorose, lactose, and
derivative cellulose have been shown to be effective in
inducing the formation of Trichoderma cellulases [5-8].
Thus, the bottleneck can be broken if simple carbon sources
like monosaccharide or disaccharides could be utilized to
activate the synthesis of cellulases with a rapid development
of cells, of which the prerequisite is to overcome the carbon
metabolism repression.
Carbon catabolite repression is a crucial regulation
mechanism in microorganisms, preventing the expression
of enzymes required for the utilization of complex carbon
sources when simple carbon sources like glucose are
present in the medium [9]. The transcription factor
responsible for the repression of glucose-regulated genes
has been found in the filamentous fungi; namely, cre1/creA,
which was highly conserved [10-12]. CRE1 can repress the
transcription of cellulases-encoding genes by binding to the
CCCCAC region in the promoter fragment of those genes
[13]. Specifically, CRE1 indirectly regulates the expression
of cbh2 by adjusting another transcription factor, XYR1 [13].
In addition, transport of the inducer sophorose could be
suppressed owing to the presence of glucose [14]. However,
the characteristic of carbon metabolism repression that
regulates cellulases synthesis in Rhizopus has not been
investigated.
In this paper, we studied the regulation of CRE from
Rhizopus stolonifer TP-02, and compared it with the transcription
Received: August 24, 2016
Revised: October 25, 2016
Accepted: November 16, 2016
First published online
November 23, 2016
*Corresponding author
Phone: +86-553-2871210;
Fax: +86-553-2871091;
E-mail: tangbin@ahpu.edu.cn
pISSN 1017-7825, eISSN 1738-8872
Copyright© 2017 by
The Korean Society for Microbiology
and Biotechnology
Carbon catabolite repression is a crucial regulation mechanism in microorganisms, but its
characteristic in Rhizopus is still unclear. We extracted a carbon regulation gene, cre, that
encoded a carbon catabolite repressor protein (CRE) from Rhizopus stolonifer TP-02, and
studied the regulation of CRE by real-time qPCR. CRE responded to glucose in a certain range,
where it could significantly regulate part of the cellulase genes (eg, bg, and cbh2) without cbh1.
In the comparison of the response of cre and four cellulase genes to carboxymethylcellulose
sodium and a simple carbon source (lactose), the effect of CRE was only related to the
concentration of reducing sugars. By regulating the reducing sugars to range from 0.4% to
0.6%, a glucose-containing medium with lactose as the inducer could effectively induce
cellulases without the repression of CRE. This regulation method could potentially reduce the
cost of enzymes produced in industries and provide a possible solution to achieve the large-
scale synthesis of cellulases.
Keywords: Cellulases, carbon catabolite repressor, transcriptional regulation, Rhizopus stolonifer
Cellulase Production Based on Regulation of CRE 515
March 2017⎪Vol. 27⎪No. 3
of four cellulase genes (eg, bg, cbh1, and cbh2) responding to
the cellulosic carbon source carboxymethylcellulose sodium
(CMC) and a simple carbon source (glucose and lactose).
Based on the characters of transcriptional regulator CRE,
we produced cellulases from R. stolonifer by a glucose-
containing medium without the repression of CRE. Moreover,
we discuss the synthesis and regulation mechanism of
cellulases, which could enrich the knowledge of related
fields and provide some basis to engineering and biological
process designs.
Materials and Methods
Strains and Reagents
R. stolonifer TP-02 was isolated in our laboratory and stored in
the China General Microbiological Culture Collection Center
(CGMCC No. 11119). The PCR product purification kit and
plasmid extraction kit were purchased from Sangon Biotech Co.,
Ltd. (China); the RNA extraction kit, cDNA reverse transcription
kit, fluorescence quantitative PCR kit, Pfu DNA polymerase, and
T4 DNA ligase were purchased from Takara Biotechnology Co.,
Ltd. (China).
Identification of Carbon Catabolite Repressor Protein-Encoding
Genes
R. stolonifer TP-02 was cultured in PDA liquid medium and
shaken for 24 h at 30°C (200 rpm). The mycelia were harvested
and freeze-dried. Standard protocols for extraction of the genomic
DNA from the straw enrichment using the CTAB method were
used [15]. Amplification of the DNA fragment encoding CRE was
done by using the primers P1: 5’-CCGGAATTCATGAAGTTT
ATTACTATTACGTC-3’ and P2: 5’-ATAAGAATGCGGCCGCTT
TATTTTCTTGAACAACCT GTC-3’. The amplification protocol
included 30 cycles, and each cycle consisted of an initial pre-
degeneration cycle of 5 min at 95°C followed by a 30 sec denaturing
step at 94°C, a 45 sec annealing step at 54°C, and finally a 50 sec
polymerization cycle at 72°C. The amplification was then switched
to a 10 min polymerization at 72°C. The PCR product was purified
by kit and sequenced by Sangon Biotech Co., Ltd. (China).
Homology alignment of the primary structure between CRE and
other enzymes was carried out in the GenBank database using the
BLAST program, together with the MegAlign program and
ClustalW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/).
Construction of R. stolonifer Δcre
The full-length hygromycin resistance gene hyg was inserted
into cre by overlapping PCR [16]. This constructed gene was
connected with the pUCm-T carrier (purchased from Sangon
Biotech Co., Ltd.) and transformed into E. coli DH5α. The positive
clones were screened and identified by sequencing the plasmid
extracted by kit. This plasmid was added into the pretreatment
spore suspension of R. stolonifer (germinated for 8 h), and placed
on ice for 10 min before being shifted into the pole cup. After
shocking at 1,500 V, the solution was immediately added into 1 ml
of pre-cooled PDA on ice for 20 min, and then cultured at 30°C,
100 rpm for 90 min. Then, it was coated to hygromycin plates
(160 μg/ml) and incubated at 30°C. The positive clones were
screened and identified by amplifying cre and hyg from genomic
DNA. For preparation of the germinated spores, the spores were
rinsed with sterile water, filtrated by two layers of gauze, inoculated
into PDA liquid medium, and cultured at 30°C at 180 rpm for 8 h
until spore germination. Scanning electron microscopy (SEM) was
used to determine the spore germination time.
Real-Time qPCR
Freeze-dried mycelia were rapidly grinded in a prechilled
mortar (180°C, dried 6 h to destroy RNAase) [17, 18]. Total RNA
was extracted by kit, which eliminated the genomic DNA for
synthesis of single-strand cDNA as a template by the reverse
transcription kit. Primers of qPCR were designed according to the
cellulase genes obtained previously (Table 1). The cDNA solution
was diluted 20-fold as a template to amplify the target strip with
the fluorescent dye SYBR. The reaction system contained cDNA
2 μl, SYBR premix Ex TaqII 10 μl, Primer mix 2 μl, and ddH2O 6 μl.
The reaction conditions were pre-incubation at 95°C for 30 sec, 2-
step amplification for 45 cycles (95°C for 10 sec, 58°C for 30 sec),
and melting (95°C for 10 sec, 65°C for 60 sec, 97°C for 1 sec). The
seed cultured in PDA liquid medium and shaken for 24 h at 30°C
(200 rpm) was the reference condition used for comparison as a
fold-change = 1. 18S rRNA was used as the reference gene. Data
analysis was carried out using LightCycler 96 and the mRNA
levels were calculated using the 2-ΔΔCT method [19].
Production of Cellulases by a Glucose-Containing Medium
Both the R. stolonifer parent and Δcre strains were grown on
Table 1. The sequences of primers for qPCR.
Gene Primers Sequences (5’-3’)Size
(bp)
18S RNA 18S-F GTAGTCATATGCTTGTCTC 19
18S-R ATTCCCCGTTACCCGTTG 18
eg EG2-F TTATTGGGTTTGTTGTCAGGC 21
EG2-R GTGCTTTGAATTGATTGCTCC 21
bg BG3-F CGAGGACATTGCCTTGCTGA 20
BG3-R GTTTGTGGAGGGAATAGTGGG 21
cbh1 CBH1-F CTTATTGTGGAGGCGGTTGC 20
CBH1-R CAGGTGGTATCGGTGGAGC 19
cbh2 CBH2-F CCTGGCTATCCCATCCCTC 19
CBH2-R CGTTCTGGGCTTTGATGTCG 20
xyr1 XYR1-F CGTCAGCTCCTACAGCGAC 19
XYR1-R CTACGAATCTCCGCATGAG 19
cre CRE-R CCACTTCCACTATGGCTTCG 20
CRE-F GTGCGGATATGTCTCGTTTGG 21
516 Zhang et al.
J. Microbiol. Biotechnol.
Fig. 1. Results of the multiple alignments of CRE and its similar sequences from other filamentous fungi (GenBank No. O94166,
EHA22819, and GAA82303, respectively).
Cellulase Production Based on Regulation of CRE 517
March 2017⎪Vol. 27⎪No. 3
PDA plates. The spores of these two strains were inoculated on
the fermentation medium in 3 L fermenters and cultured under
the same conditions. By sampling every 6-12 h, the concentration
of reducing sugars was recorded and the FPA activity of the
cellulases was measured by the DNS method described previously
[20]. A unit of enzyme activity was defined as the amount of
enzyme releasing 1 μmol of glucose equivalents per minute. The
concentration of total proteins was determined by the Bradford
method with the kit purchased from Sangon Biotech Co., Ltd. The
fermentation medium consisted of 1% glucose, 1% inducer (CMC
or lactose), 0.5% NH4Cl, 0.5% KH2PO4, 0.4% MgSO4.7H2O, 0.4%
CaCl2, 0.025% PEG4000, trace element solution, Tween-80, 1.2%
methionine, and 0.6% yeast extract.
Results
Characteristics of CRE Response to Glucose
The transcription factor CreA contains two zinc finger
domains and is the main regulator responsible for carbon
repression in filamentous fungi [21, 22]. Previous studies of
the zinc finger protein have emphasized its crucial role in
the transcriptional regulation of eukaryotes [23]. In this
study, the carbon repressor gene cre was cloned from
R. stolonifer (GenBank No. KP702729). The gene is 1,284 bp
long, and encodes a 428-amino-acid protein, CRE. The
ClustalW2 alignment showed that CRE contains two
analogous C2H2 zinc finger domains that are similar to
the CREA (GenBank No. O94166) in Aspergillus aculeatus
(Fig. 1A). The percent identity (calculated by MegAlign)
between CRE and CREA was 88.9% (Fig. 1B). Analysis of
the PROSITE and CDD engine indicated that there were
multiple functional domains in CRE, in which the main
structure was the zinc finger from Thr68 to Pro327 that
could bind to DNA.
To study the response characters of CRE, the transcription
level of cre was measured after cultivating the cells in
different concentrations of glucose that ranged from 0.2%
to 1%. The results showed that transcription levels of cre in
all the samples peaked at 4 h (Fig. 2A), which was selected
as the sampling point for the following research. In order
to build a complete response curve of CRE, the sugar
concentration was expanded to 4%. The relative mRNA
expression of CRE peaked in 0.8% glucose and decreased
gradually as the concentration of sugars increased to 2%
(Fig. 2B). Unexpectedly, the transcription of cre began to
level off when the concentration of glucose was above 2%.
It indicated that a higher glucose concentration does not
lead to a higher level of expression of cre, only if the
concentration was less than 0.8%.
Effect of CRE on the Transcription Level of Cellulase
Genes
It has been confirmed that CRE participates in the
regulation of expression of cellulase-coding genes. In this
paper, we intended to study the regulation of CRE on
cellulase genes responding to the concentration of glucose.
The transcription levels of four cellulase genes (eg, bg, cbh1,
and cbh2) were measured after cultivating the cells in
different concentrations of sugars for 4 h as described
before. The results showed that the regulation of CRE was
phased: When the concentration was lower than 0.6%, the
Fig. 2. Response characteristics of CRE to glucose.
(A) Time axis of the relative transcription levels of cre. The dotted line corresponds to the secondary ordinate. (B) Complete response curve of
CRE.
518 Zhang et al.
J. Microbiol. Biotechnol.
response of CRE was weak (Fig. 2B) and thus all the
cellulase genes were transcribed normally (Fig. 3), which
was named the control delayed period. When the
concentration ranged from 0.6% to 1%, CRE regulated the
Fig. 3. Relative transcription levels of four cellulase genes (eg, bg, cbh1, and cbh2) and xyr1 in cells cultivated in different
concentrations of sugars for 4 h.
All the tested genes, except cbh1, were repressed when the concentration of glucose was above 0.6%.
Cellulase Production Based on Regulation of CRE 519
March 2017⎪Vol. 27⎪No. 3
expression of cellulase genes (eg, bg, and cbh2) with an
obvious linear relationship, which was named the control
linear period. Once the concentration was higher than
1.2%, the regulation of CRE displayed stability control. It
means that CRE could effectively regulate the expression
of cellulases from R. stolonifer, except cbh1, when the
concentration of glucose was higher than 0.6%. To confirm
the indirect regulation of CRE on the expression of cbh2
by adjusting xyr1, the transcription level of xyr1 was
determined. Results in Figs. 3C and 3D show that there was
a significant correlation between xyr1 and cbh2 when the
glucose content was higher than 0.6%. In particular, the
transcription of xyr1 was most sensitive to CRE. In
addition, the expression of cbh1 was reported to be strictly
controlled by the carbon source, which could be increased
by above 1,000 times when cellulose was present in the
medium, and could be completely inhibited under the
condition of glucose [14]. However, there was no obvious
correlation between the transcription level of cre and cbh1
from R. stolonifer. The tendency of the transcription level
that cbh1 displayed was different from the other tested
genes, with an irregular fluctuation (Fig. 3E). However, it
Fig. 4. Construction and characterization of Rhizopus stolonifer Δcre.
(A) SEM photographs show that the spore morphology began to change in 8 h and hyphae were formed in 9 h. (B) Agarose gel electrophoresis of
cre and hyg amplified from R. stolonifer Δcre (Lines 1 and 2) and parent TP-02 (Lines 3 and 4). (C) Relative mRNA expression levels of CRE and
cellulases produced by R. stolonifer parent and Δcre strains.
520 Zhang et al.
J. Microbiol. Biotechnol.
seems positively related with the concentration of sugars,
which indicated that the carbon catabolite repression has a
weak regulation on cbh1. Consequently, there might be
another regulation approach of cbh1 present in the R.
stolonifer unlike with other filamentous fungi.
CreA can participate in the regulation of the transcription
and translation processes by binding to regulatory elements
in the promoters of target genes [23, 24]. Previous studies
suggested that CRE1 was partially involved in the negative
regulation of cellulase and hemicellulase genes from
Trichoderma. For cbh2, xyn2, and bgl1 gene expression, no
such direct regulatory effect caused by CRE1 could be
observed [25]. In order to further confirm the regulation of
CRE, we destroyed cre by inserting the full-length gene of
hygromycin, hyg, using overlapping PCR, and constructed
the R. stolonifer Δcre by homologous recombination using
R. stolonifer TP-02 as the parent strain. To obtain higher
transformation efficiency, the spore germination time was
optimized. The SEM photographs revealed that the
optimum germination time of spores was 8 h (Fig. 4A). The
end fragments of cre and hyg were used as probes to extract
target genes from the R. stolonifer TP-02 and Δcre strains,
respectively. The length of the gene extracted from Δcre by
the cre probe was 2,358 bp, which contained the hyg
sequence (1,074 bp). Moreover, the full length of hyg has
been cloned from the genomic DNA of strain Δcre instead
of the parent strain. These results showed that cre has been
successfully destroyed by inserting hyg (Fig. 4B). Both
R. stolonifer parent and Δcre strains were grown on the 0.8%
glucose-containing media for 4 h, in which the relative
mRNA expression of cre could be maximized. Transcription
levels of cellulases produced by R. stolonifer parent and
Δcre strains were assayed by qPCR. As shown in Fig. 4C,
all the tested genes, except cbh1, were significantly
downregulated in R. stolonifer parent. The transcription
levels of eg, bg, cbh1, cbh2, and xyr1 were repressed by CRE
by 67.1%, 75.2%, 15.2%, 71.6%, and 71.8%, respectively.
These results indicated that CRE plays a key role in the
production of cellulases from R. stolonifer.
Features of the CRE Response to Different Substrates
Lactose has been widely utilized to induce the production
of cellulases in industry, which can also be digested into
glucose and galactose by the β-glucosidases [5]. Compared
with lactose, CMC is an artificial cellulose derivative with a
simple composition, which is used instead of complex and
insoluble celluloses such as microcrystalline cellulose, rice
straw, and straw to study the induction of cellulose
substrates on the cellulases. The relative mRNA expression
of CRE and cellulases was assayed in MA medium containing
1% CMC or 1% lactose as the inducer, respectively. The
results showed that the relative mRNA expression of
cellulases under the CMC condition was generally higher
than under lactose, with a longer induction period (Fig. 5).
The concentration of reducing sugars was determined,
which maintained at a lower level when CMC was used as
an inducer, resulting in a weak transcription of cre (Fig. 5A).
In contrast, the transcription of cre was stronger at the
initial induction stage of lactose, of which the relevant
reducing sugars was also higher than that of CMC (Fig. 5B).
Fig. 5. Relative mRNA expression levels of CRE and cellulases induced by CMC (A) and lactose (B).
The change of transcription level of cre was strongly correlated with the reducing sugar content. In addition, the transcription level of cellulase
genes peaked in 0.4%-0.6% reducing sugar content with lower repression by CRE.
Cellulase Production Based on Regulation of CRE 521
March 2017⎪Vol. 27⎪No. 3
The reducing sugars released from CMC are glucose and
cellobiose, whereas that released from lactose are glucose
and galactose. The change of transcription level of cre
has strong correlation with the reducing sugar content.
Furthermore, the relative mRNA expression of cre in
different reducing sugar contents was similar to the results
measured under the condition of glucose (Fig. 2B). These
indicated that the transcription of cre was only related with
the concentration of reducing sugars, no matter which
substrate was selected.
In addition, the transcription of cbh1 displayed a sensitivity
of the reducing sugars; namely, the reducing end was likely
to stimulate the transcription of cbh1. Moreover, there was
a significant effect of lactose on the induction of bg, and a
similar effect of CMC on the induction of eg. The presence
of reducing sugars at a high level greatly inhibited the
transcription of cellulase genes owing to the negative
regulation of CRE and the substrate inhibition. However,
this inhibition might be overcome if the concentration of
reducing sugars could be maintained at the range from
0.4% to 0.6%.
Production of Cellulases on Glucose-Containing Media
Because the fermentation time is generally long and the
production costs are high owing to the characteristics of the
strains and the factors of culture conditions, filamentous
fungi currently used in cellulase production are hardly
fast and efficient [26]. To produce more cellulases from
Fig. 6. Production of cellulases on glucose-containing media in 3 L fermenters.
(A) Non-cellulosic substrates also could induce cellulases in low levels. (B) Cellulase production in Rhizopus stolonifer by regulating the
concentration of glucose at around 0.5% after 30 h (TP-02-Regulate 1). R. stolonifer TP-02 cultured without regulating the glucose content acted as a
control group; the reducing sugars were determined as RS-Normal. (C) Regulating the glucose content at around 1% after 30 h (TP-02-Regulate 2)
or throughout the fermentation period (TP-02-Regulate 3). (D) The protein content was determined with the Bradford method.
522 Zhang et al.
J. Microbiol. Biotechnol.
R. stolonifer in a relatively short time, a glucose-containing
medium was utilized. Although the traditional substrates
for producing cellulases is cellulosic substrates, the non-
cellulosic substrates containing glucose, disaccharides, and
oligosaccharides usually attract the attention of the carbon
metabolic repression they caused, thereby ignoring the low
expression levels of cellulases under these conditions
(Fig. 6A) [27]. Based on the characteristics of CRE described
above, lactose was selected as the inducer of the glucose-
containing medium. Spores of R. stolonifer parent and Δcre
strains were inoculated on the medium mentioned before
in 3 L fermenters and cultured under the same conditions.
According to the change of reducing sugar concentration,
additional glucose was added into the fermenter of
R. stolonifer TP-02 at 30 h for keeping the concentration of
reducing sugars at around 0.5% (group TP-02-Regulate 1).
The R. stolonifer in normal fermentation without additional
feeding was appointed as the control group. The activity of
cellulases produced by the R. stolonifer parent and Δcbs
strains was assayed. As shown in Fig. 6B, the FPA activity
of cellulases produced by R. stolonifer that was regulated by
additional glucose (3.75 IU/ml) feeding was significantly
higher than the one without additional feeding (1.96 IU/ml).
Moreover, the maximum activity of the samples that were
regulated was close to the value of Δcbs (4.16 IU/ml).
To study the cellulase production at higher glucose content,
two additional control groups were carried out (Fig. 6C).
One group was regulated to 1% glucose content at the same
time as group TP-02-Regulate 1 (TP-02-Regulate 2). The
other was regulated throughout the fermentation period to
maintain a 1% glucose content (TP-02-Regulate 3). The FPA
activity of cellulases produced by group TP-02-Regulate 2
(1.96 IU/ml) was significantly higher than that of TP-02-
Regulate 3 (0.72 IU/ml). However, the cellulase production
of group TP-02-Regulate 2 was similar to the control group
and lower than group TP-02-Regulate 1. Moreover, according
to the protein content (Fig. 6D), feeding fermentation could
obtain more total proteins. Besides this, it indicated that a
higher glucose level cannot achieve higher cellulase
production. These results suggested that a simple carbon
source could be used to effectively produce cellulases from
filamentous fungi without the repression of CRE, by
regulating the concentration of reducing sugar range at
0.4%-0.6%.
Discussion
Overcoming the carbon catabolite repression mechanism
is critical for utilizing simple carbon sources to produce
cellulases from filamentous fungi. For the first time reported,
we characterized the regulation of CRE on cellulase-
encoding genes responding to cellulosic substrates (CMC)
and simple carbon (glucose and lactose), which indicated
that the effect of CRE was only related to the concentration
of reducing sugars. CRE could effectively regulate the
expression of cellulases from R. stolonifer, except cbh1,
when the concentration of glucose was higher than 0.6%.
Based on the characteristics of CRE, we effectively produced
cellulases by a glucose-containing medium with lactose as
the inducer, by regulating the reducing sugar to range from
0.4% to 0.6% without the repression of CRE. With further
improvements, this regulation method could potentially
reduce the cost of enzymes produced in industries and
provide a possible solution to achieve large-scale synthesis
of cellulases, since a simple carbon source can be utilized to
activate the synthesis of cellulases with a rapid development
of cells.
Acknowledgments
This work was financially supported by the National
Natural Science Foundation of China (No. 31270135).
References
1. Kuhad RC, Deswal D, Sharma S, Bhattacharya A, Jain KK,
Kaur A, et al. 2016. Revisiting cellulase production and
redefining current strategies based on major challenges.
Renew. Sustain. Energy Rev. 55: 249-272.
2. Payne CM, Knott BC, Mayes HB, Hansson H, Himmel ME,
Sandgren M, et al. 2015. Fungal cellulases. Chem. Rev. 115:
1308-1448.
3. Juturu V, Wu JC. 2014. Microbial cellulases: engineering,
production and applications. Renew. Sustain. Energy Rev. 33:
188-203.
4. Hidenoa A, Inouea H, Tsukahara K, Yanoa S, Fang X, Endo
T, et al. 2011. Production and characterization of cellulases
and hemicellulases by Acremonium cellulolyticus using rice
straw subjected to various pretreatments as the carbon
source. Enzyme Microb. Technol. 48: 162-168.
5. Bischof R, Fourtis L, Limbeck A, Gamauf C, Seiboth B,
Kubicek CP. 2013. Comparative analysis of the Trichoderma
reesei transcriptome during growth on the cellulase inducing
substrates wheat straw and lactose. Biotechnol. Biofuels 6: 127.
6. Chen S, Wayman M. 1992. Novel inducers derived from
starch for cellulase production by Trichoderma reesei. Process
Biochem. 27: 327-334.
7. Mandels M, Parrish FW, Reese ET. 1962. Sophorose as an
inducer of cellulase in Trichoderma viride. J. Bacteriol. 83: 400-
408.
Cellulase Production Based on Regulation of CRE 523
March 2017⎪Vol. 27⎪No. 3
8. Nogueira KMV, Costa MN, de Paula RG, Mendonça-
Natividade FC, Ricci-Azevedo R, Silva RN. 2015. Evidence
of cAMP involvement in cellobiohydrolase expression and
secretion by Trichoderma reesei in presence of the inducer
sophorose. BMC Microbiol. 15: 195.
9. Ronne H. 1995. Glucose repression in fungi. Trends Genet.
11: 12-17.
10. Drysdale MR, Kolze SE, Kelly JM. 1993. The Aspergillus niger
carbon catabolite repressor encoding gene, creA. Gene 130:
241-245.
11. Lorito M, Mach RL, Sposato P, Strauss J, Peterbauer CK,
Kubicek CP. 1996. Mycoparasitic interaction relieves binding
of the Cre1 carbon catabolite repressor protein to promoter
sequences of the ech42 (endochitinase-encoding) gene in
Trichoderma harzianum. Proc. Natl. Acad. Sci. USA 93: 14868-
14872.
12. Strauss J, Mach RL, Zeilinger S, Hartler G, Stöffler G,
Wolschek M, et al. 1995. Cre1, the carbon catabolite
repressor protein from Trichoderma reesei. FEBS Lett. 376:
103-107.
13. Mach-Aigner AR, Pucher ME, Steiger MG, Bauer GE, Preis
SJ, Mach RL. 2008. Transcriptional regulation of xyr1,
encoding the main regulator of the xylanolytic and
cellulolytic enzyme system in Hypocrea jecorina. Appl.
Environ. Microbiol. 74: 6554-6562.
14. Ries L, Belshaw NJ, Ilmén M, Penttilä ME, Alapuranen M,
Archer DB. 2014. The role of CRE1 in nucleosome
positioning within the cbh1 promoter and coding regions of
Trichoderma reesei. Appl. Microbiol. Biotechnol. 98: 749-762.
15. Lipp M, Brodmann P, Pietsch K, Pauwels J, Anklam E. 1999.
IUPAC collaborative trial study of a method to detect
genetically modified soy beans & maize in dried powder. J.
AOAC Int. 82: 923-928.
16. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. 1989.
Site-directed mutagenesis by overlap extension using the
polymerase chain resction. Gene 77: 51-59.
17. Damsteegt EL, McHugh N, Lokman PM. 2016. Storage by
lyophilization - resulting RNA quality is tissue dependent.
Anal. Biochem. 511: 92-96.
18. Pearson G, Lago-Leston A, Valente M, Serrão E. 2006.
Simple and rapid RNA extraction from freeze dried tissue
of brown algae and seagrasses. Eur. J. Phycol. 41: 97-104.
19. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene
expression data using real-time quantitative PCR and the
2-ΔΔCT method. Methods 25: 402-408.
20. Miller GL, Blum R, Glennon WE, Burton AL. 1960. Measurement
of carboxymethylcellulase activity. Anal. Biochem. 1: 127-132.
21. Cubero B, Scazzocchio C. 1994. Two different, adjacent and
divergent zinc finger binding sites are necessary for CREA-
mediated carbon catabolite repression in the proline gene
cluster of Aspergillu nidulans. EMBO J. 13: 407-415.
22. Ruijter GJG, Visser J. 1997. Carbon repression in aspergilli.
FEMS Microbiol. Lett. 151: 103-114.
23. MacPherson S, Larochelle M, Turcotte B. 2006. A fungal
family of transcriptional regulators: the zinc cluster proteins.
Microbiol. Mol. Biol. Rev. 70: 583-604.
24. Yang F, Gong Y, Liu G, Zhao S, Wang J. 2015. Enhancing
cellulase production in thermophilic fungus Myceliophthora
thermophila ATCC42464 by RNA interference of cre1 gene
expression. J. Microbiol. Biotechnol. 25: 1101-1107.
25. Mach RL, Zeilinger S. 2003. Regulation of gene expression
in industrial fungi: Trichoderma. Appl. Microbiol. Biotechnol.
60: 515-522.
26. Berka RM, Grigoriev IV, Otillar R, Salamov A, Grimwood J,
Reid I, et al. 2011. Comparative genomic analysis of the
thermophilic biomass-degrading fungi Myceliophthora thermophila
and Thielavia terrestris. Nat. Biotechnol. 29: 922-929.
27. Hsieh CC, Cannella D, Jørgensen H, Felby C, Thygesen LG.
2014. Cellulase inhibition by high concentrations of
monosaccharides. J. Agric. Food Chem. 62: 3800-3805.
Recommended