View
1
Download
0
Category
Preview:
Citation preview
Probing the Acute and Chronic Inflammation in Pcyt2 ETKO Mouse
Model of Metabolic Syndrome
by
Albert Yu-Yao Chang
A Thesis
presented to
The University of Guelph
In partial fulfillment of requirements
for the degree of
Master of Science
in
Human Health and Nutritional Sciences
Guelph, Ontario, Canada
© Albert Yu-Yao Chang, December, 2013
ABSTRACT
PROBING THE ACUTE AND CHRONIC INFLAMMATION IN PCYT2 ETKO
MOUSE MODEL OF METABOLIC SYNDROME
Albert Chang Advisor:
University of Guelph, 2013 Dr. Marica Bakovic
CTP: phosphoethanolamine cytidylyltransferase (Pcyt2) catalyzes the rate-limiting step
of the Kennedy pathway. Pcyt2 heterozygous knockouts (ETKO) suffer from adult onset
obesity, liver steatosis, hypertriglyceridemia, and insulin resistance. This thesis project
demonstrated that Pcyt2 ETKO obesity increases liver sensitivity to acute inflammation since
enhanced LPS induction of hepatic pro-inflammatory cytokine TNFα and suppressed
anti-inflammatory cytokine IL-10 genes expression was detected in ETKO mice than wildtype
(WT) mice leading to more TNFα damage and less IL-10 protection. ETKO had higher
hepatic NF-κBp65 protein level than WT indicating that Pcyt2 ETKO obesity results in
chronic hepatic inflammation. Sea buckthorn extract treatment reduced 4 symptoms of
metabolic syndrome in Pcyt2 ETKO mice specifically decreased body weight, lowered tissue
lipids (and consequently alleviated NAFL) and blood glucose levels.
iii
Acknowledgments
Firstly, I like to acknowledge my advisor Dr. Marica Bakovic for accepting me
as a MSc student and for her continuous support throughout the years. Next, I like to
thank Dr. Lindsay Robinson for serving on my advisory committee and for her
guidance throughout my time in the department. Thanks to Dr. William Bettger for
serving as my thesis defence chair. Also, I like to acknowledge members of the
Bakovic lab specifically Dr. Ratnesh Singh, Zvezdan Pavlovic, Poulami Basu, Laila
Schenkel, Mandy Stefanson, Jessica Phulchand, Rameez Imtiaz, Shafeeq Armstrong,
and Nicholas Mozas for their assistance. OMAFRA and HHNS deserve credits for
their support. Thanks to Dr. Gopinadhan Paliyath for providing the extract. On a more
personal note, thank you to my family (Mom, Dad, and Rose), relatives, and friends
for the tremendous support and motivation.
iv
Table of Contents
Abstract ii
Acknowledgments iii
Table of Contents iv
List of Tables vi
List of Figures vii
List of Abbreviations ix
Chapter 1: Literature Review 1
Chapter 2: Rationale, Hypotheses, and Objectives 16
Chapter 3: Pcyt2 ETKO Obesity Increases Liver Sensitivity to LPS-Induced
Acute Inflammation and Results in Chronic Hepatic Inflammation
Introduction 19
Experimental Procedures 21
Results 27
Discussion 35
Conclusion 40
Chapter 4: Sea Buckthorn Extract Diet Alleviates Metabolic Syndrome in Pcyt2
ETKO
Introduction 41
Experimental Procedures 43
Results 48
Discussion 63
Conclusion 67
v
Chapter 5: General Discussion and Concluding Remarks 68
Bibliography 71
Appendix A: specific cytokine primers used in Chapter 3 PCR analyses 83
Appendix B: specific cytokine primers used for Chapter 4 PCR analyses 84
vi
List of Tables
Chapter 3:
Table 3.1 LPS treatment induction of hepatic cytokine gene expression
compared to untreated 38
Appendices:
Appendix A: specific cytokine primers used in Chapter 3 PCR analyses 83
Appendix B: specific cytokine primers used for Chapter 4 PCR analyses 84
vii
List of Figures
Chapter 1:
Figure 1.1- CDP-Ethanolamine Pathway in Pcyt2 ETKO mice 11
Chapter 3:
Figure 3.1- Body weight of WT and ETKO mice 27
Figure 3.2- Hepatic interleukin 12 (IL-12) gene expression with and without
LPS treatment 28
Figure 3.3- Hepatic tumor necrosis factor alpha (TNFα) gene expression with
and without LPS treatment 29
Figure 3.4- Hepatic interferon gamma (IFNγ) gene expression with and
without LPS treatment 30
Figure 3.5- Hepatic interleukin 10 (IL-10) gene expression with and without
LPS treatment 31
Figure 3.6- Hepatic transforming growth factor beta 1 (TGF-β1) gene
expression with and without LPS treatment 32
Figure 3.7- Hepatic NF-κBp65 protein western blot 33
Figure 3.8- Liver Immunohistochemistry 34
Chapter 4:
Figure 4.1- Body weight change in sea buckthorn extract treated and control
mice 49
Figure 4.2- Retroperitoneal adipose tissue weight after sea buckthorn extract
Treatment 50
Figure 4.3- Liver weight after sea buckthorn extract treatment 51
viii
Figure 4.4- Pre-treatment (sea buckthorn extract, 30 days) IP glucose
tolerance test (IPGTT) 53
Figure 4.5- Pre-treatment (sea buckthorn extract, 30 days) IPGTT AUC 54
Figure 4.6- Post-treatment (sea buckthorn extract, 30 days) IPGTT 56
Figure 4.7- Post-treatment (sea buckthorn extract, 30 days) IPGTT AUC 57
Figure 4.8- Hepatic interleukin 12 (IL-12) gene expression with and without
sea buckthorn extract treatment 59
Figure 4.9- Hepatic transforming growth factor beta 1 (TGF-β1) gene
expression with and without sea buckthorn extract treatment 61
Figure 4.10- Liver histology after sea buckthorn extract treatment 62
ix
List of Abbreviations
ACC acetyl-CoA carboxylase
AUC area under curve
BCA bicinchoninic acid
BMI body mass index
cDNA complementary deoxyribonucleic acid
COX-2 cyclooxygenase-2
CPT-1 carnitine palmitoyltransferase-1
CRP C-reactive protein
DAG diacylglycerol
DEPC diethylpyrocarbonate
DGAT1/2 diacylglycerol acyltransferase 1/2
EK ethanolamine kinase
EPT CDP-ethanolamine 1,2-diacylglycerol ethanolaminephosphotransferase
ER endoplasmic reticulum
ES embryonic stem
Eth ethanolamine
ETKO heterozygous knockout
G3PDH glyceraldehyde 3-phosphate dehydrogenase
x
IFNγ interferon γ
IgG immunoglobulin G
IL-10 interleukin 10
IL-12 interleukin 12
iNOS inducible nitric oxide synthase
IPGTT intraperitoneal glucose tolerance test
IRAK interleukin–1 receptor-associated kinase
JAK-STAT Janus kinase–signal transducer and activator of transcription
LBP LPS-binding protein
LPS lipopolysaccharide
mRNA messenger ribonucleic acid
MyD88 myeloid differentiation factor 88
NADPH nicotinamide adenine dinucleotide phosphate
NAFLD nonalcoholic fatty liver disease
NASH non-alcoholic steatohepatitis
NF-κB nuclear factor kappa-light-chain-enhancer of activated B cells
PBS phosphate buffered saline
PC phosphatidylcholine
PCR polymerase chain reaction
xi
Pcyt1 CTP: choline cytidylyltransferase
Pcyt2 CTP: phosphoethanolamine cytidylyltransferase
PE phosphatidylethanolamine
P-Eth phosphoethanolamine
PPAR peroxisome proliferator-activated receptor
PS phosphatidylserine
PSD PS decarboxylase
PVDF polyvinylidene difluoride
RNA ribonucleic acid
rpm revolutions per minute
SB sea buckthorn
TAG triacylglycerol
TG triglyceride
TGF-β1 transforming growth factor beta 1
TLR4 Toll-like receptor 4
TNFα tumor necrosis factor alpha
TRAF tumor necrosis factor receptor–associated factor
UPR unfolded protein response
WB western blotting
xii
WHO World Health Organization
WT wildtype
1
Chapter 1: Literature Review
Obesity and General Health
The World Health Organization (WHO) defined obesity as having a Body Mass
Index (BMI; body weight in Kg divide by the square of height in m) of 30 Kg/m2 or
greater (WHO, 2000). Obesity is a medical condition characterized by excess body
fat accumulation and is becoming more prevalent especially in the Western world to
the point of being a serious public health issue (Haslam and James, 2005). In Canada,
approximately one quarter of adults are obese (The Public Health Agency of Canada
and The Canadian Institute for Health Information, 2011). Similar prevalence exists in
the WHO European Region in which 23% of women and 20% of men are estimated to
be obese (WHO Europe, 2008). Obesity is one of the leading preventable causes of
death worldwide (Lopez et al., 2006). Causes of obesity include overeating, inactive
lifestyle, and genetics among others. In terms of genetics, variations of certain
candidate genes including many genes that are highly expressed in the central nervous
system may predispose individuals to obesity (Lee, 2009, Willer et al., 2009).
Examples of candidate genes with protein name in brackets include PCSK1
(Proprotein convertase subtilisin/kexin type 1), POMC (Pro-opiomelanocortin), and
MC4R (Melanocortin receptor 4) (Renström et al., 2009, Farooqi and O’Rahilly,
2006).
2
This disease is a risk factor for a number of diverse diseases including type 2
diabetes, hyperlipidemia, cardiovascular disease, osteoarthritis, various infections,
cancer, pulmonary diseases, liver disorder as well as systematic chronic low-grade
inflammation (Yang et al., 1997, National Institutes of Health Consensus
Development Panel on the Health Implications of Obesity, 1985, de Luca and Olefsky,
2008, Lumeng and Saltiel, 2011). Some of these diverse diseases are closely related to
components of metabolic syndrome which the International Diabetes Foundation
defined as central adiposity with at least two of the following: high triglyceride (TG),
low high-density lipoprotein cholesterol (HDL-C), hypertension, obesity, and/or
insulin resistance (Cherniack, 2011). Inflammation refers to vascular tissue (e.g. liver,
adipose tissue, and muscle) response to harmful stimuli such as pathogens, damaged
cells, or irritants (Ferrero-Miliani et al., 2007). Obesity affects multiple tissues and
organs namely brain, adipose tissue, liver, muscle, and blood vessels (Lumeng and
Saltiel, 2011). This disease activates brain and adipose tissue inflammatory pathways
leading to insulin resistance with final outcomes of hypothalamic inflammation and
adipocyte enlargement (Lumeng and Saltiel, 2011). In liver, muscle, and blood vessels,
elevated cytokines lead to hepatic and muscular insulin resistance as well as
atherosclerosis (Lumeng and Saltiel, 2011). The common condition that detriments all
these five systems is inflammation enabling classification of obesity as an
3
inflammatory disease to be appropriate. Obesity stimulates inflammatory response
that is involved in many components of classical inflammatory response to pathogen
such as systemic increases in acute phase proteins (e.g., C-reactive protein) and
circulating inflammatory cytokines (Lumeng and Saltiel, 2011).
Obesity and Liver Disease
The proposed pathogenesis of obesity-associated liver disease originates with
hepatic steatosis (fat accumulation as TG but without inflammation leading first to
non-alcoholic steatohepatitis (NASH; fat accumulation with liver inflammation) then
progressing to cirrhosis (replacement of liver tissue by fibrosis, scar tissue, and
regenerative nodules) ultimately resulting in liver failure (Yang et al., 1997, Lee, 1989,
Powell et al., 1990, Bacon et al., 1994, Ludwig et al., 1980, Marchesini et al., 2008,
Tran and Gual, 2013). The most likely mechanism of obesity-induced hepatic
inflammation starts with hepatic steatosis which activates stress/inflammatory
pathways (de Luca and Olefsky, 2008). Activated stress/inflammatory pathways
increase hepatocyte free fatty acid release which stimulates liver resident
macrophages called Kupffer cells to increase expression of TNFα, MCP1, and other
pro-inflammatory cytokines ultimately making the liver to be pro-inflammatory (de
Luca and Olefsky, 2008). Endoplasmic reticulum (ER) stress is another possible cause
of obesity-induced liver inflammation (de Luca and Olefsky, 2008). It is believed that
4
nutrient abundance overworks ER by increasing lipid accumulation and protein
synthesis, causing abnormal energy metabolism as well as inducing mechanical stress
(de Luca and Olefsky, 2008). This heightened synthetic state activates unfolded
protein response (UPR) and interferes with normal protein folding in which the
response is known to induce stress response pathways (de Luca and Olefsky, 2008). In
addition, iron accumulation possibly links obesity to liver inflammation. Obesity can
lead to nonalcoholic fatty liver disease (NAFLD) in which hepatic iron accumulation
is present in NAFLD (Kohgo et al., 2007, Aigner et al., 2008). Hepatic iron
accumulation may activate Kupffer cells and other hepatic macrophages resulting in
cytokine release, inflammatory cell recruitment and inflammation (Tran and Gual,
2013, MacDonald et al., 2001).
Cytokines
Cytokines are small signaling proteins such as interleukins and interferons that
regulate host responses to infection, immune responses, inflammation, and
trauma (Dinarello, 2000). Some cytokines called pro-inflammatory cytokines promote
inflammation whereas other cytokines termed anti-inflammatory cytokines suppress
the activity of pro-inflammatory cytokines and promote healing (Dinarello, 2000).
Examples of pro-inflammatory cytokines include interferon γ (IFNγ), tumor necrosis
factor-alpha (TNFα), and interleukin 12 (IL-12) (Yang et al., 1997, Francoeur et al.,
5
2004, Trinchieri, 1995). For anti-inflammatory cytokines, two examples are
interleukin 10 (IL-10) and transforming growth factor beta 1 (TGF-β1) (Li et al.,
2012). IFNγ regulates transcription of many genes (e.g. iNOS, CASP1, and SLC11A1)
involved in various cellular processes including nitric oxide production, apoptosis,
and antimicrobial mechanisms (Schroder et al., 2004). Il-12 activates natural killer
cells and is involved in the differentiation of naive T cells into Th1 cells (Schroder et
al., 2004, Hsieh et al., 1993). Il-10 activates Janus kinase which is one of the main
components of Janus kinase–signal transducer and activator of transcription
(JAK-STAT) signaling pathway important in transcriptional regulation (Tanuma et al.,
2001, Aaronson and Horvath, 2002).
Role of Kupffer Cells in Obesity
Kupffer cells are hepatic resident macrophages that clear portal blood endotoxin
(Yang et al., 1997). Endotoxin is also known as lipopolysaccharide (LPS) (Rietschel
et al., 1994). These cells also produce pro-inflammatory cytokines IFNγ, TNFα, and
IL-12 as well as anti-inflammatory cytokines IL-10 and TGF-β1 (Yang et al., 1997,
Decker, 1990, Grewe et al., 1994, Li et al., 2012, Clementi et al., 2009, Francoeur et
al., 2004, Trinchieri, 1995). LPS activates Kupffer cells triggering the production of
TNFα (Yang et al., 1997, Lanthier et al., 2011, Baffy, 2009, Abdel-Salam et al., 2012).
TNFα in turn promotes inflammation by stimulating pro-inflammatory lipid gene
6
expression specifically type II phospholipase A2 (PLA2), cyclooxygenase-2 (COX-2),
as well as inducible nitric oxide synthase (iNOS) (Dinarello, 2000). These genes
encode for enzymes that increase the synthesis of platelet-activating factor,
leukotrienes, prostanoids, and nitric oxide (Yang et al., 1997, Dinarello, 2000). In
addition, TNFα induces endothelial adhesion molecules leading to neutrophil
adhesion to endothelial surface with subsequent neutrophil emigration into tissues
(Dinarello, 2000). Furthermore, TNFα stimulates pro-inflammatory chemokine
synthesis (Dinarello, 2000). Neutrophil endothelial adhesion and neutrophil
emigration along with nitric oxide, platelet-activating factor, and leukotrienes lead to
inflammation, tissue damage, and loss of function (Dinarello, 2000). Work on ob/ob
mice and fa/fa rats demonstrated that obesity is associated with abnormal Kupffer cell
function specifically decreased phagocytic activity resulting in more endotoxin
staying in the systematic circulation (Yang et al., 1997). In addition, it seems that
there might be relative global dysfunction of Kupffer cell in obesity, indicated by
abnormal LPS induction of IL-10 and IL-12 (Yang et al., 1997).
Role of NF-κB
The transcription factor nuclear factor kappa-light-chain-enhancer of activated B
cells (NF-κB) is a protein complex involved in cellular responses to stimuli such as
cytokines, bacterial or viral antigens, free radicals, stress, oxidized low density
7
lipoprotein, and ultraviolet irradiation (Gilmore, 2006, Brasier, 2006, Perkins, 2007,
Gilmore, 1999, Tian and Brasier, 2003). NF-κB is composed of five distinct subunits:
p65 (RelA), p68 (RelB), p75 (c-Rel), p50 (NFkB1), and p52 (NFkB2), but only p65
can activate transcription (Zhu, Johnson, and Bakovic, 2008, Haffner, Berlato, and
Doppler, 2006). This transcription factor is inactive in cytoplasm when bound to
inhibitory IκB proteins (Wheeler, 2004, Reber et al., 2009). Upon stimuli (e.g. LPS),
IκB proteins are released from NF-κB and this transcription factor translocates to the
nucleus to become active (Wheeler, 2004, Reber et al., 2009). Once activated, NF-κB
controls transcription of multiple genes including cytokines (e.g. TNFα, IL-6, IL-1A),
cell adhesion molecules (e.g. CD44, CD209), acute phase genes (e.g. AGT, DEFB2),
and stress response genes (e.g. CYP2C11, CYP7B1) (Collart et al., 1990, Son et al.,
2008, Mori and Prager, 1996, Hinz et al., 2002, Liu et al., 2003, Brasier et al., 1990,
Kao et al., 2008, Morgan, Li-Masters, and Cheng, 2002, Dulos et al., 2005). NF-κB
activation also has several other outcomes such as superoxide generation through the
NADPH oxidase complex as well as pro-inflammatory cytokine production (TNFα,
IL-1, and IL-6) promoting inflammation (Kawai et al., 1999, Wheeler, 2004, Ulevitch
and Tobias, 1995). Since NF-κB controls transcription of cytokine genes and
expression of pro-inflammatory cytokines is elevated in obesity, NF-κB is also likely
to be elevated in this disease state.
8
ETKO as Mouse Model of Metabolic Syndrome
Two major types of mice obesity models have been established representing two
causes of obesity- diet and genetics. Typical example of a diet-induced obesity is the
C57BL/6J mouse strain fed with a high fat diet (60% of energy intake from fat) and
typical genetic models include the leptin-deficient ob/ob, the New Zealand Obese
(NZO/HlLt), the agouti mutated yellow obese, and the CTP: phosphoethanolamine
cytidylyltransferase (Pcyt2) heterozygous knockout (ETKO; Pcyt2 +/-) that our
laboratory created (Jackson Laboratory, 2002, Perfield II et al., 2012, Carrolla, Voisey,
and Van Daal, 2004).
The Pcyt2 ETKO mice are a valuable model for studying obesity since they
progressively gain weight and develop adult-onset obesity, liver steatosis, and
hyperlipidemia at 24-28 weeks old (Fullerton et al., 2009). Phosphatidylethanolamine
(PE), an important inner membrane phospholipid, is synthesized from
CDP-ethanolamine and diacylglycerol (DAG) by the Kennedy pathway (Figure 1.1).
The Kennedy pathway which consists of CDP-ethanolamine branch and CDP-choline
branch is the only route for de novo synthesis of PE (Bakovic et al., 2007, Pavlovic
and Bakovic, 2013, Figure 1.1). In the CDP-ethanolamine branch, ethanolamine
kinase converts ethanolamine to phosphoethanolamine which is subsequently
converted to the intermediate CDP-ethanolamine catalyzed by
9
CTP: phosphoethanolamine cytidylyltransferase (Pcyt2) (Bakovic et al., 2007,
Pavlovic and Bakovic, 2013, Figure 1.1). Pcyt2 catalyzes the rate-limiting step of the
Kennedy pathway (Gibellini and Smith, 2010). Finally,
CDP-ethanolamine:1,2-diacylglycerol ethanolaminephosphotransferase (EPT)
catalyzes PE formation from CDP-ethanolamine (Bakovic, Fullerton, and Michel,
2007, Pavlovic and Bakovic, 2013, Figure 1.1). In the CDP-choline branch,
phosphorylation of choline forming phosphocholine is executed by choline kinase
(Pavlovic and Bakovic, 2013). The analogous enzyme to Pcyt2 in the CDP-choline
branch is CTP: choline cytidylyltransferase (Pcyt1) which converts phosphocholine to
CDP-choline and CDP-choline is subsequently converted to phosphatidylcholine (PC)
(Bakovic, Fullerton, and Michel, 2007, Pavlovic and Bakovic, 2013). PE is formed
from PC via the intermediate conversion to phosphatidylserine (PS) (Bakovic,
Fullerton, and Michel, 2007, Pavlovic and Bakovic, 2013).
Pcyt2 +/- mice have lower CDP-ethanolamine as a result of partially knocking out
the Pcyt2 gene leading to lower rate of PE synthesis and higher availability of DAG
(another substrate in PE synthesis) (Figure 1.1). The excess DAG is then converted to
triacylglycerol (TAG) ultimately leading to Pcyt2 deficient disease phenotypes of
adult onset obesity, liver steatosis, hypertriglyceridemia, and insulin resistance
(Figure 1.1 and Fullerton et al., 2009). Metabolic adaptations to Pcyt2 deficiency lead
10
to the disease phenotype of hypertriglyceridemia. These adaptations include elevated
hepatic and intestinal lipoprotein secretion and stimulated expression and/or activity
of genes involved in lipid absorption, transport, and lipoprotein assembly (Singh et al.,
2012). In addition, lowered plasma TG clearance and utilization by peripheral tissues
work in concert leading to hypertriglyceridemia (Singh et al., 2012). Consistent with
another study, a conditional liver specific disruption of Pcyt2 results in liver steatosis
(Leonardi et al., 2009). We showed that complete Pcyt2 gene knockout is
embryonically lethal (Fullerton et al., 2007).
11
Figure 1.1- CDP-Ethanolamine Pathway in Pcyt2 ETKO mice
Pcyt2 gene disruption reduces CDP-ethanolamine and PE but increases DAG and TG.
Instead of being utilized to produce PE, DAG accumulates with excess DAG
subsequently being utilized to synthesize TG.
EPT: CDP-ethanolamine 1,2-diacylglycerol ethanolaminephosphotransferase
12
LPS: Damage, Obesity, and Liver Disease
Gram-negative bacteria in the small intestine, part of the gut flora, produce LPS
composed of an O-specific chain, a core oligosaccharide, and lipid A (Shea-Budgell et
al., 2006, Rietschel et al., 1994). LPS is also known as endotoxin serving as the major
component of the outer membrane of Gram-negative bacteria (Rietschel et al., 1994).
Together with soluble LPS-binding protein (LBP), LPS bind to the complex of
Toll-like receptor 4 (TLR4) and CD14 in macrophages (Kupffer cells) initiating a
variety of inflammatory signaling cascades (Wheeler, 2004, Rietschel et al., 1994). In
one of these cascades, LPS and LBP binding activates macrophages and downstream
molecules such as myeloid differentiation factor 88 (MyD88) and associated proteins
of interleukin–1 receptor-associated kinase (IRAK) and tumor necrosis factor
receptor–associated factor (TRAF) resulting in NF-κB activation (Hosoi et al., 2004,
Kawai et al., 1999, Zhang et al., 1999, Wheeler, 2004, Ulevitch and Tobias, 1995).
NF-κB activation has multiple outcomes such as superoxide generation through the
NADPH oxidase complex as well as pro-inflammatory cytokine production (TNFα,
IL-1, and IL-6) promoting inflammation (Kawai et al., 1999, Wheeler, 2004, Ulevitch
and Tobias, 1995). In terms of damage, LPS is a potent and even lethal toxin that
triggers a global activation of inflammatory responses that can lead to acute liver
failure and even death (Shea-Budgell et al., 2006, Baue, 1994, Livingston and Deitch,
13
1995, Wagner and Roth, 1999, Martin et al., 2003).
Obesity-related steatohepatitis shares histological resemblance with
alcohol-induced steatohepatitis (Yang et al., 1997, Ludwig et al., 1980, Diehl,
Goodman, and Ishak, 1988). In alcohol-related steatohepatitis, experimental data
suggested that LPS is involved in such pathogenesis (Yang et al., 1997, McClain et al.,
1993). Thus, it is tempting to speculate that LPS is also involved in the pathogenesis
of obesity-induced steatohepatitis. Therefore, obesity might prime individuals to liver
disease by increasing hepatic sensitivity to LPS (Yang et al., 1997).
Previous research found that obesity is associated with changes in LPS-induced
cytokine gene expression such that lower Il-12 and higher IFNγ expression was
detected in obese rats relative to normal control rats (Yang et al., 1997). Yang et al.
used leptin receptor-deficient fa/fa rats as obesity model and were uncertain if the
same result can be extrapolated to other models with different causes of obesity.
Sea Buckthorn
Sea buckthorn (Hippophae), a thorny deciduous shrub, is native to Asia and
Europe (Tirupathi Pichiah et al., 2012, Rousi, 1971). Sea buckthorn is a rich source of
vitamins A, C, E, and K as well as the two essential fatty acids specifically linoleic
acid (18:2n-6) and α-linolenic acid (18:3n-3) (Maheshwari et al., 2011, Pintea et al.,
2001, Kallio et al., 2002, Yang and Kallio, 2001, Franke and Muller, 1983, Quirin and
14
Gerard, 1993, Berezhnaya et al., 1993, Jabłczynska, Krawczyk, and Minkowski, 1994,
Moravcova et al., 1995, Zadernowski et al., 1997). Sea buckthorn is also rich in ω-9
oleic acid and ω-7 palmitoleic acid in which the latter is uncommon in plants (Yang
and Kallio, 2001, Franke and Muller, 1983, Quirin and Gerard, 1993, Jabłczynska,
Krawczyk, and Minkowski, 1994, Zadernowski et al., 1997, Ulchenko et al., 1995).
Furthermore, this plant is rich in phenolic compounds specifically flavonoids
including myricetin, quercetin, kaempferol, and isorhamnetin (Tirupathi Pichiah et al.,
2012, Maheshwari et al., 2011, Nijveldt et al., 2001).
Different parts of sea buckthorn have varying amounts of nutrients. For example,
sea buckthorn berries contain most of the ω-7 fatty acid whereas seeds contain high
levels of the two essential fatty acids (one ω-3 and one ω-6) (Suryakumar and Gupta,
2011). In addition to having high level of ω-7 fatty acid, berries are also rich in
various carotenoids namely zeaxanthin, α, β, δ-carotene, lycopene, β-cryptoxanthin,
and lutein (Kumar et al., 2011). Seeds, on the other hand, are a rich source of vitamin
E (Sne et al., 2013). Sea buckthorn is commercially available as tea, berry, oil, purée,
juice, skin cream, and gel.
In Tibetan and Mongolian traditional medicines, sea buckthorn was used to
improve digestive function and blood circulation as well as to treat cough and sputum
(Suryakumar and Gupta, 2011). Sea buckthorn exhibits many beneficial properties
15
including anti-inflammatory, immunomodulatory, hypoglycemic, hypolipidemic,
anti-atherogenic, antioxidant activity, and anticancer effects (Tirupathi Pichiah et al.,
2012, Geetha et al., 2003, Sharma et al., 2011, Geetha et al., 2005, Grey et al., 2010,
Ganju et al., 2005, Basu et al., 2007, Wang et al., 2011). However, this plant has not
been well studied in alleviating obesity and associated complications of steatosis,
hyperglycemia, and hepatic inflammation.
16
Chapter 2: Rationale, Hypotheses, and Objectives
The thesis is composed of two related projects using the same Pcyt2 ETKO
mouse model to study obesity and associated complications. The first project
investigates obesity pathology while the second project tests the medicinal properties
of sea buckthorn extract in obesity and associated complications. The specific
rationale, hypotheses, and objectives are described below:
For the first project:
Previous research found that obesity increases liver sensitivity to LPS using
leptin receptor-deficient fa/fa rats as obesity models, but authors were uncertain if the
same result can be extrapolated to other models with different causes of obesity (Yang
et al., 1997). Given LPS’s high potency and obesity’s high prevalence, it is imperative
to test if obesity increases liver sensitivity to endotoxin in other models such as Pcyt2
ETKO model in order to determine if obesity prime hepatic disease by increasing
liver sensitivity to LPS. The hypothesis is therefore: obesity increases liver
sensitivity to toxic effects of LPS. The corresponding research objective is to
determine if obesity increases liver sensitivity to toxic effects of LPS in Pcyt2 +/-
mice model.
17
For the second project:
Sea buckthorn exhibits many beneficial properties including anti-inflammatory,
immunomodulatory, hypoglycemic, hypolipidemic, anti-atherogenic, antioxidant
activity, and anticancer effects (Tirupathi Pichiah et al., 2012, Geetha et al., 2003,
Sharma et al., 2011, Geetha et al., 2005, Grey et al., 2010, Ganju et al., 2005, Basu et
al., 2007, Wang et al., 2011). However, this plant has not been well studied in
alleviating obesity and associated complications of steatosis, hyperglycemia, and
hepatic inflammation. Given obesity’s high prevalence and severe complications
including type 2 diabetes, hyperlipidemia, cardiovascular disease, various infections,
cancer, pulmonary diseases, liver disorder as well as systematic chronic low-grade
inflammation, it is imperative to find ways to prevent, manage, and treat this medical
condition. From sea buckthorn’s numerous beneficial effects such as
anti-inflammatory, immunomodulatory, hypoglycemic, hypolipidemic, and
anti-atherogenic properties, this plant presents a potential approach to prevent,
manage, and even treat this devastating health condition. The hypothesis is therefore: sea buckthorn extract diet will reduce body weight, tissue lipids, and blood
glucose and consequently alleviate the hepatic inflammation and NAFL in
ETKO mice. The corresponding research objective is to determine if orally
administered sea buckthorn extract reduce body weight, tissue lipids, and blood
18
glucose and consequently alleviate the hepatic inflammation and NAFL.
19
Chapter 3: Pcyt2 ETKO Obesity Increases Liver
Sensitivity to LPS-Induced Acute Inflammation and
Results in Chronic Hepatic Inflammation
Introduction
Together with soluble LBP, LPS bind to the complex of TLR4 and CD14 in
macrophages (Kupffer cells) initiating a variety of inflammatory signaling cascades
(Wheeler, 2004, Rietschel et al., 1994). In one of these cascades, LPS and LBP
binding activates macrophages and downstream molecules such as MyD88 and IRAK
and TRAF resulting in NF-κB activation (Hosoi et al., 2004, Kawai et al., 1999,
Zhang et al., 1999, Wheeler, 2004, Ulevitch and Tobias, 1995). NF-κB activation
results in pro-inflammatory cytokine production (Tnfα, Il-1, and Il-6) promoting
inflammation (Kawai et al., 1999, Wheeler, 2004, Ulevitch and Tobias, 1995). In
terms of damage, LPS is a potent and even lethal toxin that triggers a global activation
of inflammatory responses that can lead to acute liver failure and even death
(Shea-Budgell et al., 2006, Baue, 1994, Livingston and Deitch, 1995, Wagner and
Roth, 1999, Martin et al., 2003).
Obesity-related steatohepatitis shares histological resemblance with
alcohol-induced steatohepatitis (Yang et al., 1997, Ludwig et al., 1980, Diehl,
Goodman, and Ishak, 1988). In alcohol-related steatohepatitis, experimental data
20
suggested that LPS is involved in such pathogenesis (Yang et al., 1997, McClain et al.,
1993). Thus, it is tempting to speculate that LPS is also involved in the pathogenesis
of obesity-induced steatohepatitis. Therefore, obesity might prime individuals to liver
disease by increasing hepatic sensitivity to LPS (Yang et al., 1997).
Previous research found that obesity is associated with changes in LPS-induced
cytokine gene expression such that lower Il-12 and higher IFNγ expression was
detected in obese rats relative to normal control rats (Yang et al., 1997). Yang et al.
used leptin receptor-deficient fa/fa rats as obesity models and were uncertain if the
same result can be extrapolated to other models with different causes of obesity.
Given LPS’s high potency and obesity’s high prevalence, it is imperative to test if
obesity increases liver sensitivity to endotoxin in other models such as Pcyt2 ETKO
model in order to determine if obesity prime hepatic disease by increasing liver
sensitivity to LPS. The hypothesis is therefore: obesity increases liver sensitivity to
toxic effects of LPS. The corresponding research objective is to determine if obesity
increases liver sensitivity to toxic effects of LPS in Pcyt2 +/- mice model.
21
Experimental Procedures
Animals and Treatments
Pcyt2 +/- (ETKO) and Pcyt2 +/+ (wildtype (WT)) mice were generated as
previously described (Fullerton et al., 2007). In summary, a positively identified
bacterial artificial chromosome clone was used to subclone a 12.5-kb genomic region
used to construct the targeting vector. The targeting vector was created by
homologous recombination. 2.8 kb of the gene was replaced by neomycin cassette.
The targeting vector was transfected by electroporation of 129 SvEviTL embryonic
stem (ES) cells (InGenious Targeting, New York). After selection, surviving clones
were screened by polymerase chain reaction (PCR) to identify recombinant ES clones
with the neomycin cassette. Two positive ES clones were identified by selection
screening for homologous recombination. These clones were injected into mouse
blastocysts and implanted into pseudopregnant females. To achieve germ line
transmission, Agouti, chimeric male offspring were then crossed back to C57BL/6
mice. Genotype was determined by PCR using ear notch genomic DNA. All
procedures received University of Guelph Animal Care Committee’s approval and
were in accordance with the Canadian Council on Animal Care’s guidelines. Mice were
exposed to a 12-hour light/dark cycle with light starting at 7:00 A.M. Mice were fed ad
libitum a standard diet (Harlan Teklad S-2335) with unrestricted access to water.
22
LPS (E. coli, Sigma-Aldrich) was administered through intraperitoneal (IP)
injection shortly after noon to WT and ETKO mice (4/group) using the dosage as in a
previous study (500 ng/g body weight) (Yang et al., 1997). Mice were sacrificed 24
hours after LPS injection using CO2 and the tissues (liver, retroperitoneal adipose,
kidney, heart, lung, spleen, and muscle) were harvested. Mouse plasma from WT and
ETKO was obtained using cardiac puncture with subsequent centrifugation at 5000
rpm for 10 min at 4°C. Prior to storing at -80°C freezer for subsequent analyses,
harvested tissues were preserved in liquid nitrogen immediately following harvest
while plasma was preserved in ice. Basic mice data such as tissue weights and blood
glucose level were not measured in the WT and the ETKO to help characterize
differences in the two genotypes of mice because such measurements were conducted
previously in our lab.
Liver Immunohistochemistry
To compare approximate number of Kupffer cells in the WT and the ETKO,
histological staining for Kupffer cells was conducted from male 7-month old mice (2
WT and 2 ETKO). Following harvesting, a part of liver tissue was preserved in 10%
formalin in phosphate buffered saline (PBS) with subsequent paraffin embedding.
Section was dewaxed in xylene and rehydrated in a series of ethanol washes and
incubated with rabbit monoclonal anti-CD68 antibody (Kupffer cell marker, Abcam).
23
Leica DMR imaging microscope connected to a computer with Openlab software was
used to visualize the tissue stainings and perform image analysis. Tissue stainings
were visualized under 40x magnification and Kupffer cell numbers were quantified
and totaled from 5 areas using Openlab software.
Preparation of Liver mRNA and PCR Analyses
One year old male and female mice (4/group) were studied. Fifty mg of liver was
homogenized in 1 ml of TRIzol reagent (Invitrogen) followed by addition of 0.2 ml of
chloroform, vigorous vortexing for 15 sec, and room temperature incubation for 2 to 3
min. Next, the sample was centrifuged at 10000 rpm for 15 min at 4˚C resulting in a
multiple layer mixture. Top aqueous layer containing mRNA was then transferred to a
fresh tube with subsequent addition of 0.5 ml of isopropyl alcohol followed by 10 min
room temperature incubation. The sample was centrifuged at 10000 rpm for 25 min at
4˚C resulting in mRNA pellet and supernatant was removed. The pellet was washed
with 1 ml 75% ethanol, vortexed, and spun at 6000 rpm for 5 min at 40C. After
centrifugation, leftover ethanol was removed and the washing was repeated. mRNA
pellet was air dried for 5 min and dissolved in 90 µl diethylpyrocarbonate
(DEPC)-treated water. Spectrophotometric analysis was conducted to determine
mRNA purity (A260/A280 ratio between 1.8 to 2.0) and concentration. Concentration
was calculated using the equation: [mRNA] (µg/µl) = (40 x dilution factor x
24
absorbance at A260)/1000 where 40 refers to the convention that 1 OD (absorbance)
at A260 equals 40 µg/ml mRNA.
Complementary DNA (cDNA) was synthesized from 2 µg of liver total mRNA
using SuperScript II Reverse Transcriptase (Invitrogen). Following cDNA synthesis,
PCR was conducted for the following cytokines using cytokine-specific primers to
study hepatic mRNA level: IFNγ, TNFα, IL-12, IL-10, as well as TGF-β1. The PCR
conditions including the primers, temperatures, times, and cycle number are listed in
Appendix A. All primers were obtained from publications (IFNγ- Puddu et al., 1997;
TNFα- Peng et al., 2003; IL-12- Coutelier, Van Broeck, and Wolf, 1995; IL-10- Sohn
et al., 2001; TGF-β1- Oi, Yamamoto, and Nishioka, 2004) and purchased from
University of Guelph Laboratory Services. Finally, PCR amplified cDNA was
visualized using agarose gel electrophoresis with ethidium bromide staining.
Protein Preparation and Western Blotting (WB)
Male and female 8-month old mice (2 WT and 2 ETKO) were studied.
Bicinchoninic acid (BCA) protein assay (Thermo Scientific) was used to measure liver
total protein concentration. In brief, this assay combines protein reduction of Cu2+
to
Cu1+
(cuprous) in an alkaline environment with the highly sensitive and selective
colorimetric BCA detection of Cu1+
(Smith et al., 1985). The first step is the chelation
of copper with protein forming a light blue complex (Smith et al., 1985). In the
25
second step, BCA chelates with Cu1+
formed in step one forming intense purple
product (Smith et al., 1985). The final water-soluble product exhibits a strong linear
absorbance at 562 nm with increasing protein concentrations (Smith et al., 1985). To
prepare for protein immunoblotting, samples were diluted with 5X SDS (sodium
dodecyl sulphate) reducing buffer (0.5 M Tris-HCl pH 5.8, 25% glycerol, 2% SDS,
0.01% bromophenol blue, and 0.5% 2-mercaptoethanol) and boiled for 5 min.
To detect hepatic NF-κBp65 protein levels in Pcyt2 WT and ETKO mice, 20 µg
of proteins were loaded onto a 12% SDS-PAGE and separated by electrophoresis. The
proteins were transferred to polyvinylidene difluoride (PVDF) membranes for 30 min
and following the transfer, the membranes were stained with Ponceau S to ensure equal
loading and successful transfer of proteins. The membranes were then blocked with 5%
bovine serum albumin (BSA) in TBST (Tris buffered saline with 0.5% Tween 20) for 1
hr at room temperature. After blocking, the membranes were subjected to a 4˚C
overnight incubation with rabbit polyclonal anti-NF-κBp65 primary antibody from
Santa Cruz Biotechnology, Inc. diluted 1:2000 with 5% BSA. Next, the membranes
were washed 5x in TBST with change every 15 min followed by 1 hr room temperature
incubation with secondary antibody- goat-anti-rabbit immunoglobulin G (IgG) linked
to horse-radish peroxidase (HRP) diluted 1:20000. NF-κBp65 protein was viewed with
Sigma’s chemiluminescent peroxidase substrate assay following manufacturer’s
26
instructions including developing onto a X-ray film.
Graphs
PCR and WB band intensities were measured using Image J software. Bar graphs
with mean and SEM for body weight, PCR, and western blotting experiments were
generated using GraphPad Prism software.
Statistical Analyses
GraphPad Prism software was also used for statistical analyses. Unpaired t tests
were conducted to compare WT and ETKO body weight. For PCR experiments,
two-way ANOVA for the effect of LPS treatment, genotype, and interaction between
treatment and genotype was conducted. In addition, unpaired t tests were conducted to
compare the following: WT vs ETKO for LPS treated and not LPS treated as well as
LPS treated vs not LPS treated of the same genotype. P values < 0.05 were considered
statistically significant.
27
Results
WT and ETKO body weight
WT and ETKO mice (n = 8/group) body weight was measured to help
characterize differences in the two genotypes of mice. ETKO mice had higher body
weight than WT mice (Figure 3.1).
Figure 3.1- Body weight of WT and ETKO mice Bar graph showing mean and
SEM (n = 8/group). Each comparison line with * indicates the groups are statistically
different from each other (P < 0.05).
28
Hepatic IL-12 gene expression following LPS treatment
To determine if ETKO has increased liver sensitivity to inflammation, mRNA
level of the pro-inflammatory cytokine IL-12 was measured in four groups of mice (n
= 4/group). Only treatment had an effect and treatment did not interact with genotype
(Figure 3.2). For mice not treated with LPS, ETKO and WT mice had same IL-12
level (Figure 3.2). LPS treatment resulted in higher hepatic IL-12 level in ETKO and
WT mice compared to the untreated (Figure 3.2). IL-12 level was also same between
ETKO and WT mice treated with LPS (Figure 3.2).
Figure 3.2- Hepatic interleukin 12 (IL-12) gene expression with and without LPS
treatment- Effects of LPS on ETKO and WT mice. Liver mRNA level was measured
by PCR (n = 4/group). mRNA expression bar graph showing mean and SEM
Two-way ANOVA was conducted. Each comparison line with * indicates the groups
are statistically different from each other (P < 0.05).
29
Hepatic TNFα gene expression following LPS treatment
TNFα (pro-inflammatory cytokine) mRNA level was also measured (n = 4/group)
to determine if the ETKO has increased liver sensitivity to inflammation. Treatment,
genotype had no effect and treatment did not interact with genotype (Figure 3.3). In
mice without LPS treatment, TNFα level was same between ETKO and WT mice
(Figure 3.3). LPS treatment resulted in higher hepatic TNFα level in ETKO mice and
resulted in same level in WT mice relative to the respective untreated (Figure 3.3).
TNFα level was also same between LPS treated ETKO and WT mice (Figure 3.3).
Figure 3.3- Hepatic tumor necrosis factor alpha (TNFα) gene expression with
and without LPS treatment- Effects of LPS on ETKO and WT mice. Liver mRNA
level was measured by PCR (n = 4/group). mRNA expression bar graph showing
mean and SEM Two-way ANOVA was conducted. Each comparison line with *
indicates the groups are statistically different from each other (P < 0.05).
30
Hepatic IFNγ gene expression following LPS treatment
In addition to IL-12 and TNFα, the pro-inflammatory cytokine IFNγ mRNA level
was measured (n = 4/group) with the same goal as the previous two cytokines. Only
genotype had an effect and treatment did not interact with genotype (Figure 3.4). In
mice without LPS treatment, IFNγ mRNA was higher in WT mice (Figure 3.4). LPS
treatment had no effect on hepatic IFNγ level in both ETKO and WT mice relative to
the untreated so the level after treatment was also higher in the WT (Figure 3.4).
Figure 3.4- Hepatic interferon gamma (IFNγ) gene expression with and without
LPS treatment- Effects of LPS on ETKO and WT mice. Liver mRNA level was
measured by PCR (n = 4/group). mRNA expression bar graph showing mean and
SEM Two-way ANOVA was conducted. Each comparison line with * indicates the
groups are statistically different from each other (P < 0.05).
31
Hepatic IL-10 gene expression following LPS treatment
Another way to study inflammation is to investigate anti-inflammatory
cytokines. Thus, mRNA level of IL-10 was measured (n = 4/group). Only treatment
had an effect and treatment did not interact with genotype (Figure 3.5). In untreated
mice, IL-10 level was low and same between the two groups (Figure 3.5). LPS
treatment resulted in higher hepatic IL-10 level by 2.1 fold in the ETKO and by 6 fold
in WT mice compared to the respective untreated level demonstrating that LPS
induction of IL-10 is suppressed in the ETKO leading to less IL-10 protection (Figure
3.5).
Figure 3.5- Hepatic interleukin 10 (IL-10) gene expression with and without LPS
treatment- Effects of LPS on ETKO and WT mice. Liver mRNA level was measured
by PCR (n = 4/group). mRNA expression bar graph showing mean and SEM
Two-way ANOVA was conducted. Each comparison line with * indicates the groups
are statistically different from each other (P < 0.05).
32
Hepatic TGF-β1 gene expression following LPS treatment
The anti-inflammatory cytokine TGF-β1 was also studied and its mRNA level
was measured (n = 4/group). Only treatment had an effect and treatment did not
interact with genotype (Figure 3.6). In untreated mice, this cytokine’s level was same
between ETKO and WT mice (Figure 3.6). LPS treatment resulted in higher hepatic
TGF-β1 level only in ETKO mice by 1.4 fold relative to the untreated demonstrating
that LPS induction of TGF-β1 is enhanced in the ETKO so response to LPS was
different in WT vs ETKO (Figure 3.6). ETKO and WT mice had same post LPS
treatment TGF-β1 expression (Figure 3.6).
Figure 3.6- Hepatic transforming growth factor beta 1 (TGF-β1) gene expression
with and without LPS treatment- Effects of LPS on ETKO and WT mice. Liver
mRNA level was measured by PCR (n = 4/group). mRNA expression bar graph
showing mean and SEM Two-way ANOVA was conducted. Each comparison line
with * indicates the groups are statistically different from each other (P < 0.05).
33
Hepatic NF-κBp65 protein level
Hepatic NF-κB is linked to hepatic inflammation (Sajan et al., 2009). Since
obesity is also associated with hepatic inflammation, it is possible that obesity is
associated with hepatic NF-κB. To determine if such association exists in the ETKO,
NF-κBp65 protein was measured (n = 2/group) by western blotting. NF-κBp65
protein level was threefold higher in ETKO liver than WT liver (Figure 3.7).
WT ETKO
Figure 3.7- Hepatic NF-κBp65 protein western blot NF-κBp65 protein level in
ETKO and WT mice livers was measured (n = 2/group) by western blotting using
anti-NF-κBp65 antibody.
34
Liver Immunohistochemistry- Kupffer cells
Changes in liver Kupffer cell number have been linked to liver steatosis and
inflammation (Lin et al., 2007). Kupffer cells are elliptical and quantitative analyses
with Openlab software revealed that ETKO and WT mice had similar number (total
from 5 areas: ETKO 29 WT 31) of Kupffer cells (n = 2/group) (Figure 3.8).
WT ETKO
Figure 3.8- Liver Immunohistochemistry- Representative figures- Kupffer cells as
indicated by arrows were visualized with CD68 specific antibody under 40x
magnification (n = 2/group).
35
Discussion
ETKO mice had higher body weight than WT mice
ETKO mice had higher body weight than WT mice (Figure 3.1). ETKO mice
have lower CDP-ethanolamine as a result of partially knocking out the Pcyt2 gene
leading to lower rate of PE synthesis and higher availability of DAG (another
substrate in PE synthesis). The excess DAG is then converted to TAG ultimately
leading to Pcyt2 deficient disease phenotype of adult onset obesity (Fullerton et al.,
2009).
Mostly same basal hepatic pro-inflammatory and anti-inflammatory cytokine
gene expression between ETKO and WT mice
At the basal state (without LPS treatment), WT and ETKO mice had same liver
pro-inflammatory cytokine (IL-12 and TNFα) as well as anti-inflammatory cytokine
(IL-10 and TGF-β1) gene expression (Figures 3.2, 3.3, 3.5, 3.6). One leptin-deficient
ob/ob mice study found similar basal mRNA level of TNFα and TGF-β1 between the
obese and the regular weight (Yang et al., 1997). The only difference in cytokine gene
expression between the ETKO and the WT was IFNγ in which the expression was
lower in ETKO demonstrating that basal hepatic IFNγ gene expression was blunted
(Figure 3.4). One study found that WT mice had higher hepatic and visceral adipose
tissue pro-inflammatory cytokine (IL-6 and TNFα) gene expression compared to KO
mice (O'Rourke et al., 2012).
36
Pcyt2 ETKO obesity increases liver sensitivity to acute inflammation indicated
by higher LPS treatment induction of hepatic pro-inflammatory cytokine gene
expression and lower LPS treatment induction of hepatic anti-inflammatory
cytokine gene expression in ETKO than WT
LPS is also known as endotoxin which serves as the major component of the
outer membrane of Gram-negative bacteria (Rietschel et al., 1994). LPS is used to
study several processes including inflammation, cell proliferation and cancer,
migration, cell survival, as well as septic shock (Sharif et al., 2007). In terms of
damage, LPS is a potent and even lethal toxin that triggers a global activation of
inflammatory responses that can lead to acute liver failure and even death
(Shea-Budgell et al., 2006, Baue, 1994, Livingston and Deitch, 1995, Wagner and
Roth, 1999, Martin et al., 2003). The dosage we used was probably not high enough
to induce acute liver failure and death.
LPS treatment (500 ng/g body weight) induction of hepatic pro-inflammatory
cytokine TNFα gene expression was higher in ETKO than WT and LPS treatment
induction of hepatic anti-inflammatory cytokine IL-10 gene expression was lower in
ETKO than WT leading to more TNFα damage and less IL-10 protection in ETKO
than WT (Figures 3.3, 3.5). LPS treatment of WT and ETKO similarly induced
pro-inflammatory cytokine gene expression (IL-12) and resulted in higher TNFα in
ETKO relative to the untreated (Figures 3.2-3.3). For IFNγ, LPS treatment had no
effect relative to the untreated (Figure 3.4). One reason that LPS treatment did not
37
affect IFNγ gene expression could be cytokine specific alleviating mechanism in
response to LPS involving downregulation of IFNγ gene expression that occurs few
hours after LPS treatment. The goal of this mechanism is to restore pro-inflammatory
cytokine IFNγ gene expression back to pre-treatment level thus dampening LPS’s
damaging effect of increasing pro-inflammatory cytokine genes expression leading to
inflammation. The findings that LPS treatment resulted in higher IL-12 and TNFα
gene expression relative to the untreated are supported by Yang et al., 1997.
Endotoxin also resulted in higher anti-inflammatory cytokine (IL-10 and TGF-β1)
mRNA levels in the ETKO and resulted in higher IL-10 in the WT all compared to the
untreated (Figures 3.5-3.6). Yang et al., 1997 also found higher IL-10 in the LPS
treated.
LPS induced increase in pro-inflammatory cytokine (TNFα, IL-1, and IL-6) gene
expression is a multi-step process that begins when LPS in combination with soluble
LPS-binding protein bind to their receptor complex- Toll-like receptor 4 and CD14 in
macrophages such as Kupffer cells initiating a variety of inflammatory signaling
cascades (Wheeler, 2004, Rietschel et al., 1994). In one of these cascades, LPS and
LBP binding activates macrophages and downstream molecules such as myeloid
differentiation factor 88 and associated proteins of interleukin–1 receptor-associated
kinase and tumor necrosis factor receptor–associated factor resulting in NF-κB (a
38
transcription factor) activation (Hosoi et al., 2004, Kawai et al., 1999, Zhang et al.,
1999, Wheeler, 2004, Ulevitch and Tobias, 1995). NF-κB activation has multiple
outcomes including pro-inflammatory cytokine (TNFα, IL-1, and IL-6) production,
gene expression, and release (Kawai et al., 1999, Wheeler, 2004, Ulevitch and Tobias,
1995, Sharif et al., 2007).
LPS induced higher anti-inflammatory cytokine (TGF-β1 and especially IL-10)
gene expression relative to the untreated can be an amelioration mechanism of the
immune system in an attempt to alleviate LPS toxic effects. IL-10, for example,
inhibits TNFα toxic effects of inflammation, tissue damage, as well as loss of function
(Yang et al., 1997, Dinarello, 2000).
pro-inflammatory cytokine anti-inflammatory cytokine
IL-12 TNFα IFNγ IL-10 TGF-β1
ETKO ↑
↑
__
↑
↑
WT
↑
__
__
↑
__
Table 3.1 LPS treatment induction of hepatic cytokine gene expression compared
to untreated ↑ means LPS treatment resulted in higher cytokine gene expression
compared to untreated and means LPS treatment resulted in same cytokine gene
expression compared to untreated
Mostly same hepatic pro-inflammatory and anti-inflammatory cytokine gene
expression between WT and ETKO mice after LPS treatment
WT and ETKO mice had same liver pro-inflammatory cytokine (IL-12 and TNFα)
as well as anti-inflammatory cytokine (IL-10 and TGF-β1) gene expression following
39
500 ng LPS/g body weight treatment (comparing LPS (+) WT to LPS (+) ETKO bar
of Figures 3.2, 3.3, 3.5, 3.6). Yang et al., 1997 supported our findings for TNFα and
TGF-β1. The only difference in cytokine gene expression between the ETKO and the
WT is IFNγ in which the expression is higher in WT (comparing LPS (+) WT to LPS
(+) ETKO bar of Figure 3.4). Lower IFNγ in ETKO can be an obesity-induced
adaptive mechanism in an attempt to alleviate obesity-related metabolic dysfunction
since IFNγ deficiency lowers adipose tissue inflammatory genes gene expression and
ameliorates metabolic parameters in obese animals (Rocha and Folco, 2011, Rocha et
al., 2008).
Pcyt2 ETKO obesity results in chronic hepatic inflammation indicated by higher
hepatic NF-κBp65 protein level in ETKO than WT mice
ETKO obese mice had threefold higher hepatic NF-κBp65 protein level than WT
mice indicating that obesity (Pcyt2 ETKO) results in chronic hepatic inflammation
(Figure 3.7). Since the transcription factor NF-κB controls transcription of cytokine
genes such as IL-6 and IL-1A and expression of pro-inflammatory cytokines such as
MCP-1 is elevated in obesity, it is reasonable that NF-κB is elevated in this disease
state (Kanda et al., 2006, Conti et al., 1997). Elevated NF-κBp65 protein level in the
ETKO explains higher LPS treatment induction of hepatic pro-inflammatory cytokine
TNFα gene expression in ETKO since NF-κBp65 activates transcription of
pro-inflammatory cytokine genes such as TNFα.
40
Conclusion
Since LPS treatment induction of hepatic pro-inflammatory cytokine TNFα gene
expression was higher in ETKO than WT and LPS treatment induction of hepatic
anti-inflammatory cytokine IL-10 gene expression was lower in ETKO than WT
leading to more TNFα damage and less IL-10 protection in ETKO than WT, obesity
(Pcyt2 ETKO) increases liver sensitivity to acute inflammation. ETKO mice had
higher hepatic NF-κBp65 protein level than WT mice indicating that obesity (Pcyt2
ETKO) results in chronic hepatic inflammation. Elevated NF-κBp65 protein level in
the ETKO explains higher LPS treatment induction of hepatic pro-inflammatory
cytokine TNFα gene expression in ETKO since NF-κBp65 activates transcription of
pro-inflammatory cytokine genes such as TNFα.
41
Chapter 4: Sea Buckthorn Extract Diet Alleviates
Metabolic Syndrome in Pcyt2 ETKO
Introduction
Sea buckthorn (Hippophae), a thorny deciduous shrub, is native to Asia and
Europe (Tirupathi Pichiah et al., 2012, Rousi, 1971). Sea buckthorn is a rich source of
vitamins A, C, E, K, fatty acids linoleic acid (ω-6), α-linolenic acid (ω-3), oleic acid
(ω-9), palmitoleic acid (ω-7) and phenolic compounds specifically flavonoids
myricetin, quercetin, kaempferol, isorhamnetin (Maheshwari et al., 2011, Pintea et al.,
2001, Kallio et al., 2002, Yang and Kallio, 2001, Franke and Muller, 1983, Quirin and
Gerard, 1993, Berezhnaya et al., 1993, Jabłczynska, Krawczyk, and Minkowski, 1994,
Moravcova et al., 1995, Zadernowski et al., 1997, Ulchenko et al., 1995, Tirupathi
Pichiah et al., 2012, Nijveldt et al., 2001).
In Tibetan and Mongolian traditional medicines, sea buckthorn was used to
improve digestive function and blood circulation as well as to treat cough and sputum
(Suryakumar and Gupta, 2011). Sea buckthorn exhibits many beneficial properties
including anti-inflammatory, immunomodulatory, hypoglycemic, hypolipidemic,
anti-atherogenic, antioxidant activity, and anticancer effects (Tirupathi Pichiah et al.,
2012, Geetha et al., 2003, Sharma et al., 2011, Geetha et al., 2005, Grey et al., 2010,
Ganju et al., 2005, Basu et al., 2007, Wang et al., 2011). However, this plant has not
42
been well studied in alleviating obesity and associated complications of steatosis,
hyperglycemia, and hepatic inflammation. Given obesity’s high prevalence and
obesity’s severe complications including type 2 diabetes, hyperlipidemia,
cardiovascular disease, various infections, cancer, pulmonary diseases, liver disorder
as well as systematic chronic low-grade inflammation, it is imperative to find ways to
prevent, manage, and treat this medical condition. From sea buckthorn’s numerous
beneficial effects such as anti-inflammatory, immunomodulatory, hypoglycemic,
hypolipidemic, and anti-atherogenic properties, sea buckthorn presents a potential
approach to prevent, manage, and even treat this devastating health condition. The
hypothesis is therefore: sea buckthorn extract diet will reduce body weight, tissue
lipids, and blood glucose and consequently alleviate the hepatic inflammation and
NAFL in ETKO mice. The corresponding research objective is to determine if orally
administered sea buckthorn extract reduce body weight, tissue lipids, and blood
glucose and consequently alleviate the hepatic inflammation and NAFL.
43
Experimental Procedures
Animals and Treatments
ETKO (Pcyt2 +/-) and WT (Pcyt2 +/+) mice were described in Chapter 3. Sea
buckthorn extract was obtained from Dr. Gopinadhan Paliyath (Department of Plant
Agriculture, Ontario Agricultural College, University of Guelph). The slurry extract
was administered at about 1 pm through daily oral gavage once suspend in 0.85%
saline for 30 days to WT and ETKO mice (5/group) using the dosage of 200 μg/g
body weight. One study used 260 μg/g body weight which is somewhat similar to our
dosage (Hsu et al., 2009). Control mice were gavaged with saline. Mice were weighed
daily and sacrifice was carried out at the end of the 30-day trial using CO2. The
various tissues (liver, retroperitoneal adipose, kidney, heart, lung, spleen, and muscle)
were harvested and liver and retroperitoneal adipose tissues were weighed. Blood was
collected by cardiac puncture and plasma obtained by centrifugation at 5000 rpm for
10 min at 4°C. Prior to storing at -80°C freezer for subsequent analyses, harvested
tissues were preserved in liquid nitrogen immediately following harvest while plasma
was preserved in ice.
IP Glucose Tolerance Test
To determine if sea buckthorn extract lowers blood glucose level, IP glucose
tolerance tests were conducted prior to as well as after the 30-day trial. Male and
44
female mice 7-month of age (n = 5/group) were used. After a 16-hour fast, a baseline
saphenous vein blood sample was taken followed by glucose (2 g/Kg body weight; in
0.85% saline) IP injection. Blood glucose level was measured at the following time
points post injection using OneTouch UltraMini glucose metre: 15, 30, 60, 90,120,
and 180 min.
Liver Histology
To determine if sea buckthorn extract treatment results in lower hepatic lipid
accumulation compared to control, histological work was conducted. Male and female
mice 7-month of age (n = 5/group) were used. Following harvesting and weighing, a
part of liver tissue was preserved in 10% formalin in phosphate buffered saline (PBS)
with subsequent paraffin embedding. Section was dewaxed in xylene and rehydrated
in a series of ethanol washes and stained with hematoxylin and eosin. Leica DMR
imaging microscope set at 10x magnification connected to a computer with Openlab
software was used to visualize the tissue and perform image analysis.
Preparation of Liver mRNA and PCR Analyses
Male and female mice 7-month of age (n = 5/group) were used. Fifty mg of liver
was homogenized in 1 ml of TRIzol reagent (Invitrogen) followed by addition of 0.2
ml of chloroform, vigorous vortexing for 15 sec, and room temperature incubation for
2 to 3 min. Next, the sample was centrifuged at 10000 rpm for 15 min at 4˚C resulting
45
in a multiple layer mixture. Top aqueous layer containing mRNA was then transferred
to a fresh tube with subsequent addition of 0.5 ml of isopropyl alcohol followed by 10
min room temperature incubation. The sample was centrifuged at 10000 rpm for 25
min at 4˚C resulting in mRNA pellet and supernatant was removed. The pellet was
washed with 1 ml 75% ethanol, vortexed, and spun at 6000 rpm for 5 min at 40C.
After centrifugation, leftover ethanol was removed and the washing was repeated.
mRNA pellet was air dried for 5 min and dissolved in 90 µl DEPC-treated water.
Spectrophotometric analysis was conducted to determine mRNA purity (A260/A280
ratio between 1.8 to 2.0) and concentration. Concentration was calculated using the
equation: [mRNA] (µg/µl) = (40 x dilution factor x absorbance at A260)/1000 where
40 refers to the convention that 1 OD (absorbance) at A260 equals 40 µg/ml mRNA.
cDNA was synthesized from 2 µg of liver total mRNA using SuperScript II
Reverse Transcriptase (Invitrogen). Following cDNA synthesis, touchdown PCR was
conducted for the following cytokines using cytokine-specific primers to study
hepatic mRNA level: IL-12 and TGF-β1. In touchdown PCR, an initial annealing
temperature of several °C greater than estimated melting temperature is used (Korbie
and Mattick, 2008). Annealing temperature than gradually decreases (1-2 °C per every
second cycle) until reach estimated annealing temperature or some °C below (Korbie
and Mattick, 2008). Reaction continues using this annealing temperature. Touchdown
46
PCR increases specificity of product (Korbie and Mattick, 2008). G3PDH was used as
a control and amplified using traditional PCR. The PCR conditions including the
primers, temperatures, times, and cycle number are listed in Appendix B. Primers
were obtained from PubMed Primer-BLAST search and purchased from University of
Guelph Laboratory Services. Finally, PCR amplified cDNA was visualized using
agarose gel electrophoresis with ethidium bromide staining.
Graphs
PCR band intensities were measured using Image J software. Bar graphs with
mean and SEM for PCR experiments, body weight, post-treatment retroperitoneal
adipose tissue weight, post-treatment liver weight, and glucose tolerance test area
under the curve (AUC; trapezoidal calculation method) as well as curves for glucose
tolerance test were generated using GraphPad Prism software.
Statistical Analyses
GraphPad Prism software was also used for statistical analyses conducted using
n of 3/group to exclude outliers from analyses. For PCR experiments, post-treatment
body weight, post-treatment retroperitoneal adipose tissue and liver weight
measurements, as well as post-treatment glucose tolerance test AUC, two-way
ANOVA for the effect of treatment, genotype, and interaction between treatment and
genotype was conducted. Two-way repeated measures ANOVA was not conducted
47
for post-treatment body weight and post-treatment glucose tolerance test AUC
because data were not matched. One-way ANOVA was conducted for pre-treatment
body weight and pre-treatment glucose tolerance test AUC. In addition, unpaired t
tests were used for the following body weight comparisons: pre-treatment WT vs
ETKO, post-treatment body weight of the same genotype, and pre-treatment vs
post-treatment of the same treatment and genotype. For post-treatment retroperitoneal
adipose tissue and liver weight measurements, unpaired t tests were additionally used
for the following comparisons: WT vs ETKO and weights of the same genotype. For
pre-treatment glucose tolerance test AUC, unpaired t tests were additionally
conducted to compare WT vs ETKO. For post-treatment glucose tolerance test AUC,
unpaired t tests were additionally conducted to compare WT vs ETKO and different
treatments of the same genotype. Additionally, for PCR data, unpaired t tests were
used to compare different genotype levels of the same treatment and levels of the
same genotype with different treatments. P values < 0.05 were considered statistically
significant.
48
Results
Sea buckthorn extract induced body weight loss in ETKO
It is possible that sea buckthorn extract induces weight loss in mice. To
determine (n = 3/group) if sea buckthorn extract induce weight loss in ETKO mice,
mice were oral gavaged daily for 30 days with 200 μg/g body weight. Control mice
were gavaged with saline. For post-treatment weight, only genotype had an effect and
treatment did not interact with genotype (Figure 4.1). As shown in Figure 4.1, prior to
the 30-day treatment, ETKO mice weighed heavier than WT mice. Prior to treatment,
groups of the same genotype had the same weight (Figure 4.1). Sea buckthorn treated
ETKO mice lost weight while WT, ETKO saline control and WT sea buckthorn
treated mice did not lose weight (Figure 4.1).
49
Figure 4.1- Body weight change in sea buckthorn extract treated and control
mice WT and ETKO mice (n = 3/group) were fed a standard chow diet with
unrestricted access to water. Sea buckthorn extract was administered through daily oral
gavage for 30 days using the dosage of 200 μg/g body weight. Data are represented
using bar graphs (first six graphs = pre-treatment) showing means and SEMs.
One-way ANOVA and two-way ANOVA was conducted for pre-treatment and
post-treatment data respectively. Each comparison line with * indicates the groups are
statistically different from each other (P < 0.05).
50
Sea buckthorn extract induced retroperitoneal adipose tissue weight loss in
ETKO and WT
Genotype, treatment each had an effect and treatment interacted with genotype
(Figure 4.2). At the end of the 30-day trial, WT mice had lower retroperitoneal
adipose tissue weight compared to ETKO mice (Figure 4.2). Treated retroperitoneal
adipose tissues weighed lighter than control tissues for both the WT and the ETKO
(76.67% and 56.77% for the WT and the ETKO respectively relative to the controls)
indicating that sea buckthorn extract treatment induced retroperitoneal adipose tissue
weight loss in mice (Figure 4.2).
Figure 4.2- Retroperitoneal adipose tissue weight after sea buckthorn extract
treatment Retroperitoneal adipose tissues were harvested and weighed at the end of
the 30-day trial (n = 3/group). Data are represented using bar graphs showing means
and SEMs. Two-way ANOVA was conducted. Each comparison line with * indicates
the groups are statistically different from each other (P < 0.05).
51
Sea buckthorn extract induced liver weight loss in ETKO
To study if sea buckthorn extract reduces hepatic lipid accumulation in mice
leading to lower liver weight, harvested livers were weighed (n = 3/group) following
30 days of daily treatment. Genotype, treatment each had an effect and treatment
interacted with genotype (Figure 4.3). In addition to having lower post-treatment
retroperitoneal adipose tissue weight, WT mice had lower post-treatment liver weight
than ETKO mice (Figure 4.3). ETKO treated liver weighed lighter (59.79% of control
weight) indicating that sea buckthorn extract lowered liver weight by reducing hepatic
lipid accumulation (Figure 4.3). WT treated and control livers had same weights.
Figure 4.3- Liver weight after sea buckthorn extract treatment Livers were
harvested and weighed at the end of the 30-day trial (n = 3/group). Data are
represented using bar graphs showing means and SEMs. Two-way ANOVA was
conducted. Each comparison line with * indicates the groups are statistically different
from each other (P < 0.05).
52
Pre-treatment intraperitoneal glucose tolerance test
To ensure that changes in blood glucose levels result from sea buckthorn extract
treatment and not from pre-treatment differences between two groups of the same
genotype, pre-treatment blood glucose levels were measured to confirm that two
groups of the same genotype do not differ. WT mice had lower pre-treatment fasting
as well as post glucose administration blood glucose levels compared to ETKO mice
corresponding to smaller area under the curve of IP glucose tolerance test (Figures 4.4
and 4.5; n = 3/group).
53
Figure 4.4- Pre-treatment (sea buckthorn extract, 30 days) IP glucose tolerance
test (IPGTT) After a 16-hour fast, glucose was administered by IP injection to WT
and ETKO mice (n = 3/group). Blood glucose level was measured at baseline as well
as 15, 30, 60, 90, 120, and 180 min post injection. Statistical analyses are conducted
using IPGTT AUC data.
54
Figure 4.5- Pre-treatment (sea buckthorn extract, 30 days) IPGTT AUC Data are
represented using bar graphs showing means and SEMs (n = 3/group). One-way
ANOVA was conducted.
55
Sea buckthorn extract lowered blood glucose levels in WT and ETKO
We were interested in determining (n = 3/group) if sea buckthorn extract lower
blood glucose concentration in mice. Genotype, treatment each had an effect and
treatment did not interact with genotype (Figure 4.7). After 30 days of daily treatment
with 200 μg/g body weight, WT mice had lower concentration compared to ETKO
mice corresponding to smaller glucose area under the curve after an IP glucose
tolerance test (Figures 4.6 and 4.7). Treated ETKO and WT mice had lower blood
glucose level than control mice corresponding to smaller IPGTT AUC indicating that
sea buckthorn extract treatment lowered blood glucose concentration (Figures 4.6 and
4.7).
56
Figure 4.6- Post-treatment (sea buckthorn extract, 30 days) IPGTT After a
16-hour fast, glucose was administered by IP injection to WT and ETKO mice (n =
3/group). Blood glucose level was measured at baseline as well as 15, 30, 60, 90, 120,
and 180 min post injection. Statistical analyses are conducted using IPGTT AUC data.
57
Figure 4.7- Post-treatment (sea buckthorn extract, 30 days) IPGTT AUC Data are
represented using bar graphs showing means and SEMs (n = 3/group). Two-way
ANOVA was conducted. Each comparison line with * indicates the groups are
statistically different from each other (P < 0.05).
58
Hepatic IL-12 gene expression following sea buckthorn extract treatment
It is possible that sea buckthorn exerts its anti-inflammatory property by
reducing pro-inflammatory cytokine gene expression. To test this possibility, hepatic
mRNA level of pro-inflammatory cytokine IL-12 was measured (n = 3/group)
following 30 days of daily treatment. Only genotype had an effect and treatment
interacted with genotype (Figure 4.8). For control mice, the level was same between
WT and ETKO while WT treated mice had higher IL-12 mRNA than the ETKO
treated (Figure 4.8). Sea buckthorn extract treatment resulted in higher IL-12 mRNA
in the WT and had no effect in the ETKO compared to the control (Figure 4.8).
59
Figure 4.8- Hepatic interleukin 12 (IL-12) gene expression with and without sea
buckthorn extract treatment- Effects of sea buckthorn extract on WT and ETKO
mice. Liver mRNA level was measured by PCR (n = 3/group). Gene expression was
assessed relative to glycerol-3-phosphate dehydrogenase (G3PDH) as an endogenous
control. mRNA expression bar graph showing mean and SEM Two-way ANOVA was
conducted. Each comparison line with * indicates the groups are statistically different
from each other (P < 0.05).
60
Hepatic TGF-β1 gene expression following sea buckthorn extract treatment
Sea buckthorn possibly exerts its anti-inflammatory property by increasing
anti-inflammatory cytokine mRNA level. To test this possibility, hepatic mRNA level
of anti-inflammatory cytokine TGF-β1 was measured (n = 3/group) by PCR after 30
days of daily oral gavage. Genotype, treatment had no effect and treatment did not
interact with genotype (Figure 4.9). For control mice, the ETKO had higher level
which is beneficial for ETKO obese in alleviating hepatic inflammation although the
effect probably does not exist since ETKO level was just slightly higher (Figure 4.9).
In LPS study, we found same TGF-β1 basal level between WT and ETKO. In sea
buckthorn extract treated mice, TGF-β1 expression was same between the WT and the
ETKO (Figure 4.9). Sea buckthorn extract treatment did not have effect on TGF-β1
mRNA level in both ETKO and WT mice compared to the control (Figure 4.9).
61
Figure 4.9- Hepatic transforming growth factor beta 1 (TGF-β1) gene expression
with and without sea buckthorn extract treatment- Effects of sea buckthorn extract
on WT and ETKO mice. Liver mRNA level was measured by PCR (n = 3/group).
Gene expression was assessed relative to glycerol-3-phosphate dehydrogenase
(G3PDH) as an endogenous control. mRNA expression bar graph showing mean and
SEM Two-way ANOVA was conducted. Each comparison line with * indicates the
groups are statistically different from each other (P < 0.05).
62
Sea buckthorn extract reduced liver lipid accumulation in ETKO
Sea buckthorn extract may have potential in alleviating hepatic steatosis. We
tested such potential and determined (n = 3/group) if sea buckthorn extract reduce
obesity-induced hepatic lipid accumulation in ETKO mice by conducting a 30-day
trial with daily sea buckthorn extract administration. WT hepatic lipid accumulation
was insignificant whereas ETKO control mice had significant fat buildup (Figure
4.10). Sea buckthorn extract reduced ETKO liver fat accumulation considerably
which explains lower post-treatment liver weight in the treated ETKO relative to the
control ETKO (Figure 4.3).
WT sea buckthorn ETKO control ETKO sea buckthorn
Figure 4.10- Liver histology after sea buckthorn extract treatment (30 days, 200
μg/g body weight daily)- Representative figures- Arrows point to areas of lipid
accumulation. Livers were harvested, weighed, cut, and preserved in 10% formalin in
PBS with subsequent paraffin embedding (n = 3/group). Hematoxylin and eosin stain
was used and viewed under 40x magnification.
63
Discussion
Sea buckthorn extract decreased ETKO mice body and retroperitoneal adipose
tissue weights
Our laboratory previously developed a mouse model of Pcyt2 deficiency and
further characterized effects of partially knocking out the Pcyt2 gene. We showed that
the ETKO had higher body weight and higher adipose tissue weight relative to the
WT (Fullerton et al., 2009). Prior to sea buckthorn extract treatment, 7-month old
ETKO mice weighed heavier than WT mice (Figure 4.1). By partially knocking out
the Pcyt2 gene, Pcyt2 +/- mice have lower CDP-ethanolamine leading to lower rate of
phosphatidylethanolamine (PE) synthesis and higher availability of DAG (another
substrate in PE synthesis). The excess DAG is then converted to TAG ultimately
leading to Pcyt2 deficient disease phenotype of obesity (Fullerton et al., 2009).
One previous study showed that sea buckthorn extract prevents obesity
development in mice fed a high fat diet (60% of energy from fat) (Tirupathi Pichiah et
al., 2012). We were interested in determining if sea buckthorn induces weight loss.
We found that sea buckthorn extract treatment induced body and retroperitoneal
adipose tissue weights losses in ETKO mice (Figures 4.1-4.2). Since body weight
alone does not provide an accurate and complete characterization of obesity as body
weight is composed of lean and adipose tissue weights, retroperitoneal adipose tissue
weight was also measured. One previous study showed that sea buckthorn extract
64
attenuates epididymal fat weight gain in the high fat fed mice (Tirupathi Pichiah et al.,
2012). Body weight loss is least partly attributed to liver and retroperitoneal adipose
tissue weights losses. Other organ weights reductions may also contribute to body
weight loss. One previously conducted investigation found lower hepatic mRNA
expression of acetyl-CoA carboxylase (ACC; rate limiting enzyme in fatty acid
synthesis) and higher carnitine palmitoyltransferase-1 (CPT-1; mitochondrial fatty
acid β-oxidation enzyme) and peroxisome proliferator-activated receptor-alpha
(PPAR-α; mitochondrial fatty acid β-oxidation protein) gene expression in mice
receiving sea buckthorn extract (Tirupathi Pichiah et al., 2012, Wakil, Stoops, and
Joshi, 1983). The combination of lower hepatic ACC, higher CPT-1 and PPAR-α
gene expression may result in decreased fatty acid synthesis and increased fatty acid
oxidation possibly responsible for sea buckthorn extract-mediated body,
retroperitoneal adipose tissue, and liver weights losses.
Sea buckthorn extract reduced blood glucose level in ETKO mice
Previously, we showed that the ETKO had higher post glucose administration
blood glucose level compared to the WT determined by intraperitoneal glucose
tolerance test (Fullerton et al., 2009). One previous study showed that sea buckthorn
extract attenuates obesity-induced elevation in blood glucose level (Tirupathi Pichiah
et al., 2012). WT mice had lower pre-treatment fasting as well as post glucose
65
administration blood glucose level compared to ETKO mice (Figures 4.4-4.5). In
addition to being obese, Pcyt2 +/- mice also suffer from hepatic steatosis and reduced
fatty acid oxidation which all have been frequently associated with hyperglycemia
(Fullerton et al., 2009, Jiang and Torol, 2008, Petersen and Shulman, 2006). Sea
buckthorn extract treatment lowered ETKO blood glucose concentration (Figures
4.6-4.7). Enhanced expression of both PPAR-α and PPAR-γ may contribute to blood
glucose lowering effect of sea buckthorn as both nuclear receptors play a major role in
not only glucose but also lipid metabolism (Tirupathi Pichiah et al., 2012). PPAR-γ
increases glucose metabolism in the muscle by increasing glucose uptake leading to
lower blood glucose level (Patel et al., 2013).
Sea buckthorn extract reduced ETKO hepatic lipid accumulation (liver weight
and histological analysis)
One of the effects of partially knocking out the Pcyt2 gene is hepatic lipid
accumulation leading to higher liver weight (Fullerton et al., 2009). One previous
study showed that sea buckthorn extract prevents obesity-induced hepatic lipid
accumulation in mice fed a high fat diet (60% of energy from fat) (Tirupathi Pichiah
et al., 2012). After 30 days of daily sea buckthorn extract oral gavage (200 μg/g body
weight), liver fat accumulation as TAG was lower in ETKO mice relative to the
control ETKO resulting in lower (59.79% of control) post-treatment liver weight
(Figure 4.3). Increased expression of PPAR-α and CPT-1 coupled with decreased
66
expression of ACC produce outcomes of decreased fatty acid synthesis as well as
increased fatty acid oxidation possibly contribute to sea buckthorn extract-mediated
liver weight loss resulted from lowered hepatic lipid accumulation (Tirupathi Pichiah
et al., 2012, Xu et al., 2009).
Effects of sea buckthorn extract on hepatic pro-inflammatory and
anti-inflammatory cytokine gene expression
Although there is literature stating that sea buckthorn extract exhibits
anti-inflammatory property, no publication about sea buckthorn extract’s mechanism
of action is available (Tirupathi Pichiah et al., 2012, Ganju et al., 2005). Sea
buckthorn extract treatment did not have effect on liver pro-inflammatory cytokine
IL-12 mRNA level in the ETKO relative to control (Figure 4.8). Similar to no effect
on IL-12, treatment did not have effect on hepatic anti-inflammatory cytokine TGF-β1
gene expression among ETKO rodents (Figure 4.9). It would be interesting to study
IL-12 and TGF-β1 gene expression in adipose tissue. One human double-blind,
randomized, placebo-controlled trial found sea buckthorn extract reduced blood
C-reactive protein (CRP; inflammation marker) concentration thus confirming sea
buckthorn’s anti-inflammatory property (Larmo et al., 2008). It may be worthwhile to
measure blood CRP concentration in Pcyt2 mice prior to and after sea buckthorn
treatment.
67
Conclusion
Work conducted in this thesis project demonstrated that Pcyt2 ETKO mice
benefitted from sea buckthorn extract treatment indicated by decreased body weight,
lowered tissue lipids (and consequently alleviated NAFL) and blood glucose. Results
of this study suggest that sea buckthorn extract can be a dietary approach to
ameliorate obesity and associated complications of hyperglycemia and hepatic
steatosis. More studies are needed to determine if sea buckthorn has a role in
obesity-related inflammation.
68
Chapter 5: General Discussion and Concluding Remarks
Summary of Results
For LPS project that investigated obesity pathology, LPS treatment induction of
hepatic pro-inflammatory cytokine TNFα gene expression was higher in ETKO than
WT and LPS treatment induction of hepatic anti-inflammatory cytokine IL-10 gene
expression was lower in ETKO than WT. In addition, WT and ETKO mice had mostly
same basal as well as post LPS treatment hepatic pro-inflammatory and
anti-inflammatory cytokine gene expression (TNFα, IL-12, IL-10, as well as TGF-β1).
LPS treatment resulted in higher hepatic pro-inflammatory and anti-inflammatory
cytokine gene expression specifically IL-12, IL-10 for WT and ETKO as well as
TNFα, TGF-β1 for ETKO. Furthermore, ETKO mice had higher hepatic NF-κBp65
protein level than WT mice. For sea buckthorn project that investigated a possible
remedy for metabolic syndrome, sea buckthorn extract decreased ETKO mice body
and retroperitoneal adipose tissue weights, blood glucose level, and hepatic lipid
accumulation (liver weight and histological analysis).
Strengths and Limitations
Using a mouse model to study metabolic syndrome offers the advantage of
studying the whole body physiology and biochemistry. Since metabolic syndrome
affects multiple tissues and organs, a more complete approach that involves the
69
capability to investigate the entire body is more ideal as each affected tissue and organ
interact to contribute to the complex disease pathology. Also, these studies about
metabolic syndrome have clinical applications with the potential to benefit a
significant portion of population in developed nations. Limitations include the
relatively small sample size and the use of animal model. Results from animal model
cannot be extrapolated to humans with very high accuracy.
Future Directions
It is possible that sea buckthorn extract treatment results in same TNFα
(pro-inflammatory cytokine) gene expression following LPS treatment compared to
LPS untreated in ETKO mice based on the plant’s anti-inflammatory property.
Testing such possibility is an avenue of future research. Although we determined
beneficial effects of sea buckthorn extract in ETKO mice, mechanisms of these
effects are still uncertain and require future research. For example, as mentioned
earlier, lower hepatic mRNA expression of ACC (fatty acid synthesis enzyme) as well
as higher liver gene expression of CPT-1 (fatty acid β-oxidation enzyme) and PPAR-α
(fatty acid β-oxidation protein) may result in decreased fatty acid synthesis and
increased fatty acid oxidation possibly responsible for sea buckthorn extract-mediated
body, retroperitoneal adipose tissue, and liver weights losses. Determining if
70
enhanced expression of both PPAR-α and PPAR-γ contribute to blood glucose
lowering effect of sea buckthorn extract is also necessary.
Concluding Remarks
Work conducted in this thesis project demonstrated that obesity as induced by
partially knocking out Pcyt2 gene increases liver sensitivity to acute inflammation.
Also, sea buckthorn extract treatment reduced 4 of 5 symptoms of metabolic
syndrome in Pcyt2 ETKO mice.
71
Bibliography
Aaronson, D. S., & Horvath, C. M. (2002). A road map for those who don't
know JAK-STAT. Science, 296(5573), 1653-1655.
Abdel-Salam, B. K., & Sayed, A. A. A. (2012). Beneficial effect of garlic on
d-galactosamine and lipopolysaccharide-induced acute hepatic failure in
male albino rats. Allergologia et Immunopathologia, 40(4), 238-243.
Aigner, E., Theurl, I., Theurl, M., Lederer, D., Haufe, H., Dietze, O., ... &
Weiss, G. (2008). Pathways underlying iron accumulation in human
nonalcoholic fatty liver disease. Am J Clin Nutr, 87(5), 1374-1383.
Bacon, B. R., Farahvash, M. J., Janney, C. G., & Neuschwander-Tetri, B. A.
(1994). Nonalcoholic steatohepatitis: an expanded clinical entity.
Gastroenterology-Orlando, 107(4), 1103-1109.
Baffy, G. (2009). Kupffer cells in non-alcoholic fatty liver disease: the
emerging view. Journal of hepatology, 51(1), 212-223.
Bakovic, M., Fullerton, M. D., & Michel, V. (2007). Metabolic and
molecular aspects of ethanolamine phospholipid biosynthesis: the role of
CTP: phosphoethanolamine cytidylyltransferase (Pcyt2). Biochem and Cell
Biol, 85(3), 283-300.
Basu, M., Prasad, R., Jayamurthy, P., Pal, K., Arumughan, C., & Sawhney,
R. C. (2007). Anti-atherogenic effects of seabuckthorn (Hippophaea
rhamnoides) seed oil. Phytomedicine, 14(11), 770-777.
Baue, A. E. (1994). Multiple organ failure, multiple organ dysfunction
syndrome, and the systemic inflammatory response syndrome-where do we
stand? Shock, 2(6), 385-397.
72
Berezhnaya, G. A., Ozerinina, O. V., Yeliseev, I. P., Tsydendambaev, V. D.,
Vereshchagin, A. G. (1993). Developmental changes in the absolute content and
fatty acid composition of acyl lipids of sea buckthorn fruits. Plant Physiol and
Biochem, 31(3), 323-332.
Brasier, A. R. (2006). The NF-κB regulatory network. Cardiovas Toxi, 6(2), 111-130.
Brasier, A. R., Ron, D., Tate, J. E., & Habener, J. F. (1990). A family of constitutive
C/EBP-like DNA binding proteins attenuate the IL-1 alpha induced, NF kappa B
mediated trans-activation of the angiotensinogen gene acute-phase response
element. The EMBO Journal, 9(12), 3933.
Carroll, L., Voisey, J., & Van Daal, A. (2004). Mouse models of obesity. Clinics in
Derma, 22(4), 345-349.
Casafont, F., Crespo, J., Mayorga, M., Fernadez-Escalante, J. C., & Pons-Romero, F.
(2007). Lipopolysaccharide-binding protein plasma levels and liver TNF-alpha gene
expression in obese patients: evidence for the potential role of endotoxin in the
pathogenesis of non-alcoholic steatohepatitis. Obesity surgery,17(10), 1374-1380.
Cherniack, E. P. (2011). Polyphenols: planting the seeds of treatment for the
metabolic syndrome. Nutrition, 27(6), 617-623.
Clementi, A. H., Gaudy, A. M., van Rooijen, N., Pierce, R. H., & Mooney, R. A.
(2009). Loss of Kupffer cells in diet-induced obesity is associated with increased
hepatic steatosis, STAT3 signaling, and further decreases in insulin
signaling. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease,1792(11),
1062-1072.
Collart, M. A., Baeuerle, P., & Vassalli, P. (1990). Regulation of tumor necrosis factor
alpha transcription in macrophages: involvement of four kappa B-like motifs and of
constitutive and inducible forms of NF-kappa B. Molecular and Cellular
Biology, 10(4), 1498-1506.
Conti, P., Pang, X., Boucher, W., Letourneau, R., Reale, M., Barbacane, R. C., ... &
Theoharides, T. C. (1997). Monocyte chemotactic protein-1 is a proinflammatory
chemokine in rat skin injection sites and chemoattracts basophilic granular
cells. International Immunology, 9(10), 1563-1570.
73
Coutelier, J. P., Van Broeck, J. O. H. A. N., & Wolf, S. F. (1995). Interleukin-12 gene
expression after viral infection in the mouse. Journal of Virology, 69(3), 1955-1958.
Decker, K. (1990). Biologically active products of stimulated liver macrophages
(Kupffer cells). European Journal of Biochemistry, 192(2), 245-261.
de Luca, C., & Olefsky, J. M. (2008). Inflammation and insulin resistance. FEBS
Letters, 582(1), 97-105.
Diehl, A. M., Goodman, Z., & Ishak, K. G. (1988). Alcohollike liver disease in
nonalcoholics. A clinical and histologic comparison with alcohol-induced liver
injury. Gastroenterology, 95(4), 1056-1062.
Dinarello, C. A. (2000). Proinflammatory cytokines. CHEST Journal, 118(2),
503-508.
Dulos, J., Kaptein, A., Kavelaars, A., Heijnen, C., & Boots, A. (2005). Tumour
necrosis factor-alpha stimulates dehydroepiandrosterone metabolism in human
fibroblast-like synoviocytes: a role for nuclear factor-kappaB and activator protein-1
in the regulation of expression of cytochrome p450 enzyme 7b. Arthritis Res Ther, 7,
R1271-R1280.
Farooqi, I. S., & O’Rahilly, S. (2006). Genetics of obesity in humans. Endocrine
reviews, 27(7), 710-718.
Ferrero‐Miliani, L., Nielsen, O. H., Andersen, P. S., & Girardin, S. E. (2007). Chronic
inflammation: importance of NOD2 and NALP3 in interleukin‐1β generation. Clinical
& Experimental Immunology, 147(2), 227-235.
Francoeur, C., Escaffit, F., Vachon, P. H., Beaulieu, J. F. (2004). Proinflammatory
cytokines TNF-alpha and IFN-gamma alter laminin expression under an
apoptosis-independent mechanism in human intestinal epithelial cells.
American Journal of Physiology Gastrointestinal Liver Physiology, 287(3),
G592-598.
Franke, W., & Muller, H. (1983). A contribution to the biology of useful plants. 2.
Quantity and composition of fatty acid in the fat of the fruit flesh and seed of sea
buckthorn. Angew. Bot, 57, 77-83.
74
Fullerton, M. D., Hakimuddin, F., & Bakovic, M. (2007). Developmental and
metabolic effects of disruption of the mouse CTP: phosphoethanolamine
cytidylyltransferase gene (Pcyt2). Molecular and cellular biology, 27(9), 3327-3336.
Fullerton, M. D., Hakimuddin, F., Bonen, A., & Bakovic, M. (2009). The
development of a metabolic disease phenotype in CTP: phosphoethanolamine
cytidylyltransferase-deficient mice. Journal of Biological Chemistry, 284(38),
25704-25713.
Ganju, L., Padwad, Y., Singh, R., Karan, D., Chanda, S., Chopra, M. K., ... &
Sawhney, R. C. (2005). Anti-inflammatory activity of Seabuckthorn (Hippophae
rhamnoides) leaves. International Immunopharmacology, 5(12), 1675-1684.
Geetha, S., Sai Ram, M., Mongia, S. S., Singh, V., Ilavazhagan, G., & Sawhney, R. C.
(2003). Evaluation of antioxidant activity of leaf extract of Seabuckthorn (Hippophae
rhamnoides L.) on chromium (VI) induced oxidative stress in albino rats. Journal of
Ethnopharmacology, 87(2), 247-251.
Geetha, S., Singh, V., Ram, M. S., Ilavazhagan, G., Banerjee, P. K., & Sawhney, R. C.
(2005). Immunomodulatory effects of seabuckthorn (Hippophae rhamnoides L.)
against chromium (VI) induced immunosuppression. Molecular and cellular
biochemistry, 278(1-2), 101-109.
Gibellini, F., & Smith, T. K. (2010). The Kennedy pathway—De novo synthesis of
phosphatidylethanolamine and phosphatidylcholine. IUBMB life, 62(6), 414-428.
Gilmore, T. D. (2006). Introduction to NF-κB: players, pathways,
perspectives.Oncogene, 25(51), 6680-6684.
Grewe, M., Gausling, R., Gyufko, K., Hoffmann, R., & Decker, K. (1994). Regulation
of the mRNA expression for tumor necrosis factor-α in rat liver macrophages. Journal
of hepatology, 20(6), 811-818.
Grey, C., Widén, C., Adlercreutz, P., Rumpunen, K., & Duan, R. D. (2010).
Antiproliferative effects of sea buckthorn (Hippophae rhamnoides L.) extracts on
human colon and liver cancer cell lines. Food Chemistry, 120(4), 1004-1010.
75
Haffner, M. C., Berlato, C., & Doppler, W. (2006). Exploiting our knowledge of
NF-κB signaling for the treatment of mammary cancer. Journal of mammary gland
biology and neoplasia, 11(1), 63-73.
Hosoi, T., Wada, S., Suzuki, S., Okuma, Y., Akira, S., Matsuda, T., & Nomura, Y.
(2004). Bacterial endotoxin induces IL-20 expression in the glial cells.Molecular
brain research, 130(1), 23-29.
Hsieh, C. S., Macatonia, S. E., Tripp, C. S., Wolf, S. F., O'Garra, A., & Murphy, K. M.
(1993). Development of TH1 CD4+ T cells through IL-12 produced by
Listeria-induced macrophages. Science, 260(5107), 547-549.
Hsu, Y. W., Tsai, C. F., Chen, W. K., & Lu, F. J. (2009). Protective effects of
seabuckthorn (Hippophae rhamnoide s L.) seed oil against carbon
tetrachloride-induced hepatotoxicity in mice. Food and Chemical Toxicology,47(9),
2281-2288.
Kallio, H., Yang, B., & Peippo, P. (2002). Effects of different origins and harvesting
time on vitamin C, tocopherols, and tocotrienols in sea buckthorn (Hippophae
rhamnoides) berries. Journal of Agricultural and Food Chemistry,50(21), 6136-6142.
Kanda, H., Tateya, S., Tamori, Y., Kotani, K., Hiasa, K. I., Kitazawa, R., ... & Kasuga,
M. (2006). MCP-1 contributes to macrophage infiltration into adipose tissue, insulin
resistance, and hepatic steatosis in obesity. Journal of Clinical Investigation, 116(6),
1494-1505.
Kawai, T., Adachi, O., Ogawa, T., Takeda, K., & Akira, S. (1999). Unresponsiveness
of MyD88-deficient mice to endotoxin. Immunity, 11(1), 115-122.
Kohgo, Y., Ikuta, K., Ohtake, T., Torimoto, Y., & Kato, J. (2007). Iron overload and
cofactors with special reference to alcohol, hepatitis C virus infection and
steatosis/insulin resistance. World Journal of Gastroenterology, 13(35), 4699.
Korbie, D. J., & Mattick, J. S. (2008). Touchdown PCR for increased specificity and
sensitivity in PCR amplification. Nature Protocols, 3(9), 1452-1456.
76
Kumar, M. S., Dutta, R., Prasad, D., & Misra, K. (2011). Subcritical water extraction
of antioxidant compounds from Seabuckthorn (Hippophae rhamnoides) leaves for the
comparative evaluation of antioxidant activity.Food Chemistry, 127(3), 1309-1316.
Lanthier, N., Molendi-Coste, O., Cani, P. D., van Rooijen, N., Horsmans, Y., &
Leclercq, I. A. (2011). Kupffer cell depletion prevents but has no therapeutic effect on
metabolic and inflammatory changes induced by a high-fat diet. The FASEB
Journal, 25(12), 4301-4311.
Larmo, P., Alin, J., Salminen, E., Kallio, H., & Tahvonen, R. (2007). Effects of sea
buckthorn berries on infections and inflammation: a double-blind, randomized,
placebo-controlled trial. European journal of clinical nutrition, 62(9), 1123-1130.
Lee, Y. S. (2009). The role of leptin-melanocortin system and human weight
regulation: lessons from experiments of nature. Annals Academy of Medicine
Singapore, 38(1), 34.
Leonardi, R., Frank, M. W., Jackson, P. D., Rock, C. O., & Jackowski, S. (2009).
Elimination of the CDP-ethanolamine pathway disrupts hepatic lipid
homeostasis. Journal of Biological Chemistry, 284(40), 27077-27089.
Lepper, P. M., Schumann, C., Triantafilou, K., Rasche, F. M., Schuster, T., Frank,
H., ... & von Eynatten, M. (2007). Association of lipopolysaccharide-binding protein
and coronary artery disease in men. Journal of the American College of
Cardiology, 50(1), 25-31.
Li, H., Zheng, H. W., Chen, H., Xing, Z. Z., You, H., Cong, M., & Jia, J. D. (2012).
Hepatitis B virus particles preferably induce Kupffer cells to produce TGF-β1 over
pro-inflammatory cytokines. Digestive and Liver Disease, 44(4), 328-333.
Lin, H. V., Kim, J. Y., Pocai, A., Rossetti, L., Shapiro, L., Scherer, P. E., & Accili, D.
(2007). Adiponectin resistance exacerbates insulin resistance in insulin receptor
transgenic/knockout mice. Diabetes, 56(8), 1969-1976.
Liu, H., Yu, W., Liou, L. Y., & Rice, A. P. (2003). Isolation and characterization of
the human DC-SIGN and DC-SIGNR promoters. Gene, 313, 149-159.
77
Livingston, D. H., & Deitch, E. A. (1995). Multiple organ failure: a common problem
in surgical intensive care unit patients. Annals of medicine, 27(1), 13-20.
Lopez, A. D., Mathers, C. D., Ezzati, M., Jamison, D. T., & Murray, C. J. (2006).
Global and regional burden of disease and risk factors, 2001: systematic analysis of
population health data. The Lancet, 367(9524), 1747-1757.
Ludwig, J., Viggiano, T. R., McGill, D. B., & Oh, B. J. (1980). Nonalcoholic
steatohepatitis: Mayo Clinic experiences with a hitherto unnamed disease. InMayo
Clinic proceedings. Mayo Clinic (Vol. 55, No. 7, pp. 434-438).
Lumeng, C. N., & Saltiel, A. R. (2011). Inflammatory links between obesity and
metabolic disease. The Journal of clinical investigation, 121(6), 2111.
Maheshwari, D. T., Kumar, Y., Verma, S. K., Singh, V. K., & Singh, S. N. (2011).
Antioxidant and hepatoprotective activities of phenolic rich fraction of Seabuckthorn
(Hippophae rhamnoides L.) leaves. Food and Chemical Toxicology, 49(9),
2422-2428.
Marchesini, G., Moscatiello, S., Di Domizio, S., & Forlani, G. (2008).
Obesity-associated liver disease. Journal of Clinical Endocrinology &
Metabolism, 93(11 Supplement 1), s74-s80.
Martin, G. S., Mannino, D. M., Eaton, S., & Moss, M. (2003). The epidemiology of
sepsis in the United States from 1979 through 2000. New England Journal of
Medicine, 348(16), 1546-1554.
McClain, C., Hill, D., Schmidt, J., & Diehl, A. M. (1993, May). Cytokines and
alcoholic liver disease. In Seminars in Liver Diseases (Vol. 13, pp. 170-170). GEORG
THIEME VERLAG.
Moreno-Navarrete, J. M., Ortega, F., Serino, M., Luche, E., Waget, A., Pardo, G., ...
& Fernández-Real, J. M. (2011). Circulating lipopolysaccharide-binding protein (LBP)
as a marker of obesity-related insulin resistance. International Journal of
Obesity, 36(11), 1442-1449.
Morgan, E. T., Li-Masters, T., & Cheng, P. Y. (2002). Mechanisms of cytochrome
P450 regulation by inflammatory mediators. Toxicology, 181, 207-210.
78
Mori, N., & Prager, D. (1996). Transactivation of the interleukin-1alpha promoter by
human T-cell leukemia virus type I and type II Tax proteins. Blood, 87(8), 3410-3417.
Nijveldt, R. J., van Nood, E., van Hoorn, D. E., Boelens, P. G., van Norren, K., & van
Leeuwen, P. A. (2001). Flavonoids: a review of probable mechanisms of action and
potential applications. The American journal of clinical nutrition,74(4), 418-425.
O'Rourke, R. W., White, A. E., Metcalf, M. D., Winters, B. R., Diggs, B. S., Zhu, X.,
& Marks, D. L. (2012). Systemic inflammation and insulin sensitivity in obese IFN-γ
knockout mice. Metabolism, 61(8), 1152-1161.
Patel, T. P., Soni, S., Parikh, P., Gosai, J., Chruvattil, R., & Gupta, S. (2013).
Swertiamarin: An Active Lead from Enicostemma littorale Regulates Hepatic and
Adipose Tissue Gene Expression by Targeting PPAR-γ and Improves Insulin
Sensitivity in Experimental NIDDM Rat Model. Evidence-Based Complementary and
Alternative Medicine, 2013.
Pavlovic, Z., & Bakovic, M. (2013). Regulation of Phosphatidylethanolamine
Homeostasis—The Critical Role of CTP: Phosphoethanolamine Cytidylyltransferase
(Pcyt2). International journal of molecular sciences, 14(2), 2529-2550.
Peng, T., Lu, X., Lei, M., & Feng, Q. (2003). Endothelial nitric-oxide synthase
enhances lipopolysaccharide-stimulated tumor necrosis factor-α expression via
cAMP-mediated p38 MAPK pathway in cardiomyocytes. Journal of Biological
Chemistry, 278(10), 8099-8105.
Perfield, J. W., Ortinau, L. C., Pickering, R. T., Ruebel, M. L., Meers, G. M., &
Rector, R. S. (2013). Altered hepatic lipid metabolism contributes to nonalcoholic
Fatty liver disease in leptin-deficient ob/ob mice. Journal of obesity, 2013.
Perkins, N. D. (2007). Integrating cell-signalling pathways with NF-κB and IKK
function. Nature Reviews Molecular Cell Biology, 8(1), 49-62.
Pichiah, P. B., Moon, H. J., Park, J. E., Moon, Y. J., & Cha, Y. S. (2012). Ethanolic
extract of seabuckthorn (Hippophae rhamnoides L) prevents high-fat diet–induced
obesity in mice through down-regulation of adipogenic and lipogenic gene
expression. Nutrition Research, 32(11), 856-864.
79
Pintea, A., Marpeau, A., Faye, M., Socaciu, C., & Gleizes, M. (2001). Polar lipid and
fatty acid distribution in carotenolipoprotein complexes extracted from sea buckthorn
fruits. Phytochemical Analysis, 12(5), 293-298.
Puddu, P., Fantuzzi, L., Borghi, P., Varano, B., Rainaldi, G., Guillemard, E., ... &
Gessani, S. (1997). IL-12 induces IFN-gamma expression and secretion in mouse
peritoneal macrophages. The journal of Immunology, 159(7), 3490-3497.
Reber, L., Vermeulen, L., Haegeman, G., & Frossard, N. (2009). Ser276
phosphorylation of NF-kB p65 by MSK1 controls SCF expression in
inflammation. PLoS One, 4(2), e4393.
Renström, F., Payne, F., Nordström, A., Brito, E. C., Rolandsson, O., Hallmans, G., ...
& Franks, P. W. (2009). Replication and extension of genome-wide association study
results for obesity in 4923 adults from northern Sweden.Human molecular
genetics, 18(8), 1489-1496.
Rietschel, E. T., Kirikae, T., Schade, F. U., Mamat, U., Schmidt, G., Loppnow, H., ...
& Di Padova, F. (1994). Bacterial endotoxin: molecular relationships of structure to
activity and function. The FASEB Journal, 8(2), 217-225.
Rocha, V. Z., & Folco, E. J. (2011). Inflammatory concepts of obesity.International
journal of inflammation, 2011.
Rocha, V. Z., Folco, E. J., Sukhova, G., Shimizu, K., Gotsman, I., Vernon, A. H., &
Libby, P. (2008). Interferon-γ, a Th1 Cytokine, Regulates Fat Inflammation A Role
for Adaptive Immunity in Obesity. Circulation research, 103(5), 467-476.
Rousi, A. (1971). The genus Hippophae L.: A taxonomic study. Ann. Bot. Fenn,8(3),
177-227.
Sajan, M. P., Standaert, M. L., Nimal, S., Varanasi, U., Pastoor, T., Mastorides, S., ...
& Farese, R. V. (2009). The critical role of atypical protein kinase C in activating
hepatic SREBP-1c and NFκB in obesity. Journal of lipid research, 50(6), 1133-1145.
Schroder, K., Hertzog, P. J., Ravasi, T., & Hume, D. A. (2004). Interferon-γ: an
overview of signals, mechanisms and functions. Journal of leukocyte biology,75(2),
163-189.
80
Sharif, O., Bolshakov, V. N., Raines, S., Newham, P., & Perkins, N. D. (2007).
Transcriptional profiling of the LPS induced NF-κB response in macrophages.BMC
immunology, 8(1), 1.
Sharma, M., Siddique, M. W., Shamim, A. M., Shukla, G., & Pillai, K. K. (2011).
Evaluation of antidiabetic and antioxidant effects of seabuckthorn (Hippophae
rhamnoides l.) in streptozotocin-nicotinamide induced diabetic rats. In The Open
Conference Proceedings Journal (Vol. 2, pp. 53-58).
Shea-Budgell, M., Dojka, M., Nimmo, M., Lee, D., & Xu, Z. (2006). A BRIEF
COMMUNICATION Marginal Zinc Deficiency Increased the Susceptibility to Acute
Lipopolysaccharide-Induced Liver Injury in Rats. Experimental Biology and
Medicine, 231(5), 553-558.
Singh, R. K., Fullerton, M. D., Vine, D., & Bakovic, M. (2012). Mechanism of
hypertriglyceridemia in CTP: phosphoethanolamine cytidylyltransferase-deficient
mice. Journal of Lipid Research, 53(9), 1811-1822.
Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H.,
Provenzano, M., ... & Klenk, D. C. (1985). Measurement of protein using
bicinchoninic acid. Analytical biochemistry, 150(1), 76-85.
Šnē, E., Segliņa, D., Galoburda, R., & Krasnova, I. (2013). Content of Phenolic
Compounds in Various Sea Buckthorn Parts. In Proceedings of the Latvian Academy
of Sciences. Section B. Natural, Exact, and Applied Sciences (pp. 27-31).
Sohn, B., Moon, H., Kim, T., Kang, H., Bae, Y., Lee, K., & Kim, S. (2001).
Interleukin-10 up-regulates tumour-necrosis-factor-α-related apoptosis-inducing
ligand (TRAIL) gene expression in mammary epithelial cells at the involution
stage. Biochem. J, 360, 31-38.
Son, Y. H., Jeong, Y. T., Lee, K. A., Choi, K. H., Kim, S. M., Rhim, B. Y., & Kim, K.
(2008). Roles of MAPK and NF-[kappa] B in Interleukin-6 Induction by
Lipopolysaccharide in Vascular Smooth Muscle Cells. Journal of cardiovascular
pharmacology, 51(1), 71-77.
81
Suryakumar, G., & Gupta, A. (2011). Medicinal and therapeutic potential of Sea
buckthorn (Hippophae rhamnoides L.). Journal of ethnopharmacology,138(2),
268-278.
Tanuma, N., Shima, H., Nakamura, K., & Kikuchi, K. (2001). Protein tyrosine
phosphatase εC selectively inhibits interleukin-6–and interleukin-10–induced
JAK-STAT signaling. Blood, 98(10), 3030-3034.
Tran, A., & Gual, P. (2013). Non-alcoholic steatohepatitis in morbidly obese
patients. Clinics and research in hepatology and gastroenterology, 37(1), 17-29.
Trinchieri, G. (1995). Interleukin-12: a proinflammatory cytokine with
immunoregulatory functions that bridge innate resistance and antigen-specific
adaptive immunity. Annual review of immunology, 13(1), 251-276.
Ulevitch, R. J., & Tobias, P. S. (1995). Receptor-dependent mechanisms of cell
stimulation by bacterial endotoxin. Annual review of immunology, 13(1), 437-457.
Wagner, J. G., & Roth, R. A. (1999). Neutrophil migration during
endotoxemia.Journal of leukocyte biology, 66(1), 10-24.
Wakil, S. J., Stoops, J. K., & Joshi, V. C. (1983). Fatty acid synthesis and its
regulation. Annual review of biochemistry, 52(1), 537-579.
Wang, J., Zhang, W., Zhu, D., Zhu, X., Pang, X., & Qu, W. (2011). Hypolipidaemic
and hypoglycaemic effects of total flavonoids from seed residues of Hippophae
rhamnoides L. in mice fed a high‐fat diet. Journal of the Science of Food and
Agriculture, 91(8), 1446-1451.
Wheeler, M. D. (2003). Endotoxin and Kupffer cell activation in alcoholic liver
disease. Alcohol research and Health, 27, 300-306.
Willer, C. J., Speliotes, E. K., Loos, R. J., Li, S., Lindgren, C. M., Heid, I. M., ... &
Gillson, C. J. (2008). Six new loci associated with body mass index highlight a
neuronal influence on body weight regulation. Nature genetics, 41(1), 25-34.
82
Yang, B., & Kallio, H. P. (2001). Fatty acid composition of lipids in sea buckthorn
(Hippophae rhamnoides L.) berries of different origins. Journal of Agricultural and
Food Chemistry, 49(4), 1939-1947.
Yang, S. Q., Lin, H. Z., Land, M. D., Clemens, M., & Diehl, A. M. (1997). Obesity
increases sensitivity to endotoxin liver injury: Implications for the pathogenesis of
steatohepatitis. Proceedings of the National Academy of Sciences, 94, 2557–2562.
Zhang, F. X., Kirschning, C. J., Mancinelli, R., Xu, X. P., Jin, Y., Faure, E., ... &
Arditi, M. (1999). Bacterial lipopolysaccharide activates nuclear factor-κB through
interleukin-1 signaling mediators in cultured human dermal endothelial cells and
mononuclear phagocytes. Journal of Biological Chemistry, 274(12), 7611-7614.
Zhu, L., Johnson, C., & Bakovic, M. (2008). Stimulation of the human CTP:
phosphoethanolamine cytidylyltransferase gene by early growth response protein
1. Journal of lipid research, 49(10), 2197-2211.
83
Appendix A
Gene Primers Temperatures, Time, and
Cycle Numbers
IFNγ
Puddu et al., 1997
F: 5' AACGCTACACACTGCATCTTG
G 3'
R: 5' GACTTCAAAGAGTCTGAGG 3'
95°C 5 min
(90°C 40 sec 62°C 40
sec 72°C 1 min)- 30
cycles
72°C 10 min
TNFα
Peng et al., 2003
F: 5' CCGATGGGTTGTACCTTGTC 3'
R: 5' GGGCTGGGTAGAGAATGGAT
3'
95°C 5 min
(95°C 1.5 min 62°C 1
min 72°C 45 sec)- 40
cycles
72°C 10 min
IL-12
Coutelier, Van
Broeck, and Wolf,
1995
F: 5' TTGCCCTCCTAAAC
CACCTCA 3’
R: 5' CTTGCTCTTCTGCT
AACACAT 3’
95°C 5 min
(95°C 2 min 55°C 2 min
72°C 1 min)- 35 cycles
72°C 10 min
IL-10
Sohn et al., 2001
F: 5' GCTGAGGCGCTGTCATCGAT 3'
R: 5' GAGCTGCTGCAGGAATGATC 3'
95°C 5 min
(94°C 45 sec 62°C 1 min
72°C 40 sec)- 25 cycles
72°C 10 min
TGF-β1
Oi, Yamamoto,
and Nishioka,
2004
F: 5' AAGTGGATCCACGAGCCCAA 3'
R: 5' CTGCACTTGCAGGAGCGCAC 3'
95°C 5 min
(95°C 2 min 60°C 2 min
72°C 1 min)- 40 cycles
72°C 10 min
specific cytokine primers used in Chapter 3 PCR analyses
84
Appendix B
Gene Primers Temperatures, Time, and
Cycle Numbers
IL-12
F: 5' ACCCTTGCATCTGGC
GTCTA 3’
R: 5' TGGTCTTCAGCAGGT
TTCGG 3’
95°C 7 min
(95°C 2 min 64°C
(annealing
temperature-Ta) 1 min
72°C 40 sec)- 18 cycles
(every cycle, Ta goes
down 0.5°C)
(95°C 2 min 55°C 1 min
72°C 40 sec)- 17 cycles
72°C 10 min
TGF-β1
F: 5' GCTGAACCAAGGAGACGGAA
3'
R: 5' AGAAGTTGGCATGGTAGCCC 3'
95°C 7 min
(95°C 2 min 64°C (Ta) 1
min 72°C 45 sec)- 18
cycles (every cycle,
Ta goes down 0.5°C)
(95°C 2 min 55°C 1 min
72°C 45 sec)- 17 cycles
72°C 10 min
G3PDH
F: 5' ACCACAGTCCATGCCATCAC 3'
R: 5' TCCACCACCCTGTTGCTGTA 3'
95°C 3 min
(95°C 40 sec 55°C 40
sec 72°C 1 min)- 32
cycles
72°C 10 min
specific cytokine primers used for Chapter 4 PCR analyses
Recommended