View
225
Download
0
Category
Preview:
Citation preview
TECHNICAL NOTE
Novel tetra- and pentanucleotide microsatellite markers allowfor multiplexed genotyping of Sulawesi tarsiers (Tarsius spp.)
Stefan Merker • Desiree Boucsein •
Barbara Feldmeyer • Dyah Perwitasari-Farajallah •
Bruno Streit
Received: 21 September 2011 / Accepted: 22 September 2011 / Published online: 1 October 2011
� Springer Science+Business Media B.V. 2011
Abstract Based on 454 sequencing, we characterized 10
polymorphic tetra- and pentanucleotide microsatellites for
population studies of Sulawesi tarsiers. We identified 2516
repeat regions and designed PCR primer pairs for 60 tetra-,
penta- and hexanucleotide repeat loci. Of 16 markers tested
with dye-labelled primers, 11 proved to be polymorphic
and 10 were readily amplified in multiplex PCR reactions.
We tested 54 individuals of three species (T. lariang,
T. dentatus, T. wallacei) and 10 putative hybrids for allelic
diversity. All loci are genetically unlinked, one locus was
found to deviate from Hardy–Weinberg equilibrium in one
species. The novel marker system will aid studies of tarsier
landscape genetics in the biodiversity hotspot Sulawesi.
Keywords 454 Sequencing � Microsatellites � Primates �Sulawesi � Tarsius
Next-generation sequencing is the new method of choice
for characterizing microsatellite loci. Novel marker sys-
tems can easily be tailored to include e.g., different repeat
region lengths or various degrees of polymorphism. It is
thus valuable not only to identify new polymorphic loci for
yet unstudied taxa but also to complement existing marker
sets to increase efficacy of genotyping and to address
questions at a deeper level of resolution. Molecular tools
are particularly helpful in disentangling cryptic species
complexes. Sulawesi tarsiers are such a group. Tarsiers are
small nocturnal, Southeast Asian primates whose isolated
phylogenetic position had sparked controversy among
evolutionists for decades. Apart from addressing the evo-
lutionary position of Tarsius, genetic studies have con-
centrated on the origin of the intriguing species diversity on
Sulawesi thus supporting the notion of numerous taxa on
this island—some of them under great conservation threat
(IUCN 2011). Dinucleotide repeat markers have previously
been isolated and characterized for Sulawesi tarsiers
(Merker et al. 2007) and for Philippine tarsiers (Merker
et al. 2008). These were employed in studies of hybrid-
ization (Merker et al. 2009), species differentiation and
characterization (Merker et al. 2010) and in analysing
pedigrees (Driller et al. 2009) of Sulawesi tarsiers. As PCR
multiplexing these markers was impracticable and a num-
ber of loci called for repeated typing, these studies required
considerable time, effort and funds. It was thus our inten-
tion to characterize novel, quick-and-easy-to-type micro-
satellite loci to provide the burgeoning field of tarsier
phylogeography with efficient genotyping tools.
DNA was isolated from an ear biopsy of a Lariang
tarsier (Tarsius lariang) captured near the village of
Powelua, Sulawesi, Indonesia. After DNA extraction with
a DNeasy Blood and Tissue Kit (Qiagen) the sample was
WGA-amplified using a GenomiPhi DNA Amplification
S. Merker (&) � D. Boucsein � B. Streit
Evolutionary Ecology Group, Goethe University Frankfurt,
Biologicum, Max-von-Laue-Str. 13, 60438 Frankfurt am Main,
Germany
e-mail: smerker@bio.uni-frankfurt.de
B. Feldmeyer
Molecular Ecology Group, Forschungszentrum Biodiversitat
und Klima, Siesmayerstr. 70A, 60323 Frankfurt am Main,
Germany
D. Perwitasari-Farajallah
Primate Research Center, Bogor Agricultural University,
Jalan Lodaya II/5, Bogor 16151, Indonesia
D. Perwitasari-Farajallah
Department of Biology, Bogor Agricultural University,
Gedung FAPET W1L5 Kampus IPB Darmaga,
Bogor, Indonesia
123
Conservation Genet Resour (2012) 4:343–345
DOI 10.1007/s12686-011-9543-z
Kit (GE Healthcare). 0.5 lg of the sample were 454
sequenced on � plate. Screening reads for microsatellite
repeat regions using an in-lab Python script (by B. Gre-
shake) resulted in the identification of 2516 loci with
2–6 bp-repeats. Of these, 60 tetra-, penta- and hexanu-
cleotide repeat regions were selected for further testing
based on flanking region composition, repeat length and
homogeneity. Primer pairs were designed for each marker,
and PCR was performed using one sample of T. lariang, T.
dentatus and T. wallacei each. PCR results were examined
by electrophoresis on a 1.4% agarose gel estimating
polymorphism and ready amplification by eye. For 16
markers, forward or reverse primers were dye-labelled
(Cy5 and IRD700 from metabion; DY-751 from bio-
mers.net). Of these loci, 11 proved to be polymorphic
(visualized on a Beckman Coulter capillary sequencer CEQ
2000). One locus was not consistently amplified in multi-
plex PCR; the remaining 10 primer pairs were arranged
into three multiplex reactions (Table 1) and subjected to
PCR using Type-it Microsatellite PCR kits (Qiagen). PCR
included initial denaturation for 5:00 min at 95�C, 32
cycles of 0:30 min at 95�C, 1:30 min at 60�C and 0:30 min
at 72�C and final extension for 30:00 min at 60�C. Com-
ponents of a 12.5 ll-reaction mix included 6.25 ll Type-it
master mix, 1.25 ll primer mix, 1.25 ll Q-solution,
3.25 ll RNase-free water and 1 ll template DNA. Markers
were tested on 20 T. lariang, 20 T. dentatus, 14 T. wallacei
(Table 2) and 10 interspecific hybrids. Animals were col-
lected between 2001 and 2008 in central Sulawesi (Merker
unpublished, Merker et al. 2009, 2010). To disclose as
much allelic diversity as possible, samples from different
populations covering a wide geographic range were cho-
sen. To allow for tests for deviation from Hardy–Weinberg
equilibrium (HWE), one reference population was over-
represented in each species sample (‘‘Peana’’ for T. lariang,
n = 11; ‘‘Kamarora’’ for T. dentatus, n = 10; ‘‘Uwe-
manje’’ for T. wallacei; n = 7; for population details see
Merker et al. 2009, 2010).
ARLEQUIN v3.5 (Excoffier and Lischer 2010) was
used to calculate expected (HE) and observed (HO) heter-
ozygosity and to test for deviations from HWE and linkage
equilibrium in reference populations. All loci were found to
be in genetic equilibrium. After applying a Bonferroni
correction for multiple tests, deviation from HWE was
found in only one locus (Tl2407) in T. lariang possibly due
to a close kinship of the three homozygotes carrying allele
140 (as shown for two of these, individuals Jm17 (son) and
Am18 (father), by Driller et al. 2009). Applicability of the
new set of markers was confirmed (data not shown) by tests
of species differentiation (PCA in GENALEX v6.4.1,
Peakall and Smouse 2006) and by assignments of indi-
viduals (STRUCTURE, Pritchard et al. 2000) to either
Table 1 Characteristics of 10 novel microsatellite markers for Sulawesi tarsiers
Locus Primer pair sequence (50–30) Repeat motif Multiplex
reaction
GenBank Acc. no.
Tl2296 F: CTTTGGGAGGACGAGATGAGa
R: TGAGTTGCAATGGTTTTCCA
(AATA)5 III JN652221
Tl2301 F: CCAGAACACTGCTTATGGATGAa
R: ACCCTGAATTGTACCCCACA
(TTTA)13 I JN652222
Tl2325 F: ACTTCAGTCTGGGCGACAG
R: ATGATCTCACTCAGCGGTCAb
(AAAT)9 II JN652223
Tl2328 F: TCACAACCGCTTTCACCATAc
R: TGCAGTTTCGTCATTGGAAA
(AGAT)10 II JN652224
Tl2350 F: CAAACCCCAGCATTCCACb
R: GCCATGATACACTCAAATGGA
(ATAA)8 I JN652225
Tl2407 F: ATGGCATGTTTCTCGTAGGGc
R: CTCAGTGCTCAAGCTCGTTG
(GAAG)5 I JN652226
Tl2457 F: TCCACAGCTGGGACAATCTa
R: AGGCAGATGAATTGATGATAGG
(ATCT)5 III JN652227
Tl2481 F: GAATTGAGTGAGTTATTAAGGGCATAGb
R: CGCATATGGCTGGTGATTATT
(ATCT)5 III JN652228
Tl2487 F: CTGGAAAACCCGAACTAGGAa
R: AGCCTGGGTGACAGAGTGAG
(TTGTT)5 II JN652229
Tl2491 F: ATTTCCCTGGTGAATTGCTGb
R: CTCAAACTCCTGGCTTCCAC
(TTTGT)5 I JN652230
a 50-Cy5-labelled, b 50-IRD700-labelled, c 50-DYE-751-labelled
344 Conservation Genet Resour (2012) 4:343–345
123
species or to a cluster of hybrids (cf. Merker et al. 2009,
2010). Lower mutation rates in tetra- and pentanucleotide
microsatellites result in less intraspecific variability of the
novel, compared to the known dinucleotide repeats. The
cost-effective multiplex system of new markers is thus not
only an effective tool in population genetics but may add
phylogenetic depth to microsatellite studies of Sulawesi
tarsiers.
References
Driller C, Perwitasari-Farajallah D, Zischler H, Merker S (2009) The
social system of Lariang tarsiers (Tarsius lariang) as revealed by
genetic analyses. Int J Primatol 30:267–281
Excoffier L, Lischer HEL (2010) Arlequin suite ver 3.5: a new series
of programs to perform population genetics analyses under
Linux and Windows. Mol Ecol Resour 10:564–567
IUCN (2011) IUCN red list of threatened species. Version 2011.1.
Available at www.iucnredlist.org. Downloaded on 16 September
2011
Merker S, Driller C, Perwitasari-Farajallah D, Zahner R, Zischler H
(2007) Isolation and characterization of 12 microsatellite loci for
population studies of Sulawesi tarsiers (Tarsius spp.). Mol Ecol
Notes 7:1216–1218
Merker S, Driller C, Neri-Arboleda I, Zischler H (2008) Polymorphic
microsatellite markers for Philippine tarsiers (Tarsius syrichta).
Conserv Genet 9:1349–1351
Merker S, Driller C, Perwitasari-Farajallah D, Pamungkas J, Zischler
H (2009) Elucidating geological and biological processes
underlying the diversification of Sulawesi tarsiers. Proc Natl
Acad Sci USA 106:8459–8464
Merker S, Driller C, Dahruddin H, Wirdateti, Sinaga W, Perwitasari-
Farajallah D, Shekelle M (2010) Tarsius wallacei: a new tarsier
species from Central Sulawesi occupies a discontinuous range.
Int J Primatol 31:1107–1122
Peakall R, Smouse PE (2006) GENALEX 6: genetic analysis in excel.
Population genetic software for teaching and research. Mol Ecol
Notes 6:288–295
Pritchard JK, Stephens M, Donnelly P (2000) Inference of population
structure using multilocus genotype data. Genetics 155:945–959
Table 2 Polymorphism of 10 novel microsatellite markers tested in Sulawesi tarsiers
Locus T. lariang T. dentatus T. wallacei
k Size (bp) He/Ho (n = 11) k Size (bp) He/Ho (n = 10) k Size (bp) He/Ho (n = 7)
Tl2296 1 342 – 3 316–346 0.00/0.34 1 342 –
Tl2301 7 114–138 0.55/0.66 2 114–118 – 4 102–114 0.14/0.36
Tl2325 3 321–329 0.64/0.45 2 321–325 0.11/0.11 3 325–333 0.71/0.54
Tl2328 7 297–325 0.64/0.75 5 297–313 0.80/0.83 5 293–321 0.43/0.74
Tl2350 6 228–248 0.64/0.79 5 232–248 0.10/0.28 6 228–260 0.43/0.63
Tl2407 2 140–149 0.00/0.42* 1 149 – 3 137–149 0.29/0.26
Tl2457 3 244–252 0.36/0.33 1 220 – 4 216–252 0.57/0.60
Tl2481 1 213 – 2 213–221 0.11/0.11 1 209 –
Tl2487 4 186–211 0.20/0.28 2 186–196 0.10/0.27 4 196–211 0.33/0.62
Tl2491 4 180–200 0.73/0.55 1 190 – 4 180–200 0.29/0.48
Number of alleles (k) and fragment length (size) refer to all tested individuals of each species (Tarsius lariang, n = 20; T. dentatus, n = 20;
T. wallacei, n = 14). Expected (He) and observed (Ho) heterozygosity were calculated from species reference populations (n given separately)
* Significant deviation from Hardy–Weinberg equilibrium
Conservation Genet Resour (2012) 4:343–345 345
123
Recommended