TECHNICAL NOTE

Novel tetra- and pentanucleotide microsatellite markers allowfor multiplexed genotyping of Sulawesi tarsiers (Tarsius spp.)

Stefan Merker • Desiree Boucsein •

Barbara Feldmeyer • Dyah Perwitasari-Farajallah •

Bruno Streit

Received: 21 September 2011 / Accepted: 22 September 2011 / Published online: 1 October 2011

� Springer Science+Business Media B.V. 2011

Abstract Based on 454 sequencing, we characterized 10

polymorphic tetra- and pentanucleotide microsatellites for

population studies of Sulawesi tarsiers. We identified 2516

repeat regions and designed PCR primer pairs for 60 tetra-,

penta- and hexanucleotide repeat loci. Of 16 markers tested

with dye-labelled primers, 11 proved to be polymorphic

and 10 were readily amplified in multiplex PCR reactions.

We tested 54 individuals of three species (T. lariang,

T. dentatus, T. wallacei) and 10 putative hybrids for allelic

diversity. All loci are genetically unlinked, one locus was

found to deviate from Hardy–Weinberg equilibrium in one

species. The novel marker system will aid studies of tarsier

landscape genetics in the biodiversity hotspot Sulawesi.

Keywords 454 Sequencing � Microsatellites � Primates �Sulawesi � Tarsius

Next-generation sequencing is the new method of choice

for characterizing microsatellite loci. Novel marker sys-

tems can easily be tailored to include e.g., different repeat

region lengths or various degrees of polymorphism. It is

thus valuable not only to identify new polymorphic loci for

yet unstudied taxa but also to complement existing marker

sets to increase efficacy of genotyping and to address

questions at a deeper level of resolution. Molecular tools

are particularly helpful in disentangling cryptic species

complexes. Sulawesi tarsiers are such a group. Tarsiers are

small nocturnal, Southeast Asian primates whose isolated

phylogenetic position had sparked controversy among

evolutionists for decades. Apart from addressing the evo-

lutionary position of Tarsius, genetic studies have con-

centrated on the origin of the intriguing species diversity on

Sulawesi thus supporting the notion of numerous taxa on

this island—some of them under great conservation threat

(IUCN 2011). Dinucleotide repeat markers have previously

been isolated and characterized for Sulawesi tarsiers

(Merker et al. 2007) and for Philippine tarsiers (Merker

et al. 2008). These were employed in studies of hybrid-

ization (Merker et al. 2009), species differentiation and

characterization (Merker et al. 2010) and in analysing

pedigrees (Driller et al. 2009) of Sulawesi tarsiers. As PCR

multiplexing these markers was impracticable and a num-

ber of loci called for repeated typing, these studies required

considerable time, effort and funds. It was thus our inten-

tion to characterize novel, quick-and-easy-to-type micro-

satellite loci to provide the burgeoning field of tarsier

phylogeography with efficient genotyping tools.

DNA was isolated from an ear biopsy of a Lariang

tarsier (Tarsius lariang) captured near the village of

Powelua, Sulawesi, Indonesia. After DNA extraction with

a DNeasy Blood and Tissue Kit (Qiagen) the sample was

WGA-amplified using a GenomiPhi DNA Amplification

S. Merker (&) � D. Boucsein � B. Streit

Evolutionary Ecology Group, Goethe University Frankfurt,

Biologicum, Max-von-Laue-Str. 13, 60438 Frankfurt am Main,

Germany

e-mail: smerker@bio.uni-frankfurt.de

B. Feldmeyer

Molecular Ecology Group, Forschungszentrum Biodiversitat

und Klima, Siesmayerstr. 70A, 60323 Frankfurt am Main,

Germany

D. Perwitasari-Farajallah

Primate Research Center, Bogor Agricultural University,

Jalan Lodaya II/5, Bogor 16151, Indonesia

D. Perwitasari-Farajallah

Department of Biology, Bogor Agricultural University,

Gedung FAPET W1L5 Kampus IPB Darmaga,

Bogor, Indonesia

123

Conservation Genet Resour (2012) 4:343–345

DOI 10.1007/s12686-011-9543-z

Kit (GE Healthcare). 0.5 lg of the sample were 454

sequenced on � plate. Screening reads for microsatellite

repeat regions using an in-lab Python script (by B. Gre-

shake) resulted in the identification of 2516 loci with

2–6 bp-repeats. Of these, 60 tetra-, penta- and hexanu-

cleotide repeat regions were selected for further testing

based on flanking region composition, repeat length and

homogeneity. Primer pairs were designed for each marker,

and PCR was performed using one sample of T. lariang, T.

dentatus and T. wallacei each. PCR results were examined

by electrophoresis on a 1.4% agarose gel estimating

polymorphism and ready amplification by eye. For 16

markers, forward or reverse primers were dye-labelled

(Cy5 and IRD700 from metabion; DY-751 from bio-

mers.net). Of these loci, 11 proved to be polymorphic

(visualized on a Beckman Coulter capillary sequencer CEQ

2000). One locus was not consistently amplified in multi-

plex PCR; the remaining 10 primer pairs were arranged

into three multiplex reactions (Table 1) and subjected to

PCR using Type-it Microsatellite PCR kits (Qiagen). PCR

included initial denaturation for 5:00 min at 95�C, 32

cycles of 0:30 min at 95�C, 1:30 min at 60�C and 0:30 min

at 72�C and final extension for 30:00 min at 60�C. Com-

ponents of a 12.5 ll-reaction mix included 6.25 ll Type-it

master mix, 1.25 ll primer mix, 1.25 ll Q-solution,

3.25 ll RNase-free water and 1 ll template DNA. Markers

were tested on 20 T. lariang, 20 T. dentatus, 14 T. wallacei

(Table 2) and 10 interspecific hybrids. Animals were col-

lected between 2001 and 2008 in central Sulawesi (Merker

unpublished, Merker et al. 2009, 2010). To disclose as

much allelic diversity as possible, samples from different

populations covering a wide geographic range were cho-

sen. To allow for tests for deviation from Hardy–Weinberg

equilibrium (HWE), one reference population was over-

represented in each species sample (‘‘Peana’’ for T. lariang,

n = 11; ‘‘Kamarora’’ for T. dentatus, n = 10; ‘‘Uwe-

manje’’ for T. wallacei; n = 7; for population details see

Merker et al. 2009, 2010).

ARLEQUIN v3.5 (Excoffier and Lischer 2010) was

used to calculate expected (HE) and observed (HO) heter-

ozygosity and to test for deviations from HWE and linkage

equilibrium in reference populations. All loci were found to

be in genetic equilibrium. After applying a Bonferroni

correction for multiple tests, deviation from HWE was

found in only one locus (Tl2407) in T. lariang possibly due

to a close kinship of the three homozygotes carrying allele

140 (as shown for two of these, individuals Jm17 (son) and

Am18 (father), by Driller et al. 2009). Applicability of the

new set of markers was confirmed (data not shown) by tests

of species differentiation (PCA in GENALEX v6.4.1,

Peakall and Smouse 2006) and by assignments of indi-

viduals (STRUCTURE, Pritchard et al. 2000) to either

Table 1 Characteristics of 10 novel microsatellite markers for Sulawesi tarsiers

Locus Primer pair sequence (50–30) Repeat motif Multiplex

reaction

GenBank Acc. no.

Tl2296 F: CTTTGGGAGGACGAGATGAGa

R: TGAGTTGCAATGGTTTTCCA

(AATA)5 III JN652221

Tl2301 F: CCAGAACACTGCTTATGGATGAa

R: ACCCTGAATTGTACCCCACA

(TTTA)13 I JN652222

Tl2325 F: ACTTCAGTCTGGGCGACAG

R: ATGATCTCACTCAGCGGTCAb

(AAAT)9 II JN652223

Tl2328 F: TCACAACCGCTTTCACCATAc

R: TGCAGTTTCGTCATTGGAAA

(AGAT)10 II JN652224

Tl2350 F: CAAACCCCAGCATTCCACb

R: GCCATGATACACTCAAATGGA

(ATAA)8 I JN652225

Tl2407 F: ATGGCATGTTTCTCGTAGGGc

R: CTCAGTGCTCAAGCTCGTTG

(GAAG)5 I JN652226

Tl2457 F: TCCACAGCTGGGACAATCTa

R: AGGCAGATGAATTGATGATAGG

(ATCT)5 III JN652227

Tl2481 F: GAATTGAGTGAGTTATTAAGGGCATAGb

R: CGCATATGGCTGGTGATTATT

(ATCT)5 III JN652228

Tl2487 F: CTGGAAAACCCGAACTAGGAa

R: AGCCTGGGTGACAGAGTGAG

(TTGTT)5 II JN652229

Tl2491 F: ATTTCCCTGGTGAATTGCTGb

R: CTCAAACTCCTGGCTTCCAC

(TTTGT)5 I JN652230

a 50-Cy5-labelled, b 50-IRD700-labelled, c 50-DYE-751-labelled

344 Conservation Genet Resour (2012) 4:343–345

123

species or to a cluster of hybrids (cf. Merker et al. 2009,

2010). Lower mutation rates in tetra- and pentanucleotide

microsatellites result in less intraspecific variability of the

novel, compared to the known dinucleotide repeats. The

cost-effective multiplex system of new markers is thus not

only an effective tool in population genetics but may add

phylogenetic depth to microsatellite studies of Sulawesi

tarsiers.

References

Driller C, Perwitasari-Farajallah D, Zischler H, Merker S (2009) The

social system of Lariang tarsiers (Tarsius lariang) as revealed by

genetic analyses. Int J Primatol 30:267–281

Excoffier L, Lischer HEL (2010) Arlequin suite ver 3.5: a new series

of programs to perform population genetics analyses under

Linux and Windows. Mol Ecol Resour 10:564–567

IUCN (2011) IUCN red list of threatened species. Version 2011.1.

Available at www.iucnredlist.org. Downloaded on 16 September

2011

Merker S, Driller C, Perwitasari-Farajallah D, Zahner R, Zischler H

(2007) Isolation and characterization of 12 microsatellite loci for

population studies of Sulawesi tarsiers (Tarsius spp.). Mol Ecol

Notes 7:1216–1218

Merker S, Driller C, Neri-Arboleda I, Zischler H (2008) Polymorphic

microsatellite markers for Philippine tarsiers (Tarsius syrichta).

Conserv Genet 9:1349–1351

Merker S, Driller C, Perwitasari-Farajallah D, Pamungkas J, Zischler

H (2009) Elucidating geological and biological processes

underlying the diversification of Sulawesi tarsiers. Proc Natl

Acad Sci USA 106:8459–8464

Merker S, Driller C, Dahruddin H, Wirdateti, Sinaga W, Perwitasari-

Farajallah D, Shekelle M (2010) Tarsius wallacei: a new tarsier

species from Central Sulawesi occupies a discontinuous range.

Int J Primatol 31:1107–1122

Peakall R, Smouse PE (2006) GENALEX 6: genetic analysis in excel.

Population genetic software for teaching and research. Mol Ecol

Notes 6:288–295

Pritchard JK, Stephens M, Donnelly P (2000) Inference of population

structure using multilocus genotype data. Genetics 155:945–959

Table 2 Polymorphism of 10 novel microsatellite markers tested in Sulawesi tarsiers

Locus T. lariang T. dentatus T. wallacei

k Size (bp) He/Ho (n = 11) k Size (bp) He/Ho (n = 10) k Size (bp) He/Ho (n = 7)

Tl2296 1 342 – 3 316–346 0.00/0.34 1 342 –

Tl2301 7 114–138 0.55/0.66 2 114–118 – 4 102–114 0.14/0.36

Tl2325 3 321–329 0.64/0.45 2 321–325 0.11/0.11 3 325–333 0.71/0.54

Tl2328 7 297–325 0.64/0.75 5 297–313 0.80/0.83 5 293–321 0.43/0.74

Tl2350 6 228–248 0.64/0.79 5 232–248 0.10/0.28 6 228–260 0.43/0.63

Tl2407 2 140–149 0.00/0.42* 1 149 – 3 137–149 0.29/0.26

Tl2457 3 244–252 0.36/0.33 1 220 – 4 216–252 0.57/0.60

Tl2481 1 213 – 2 213–221 0.11/0.11 1 209 –

Tl2487 4 186–211 0.20/0.28 2 186–196 0.10/0.27 4 196–211 0.33/0.62

Tl2491 4 180–200 0.73/0.55 1 190 – 4 180–200 0.29/0.48

Number of alleles (k) and fragment length (size) refer to all tested individuals of each species (Tarsius lariang, n = 20; T. dentatus, n = 20;

T. wallacei, n = 14). Expected (He) and observed (Ho) heterozygosity were calculated from species reference populations (n given separately)

* Significant deviation from Hardy–Weinberg equilibrium

Conservation Genet Resour (2012) 4:343–345 345

123