NIPT inservice talk May 2015

Kathryn Murray, MS, CGC Center for Genetics

May 2015

541-349-7600

NIPT The Present and Future of Prenatal Diagnosis

Some slides used with permission from:

• Verinata Laboratory

• Sequenom Laboratory

• Natara Laboratory

• Charlotte Clausen, MD

Disclosure

Lecturer for Myriad Genetics regarding

Inherited Cancer Syndromes

I have no affiliation with any company

mentioned during this presentation

Objectives

Describe the different techniques used to

evaluate fetal DNA in the maternal serum.

Identify appropriate candidates for non

invasive prenatal testing(NIPT).

Understand the benefits and limitations of

PRESENTATION-0029 vB

ACOG Committee Opinion on NIPT

“Cell free fetal DNA appears to be the most effective screening test for aneuploidy in high risk

women… is one option that can be used as a primary screening test in women at increased risk of

aneuploidy”

“[NIPT] should be an informed patient choice after pretest counseling”

“[NIPT] should not be offered to low-risk women or women with multiple gestations”

“A patient with a positive test result should be referred for genetic counseling and should be

offered invasive prenatal diagnosis for confirmation of test results.”

Also supporting NIPT for high risk pregnancies:

ACOG Practice Advisory on

Cell-Free DNA Screening

• April 2015: Committee opinion is being re-

evaluated based on extending testing to low risk

women.

• In response to additional publications - Large

Meta analysis & large study in low risk women.

Glossary of Abbreviations

Abbreviation Meaning

NGS Next Generation Sequencing

MPS Massively Parallel Sequencing

NCV Normalized Chromosome Value

Noninvasive Prenatal Testing

Noninvasive Prenatal Screening

cfDNA Cell Free DNA

ART Assisted Reproductive Technology

SAFeR™ Selective Algorithm for Fetal Results

CPM Confined Placental Mosaicism

History of antenatal testing 1966- amniocentesis

1970’s- age alone

1980’s

– AFP

– Triple screen- 72% detection 5% False positive

– Quad screen- 79% detection 5% False positive

– Penta screen- 83% detection 5% False positive

1980’s- CVS

1990’s –

– First Trimester screen- 80-85% 5% False positive

– Sequential screen 90-94% detection 3-5% FP

2010’s- Non-invasive prenatal diagnosis(placental fetal DNA)

Prenatal Prevalence of Chromosomal

Abnormalities

Percent of Reported Chromosome Abnormalities

Sex trisomy

Other rare

Data adapted from Wellesley, D, et al., Rare chromosome abnormalities, prevalence and prenatal diagnosis rates from population-based

congenital anomaly registers in Europe. Eur J of Hum Gen, 11 January 2012.

Four major

fetal trisomies

Screening Tests

Definition – a test applied to an asymptomatic population in order to classify them with respect to their likelihood of having a specific condition

The difference between screening and diagnostic tests:

1. Screening tests give a risk for a condition

MSAFP, Multiple Marker Screen, Ultrasound for Down Syndrome

2. Diagnostic tests give a definitive result as to the presence or absence of a condition

Amniocentesis, Ultrasound for spina bifida

PRESENTATION-0029 vB Reference: ACOG Practice Bulletin, Number 77, Jan 2007

Numerous Options with Variable

Performance

FASTER Trial Malone et al, NEJM, 2005

Modeled predicted performance

Cuckle et al, Semin Perinatol, 2005

What are the Goals of NIPT?

Goals of

Reduce exposure of fetus to

Reduce false

positives

Enable a high

detection rate

Testing that can easily be offered to all

pregnant women*

*When data supports testing in all patients, instead

of only high risk patients.

Technology Behind NIPT

Circulating Cell Free Fetal DNA

1997 article by Lo in Lancet

– Lo YM, Corbetta N, Chamberlin PF et al. Presence of fetal DNA in

maternal plasma and serum. Lancet 1997;350: 485-487.

Based on previous findings of tumor DNA present in

patients with cancer

30 pregnant women with male fetuses

Serum and plasma analyzed

70 – 80% detection rate

Lo et al. Presence of fetal DNA in maternal plasma and serum. Lancet 1997

Two Sources of Fetal DNA

Cell-free DNA (cfDNA)

– 2–20% of total cfDNA is fetal

– Requires DNA isolation and counting

– Counting method developed by Dr. Stephen Quake, Stanford University

Fetal cells

– 1 in a billion of total cell population

– Require isolation via mechanical and/or biochemical means

Circulating Cell Free (ccff) Fetal

Source of ccff is thought to be from placental cells through breakdown of fetal cells in circulation

Circulating fetal DNA thought to comprise 3 – 6% of all DNA in circulating maternal plasma. Now it’s known to range from 3 – 40%, with an average of about 10%

Detection starting at as early as 5 weeks. Consistently seen at 10 weeks

Little risk of interference of ccf from previous pregnancies

Half-life of ccff is 15 minutes and is undetectable within 2 hours postpartum

Ehrich et al. Noninvasive detection of fetal T21 by sequencing of DNA in maternal blood. AJOG 2011

Noninvasive Aneuploidy Detection

Aneuploidy detection is much more

challenging

– Single nucleotide polymorphisms

– DNA methylation (silencing)

– Fetal mRNA

Cell-free fetal DNA

2007 Digital PCR

– Lo YM, Lun F, Chan KC, et al. Digital PCR for the

molecular detection of fetal chromosomal aneuploidy

2008 detection of Trisomy 21

– Chiu RW, Chan KC, Gao Y, et al. Noninvasive prenatal

diagnosis of fetal chromosomal aneuploidy by massively

parallel genomic sequencing of DNA in maternal plasma.

Proc Natl Acad Sci USA 2008;105:20458-20463

– Fan HC, Blumenfeld YJ, Chitkara U, Hudgins L, Quake

SR. Noninvasive diagnosis of fetal aneuploidy by shotgun

sequencing DNA from maternal blood. Proc Natl Acad Sci

USA 2008;105:16266-16271

Massively Parallel Sequencing (MPS)

Method of analysis for verifi® prenatal test

Extract and Prepare

cfDNA Next-Gen Sequencing 1 2

~10% of the DNA fragments in a pregnant

woman’s blood are from the fetus ( )

~90% are from the mother ( )

Schematic of DNA Fragments Isolated

From Maternal Plasma Containing Maternal

DNA and Euploid Fetal DNA

Schematic of DNA Fragments Isolated

From Maternal Plasma Containing Maternal

DNA, Fetal DNA and Extra Fragments of Chromosome 21

Contributed by a Fetal Trisomy 21

Euploid Fetus Fetus with Trisomy 21

Principles of Fetal Trisomy 21 Testing From a

Maternal Blood Sample Using DNA Sequencing

GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10

GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14

ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21

Principles of Fetal Trisomy 21 Testing From a

Maternal Blood Sample Using DNA Sequencing

TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21

ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21

Sequencing tells you which

chromosome the ccf fragment

comes from

TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y

Principles of Fetal Trisomy 21 Detection Using DNA

Sequencing

DNA MPS* does not differentiate which fragments come from the mother

and which from the fetus.

Unaffected Fetus Fetus with Trisomy 21

The quantitative over-representation

of Trisomy 21 fragments in an

affected pregnancy is significant

and can be measured with high

precision.

* MPS - Massively Parallel Sequencing

“Counting Method” ofNIPT

2 ways to sequence

using cfDNA

Massively Parallel

Sequencing Targeted Sequencing

3 ways to analyze

Normalized

Chromosome Value

Estimate risk using

combination of

sequence data and

other factors

Z-Score

NIPT Laboratories: Shifting Rapidly

Sequenom MaterniT21plus – launched 10/2011

Illumina (formally known as Verinata)

– Verifi - launched 3/2012

Skins: Counsyl Laboratory and Illumina.

LabCorp: developed test based on Verinata

bioinfomatics – InfomaSeq.

Ariosa Harmony – launched 6/2012 - To be bought by Roche soon.

Natera- data published in 2015.

NIPT Laboratories: Shifting Rapidly

Ariosa will be changing their methodology from a

counting method of targeted sequencing to a

microarray testing method.

December 2014, it was announced that Illumina

and Sequenom will pool intellectual property

including patents. Illumina will have exclusive worldwide

rights to use IP to develop and sell IVD kits for NIPT. Illumina

will pay Sequenom 50 million upfront with additional payments.

Two companies outside of USA: PGI & Berry Genomics.

Technology

Natera Verinata Natera

SNP technology Massively parallel

shotgun

sequencing

(MPSS)

SNP technology

Sequenom Verinata Ariosa

Massively parallel

shotgun

sequencing

(MPSS)

Massively parallel

shotgun

sequencing

(MPSS)

Digital analysis of

selected regions

(DANSR)

(soon to change to a

microarray method)

Data Slides discussing the original

published papers of the primary 4

NIPT companies in the US are

included in the end of the lecture

slide set.

Natera (SNP)

Technology based on Parental SupportTM

– Targeted sequencing approach measuring SNP’s, then incorporates

high fidelity parental allelic information and crossover frequency data

to model a set of hypothesis(monosomy, disomy and trisomy). Gives

maximum likelihood estimation.

Addressing Unmet Needs in Prenatal Testing

• Develop a method for non-invasive detection of fetal aneuploidy that:

– Can test chromosomes 13,18, 21, X, and Y

– Performs equally well across all chromosomes

– Produces reliable results at low fetal fractions as early as 9 weeks gestation

– Sensitivity and specificity >99%

How does Natera NIPT work?

Maternal blood

Buffy coat = Maternal DNA

Plasma = Maternal + Fetal DNA

SNP Sequencing

Maternal Genotype

Maternal + Fetal Genotype

Target Fetal DNA

Signal

Fetal Genotype

A simplification of Natera’s non-invasive prenatal aneuploidy test

NATUS – Next Generation Aneuploidy Testing Using SNPs

Data from Human Genome Project (HapMap)

High Throughput DNA Measurements on Mom & Dad

Noisy WGA Single Cell DNA Measurements

SNP targeted sequencing data From Mom (buffy coat) +/- Dad

Data from Human Genome Project (HapMap)

NATUS Algorithm

SNP targeted sequencing data from Fetal/Mat DNA mixture (plasma)

MLE technique selects hypothesis with the highest

confidence

Multiple hypotheses for each chromosome

Compare each sub-hypotheses to Fetal/Maternal DNA data

RESULT: •High Accuracy across chrom 13, 18, 21, X, Y • Calculated accuracy for each result

Sub-hypotheses with different crossover points

Differences Panorama

– Distinguishes fetal chromosomes from maternal chromosomes.

– Can detect triploidy.

– Lags significantly behind others regarding published data.

– Very excited and very different technology.

– Cannot be used with egg donors.

– In other applications, they have experience with single gene disorders (i.e. preimplantation genetic diagnosis).

Future Directions for NIPT with MPS

Expanding patient eligibility: – Multiple gestations

– General population testing

Expanding menu content: – Other whole chromosome

aneuploidy

– Mosaic conditions (fetus, placenta, patient)

– Sub-chromosomal copy number variations

– Single gene disorders

MPS has potential for expanded use in prenatal testing

Meta Analysis of NIPT (Feb 2015; handout)

37 Relevant studies.

5 had data from the general population (i.e. low

risk population).

Most were retrospective (stored samples with known

outcomes) or prospective (using high risk pregnancies

undergoing invasive testing).

Risks of bias thoroughly discussed.

Gil M.M. Ultrasound Obstet Gynecol 2015

Meta Analysis of NIPT (Performance of Screening for Aneuploidies)

Trisomy 21

– Unaffected = 21608; Affected = 1051.

– Detection rate = 99%.

– False Positive rate = 0.1%.

– Heterogeneity between studies was low.

Trisomy 18 & 13

– Unaffected = 21608

Affected + 18 = 389; +13 = 139.

– Detection rates

+ 18 = 96%; +13 = 91%.

– Combined (13 & 18) False Positive rate = 0.26%.

– FPR all 3 trisomies (21, 18 13) = 0.35% (4 fold increase).

Sex Chromosome aneuploidies

– Affected 177 monosomy X + other (56) = 233.

– Detection rates 90% & 93% respectively.

– Combined FPR = 0.37%.

– Failure to provide a result – higher FPR.

Twin pregnancies

– Di/di twins: each fetus can contribute different amounts of

cfDNA, as much as 2 fold. The aneuploid fetus may have too low

of fetal fraction for detection.

Meta Analysis of NIPT (Clinical implications)

For singleton pregnancies, NIPT is superior to

all other methods.

Limitations for wide spread use:

– High Cost.

– Failure to provide a result.

Contingent screening:

– Very High detection rate.

– Very low invasive testing rate.

– Considerably lower cost.

– For NIPT with a “no result call”, could rely on

biochemical screening to make invasive testing

decision.

– Still have the first trimester ultrasound with NT.

Trisomy 18 & 13:

– Performance may be worse that Sequential

screening.

– Detection rates are similar.

– However, it may be lower if “No Calls” are

considered.

– Screening for all three aneuploidies increase the

Sex Chromosome aneuploidy:

– Questions whether it should be included.

Milder phenotype.

Higher failure rate – no result.

Lower detection rate.

Higher FPR.

Higher fetal mosaicism.

Detection of maternal sex chromosome aneuploidy.

Inclusion with DS screening increase FPR 8 fold to

0.72%.

Nuchal translucency ultrasound Correct gestation age

Early diagnosis of fetal malformation

Diagnosis of multifetal gestation and

chorionicity

Can see cystic hygroma: 50% aneuploidy

– Most are T21 or Monosomy X,

– but there are rare, yet significant, other

chromosome abnormalities

Screening for low risk populations

Microdeletions / Single Gene Test ? Fetal (Placental) karyotype?

Microdeletions:

– Several abstract presentations.

– Varies between laboratories.

– Difficult to evaluate – because rare.

– Likely to raise FPR.

– Increased cost with 3 of the 4 labs.

Case reports of achondroplasia & thanatophoric

Dwarism.

Rh genotype in fetus.

Low Risk Population NEXT (noninvasive examination of trisomy)

Hypothesis: NIPT better screening tool than

biochemical screening.

Norton, ME, NEJM 2015

Prompted ACOG statement

Prospective, multicentered, blinded study.

35 International centers.

Patients, 10-14 wks gestation, undergoing routine first

trimester screening (NT & Biochemical screening).

cfDNA results blinded.

Birth outcome: dx testing or newborn examination.

18,955 women enrolled.

15,841 results available for analysis.

Mean maternal age: 30.7 yrs.

Compared to standard screening.

Method: targeted sequencing (counting method)

76% less than 35 yrs of age.

NIPT detected 38/38 trisomy 21.

– 19 were in the low risk group.

First trimester screening 30/38 (No second

trimester test).

FPR 0.06 & 5.4% respectively.

PPV 80.9% vs 3.4%. (4/5 vs 1/30)

No results group:

– 13 aneuploidies (3 DS, 1 +18, 2 +13, 4 triploidy, 1

+16, 1 del11p, 1 with structurally abnormal

chromosome.

Prevalence higher than in the cohort with

results: 1/38 (2.7%) vs 1/236 (0.4%).

Among 6 common aneuploidies, each detected

with biochemical screening (risk range 1/26-1/2).

Higher sensitivity and specificity than

biochemical screening.

FPR 100 fold less than std screening.

Regardless of maternal age.

Higher cost.

Conclusions

3% did not reveal a result.

– May be related to increased maternal weight.

– May be related to an abnormal karotype.

– If these were included, the detection rate would

decrease.

– No consensus about: repeating NIPT, using

biochemical screening or offering diagnostic

testing.

Conclusions

Explanations for Discordant

Results

Confined placental mosaicism.

Fetal mosaicism.

Vanishing twin.

Maternal Karyotype.

Discordant twin karyotype.

Cancer.

ACOG Practice Advisory April 2015

Still using 2012 committee opinion.

Positive result requires confirmation with

diagnostic test.

“No-call” group is at increased risk of

chromosomal abnormality.

– Tests that do not return results are typically excluded

from companies’ summary statistics leading to an

overstatement of the test preformance.

ACOG Practice Advisory April 2015

Other screening modalities, biochemical and

ultrasound, will detect additional important

conditions not detected by NIPT.

All of these issues are true in high and low risk

populations, but more pronounced in the low risk

population (e.g. lower PPV).

ACOG Committee Opinion on NIPT

“Cell free fetal DNA appears to be the most effective screening test for aneuploidy in high risk

women… is one option that can be used as a primary screening test in women at increased risk of

aneuploidy”

“[NIPT] should be an informed patient choice after pretest counseling”

“[NIPT] should not be offered to low-risk women or women with multiple gestations”

“A patient with a positive test result should be referred for genetic counseling and should be

offered invasive prenatal diagnosis for confirmation of test results.”

Also supporting NIPT for high risk pregnancies:

Explaining test to Patients

Blood)

Modified (Personal) risk assessment

1 _____

10,000 <

1 _____

200 Seq vs NIPT

90% 99%

Positive rate:

Detection rate:

Pre-lecture Questions: True or False

NIPT stands for NonInvasive Prenatal test. T

Considering current guidelines, all women should be offered NIPT

screening. F

All NIPT techniques preform similarly. T

The primary source of “fetal DNA” is from the fetus. F

The introduction of the NIPT test has reduced the number if invasive

tests. T

NIPT is the quickest test to go from publication to use to insurance

coverage in the history of medicine. T

The primary purpose of NIPT testing is to determine the gender of the

baby. F

A twin demise that appears to have died 4+ weeks earlier, will not

interfere with the NIPT analysis. F

Kathryn Murray, MS, CGC

FORTE vs. Z-score Comparison

Provides individualized risk

Accounts for fetal fraction

Can incorporate other

clinical risk factors

FORTE Z-Score • Groups all trisomies

into one category

• Does not factor in fetal

fraction

FORTETM (Fetal-fraction Optimized Risk of Trisomy Evaluation) – refers to the algorithm that incorporates DANSR assay results (chromosome counts, fetal fraction), and other clinical information to provide a individualized risk score

Normalized chromosomal value

vs. Z-score method NCV

– #counts Chr 21/Counts

on Custom reference Chr

– High precision, removes

variation

– Maximizes dynamic

Z-score

– # counts Chr 21/# counts

all Chr

– GC correction

– Z-score result

– Sample to sample

variability

– Reduces dynamic range

Risk Calculation

Z-score(Sequenom)

– Total maternal and fetal/total reference

– Mean chromosomal amount + 3 SD

– >3 is positive, <3 is negative

Normalized chromosomal value(Verinata)

– Total maternal and fetal/custom reference

– >4SD is positive, 2.5-4 is no-call, <2.5 is negative

FORTE(Fetal-fraction optimized risk of Trisomy Evaluation) (Ariosa)

– LR = cfDNA of specific chr/total cffDNA

– Provides individualized risk score

– Maternal age + GA x LR of result

– Accounts for fetal fraction

Initial Study Data Sequenom Verinata Ariosa

total n= 2,437 651 4097

# of published

studies

T21 249 102 205

T18 62 44 113

T13 12 15 -

XO ? 19 - 20 -

2013 Publication

Clinical experience

(>6,000 spls)

within expected

performance parameters

2013 Poster presentation

Clinical experience

(>60,000 spls)

within expected

performance parameters Update

Sensitivity/Specificity - Totals Sequenom Verinata Ariosa

T21 detection 249/251

(99.2%)

102/102

(100%)

205/205

(100%)

FPR 4/1880

(0.2%)

0/438 3/3547

(0.08%)

T18 detection 59/59

(>99.9%)

(97.7%)

111/113

(98.2%)

FPR 5/1688

(0.3%)

0/499 2/3547

(0.05%)

T13 detection 11/12

(91.7%)

(73.3%)

FPR 16/1688

(0.9%)

0/531 -

XO detection NA 15/16

(93.8%)

FPR NA 0/464 NA

MaterniT21plus (Sequenom)

Results: “Positive” vs. “Negative” based on z-score.

1% chance for no result

Determines whether or not a Y chromosome is

present.

Will accept samples on twins and IVF/egg donor

Long term potential for genome wide studies

MaterniT21 (Sequenom)

Verinata Health MELISSA Study

• Large-scale, prospective and blinded clinical validation

– High-risk patient population

– Singleton gestations analyzed

– Over 60 U.S. centers enrolled

• All samples with any abnormal karyotype analyzed

– Emulates real-world testing, fetal karyotype not known beforehand

• Samples analyzed for aneuploidy across the genome

– Demonstrates the true potential of verifi® test MPS technology

MatErnal BLood IS Source to Accurately Diagnose Fetal Aneuploidy

MELISSA Study

• 2,882 samples collected

• 534 selected for analysis

– Including all abnormal karyotypes (N=221)

– Gestational age: 10 – 23 weeks

– BMI (kg/m2): 17 – 59

– Includes 38 ART pregnancies

– Diverse (27.3% non-white)

Study Design, Demographics

MELISSA Study MPS Performance

Classified Sensitivity

95% CI Specificity

95% CI

Chromosome 21 100·0

(89/89)

95·9 - 100·0 100·0

(404/404)

99·1 - 100·0

Chromosome 18 97·2

(35/36)

85·5 - 99·9 100·0

(460/460)

99·2 - 100·0

Chromosome 13 78·6

(11/14)

49·2 - 95.3 100·0

(485/485)

99·2 - 100·0

Monosomy X 93·8

(15/16)

69·8 - 99·8 99·8

(416/417)

98·7 - >99.9

Bianchi et al. Obstetrics and Gynecology, Vol 119, No. 5, May 2012

Other Abnormal Karyotypes in MELISSA

Complex Karyotypes Detection

Mosaics (T21, T18) Demonstrated blinded detection (4/4)1

Robertsonian Translocations (T21, T13) Demonstrated blinded detection (3/3)1

Rare autosomal aneuploidies Demonstrated blinded detection (T16, T20)1

Sub-chromosomal Duplication Demonstrated blinded detection (38MB duplication on chromosome 6)2

Demonstrated Detection of Complex Karyotypes

1 Bianchi DW, et al. Obstet Gynecol. 2012 Mar;119(5):890-901. 2 Srinivasan et al., ASHG 2012 Abstract.

Note: verifi® test does not distinguish between full chromosome, mosaic, or translocation trisomy

Product Profile

Chromosomes Analyzed 21, 18, 13, and (Optional) X and Y

Blood draw requirement 1 blood tube (7-10mL)

Patient Eligibility Validated in high risk pregnancies

Singletons at ≥10 weeks gestation

Egg donors accepted

Sample collection On-site collection kits, ambient shipping

Turn-around time 8 to 10 days

Clinical Support In-house genetic counselors for consultation with

healthcare providers

verifi® prenatal test Results

verifi® test uses a unique dual threshold

classification system

Borderline results classified as

“Aneuploidy Suspected”

– Indicates borderline results where false

positive is more likely than “detected” results

– Occur in approximately 0.2-0.6% of results

per chromosome* UPDATE 6/13 They have

adjusted their algorithm with more narrow

“aneuploidy suspected” range.

A Safe and Effective Classification System

* Verinata Health, Inc - data on file.

Original Publication: Bianchi et al. Obstetrics and Gynecology, Vol 119, No. 5, May 2012

Dual Threshold Classification Indicates Borderline Results

Single Threshold

Method verifi® prenatal test

Dual Threshold

Trisomy

Diploid

verifi® prenatal test

• Red alert at top to highlight abnormal results

• Abnormal results in table are highlighted in red

• Comments included to provide additional guidance

• Test claims restated as reference

Test Report

Sex Chromosome Aneuploidy (SCA)

High incidence

• Affects 1 in 300-400 live births

• Monosomy X associated with high rate of spontaneous loss

• Mosaic forms common

Prenatal diagnosis difficult

• Not screened by current serum screens

• Ultrasound usually normal (except in monosomy X)

• Only diagnosed by invasive procedures

Detection of SCA has clinical utility

• Delivery management when ultrasound abnormalities present

• E.G. Monosomy X with cystic hygroma

• Early detection may help in early childhood intervention in SCA cases

* False Positive Rate

Verinata Health publication “Analytical Validation of the verifi® prenatal test: Enhanced Test Performance for Detecting Trisomies 21, 18, and 13 and the Option for Classification of Sex

Chromosome Status”, Data on File. Original Publication: *Bianchi et al. Obstetrics and Gynecology, Vol 119, No. 5, May 2012

Sex Chromosome Option

(19/20

) (243/249

) (227/229

Accuracy Sensitivity

XXX, XXY, XYY

Monosomy X 1.0%

Limited prevalence in clinical data precludes performance calculations

verifi® prenatal test Performance

Fetal Sex Chromosome

determination • Both Verinata and Sequenom give results

regarding sex chromosomes:

• Verinata: with every report.

• Sequenom: reports whether Y is present or not

and only if they have evidence of SC aneuploidy.

• Sequenom Published paper:

• 6% not reportable rate.

• Lower accuracy than trisomies.

• Assumes mom is normal for sex chromosomes.

• CG composition of CG of X and Y is similar.

• Homology of Y chromosome and other chromosome

(i.e. decreased signal noise relationship)

• Y chromosome is small and there is wide variation

in measured representation.

Harmony (Ariosa)

Prospective, blinded

– NICE trial

81/81 T21 1/2888 FP 0.03%

37/38 T18 2/2888 FP 0.07%

– 4.5% failure rate

– 39% of abnormal karyotypes were other than T21/T18

Norton ME, Brar H, Weiss J, et al. Non-

Invasive Chromosomal Evaluation(NICE)

Study: results of a multicenter prospective

cohort study for detection of fetal trisomy

21 and trisomy 18. AJOG 137.e1-e8. Aug

Harmony (Ariosa)

Up to 4.6% chance for no result

Can’t do on twins or IVF with egg donor at this time

Technology may be limiting in the future

Offering to the general population

Results predict PPV and NPV allowing providers to counsel patients appropriately

Largest published data set

Inclusion of clinical information in risk assessment

Targeted sequencing means decreased cost

Future studies

– T13 validation

– NITE- 500 subjects. European eval of T21 and T18

– NEXT- 25,000 subjects comparing Harmony to current 1st trimester screening for

Harmony (Ariosa)

DANSR vs Massively Parallel Shotgun Sequencing Assay Comparison

Chr 18 and 21 cfDNA

Other Chr cfDNA

Unmapped cfDNA

cfDNA in blood

DANSR (Directed analysis) MPSS (Random analysis)

Same cfDNA fragments from select

chromosomes analyzed every time

Only relevant cfDNA fragments go onto

DNA sequencing

96 patient samples analyzed

simultaneously

Random cfDNA fragments from all

chromosomes analyzed every time

All cfDNA fragments go onto DNA

sequencing regardless of relevance

4-8 patient samples analyzed

simultaneously

Previous NIPT Results – Proof of Concept Study

•166 Maternal blood samples, 9+ weeks •Confirmed by amnio/CVS or cord blood •145 euploid / 21 aneuploid •Includes T13, T18, T21, 45X, 47XXY

• 145 have high confidence at all 5 chrom

• >99% average confidence for all high confidence call chromosomes

• Nicolaides Paper 2013:

• 242 blinded high risk CVS.

• 229/242 results.

• 32/229 abnormal (+21, +18, +13, -X, triploidy)

• No false positive.

• No false negatives.

Fetal Fraction

All Correctly Called

Failed Quality Test

Zimmermann et al. Prenat Diag. 2012

NIPT inservice talk May 2015

Documents

Inservice Edu.ppt

Anaphylaxis Inservice

Inservice Testing Of Pumps And Valves, And Inservice ...Inservice Testing of Pumps and Valves, and Inservice Examination and Testing of Dynamic Restraints (Snubbers) at Nuclear Power

Wikis inservice

SNP-based Non-invasive Prenatal Testing (NIPT) · SNP-based Non-invasive Prenatal Testing (NIPT) ... e Non Invasive Prenatal Testing (NIPT): ... maternal weight,

Inservice education

Ann tabor nipt til nnfm

More information EN NIPT Advantages

Generation NIPT - Genomic Diagnostics

Speech Inservice

PATIENT HISTORY FORM FOR NON-INVASIVE PRENATAL TESTING (NIPT) · PATIENT HISTORY FORM FOR NON-INVASIVE PRENATAL TESTING (NIPT) ... Patient’s current weight _____ lbs ... The NIPT

TOWARDS AFFORDABLE NIPT - LOW COVERAGE … · towards affordable nipt - low coverage whole genome resequencing based nipt on small benchtop ngs systems ... (acog opinion) 2015 –ispd

Hearing Inservice

Current advances in the application of genome-wide NIPT · 2019-12-23 · genome-wide NIPT. Percept® NIPT (VCGS assay) April 2015 Illumina WGS NIPT tech transfer (13, 18, 21, X,

Superintendent’s Inservice

Serenity NIPT Brochure

inservice Wii

Test prenatale non invasivo NIPT vantaggi e limiti - EOC · Test prenatale non invasivo – NIPT – vantaggi e limiti ... NIPT is considered to be the most ... short neck, sacral

Inservice Powerpoint

NIPT - BeSHG 2014