View
221
Download
1
Category
Preview:
Citation preview
Major Components of a Gene
Promoter: The DNA region that signal initiation of transcription
5’-Untranslated Region: A short DNA sequence rich in GC pairs present in the 5’-flanking region of the gene
Exon: Segment of a gene which is decoded to give an mRNA product or a mature mRNA product
Major Components of a Gene
Intron: Noncoding DNA which separates neighboring exons in a gene
3’-Untranslated Region: A short DNA sequence in the 3’-flanking region of the gene that contains polyadenylation signal
Codon: A nucleotide triplet which specifies an amino acid or a signal for terminating the synthesis of a polypeptide
The Genetic Code
Three-nucleotide sequences (codons) control selection of amino acids for protein synthesis
Four kinds of Nucleic acids in mRNA: Adenine, Guanine, Uracil, Cytosine
Commaless and nonoverlapping within a reading frame
The Genetic Code
Non-ambiguous (no codon is specific for two different products)
Redundant (or Degenerate)
Code degeneracy usually in the third position of the codon
Major Components of a Gene
Open reading frame (ORF): A long sequence of DNA in which there are no termination codons
Example:5’…TGTCCCGGCATGGATATCCGGAACAACCTCACTAGG…3'
…CysProGlyMetAspIleArgAsnAsnLeuThrArg…
Basic Concepts in Gene Mapping
genomic DNA: the entire complement of genetic material
mRNA: RNA that is transcribed from the genomic DNA of a gene
cDNA: DNA which is synthesized by the enzyme reverse transcriptase using mRNA as a template
Basic Concepts in Gene Mapping
Genomic DNA
Pre-mRNA
cDNA
Transcription
Reverse Transcription
Mature mRNA
Splicing
Basic Concepts in Modern Genetic Epidemiology
Allele: Alternative forms of a gene or DNA sequence at a specific chromosomal location
Allelic association: Any significant association between specific alleles at two or more neighboring loci
Allelic heterogeneity: Different mutations at the same locus cause the same phenotype
Basic Concepts in Modern Genetic Epidemiology
Locus: The physical location of a gene
Locus heterogeneity: A phenotype may be caused by mutations at more than one gene locus
Basic Concepts in Modern Genetic Epidemiology
Mutation: A change in the DNA
Polymorphism: A locus with more than one allele, each of which occurs with at least 1% frequency
Point Mutations
Base substitutions» Change in a single nucleotide
»Transitions: changes from purine-purine or pyrimidine-pyrimidine.– Examples: AG, TC
»Transversions: changes from purine to pyrimidine or vice versa. – Examples: AT, GC
Synonymous substitutions: A substitution which replaces one codon by another without changing the amino acid that is specified
=silent mutation
Non-synonymous substitutions: A substitution which replaces one codon by another with changing the amino acid that is specified
=missense mutation
Point Mutations
Mutations
Deletions - small and large»Example: insulin receptor gene» TTCAAGAGATgATTCAGATGG (small)
» Entire gene (large)
Mutations
Insertions»Example: ACE Gene
– Intron 16 D/I (289-bp Alu-I repeat sequence)
Inversions»Example: IDS Gene
– Inversions of Exons 8 and 9
Missense mutation: A codon change can occur, such that a new amino acid is coded for.
Nonsense mutation: A stop codon can be created, causing termination of synthesis. Silent mutation: If no change in product is observed, because of the redundancy
of the genetic code. Frameshift Mutation: Change in reading frame, usually by deletion or insertion of
one or more nucleotides.
Point Mutations
Splicing mutation: Changes in the splice donor/acceptor site or branch site that cause aberrant splicing
»Example: Insulin receptor gene– Intron4 AG GG (splice acceptor site)
Regulatory mutation: Changes in promoter site sequences that can affect the rate of transcription
»Example: IL1 alpha gene– GGCAACA(CT)CATTGAAGGC (-889 relative to the
transcription initiation site)
Point Mutations
Mitosis: A type of nuclear division that results in two daughter cells identical to the original cell
Meiosis: The process of two successive nuclear divisions resulting in cell with 1/2 the genetic complement of the original cell
Mitosis and Meiosis
Hardy and Weinberg discovered that for a given population, under certain stable conditions, gene frequencies tended to remain constant
Hardy-Weinberg Equilibrium
Let p = freq. Of one allele (A) Let q = freq. Of the alternative allele (a) p + q =1 HWE predicts that proportion in the next generation
will be:»p2 + 2pq + q2 =1, where»p2, 2pq, q2 represent allele freq. of AA, Aa, and aa
Hardy-Weinberg Equilibrium
Population is definitely large Each genotype is equally likely to mate with
any other All genotypes produce viable offspring with
same frequency - have equal genetic fitnessNo mutation occurs No migration in or out of population occurs
Hardy-Weinberg Assumptions
Mendel’s First Law
The law of segregation
During gamete formation each member of the allelic pair separates from the other member to form the genetic constitution of the gamete
Mendel’s Second Law
The law of independent assortment
During gamete formation the segregation of the alleles of one allelic pair is independent of the segregation of the alleles of another allelic pair
Basic Concepts in Gene Mapping
Genetic Linkage Map: Measures the amount of recombination between two loci; quantified by either recombination fraction or centiMorgans
Physical Map: Quantifies the actual amount of DNA, usually in base pairs, between two loci
Genetic Map and Physical Map
A B C D
A B C D
Physical Map (Number of DNA Base Pairs)
Genetic Map (Distribution of Cross-Overs)
A-B: Suppression of recombination
Genetic Distance Shorter than Physical Distance
B-C: Increase of recombination
Genetic Distance Larger than Physical Distance
Basic Concepts in Gene Mapping
Sequence-tagged site (STS): any piece of DNA whose sequence is known and for which a specific PCR assay has been designed
Example: » 273-bp STS (Genebank: G54567)
» TGACTCCAATGACCGTCTGTCTATTTCACTGTATCCAGGCCAGTCTCTTTGAAGCTCTTTAAAAACATAATCCTTTAAGGTATATGAGAGGTCCTTAGAATTCAGATTGGCTACCTAGTATGAGGTATAAAAACAGAGCATTAGGTATTTTTACTATCATCTCCTAACCTAAAACAGGCAACCTTTAGGATTTACACTGAAAATAATTACATCAATTGGCCCCAAAGGGACTGCTAGTTTTGTATTATATGCCAGATCTCAATAAATGCCATT
Basic Concepts in Gene Mapping
Expressed sequence tag (EST): A short sequence of a cDNA clone for which a PCR assay is available
Example:187-bp cDNA (Genebank: AL110360)
» AAAAAAGGCAGCAGCTACCAAGAAACCAGCCCCTGAAAAGAAGCCTGCAGAGAAGAAACCTACTACAGAGGAGAAGAAGCCTGCTGCATAAACTCTTAAATTTGATTATTCCATAAAGGTCAAATCATTTTGGACAGCTTCTTTTGAATAAAGACCTGATTATACAGGCAAAAAAAAAAAAAAAAAA
Basic Concepts in Gene Mapping
Recombination: The process during meiosis by which homologous chromosomes exchange material
Crossover: The physical process that results in the exchange of genetic materials between two paired chromosomes during a recombination event
Recombination fraction: The frequency of crossing over between two loci
Basic Concepts in Gene Mapping
Marker: A polymorphic DNA or protein sequence derived from a single chromosomal location
Primer: A short nucleic acid sequence which specifically binds to a single strand of a targeted nucleic acid sequence
Basic Concepts in Modern Genetic Epidemiology
Genotype: The observed alleles at a locus in an individual
Haplotype: A series of alleles found at linked loci on a single chromosome
Basic Concepts in Gene Mapping
Heterozygous: The alleles at a genetic locus are different from one another» Example: Aa
Homozygous: The alleles at a genetic locus are identical» Examples: AA and aa
Basic Concepts in Gene Mapping
Single nucleotide polymorphism (SNP): a substitution, deletion, or insertion of a single nucleotide» Examples: AG, AC
cSNP: A SNP that occurs in the coding sequence of a gene» Example: CTC (Leu)TTC (Phe)
Basic Concepts in Gene Mapping
Microsatellite DNA: small array of tandem repeats of a very simple sequence, often between 1-4 bp (often < 0.1 kb)Example: A tetranucleotide repeat microsatellite
…GAAAGAAAGAAAGAAAGAAAGAAAGAAA...
Minisatellite DNA: An intermediate size array of short tandemly repeated DNA sequencesExample: A minisatellite (Genebank: AF157691)
…(AGGGGGTGAGGGTGGGTGTGCTGG)n...
Basic Concepts in Modern Genetic Epidemiology
Polymorphism Information Content: A measure of marker informativeness that reflects the fraction of matings in which a particular parent is expected to be fully informative
Heterozygosity: The fraction of individuals that are likely to be heterozygous at that locus
Basic Concepts in Gene Mapping
Identity by descent (IBD): Two alleles are IBD which it can be determined with certainty that they have been inherited from a common ancestor
Identity by state (IBS): Two alleles are IBS when they share the same state
Basic Concepts in Gene Mapping
Linkage: The tendency of genes or other DNA sequences at specific loci to be inherited together as a consequence of their physical proximity on a single chromosome
Linkage Disequilibrium: Nonrandom associations of alleles at linked loci
LOD Score
)5.0|(
)|(log)( 10
pedigreeL
xpedigreeLxzLOD
• a two-point LOD score defined by Morton (1955)
•L(pedigree|=x): the likelihood of observing a particular configuration of a disease and a marker locus in a family assuming a selected range of (0 0.5)
Basic Concepts in Modern Genetic Epidemiology
Morgan: A unit of genetic distance corresponding to a length of DNA which, on average, undergoes one crossover per individual chromatid strand
centiMorgan (cM): A unit of genetic distance equivalent to a 1% probability of recombination during meiosis
Basic Concepts in Modern Genetic Epidemiology
Aa
Bb
aa
bb
Aa
Bb
aa
bb
Aa
Bb
aa
bb
Phase Unknown Phase Known
Basic Concepts in Gene Mapping
Penetrance: The probability of expressing a phenotype given a genotype
Phenocopy: A trait that appears to be identical to a genetic trait but is caused by non-genetic factors
Pleiotropy: One gene loading to many different phenotypic expressions.
Basic Concepts in Gene Mapping
Bacterial artificial chromosomes (BAC): A recombinant plasmid which permits propagation of very large inserts (up to 300kb) in bacterial cells
Yeast artificial chromosomes (YAC): An artificial chromosome produced by combining large fragments of foreign DNA with small sequence elements necessary for chromosome function in yeast cells
Recommended