48
Major Components of a Gene Promoter: The DNA region that signal initiation of transcription 5’-Untranslated Region: A short DNA sequence rich in GC pairs present in the 5’-flanking region of the gene Exon: Segment of a gene which is decoded to give an mRNA product or a mature mRNA product

Major Components of a Gene l Promoter: The DNA region that signal initiation of transcription l 5’-Untranslated Region: A short DNA sequence rich in GC

  • View
    221

  • Download
    1

Embed Size (px)

Citation preview

Major Components of a Gene

Promoter: The DNA region that signal initiation of transcription

5’-Untranslated Region: A short DNA sequence rich in GC pairs present in the 5’-flanking region of the gene

Exon: Segment of a gene which is decoded to give an mRNA product or a mature mRNA product

Major Components of a Gene

Intron: Noncoding DNA which separates neighboring exons in a gene

3’-Untranslated Region: A short DNA sequence in the 3’-flanking region of the gene that contains polyadenylation signal

Codon: A nucleotide triplet which specifies an amino acid or a signal for terminating the synthesis of a polypeptide

The Genetic Code

Three-nucleotide sequences (codons) control selection of amino acids for protein synthesis

Four kinds of Nucleic acids in mRNA: Adenine, Guanine, Uracil, Cytosine

Commaless and nonoverlapping within a reading frame

The Genetic Code

Non-ambiguous (no codon is specific for two different products)

Redundant (or Degenerate)

Code degeneracy usually in the third position of the codon

Major Components of a Gene

Open reading frame (ORF): A long sequence of DNA in which there are no termination codons

Example:5’…TGTCCCGGCATGGATATCCGGAACAACCTCACTAGG…3'

…CysProGlyMetAspIleArgAsnAsnLeuThrArg…

Gene Transcription

5’-Capping 3’-Polyadenylation Intron Splicing

Basic Concepts in Gene Mapping

genomic DNA: the entire complement of genetic material

mRNA: RNA that is transcribed from the genomic DNA of a gene

cDNA: DNA which is synthesized by the enzyme reverse transcriptase using mRNA as a template

Basic Concepts in Gene Mapping

Genomic DNA

mRNA

cDNA

Transcription

Reverse Transcription

Basic Concepts in Gene Mapping

Genomic DNA

Pre-mRNA

cDNA

Transcription

Reverse Transcription

Mature mRNA

Splicing

Basic Concepts in Modern Genetic Epidemiology

Allele: Alternative forms of a gene or DNA sequence at a specific chromosomal location

Allelic association: Any significant association between specific alleles at two or more neighboring loci

Allelic heterogeneity: Different mutations at the same locus cause the same phenotype

Basic Concepts in Modern Genetic Epidemiology

Locus: The physical location of a gene

Locus heterogeneity: A phenotype may be caused by mutations at more than one gene locus

Basic Concepts in Modern Genetic Epidemiology

Mutation: A change in the DNA

Polymorphism: A locus with more than one allele, each of which occurs with at least 1% frequency

Point Mutations

Base substitutions» Change in a single nucleotide

»Transitions: changes from purine-purine or pyrimidine-pyrimidine.– Examples: AG, TC

»Transversions: changes from purine to pyrimidine or vice versa. – Examples: AT, GC

Synonymous substitutions: A substitution which replaces one codon by another without changing the amino acid that is specified

=silent mutation

Non-synonymous substitutions: A substitution which replaces one codon by another with changing the amino acid that is specified

=missense mutation

Point Mutations

Mutations

Deletions - small and large»Example: insulin receptor gene» TTCAAGAGATgATTCAGATGG (small)

» Entire gene (large)

Mutations

Insertions»Example: ACE Gene

– Intron 16 D/I (289-bp Alu-I repeat sequence)

Inversions»Example: IDS Gene

– Inversions of Exons 8 and 9

Missense mutation: A codon change can occur, such that a new amino acid is coded for.

Nonsense mutation: A stop codon can be created, causing termination of synthesis. Silent mutation: If no change in product is observed, because of the redundancy

of the genetic code. Frameshift Mutation: Change in reading frame, usually by deletion or insertion of

one or more nucleotides.

Point Mutations

Splicing mutation: Changes in the splice donor/acceptor site or branch site that cause aberrant splicing

»Example: Insulin receptor gene– Intron4 AG GG (splice acceptor site)

Regulatory mutation: Changes in promoter site sequences that can affect the rate of transcription

»Example: IL1 alpha gene– GGCAACA(CT)CATTGAAGGC (-889 relative to the

transcription initiation site)

Point Mutations

Mitosis: A type of nuclear division that results in two daughter cells identical to the original cell

Meiosis: The process of two successive nuclear divisions resulting in cell with 1/2 the genetic complement of the original cell

Mitosis and Meiosis

Hardy and Weinberg discovered that for a given population, under certain stable conditions, gene frequencies tended to remain constant

Hardy-Weinberg Equilibrium

Let p = freq. Of one allele (A) Let q = freq. Of the alternative allele (a) p + q =1 HWE predicts that proportion in the next generation

will be:»p2 + 2pq + q2 =1, where»p2, 2pq, q2 represent allele freq. of AA, Aa, and aa

Hardy-Weinberg Equilibrium

Population is definitely large Each genotype is equally likely to mate with

any other All genotypes produce viable offspring with

same frequency - have equal genetic fitnessNo mutation occurs No migration in or out of population occurs

Hardy-Weinberg Assumptions

Mendel’s First Law

The law of segregation

During gamete formation each member of the allelic pair separates from the other member to form the genetic constitution of the gamete

Mendel’s Second Law

The law of independent assortment

During gamete formation the segregation of the alleles of one allelic pair is independent of the segregation of the alleles of another allelic pair

Basic Concepts in Modern Genetic Epidemiology

Autosomal Dominant Inheritance

X-Linked Inheritance

Autosomal Recessive Inheritance

Basic Concepts in Gene Mapping

Genetic Linkage Map: Measures the amount of recombination between two loci; quantified by either recombination fraction or centiMorgans

Physical Map: Quantifies the actual amount of DNA, usually in base pairs, between two loci

Genetic Map and Physical Map

A B C D

A B C D

Physical Map (Number of DNA Base Pairs)

Genetic Map (Distribution of Cross-Overs)

A-B: Suppression of recombination

Genetic Distance Shorter than Physical Distance

B-C: Increase of recombination

Genetic Distance Larger than Physical Distance

Basic Concepts in Gene Mapping

Sequence-tagged site (STS): any piece of DNA whose sequence is known and for which a specific PCR assay has been designed

Example: » 273-bp STS (Genebank: G54567)

» TGACTCCAATGACCGTCTGTCTATTTCACTGTATCCAGGCCAGTCTCTTTGAAGCTCTTTAAAAACATAATCCTTTAAGGTATATGAGAGGTCCTTAGAATTCAGATTGGCTACCTAGTATGAGGTATAAAAACAGAGCATTAGGTATTTTTACTATCATCTCCTAACCTAAAACAGGCAACCTTTAGGATTTACACTGAAAATAATTACATCAATTGGCCCCAAAGGGACTGCTAGTTTTGTATTATATGCCAGATCTCAATAAATGCCATT

Basic Concepts in Gene Mapping

Expressed sequence tag (EST): A short sequence of a cDNA clone for which a PCR assay is available

Example:187-bp cDNA (Genebank: AL110360)

» AAAAAAGGCAGCAGCTACCAAGAAACCAGCCCCTGAAAAGAAGCCTGCAGAGAAGAAACCTACTACAGAGGAGAAGAAGCCTGCTGCATAAACTCTTAAATTTGATTATTCCATAAAGGTCAAATCATTTTGGACAGCTTCTTTTGAATAAAGACCTGATTATACAGGCAAAAAAAAAAAAAAAAAA

Basic Concepts in Gene Mapping

Recombination: The process during meiosis by which homologous chromosomes exchange material

Crossover: The physical process that results in the exchange of genetic materials between two paired chromosomes during a recombination event

Recombination fraction: The frequency of crossing over between two loci

Crossover

Basic Concepts in Gene Mapping

Marker: A polymorphic DNA or protein sequence derived from a single chromosomal location

Primer: A short nucleic acid sequence which specifically binds to a single strand of a targeted nucleic acid sequence

Basic Concepts in Modern Genetic Epidemiology

Genotype: The observed alleles at a locus in an individual

Haplotype: A series of alleles found at linked loci on a single chromosome

Basic Concepts in Gene Mapping

Heterozygous: The alleles at a genetic locus are different from one another» Example: Aa

Homozygous: The alleles at a genetic locus are identical» Examples: AA and aa

Basic Concepts in Gene Mapping

Single nucleotide polymorphism (SNP): a substitution, deletion, or insertion of a single nucleotide» Examples: AG, AC

cSNP: A SNP that occurs in the coding sequence of a gene» Example: CTC (Leu)TTC (Phe)

Basic Concepts in Gene Mapping

Microsatellite DNA: small array of tandem repeats of a very simple sequence, often between 1-4 bp (often < 0.1 kb)Example: A tetranucleotide repeat microsatellite

…GAAAGAAAGAAAGAAAGAAAGAAAGAAA...

Minisatellite DNA: An intermediate size array of short tandemly repeated DNA sequencesExample: A minisatellite (Genebank: AF157691)

…(AGGGGGTGAGGGTGGGTGTGCTGG)n...

Basic Concepts in Modern Genetic Epidemiology

Polymorphism Information Content: A measure of marker informativeness that reflects the fraction of matings in which a particular parent is expected to be fully informative

Heterozygosity: The fraction of individuals that are likely to be heterozygous at that locus

Basic Concepts in Gene Mapping

Identity by descent (IBD): Two alleles are IBD which it can be determined with certainty that they have been inherited from a common ancestor

Identity by state (IBS): Two alleles are IBS when they share the same state

IBD and IBS

AB CD

AC AC

IBD sharing: 2

IBS sharing: 2

AB AC

AB AC

IBD sharing: 0

IBS sharing: 1

Basic Concepts in Gene Mapping

Linkage: The tendency of genes or other DNA sequences at specific loci to be inherited together as a consequence of their physical proximity on a single chromosome

Linkage Disequilibrium: Nonrandom associations of alleles at linked loci

LOD Score

)5.0|(

)|(log)( 10

pedigreeL

xpedigreeLxzLOD

• a two-point LOD score defined by Morton (1955)

•L(pedigree|=x): the likelihood of observing a particular configuration of a disease and a marker locus in a family assuming a selected range of (0 0.5)

Basic Concepts in Modern Genetic Epidemiology

Morgan: A unit of genetic distance corresponding to a length of DNA which, on average, undergoes one crossover per individual chromatid strand

centiMorgan (cM): A unit of genetic distance equivalent to a 1% probability of recombination during meiosis

Basic Concepts in Modern Genetic Epidemiology

Aa

Bb

aa

bb

Aa

Bb

aa

bb

Aa

Bb

aa

bb

Phase Unknown Phase Known

Basic Concepts in Gene Mapping

Penetrance: The probability of expressing a phenotype given a genotype

Phenocopy: A trait that appears to be identical to a genetic trait but is caused by non-genetic factors

Pleiotropy: One gene loading to many different phenotypic expressions.

Basic Concepts in Gene Mapping

Bacterial artificial chromosomes (BAC): A recombinant plasmid which permits propagation of very large inserts (up to 300kb) in bacterial cells

Yeast artificial chromosomes (YAC): An artificial chromosome produced by combining large fragments of foreign DNA with small sequence elements necessary for chromosome function in yeast cells