View
225
Download
0
Category
Preview:
Citation preview
8/7/2019 Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL
1/13
The phylogenetic history of Selaginellaceae based on DNAsequences from the plastid and nucleus: extreme substitution
rates and rate heterogeneity
Petra Koralla,* and Paul Kenrickb
a Department of Botany, Stockholm University, SE-106 91 Stockholm, Sweden, and Molecular Systematics Laboratory,
Swedish Museum of Natural History, Box 50007, SE-104 05 Stockholm, Swedenb Department of Palaeontology, The Natural History Museum, Cromwell Road, London, SW7 5BD, UK
Received 11 October 2002; revised 1 October 2003
Abstract
Molecular phylogenetic research on Selaginellaceae has focused on the plastid gene rbcL, which in this family has unusually high
substitution rates. Here we develop a molecular data set from the nuclear 26S ribosomal DNA gene with the aim of evaluating and
extending the results of previous phylogenetic research. The 26S rDNA and the rbcL regions were sequenced for a sample of 23
species, which represent the main elements of species diversity in the family. The data were analysed independently and in com-
bination using both maximum parsimony and Bayesian inference. Although several between genome differences were found, the
general pattern of relationships uncovered by all analyses was very similar. Results corroborate the previous study supporting new
groupings not previously recognised on morphological grounds. Substitution rates in the 26S rDNA were also found to be high
(26% informative) for the region analysed, but lower than for rbcL (37% informative). These data indicate that high substitution
rates might be widespread in all three genomes (i.e., plastid, mitochondrion, and nucleus).
2003 Elsevier Inc. All rights reserved.
Keywords: Selaginellaceae; Phylogeny; 26S rDNA; rbcL; Maximum parsimony; Bayesian inference; Long branches; Rate heterogeneity; Substitution
rate
1. Introduction
Lycopods hold a prominent position in the history of
plant life. The living members of this small but distinc-
tive group represent the remnants of a once diverse and
ancient clade which has a well documented fossil record
(DiMichele and Skog, 1992; Thomas, 1992, 1997). The
three living families (Lycopodiaceae, Selaginellaceae,
and Isoetaceae) are known to be monophyletic, but the
relationships among species and subfamily groupings
are poorly understood (Kenrick and Crane, 1997). Re-
cently, several molecular studies have begun to address
some basic systematic questions, and these have led to
the development of outline phylogenetic frameworks for
all three families; Lycopodiaceae (Wikstrom, 2001;
Wikstrom and Kenrick, 1997, 2000a,b, 2001; Wikstrom
et al., 1999), Selaginellaceae (Korall and Kenrick, 2002;
Korall et al., 1999), and Isoetaceae (Rydin and Wi-
kstrom, 2002). Within Selaginellaceae, molecular work
has focused on the plastid gene rbcL.
Our previous analysis of a representative sample of 62
species (approximately 10% of living species diversity)
concluded that current morphology based taxonomies
poorly reflect the evolutionary history of the group
(Korall and Kenrick, 2002). We found many new
groupings, some very well supported, others less so.
Some new clades recognised on molecular grounds also
appeared to correspond to morphological and perhaps
ecological entities. For example, species with rhizo-
phoresconspicuous aerial rootsform a large clade.
Within this clade, aspects of rhizophore development
also map onto a major subgroup. Adaptation to
drought, which in Selaginellaceae takes two extreme
forms, also has a phylogenetic component. Moss-like
xerophytes in the subgenus Tetragonostachys are
* Corresponding author. Fax: +46-8-51-95-42-21.
E-mail address: petra.korall@nrm.se (P. Korall).
1055-7903/$ - see front matter 2003 Elsevier Inc. All rights reserved.
doi:10.1016/j.ympev.2003.10.014
Molecular Phylogenetics and Evolution 31 (2004) 852864
MOLECULAR
PHYLOGENETICS
AND
EVOLUTION
www.elsevier.com/locate/ympev
http://mail%20to:%20petra.korall@nrm.se/http://mail%20to:%20petra.korall@nrm.se/8/7/2019 Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL
2/13
monophyletic, but the so-called resurrection plants are
polyphyletic.
One striking feature of Selaginellaceae is the extremely
high substitution rate in the rbcL gene. We found that566
of the 1299 available characters were phylogenetically
informative (Korall and Kenrick, 2002). Some branches
even exceed 100 characters in length. Taken as a whole,branch length variation within this family is greater than
that of all other land plants, and this leads to instability in
phylogenetic analysis. The position of two species, Se-
laginella australiensis and Selaginella sinensis, were par-
ticularly unstable. Under certain ingroup/outgroup
combinations, monophyly of Selaginellaceae would
break down, and this species pair would make an enor-
mous phylogenetic leap across thetree to group as sister to
Gnetales.
Here we attempt a critical evaluation of the results of
our previous study on chloroplast data by sampling a
more conserved region from the nuclear genome, 26S
nuclear ribosomal DNA. In plants, the 26S nuclear
ribosomal DNA region is approximately 3.4 kb in
length, and it is divided into rapidly evolving expansion
segments and more conservative core regions (Kuzoff et
al., 1998). Overall, 26S rDNA evolves at a slightly lower
rate than rbcL (Kuzoff et al., 1998). We chose to focus
on the 26S rDNA region because the anticipated lower
evolutionary rates would help address problems that we
had encountered with long branches in rbcL (Korall and
Kenrick, 2002). Also, 26S rDNA provides a comple-
mentary data set from a different genome (nucleus). This
has the advantage of side-stepping problems or pecu-
liarities specific to the plastid genome. We have alsochosen to analyse our data using both maximum parsi-
mony and Bayesian inference in an attempt to correct
for the effects of high substitution rates.
2. Materials and methods
2.1. Choice of taxa
A total of 23 ingroup species were chosen to represent
a sample of the 62 species included in our previous rbcL
analysis (Korall and Kenrick, 2002) (Table 1). Note that
Selaginella peruviana was previously misidentified and
was included in Korall and Kenrick (2002) under the
name S. sellowii. The misidentification does not affect
the results, since the same voucher and DNA extract
have been used in both studies.
The choice of outgroup was based on previous
morphological (Kenrick and Crane, 1997) and molec-
ular (Korall et al., 1999; Kranz and Huss, 1996; Wi-
kstrom and Kenrick, 1997) phylogenetic studies. These
indicate that Isoetaceae is the sister group to Selagi-
nellaceae. We included two species of Isoetaceae:
Isoetes lacustris and Isoetes andina. In the rbcL study,
Isoetes melanopoda was chosen as outgroup instead of
I. andina. In the combined analysis we have united the
rbcL sequence of I. melanopoda with the 26S rDNA
sequence of I. andina in a single OTU, here called I.
melanopoda/andina.
2.2. DNA extraction, amplification, and sequencing
With the exception of Selaginella lepidophylla, the
total DNA extractions were those used by Korall and
Kenrick (2002). Most of the extractions were made us-
ing the DNeasy Plant Mini Kit from Qiagen (Santa
Clarita, California, USA). The total DNA extraction of
S. lepidophylla was no longer available, and a new ex-
traction was made. Total DNA of I. andina was kindly
provided by Catarina Rydin (Department of Botany,
Stockholm university, Sweden).
Based on the results of Kuzoff et al. (1998) we de-
cided to amplify the first third of the 26S rDNA region
which is approximately 1200 bp. This required the
synthesis of more specific primers, which were con-
structed in the following way. PCR amplification of the
26S rDNA was performed using the primers N-nc26S1
and 1229rev (Table 2) from Kuzoff et al. (1998) and the
Ready-To-GoTM PCR beads from AmershamPhar-
macia Biotech (Uppsala, Sweden). The reactions were
run in a PerkinElmer Thermal Cycler with one cycle
of 95 C for 5 min and 30 cycles of 95 C for 30 s, 55 C
for 30 s, and 72C for 1.5 min. Since the primers were
unspecific, multiple sequences were produced. The
products were separated on a 4% agarose gel, and the
section of the gel containing the DNA of the correctlength was excised. The DNA was extracted by the
freeze and squeeze-method. The piece of gel with the
correct DNA was placed in a small package of para-
film open at one end, frozen for a few minutes
()80 C), and then the package was squeezed by hand.
The resulting drop of fluid containing the DNA was
collected. This was used as a template for a nested
PCR using internal primers. Cycle sequencing of the
PCR products was performed using an ABI kit [Big-
Dye Terminator-kit (PE Applied Biosystems, War-
rington, WA1, USA)] with the PCR primers as well as
the two internal sequencing primers 641R by Kuzoff
et al. (1998) and 380F constructed by Catarina Rydin
(Department of Botany, Stockholm university, Swe-
den). The resulting fragments were separated on an
ABI Prism 377 automated sequencer (PE Applied
Biosystems, Warrington, WA1, USA). These were used
to construct the Selaginella specific PCR and se-
quencing primers 60F and 1160R (Table 2). The new
primers were then used for PCR amplification and
sequencing using the protocol outlined above. Se-
quences were assembled and edited using the Staden
Package (Staden, 1996) and deposited in the EMBL
sequence database.
P. Korall, P. Kenrick / Molecular Phylogenetics and Evolution 31 (2004) 852864 853
8/7/2019 Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL
3/13
8/7/2019 Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL
4/13
2.3. Alignment
Multiple sequence alignment was made by eye using
the sequence alignment editor SeAl (Rambaut, 1996).
The 26S rDNA data matrix contained 1150 characters
corresponding to bases 241087 of the 26S rDNA se-
quence ofOryza sativa (Sugiura et al., 1985). Parts of the
26S rDNA sequences were very divergent, and 261
characters were excluded from the 26S rDNA matrix.
The rbcL sequences were easily aligned with no inser-
tions or deletions. The rbcL data matrix contained 1299
characters corresponding to bases 831382 of the rbcL
gene of Marchantia polymorpha (Ohyama et al., 1986).
The resulting alignment of 26S rDNA sequences is
available upon request from the corresponding author.
2.4. Phylogenetic analyses
Phylogenetic analyses were performed using maxi-
mum parsimony and Bayesian inference methods. The
26S rDNA and the reduced (as compared to the 62-taxon analysis in Korall and Kenrick, 2002) rbcL data
sets were analysed separately as well as in combination.
In all analyses, trees were rooted using both Isoetes
species and gaps were treated as missing data.
Parsimony analyses were performed using PAUP*
4.0 (Swofford, 2002). Analyses used the heuristic search
option, and the settings were random-sequence addi-
tion with 2000 replicates, TBR branch swapping, col-
lapse of zero length branches and MULTREES on. An
equal weighting scheme was employed with no transi-
tiontransversion bias (Albert and Mishler, 1992).
Support for individual clades was assessed using the
decay index (Bremer, 1988; Donoghue et al., 1992) and
bootstrap values (Felsenstein, 1985). Decay indices
were calculated using AutoDecay 4.0.2 (Eriksson,
1999) and PAUP* 4.0 (Swofford, 2002). PAUP* 4.0
settings used during decay analyses to find the tree
length of constrained trees were: heuristic search with
200 replicates of random addition sequence, TBR
branch swapping, collapse of zero length branches, and
MULTREES off. Bootstrap values were calculated
using PAUP* 4.0 by performing 30,000 replicates with
the following options selected: heuristic search, TBR
branch swapping, collapse of zero length branches,
random sequence addition with one replicate, and
MULTREES off.
Bayesian inference analyses were performed using
MrBayes 2.01 (Huelsenbeck and Ronquist, 2001). The
choice of evolutionary models was based on hierarchi-
cal likelihood ratio tests testing different hypotheses of
DNA substitution. These tests were performed using
the program MrModeltest 1.0b (Nylander, 2002) in
combination with PAUP* 4.0 (Swofford, 2002). This
program is a simplified version of Modeltest 3.06 (Po-
sada and Crandall, 1998), and includes a reduced set of
evolutionary models. Settings for the Bayesian inference
analyses of rbcL included General Time Reversible
model (GTR) (Lanave et al., 1984; Rodrguez et al.,
1990; Tavare, 1986) with a gamma distribution of
substitution rates (C). Base frequencies were estimated
for each analysis. Initial substitution rates for rbcL were
set to r(ac) 1.9232, r(ag) 5.5969, r(at) 0.5358,
r(cg) 0.5272, r(ct) 10.8304, r(gt) 1.000, and
had a C shape parameter of 0.3281. Settings for the
Bayesian inference analyses of 26S rDNA includedGTR+C and with a proportion of invariant sites (I).
Initial substitution rates for 26S rDNA were set to
r(ac) 0.5752, r(ag) 2.1017, r(at) 1.1106, r(c
g) 0.3655, r(ct) 5.0765, r(gt) 1.000, and had a C
shape parameter of 0.8347. Settings for the Bayesian
inference analyses of the combined data set were:
GTR+C+ I. Initial substitution rates were set to
r(ac) 1.2914, r(ag) 3.7017, r(at) 0.7952, r(c
g) 0.4653, r(ct) 8.2280, r(gt) 1.000, and a C
shape parameter of 0.9083. Furthermore, since the rbcL
gene is a protein coding gene, we performed an analysis
allowing for different rates of codon site substitution,
each described by a unique gamma distribution (the
ssgamma command in MrBayes). Substitution rates,
shape parameter, and base frequencies were all esti-
mated. The combined data set was also analysed using
the ssgamma command. This was performed in two
ways; (1) allowing for both separate distribution rates
for the two data sets, and (2) for separate rates for 26S
rDNA and each of the three codon positions in rbcL.
The default settings of MrBayes 2.01 (Huelsenbeck and
Ronquist, 2001) were used for parameters not men-
tioned above, which included running four simulta-
neous chains of which three were heated, the so-called
Table 2
Primers used in amplifying and sequencing 26S rDNA
Primer Direction 5030 sequence Reference/designed by
N-nc26S1a Forward CGACCCCAGGTCAGGCG Kuzoff et al. (1998)
60Fa Forward TTTAAGCATATCACTAAGCGGAGG Petra Korall
380F Forward CCGCGAGGGAAAGATGAAAAGGAC Catarina Rydin, Department of Botany, Stockholm University
1229reva Reverse ACTTCCATGACCACCGTCCT Kuzoff et al. (1998)
1160Ra Reverse CCAGTTCTGCTTACCAAAAATGGCCC Petra Korall
641rev Reverse TTGGTCCGTGTTTCAAGACG Kuzoff et al. (1998)
a Primers used both in PCR and sequencing.
P. Korall, P. Kenrick / Molecular Phylogenetics and Evolution 31 (2004) 852864 855
8/7/2019 Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL
5/13
Metropolis-coupled Markov chain Monte Carlo. In all
analyses, 200,000 generations were performed and every
10th tree was saved. Stationarity of the chains was
judged by examining the output files of the analyses.
The first 3000 trees sampled were discarded as burn-in
(corresponding to 30,000 generations which was well
beyond apparent stationarity in all analyses) and a 50%majority rule consensus tree was calculated for the re-
maining 17,000 trees.
Each Bayesian inference analysis was repeated three
times to test for convergence. Furthermore, we investi-
gated the variation found in the posterior probabilities
values obtained by running 10 replicates of the 26S rDNA
analysis (GTR +C+ I). The mean and the Monte Carlo
variance of the posterior probabilities were calculated.
The test for homogeneity among data sets with dif-
ferent origins implemented in PAUP* 4.0 (Swofford,
2002) and described by Farris et al. (Farris et al., 1995)
was performed, using 1000 heuristic searches each with
10 replicates of random addition sequence.
3. Results
The data sets were analysed separately and in
combination. Parsimony analyses are presented as
bootstrap trees (Figs. 1A, 2A, and 3A), and tree sta-
tistics are summarised in Table 3. The Bayesian infer-
ence analyses are presented as 50% majority rule
consensus trees (Figs. 1B, 2B, and 3B). The topologies
depicted here are those derived from the most complex
model for each data set. For rbcL this is GTR+C,with each codon position treated separately (Fig. 1B).
The model for the 26S rDNA data set is GTR+ C+ I
(Fig. 2B), and for the combined data set GTR +C with
four partitions treated separately (26S rDNA sequences
plus three codon positions) (Fig. 3B). All differences
in the results of the various analyses are summarised in
Table 4. The three replicates run in each Bayesian in-
ference analysis always produced the same topology. The
Monte Carlo variance found in posterior probability
values of the 26S rDNA analysis is presented in Table 5.
Names on clades follow Korall and Kenrick (2002).
Unnamed clades are referred to throughout the text by
the outermost (top and bottom) species as depicted in
the figures. Note that the circumscriptions are depen-
dent on how the trees are drawn and are only relevant
when compared to the figures in question.
3.1. rbcL data setchloroplast genome
Parsimony analysis places two species in basal posi-
tions within the family. S. sinensis is sister to all other
species, but this relationship has very low support with a
bootstrap value (bv) of 53% and a decay index (di) of 2
(Fig. 1A). The next basal lineage is composed of S. se-
laginoides (Fig. 1A). All other species fall into one of
two large clades (clades A and B), which have moderate
support (bv 88%/di 9 and bv 69%/di 4, respectively).
Groups with moderate or high support within clade A
include the subgenus Ericetorum (Selaginella uliginosa
and Selaginella gracillima, bv 100%/di 45) and the so-
called articulate species, excluding Selaginella exaltata(Selaginella diffusaSelaginella kraussiana, bv 78%/di 3).
Most internal nodes within the articulate group are well
supported. In clade B all of the main groups are well-
supported. The Asian species and species groups
(Selaginella brooksiSelaginella kerstingii, Selaginella
planaSelaginella willdenovii, Selaginella stauntoniana)
are paraphyletic to a clade of South and Central
American species (Selaginella haematodesSelaginella
acanthostachys, bv 81%/di 3).
The result of the Bayesian inference analyses (Fig. 1B,
Table 4) is broadly similar to maximum parsimony
(Fig. 1A), with notable exceptions (Table 4). The most
striking incongruence is the position of S. sinensis. The
Bayesian inference analyses always place this species in a
more crownward position within the rhizophoric clade.
Depending upon the model chosen, S. sinensis either
appears as sister to clade A (GTR +C, Table 4), or sister
to clade B (GTR+ C with three partitions, Fig. 1B,
Table 4). Both results have low posterior probability.
The relationships of the articulate species S. diffusa,
Selaginella lingulata, Selaginella suavis, and Selaginella
sericea, also differ with respect to each other.
3.2. 26S rDNA data setnuclear genome
Parsimony analysis places a single species, S. selagi-
noides, as sister to a clade containing all other species,
the rhizophoric clade (Fig. 2A, bv 67%/di 3). Relation-
ships among basal groups in the rhizophoric clade are
unresolved. Clade B is resolved with weak support (bv
57%/di 2). There is high support for a close relationship
between the problematic S. sinensis and clade B (bv
90%/di 7), with S. sinensis as either sister group to or
included in clade B. Clade A is not resolved in the
consensus tree (Fig. 2A). Within the rhizophoric group
there is a basal polytomy, which comprises clades and
species that other analyses (rbcL here, and Korall and
Kenrick, 2002) place in clade A. Bayesian inference
analyses yield a completely congruent but more resolved
phylogeny (Fig. 2B, Table 4). Here, clade A is resolved
as a monophyletic group. However, all nodes unique to
this more resolved phylogeny have low posterior prob-
ability.
3.3. Partition homogeneity test
The result of the test for homogeneity of partitioned
data sets indicates that the null hypothesis of congruence
856 P. Korall, P. Kenrick / Molecular Phylogenetics and Evolution 31 (2004) 852864
8/7/2019 Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL
6/13
between the two data sets (26S rDNA versus rbcL) can
be rejected (P 0:016).
3.4. rbcL and 26S rDNAcombined analyses
Parsimony analysis of the combined data sets again
places S. selaginoides, as sister to the rhizophoric clade
(Fig. 3A, bv 52%/di 0). Clades A and B are both
resolved with comparatively high support (bv 94%/di 11
and bv 86%/di 5, respectively). The problematic S. sin-
ensis is placed within the rhizophoric clade, but its re-
lationship to clades A and B remains unresolved.
Within clade A, the basal most nodes are rather weakly
supported (bv/di 63%/2, 53%/1, and 56%/1, respec-
tively), but three clades have stronger support; S. le-
pidophylla and S. peruviana (bv 88%/di 8), the subgenus
Ericetorum (S. uliginosa and S. gracillima, bv 100%/
di 72), and the so-called articulate series, excluding
S. kraussiana and S. exaltata (S. diffusaS. fragilis, bv
Fig. 1. Alternative topologies for a Selaginella phylogeny based on rbcL gene sequences. S. sinensis is marked in bold to highlight its position in the
different analyses. (A) Maximum parsimony. Bootstrap consensus tree, support values above branches denote bootstrap values and below branches
decay indices; (B) Bayesian inference. Fifty percent majority rule consensus tree of 17,000 trees, support values denote posterior probabilities.
P. Korall, P. Kenrick / Molecular Phylogenetics and Evolution 31 (2004) 852864 857
8/7/2019 Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL
7/13
100%/di 55). In clade B all the main groups are
well-supported. The Asian species and species groups
(S. brooksiS. frondosa, S. planaS. willdenovii,
S. stauntoniana) are paraphyletic to a clade of South
and Central American species (S. haematodes
S. acanthostachys, bv 100%/di 13).
The Bayesian inference analysis is more resolved and
differs only slightly from the parsimony analysis (Fig. 3B,
Table 4). The support for the rhizophoric clade is high
and the basal polytomy is resolved with S. sinensis sister
to clade B. The single incongruence is the position of
S. exaltata which is resolved as sister group to the
Fig. 2. Alternative topologies for a Selaginella phylogeny based on 26S rDNA sequences. S. sinensis is marked in bold to highlight its position in the
different analyses. (A) Maximum parsimony. Bootstrap consensus tree, support values above branches denote bootstrap values and below branches
decay indices; (B) Bayesian inference. Fifty percent majority rule consensus tree of 17,000 trees, support values denote posterior probabilities. Nodes
are numbered, with figures to the right of the node corresponding to those in Table 5.
858 P. Korall, P. Kenrick / Molecular Phylogenetics and Evolution 31 (2004) 852864
8/7/2019 Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL
8/13
subgenus Ericetorum, but this result has low posterior
probability.
4. Discussion
The nuclear 26S rDNA sequence data broadly cor-
roborate the phylogenetic conclusions that emerged
from our earlier rbcL analysis of 62 species. The 26S
Fig. 3. Alternative topologies for a Selaginella phylogeny based on combined analyses ofrbcL and 26S rDNA sequences. S. sinensis is marked in bold
to highlight its position in the different analyses. (A) Maximum parsimony. Bootstrap consensus tree, support values above branches denote
bootstrap values and below branches decay indices; (B) Bayesian inference. Fifty percent majority rule consensus tree of 17,000 trees, support values
denote posterior probabilities.
Table 3
Tree statistics of the parsimony analyses
rbcL 26S rDNA Combined
No. of characters 1299 889 2188
No. of informative characters 477 235 712
No. of most parsimonious trees 1 4 3
Treelength 1623 910 2558
Islands 1 2 1
CI 0.48 0.44 0.46
RI 0.67 0.64 0.66
P. Korall, P. Kenrick / Molecular Phylogenetics and Evolution 31 (2004) 852864 859
8/7/2019 Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL
9/13
Table 4
Summary of all differences in results found using maximum Parsimony versus Bayesian inference
Analysisa Position of S. sinensisb Rhizophoric clade? Ericetorum (er), S. exaltata (ex),
Articulatae excl. S. exaltata (art)
rbcL
Parsimony (Fig. 1A) Sister to rest of ingroup bv 53% No - (ex(er, art)) bv 54%
Bayesian, GTR +C Sister to clade A pp 0.50 Yes pp 1.00 (ex, er, art) -
Bayesian, GTR +C, 3 parts (Fig. 1B) Sister to clade B pp 0.71 Yes pp 1.00 (ex(er, art)) pp 0.96
26S rDNA
Parsimony (Fig. 2A) Sister to clade B bv 57% Yes bv 67% In basal polytomy in rhizophoric c
Bayesian, GTR +C+ I (Fig. 2B) Sister to clade B pp 0.61 Yes pp 80 (art(er, ex)) pp 0.50
Combined
Parsimony (Fig. 3A) Trichotomy with clades A and B Yes bv 52% (ex(er, art)) bv 53%
Bayesian, GTR +C+ I Sister to clade B pp 0.96 Yes pp 1.00 (art(er, ex)) pp 0.80
Bayesian, GTR +C, 2 parts Sister to clade B pp 0.99 Yes pp 1.00 (art(er, ex)) pp 0.80
Bayesian, GTR +C, 4 parts (Fig. 3B) Sister to clade B pp 0.99 Yes pp 1.00 (art(er, ex)) pp 0.51
Analysisa (S. lepidophylla, S. peruviana)? S. brooksii (br),
S. kerstingii (ke),
S. frondosa (fr)
S. acanthostachys (ac),
S. bombycina (bo), S. erythropus (e
S. haematodes (ha)
rbcL
Parsimony (Fig. 1A) Collapsed (ke(br, fr)) bv 61% (ac(bo(er, ha))) bv 98%, 62%
Bayesian, GTR +C Yes pp 1.00 (ke(br, fr)) pp 0.67 (ac(bo(er, ha))) pp 1.00, 0.88
Bayesian, GTR +C, 3 parts (Fig. 1B) Yes pp 0.99 (ke(br, fr)) pp 0.95 (ac(bo(er, ha))) pp 1.00, 0.84
26S rDNA
Parsimony (Fig. 2A) Yes bv 84% (br, ke, fr) - (er(ac(bo, ha))) bv 74%, 76%
Bayesian, GTR +C+ I (Fig. 2B) Yes pp 1.00 (br(ke, fr)) pp 0.86 (er(ac(bo, ha))) pp 0.89, 0.86
Combined
Parsimony (Fig. 3A) Yes bv 88% (br, ke, fr) - (ac(er(bo, ha))) bv 74%, 67%
Bayesian, GTR +C
+ I Yes pp 1.00 (br(ke, fr)) pp 0.80 (ac(er(bo, ha))) pp 0.99, 0.72Bayesian, GTR+, 2 parts Yes pp 1.00 (br(ke, fr)) pp 0.82 (ac(er(bo, ha))) pp 0.99, 0.73
Bayesian, GTR +C, 4 parts (Fig. 3B) Yes pp 1.00 (br(ke, fr)) pp 0.69 (ac(er(bo, ha))) pp 0.99, 0.87
a See text for a description of the models used in Bayesian inference analyses.b Stability values presented denote the weakest node involved (bvbootstrap value, ppposterior probability).
8/7/2019 Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL
10/13
rDNA data, when analysed independently or in com-
bination with rbcL, identify a major monophyletic
group uniting all species of Selaginellaceae, except S.
selaginoides, into a clade of rhizophore-bearing species.
The parsimony analysis of only the rbcL data set yielded
no support for this clade due to the inclusion of the
enigmatic species S. sinensis. Support for the rhizo-phoric clade ranged from low (combined analysis, bv
52%) to moderate (26S, bv 67%), but these were higher
than in the previous rbcL study (bv 50%) (Korall and
Kenrick, 2002). Species diversity within the rhizophoric
clade is partitioned into two major subclades, A and B,
neither of which is characterised by a clear morpho-
logical synapomorphy.
Clade A was not resolved in the 26S rDNA parsi-
mony analysis, yielding a basal polytomy in this part of
the tree, but it is comparatively well supported in the
rbcL (bv 88%) and the combined (bv 94%) analyses.
Similarly, there is support for monophyly of the Artic-
ulatae series (excluding S. exaltata), except for in the 26S
parsimony analysis in which relationships are unre-
solved. Monophyly of the small (three species) Austra-
lian/S African subgenus Ericetorum was called into
question in our previous rbcL study (Korall and Ken-
rick, 2002), which found this group to be paraphyletic to
three Madagascan species (Selaginella lyallii, Selaginella
moratii, and Selaginella polymorpha). All analyses unite
the Ericetorum species S. uliginosa and S. gracillima as
sister taxa, but the third species of this subgenus, Se-
laginella pygmaea, seems to be more distantly related.
We were unable to investigate this issue further because
of difficulties encountered in amplifying the 26S rDNA
region for S. pygmaea. Monophyly of subgenus Te-
tragonostachys was not explicitly tested, but it is un-
controversial and has been confirmed in several previous
studies (Korall and Kenrick, 2002; Therrien and Hau-
fler, 2000; Therrien et al., 1999). The sistergroup rela-
tionship between Tetragonostachys (here represented byS. peruviana) and the resurrection plant S. lepidophylla is
supported in all analyses, except for the parsimony
analysis of the reduced rbcL data set in which this
branch collapses. This unresolved topology can be ex-
plained by the reduced number of taxa sampled, because
the relationship is resolved in the 62-taxon analysis.
Support for the S. lepidophyllaS. peruviana clade is
rather high (26S bv 84%, combined bv 88%) and higher
than in the 62-taxon rbcL analysis (bv 70%). Clade B is
found in all analyses, and it has moderate to high sup-
port (rbcL bv 69%, 26S bv 57%, combined bv 86%).
Well-supported subclades include a group of South and
Central American species (S. haematodes, Selaginella
bombycina, Selaginella erythropus, and S. acanthosta-
chys) and a group of southeast Asian species (S.
brooksii, S. kerstingii, and S. frondosa).
The results of the 26S rDNA analysis do not support
monophyly of the dorsal rhizophoric clade. This is a
large group of species identified in the 62-taxon analysis
of rbcL (Korall and Kenrick, 2002). Species in this
group possess a distinctive form of rhizophore devel-
opment that begins on the upper rather than the lower
surface of a branch to produce an aerial root that loops
over to grow downwards. Of the species in this study,
dorsal rhizophores are found in S. peruviana (Tetrag-onostachys), S. lepidophylla, and in the articulate species
(i.e., S. diffusaS. kraussiana in, e.g., Fig. 3A). Support
for this clade was weak in the 62-taxon analysis and it
conflicts with most of the topologies found in this study.
However, support for all of these conflicting topologies
is weak. This relationship would certainly benefit from
further investigation and an expanded sample of species.
4.1. Partition homogeneity test
When combining two data sets of different origins,
such as two genes from different genomes, there is al-
ways the risk of analysing data that do not reflect the
same evolutionary history. We have used the test for
homogeneity among data sets with different origins im-
plemented in PAUP* 4.0 (Swofford, 2002) and described
by Farris et al. (1995) in order to test the null hypothesis
that the two data sets can be considered to be drawn
from the same population. We see this test not as a test
of combinability, but as a tool for recognising that there
may exist differences between the data sets. It does not
prevent us from analyse the combined data set (see e.g.,
Fishbein et al., 2001; Johnson and Whiting, 2002). A
combined analysis, evaluated with caution, may add
Table 5
Mean and Monte Carlo variance of the posterior probabilities found in
the 10 replicates of the Bayesian inference analysis of the 26S rDNA
region
Node in Fig. 2B Posterior
probability, mean
Monte Carlo
variance
1 100.0 0.0
2 83.4 4.5
3 82.3 4.7
4 64.3 12.9
5 62.2 30.4
6 100.0 0.0
7 97.1 0.1
8 99.5 0.3
9 100.0 0.0
10 57.4 30.5
11 100.0 0.0
12 100.0 0.0
13 100.0 0.0
14 64.5 13.2
15 100.0 0.0
16 100.0 0.0
17 91.6 2.0
18 83.0 3.8
19 100.0 0.0
20 86.4 2.3
21 100.0 0.0
P. Korall, P. Kenrick / Molecular Phylogenetics and Evolution 31 (2004) 852864 861
8/7/2019 Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL
11/13
insights to the phylogeny and should not, in our opin-
ion, be avoided. The null hypothesis is rejected
(P 0:016), but the test is not significant if S. sinensis is
excluded (P 0:36). These results are in line with the
different topologies found, where the major differences
concerns the position of S. sinensis, see below.
4.2. Genome and analytical differences
Consistent differences emerged in several areas be-
tween genomes and between methods of analysis. These
were generally found in parts of the tree where branch
support was weak. Incongruence may therefore reflect a
lack of signal or biases in analytical models rather than
fundamentally different evolutionary histories of orga-
nelle genomes. There is only one case in which all plastid
analyses yield one topology, whereas analyses of the
nuclear gene, irrespective of method, yield another one.
This concerns the internal relationships of the South and
Central American clade (S. acanthostachys, S. bomby-
cina, S. erythropus, and S. haematodes) in clade B (Figs.
1 and 2, Table 4). The combined analyses yield a third
topology (Fig. 3). There was no clear rise in indices of
branch support in analyses run on the combined data
set. Where incongruence occurred between genomes or
between analyses of the same genome, the combined
analyses yielded low support. Where the separate anal-
yses yielded the same topology, the branch support
values were high. The posterior probabilities were usu-
ally slightly higher in the combined analyses.
The most conspicuous phylogenetic conflicts con-
cerned the position of S. sinensis, which varied de-pending upon analytical method and gene sequence.
Parsimony analysis of the rbcL gene placed S. sinensis as
sister to a clade containing all other species in the family.
Bayesian inference however moved S. sinensis to posi-
tions within the rhizophoric clade, either as sister to
clade A or clade B. Both parsimony and Bayesian
analyses of the 26S rDNA alone and the combined data
indicated a position within the rhizophoric clade with
five out of six analyses placing S. sinensis as sister to
clade B. A position within the rhizophoric clade is
consistent with comparative morphology. S. sinensis
possesses the distinctive rhizophores as well as the de-
cussately arranged sporophylls that characterise the
rhizophoric clade. We attribute the anomalous result
obtained from maximum parsimony analysis of the rbcL
gene to branch length effects (see below).
Further differences in results that are attributable to
genome or analytical preference involve the position of
S. brooksii with respect to the Asian species S. frondosa
and S. kerstingii (clade B). In this case support is uni-
formly low. The position of S. exaltata is also ambigu-
ous. All analyses resolve the Articulatae series as
paraphyletic. However, none of the hypothesised
relationships for S. exaltata is strongly supported.
The position ofS. exaltata as sister to all other articulate
species (i.e., a monophyletic Articulatae) in the 62-taxon
analysis is also weakly supported.
Because the cases of incongruence outlined above
mainly involve nodes for which branch support is low, it
remains unclear whether the differences are real or just
the consequences of low phylogenetic signal masked bynoisy data. In the case of differences emerging from an-
alytical methods (e.g., relations among articulate species:
S. diffusa, S. lingulata, S. sericea, and S. suavis) there may
be problems with the assumptions underlying either the
maximum parsimony or Bayesian models of analysis. On
the other hand, the between genome differences observed
in the relationships of the South and Central American
species (S. haematodes, S. bombycina, S. erythropus, and
S. acanthostachys) could reflect fundamentally different
evolutionary histories. These species are all closely re-
lated, and in some areas they have sympatric distribu-
tions. Among other explanations, a hybridisation event
with accompanying introgression of chloroplast DNA
should be considered as a possible cause of the perceived
differences in phylogenetic histories.
In the Bayesian inference analysis, multiple Markov
chains were performed to minimise the risk of the al-
gorithm failing to converge. All replicates of each
analysis produced the same topology, and convergence
seems to have been reached. It should be noted that the
posterior probabilities of the different chains vary, with
lower posterior probabilities having a rather high Monte
Carlo variance (Table 5). Posterior probabilities above
97%, on the other hand, are almost constant in all
analyses, with a Monte Carlo variance less than 0.3.Thisstudy, as well as most previouslypublished studies
(see e.g., Douady et al., 2003; Leache and Reeder, 2002;
Smedmark and Eriksson, 2002; Wilcox et al., 2002), show
that the posterior probabilities of the Bayesian inference
analysis tend to be higher than nonparametric bootstrap
values. Simulation studies indicate that the posterior
probabilities tend to be overestimations of phylogenetic
accuracy, whereas bootstrap values tend to be conserva-
tive estimates (Hillis and Bull, 1993; Suzuki et al., 2002).
Wilcox et al. (2002), however, maintain that, based on
their results, the posterior probabilities are underesti-
mates as well, although less so than bootstrap values, and
they advocate the use of posterior probabilities.
Posterior probabilities also have a tendency to yield
high values for false nodes, as seen in simulation studies
where the true phylogeny is known (Douady et al.,
2003; Suzuki et al., 2002). This is especially true when
the chosen model of evolution is inappropriate (Douady
et al., 2003; Suzuki et al., 2002). Huelsenbeck et al.
(2002) also points out the importance of choosing a
correct model of evolution when using Bayesian infer-
ence for reconstructing phylogenies.
Bayesian inference of phylogeny is a rather new
method in phylogenetic reconstruction, with many
862 P. Korall, P. Kenrick / Molecular Phylogenetics and Evolution 31 (2004) 852864
8/7/2019 Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL
12/13
questions still unanswered. The conclusion by Douady
et al. (2003) seems very appropriate at this time: Both
PP and bootstrap supports are of great interest to
phylogeny as potential upper and lower bound of node
support, but they are surely not interchangeable and
cannot be directly compared.
4.3. Exceptional rates of molecular evolution
The results of the 26S rDNA analysis presented here
indicate that the high number of parsimony informative
characters previously observed in the plastid gene rbcL
(Korall and Kenrick, 2002) is to an extent mirrored also
in the nucleus. We found that 37% of the characters
were parsimony informative for rbcL and 26% for the
region of the 26S rDNA included in this study. Typi-
cally, this amount of variation would be associated with
analyses that include much larger numbers of species.
Phylogenetic analyses of 26S rDNA usually exhibit
lower levels of variation than we have observed in Se-
laginellaceae (e.g., Fan and Xiang, 2001; Stefanovic
et al., 1998). In an analysis of 147 species of angiosperms
Nandi et al. (1998) found that 40% of rbcL sites were
parsimony informative, and in a larger 357 species
analysis Savolainen et al. (2000) found 52% parsimony
informative characters. Another feature of the rbcL tree
is that branch length is unevenly distributed: there are
far more substitutions in clade Aa fast cladethan in
clade Ba slow clade (see Fig. 2 in Korall and Kenrick,
2002). Some branches are also extremely long, such as
the 155 character long terminal branch leading to S.
sinensis in the 62-taxon analysis (Korall and Kenrick,2002). This extreme branch length variation is not,
however, a feature of the 26S rDNA, in which the
number of substitutions are distributed more evenly
throughout the family. Both genes, therefore, have large
numbers of substitutions but the imbalance in the dis-
tribution of these substitutions is found only in rbcL.
The extraordinary large number of substitutions in
Selaginellaceae is most probably due to an elevated sub-
stitution rate, and the new evidence from the nuclear 26S
rDNA indicates that this is a phenomenon that is not
localised to the plastid. High substitution rates have been
observed in other regions as well. Unpublished data in-
dicate that within the chloroplast, not only the rbcL gene
but also atpB have a high substitution rate. Besides 26S
rDNA, the nuclear 18S rDNA region seems to evolve
quickly in Selaginellaceae compared to other land plants
(Kranz and Huss, 1996). The high rates of substitution in
Selaginellaceae are most likely not an effect of its long
evolutionary history. Although the family has ancient
origins dating back to the beginning of the Carboniferous
Period (Thomas, 1992, 1997) high rates of substitution
are not seen within and among closely related similarly
ancient groups such as Lycopodiaceae (Wikstrom and
Kenrick, 1997) and Isoetaceae (Rydin and Wikstrom,
2002). Furthermore, branch length heterogeneity within
the family itself (see Fig. 2 in Korall and Kenrick, 2002),
can not be explained simply by an ancient origin.
High substitution rates in plant genes are likely to
have a variety of causes, none of which is very well
understood (Muse, 2000). They will depend upon whe-
ther the rate differences are coupled to a specific gene, toa genome, or correlated in all three genomes (chloro-
plast, mitochondrion, and nucleus). Several plausible
mechanisms have been proposed (e.g., accuracy of DNA
replication, generation time, speciation rate, and popu-
lation size (Andreasen and Baldwin, 2001; Barraclough
and Savolainen, 2001; Bousquet et al., 1992; Britten,
1986; Gaut et al., 1996; Muse, 2000, and references
therein)), but the extent to which these mechanisms are
active individually or how they might interact to elevate
rates is very poorly understood. With its elevated and
heterogeneous rates of base substitution, Selaginellaceae
might provide a good model to study the relationship
between rate heterogeneity and gene function within and
among plant genomes and plant groups.
Acknowledgments
The authors thank Catarina Rydin for providing to-
tal DNA extract of Isoetes andina, and Mari Kallersjo,
PO Karis, and Johan Nylander for valuable comments
on the manuscript. This work was financially supported
by the Swedish Natural Science Research Council (NFR
research grant to Paul Kenrick and PO Karis: B 1393/
1999), and the foundation Lars Hiertas minne (grant
to Petra Korall).
References
Albert, V.A., Mishler, B.D., 1992. On the rationale and utility of
weighting nucleotide sequence data. Cladistics 8, 7383.
Andreasen, K., Baldwin, B.G., 2001. Unequal evolutionary rates
between annual and perennial lineages of checker mallows (Sidal-
cea, Malvaceae): evidence from 18S-26S rDNA internal and
external transcribed spacers. Mol. Biol. Evol. 18, 936944.
Barraclough, T.G., Savolainen, V., 2001. Evolutionary rates and
species diversity in flowering plants. Evolution 55, 677683.Bousquet, J., Strauss, S.H., Doerksen, A.H., Price, R.A., 1992.
Extensive variation in evolutionary rate of rbcL gene sequences
among seed plants. Proc. Natl. Acad. Sci. USA 89, 78447848.
Bremer, K., 1988. The limits of amino acid sequence data in
angiosperm phylogenetic reconstruction. Evolution 42, 795803.
Britten, R.J., 1986. Rates of DNA sequence evolution differ between
taxonomic groups. Science 231, 13931398.
DiMichele, W.A., Skog, J.E., 1992. The Lycopsida: a symposium.
Ann. Mo. Bot. Gard. 79, 447449.
Donoghue, M.J., Olmstead, R.G., Smith, J.F., Palmer, J.D., 1992.
Phylogenetic relationships of Dipsacales based on rbcL sequences.
Ann. Mo. Bot. Gard. 79, 333345.
Douady, C.J., Delsuc, F., Boucher, Y., Doolittle, W.F., Douzery,
E.J.P., 2003. Comparison of Bayesian and maximum likelihood
P. Korall, P. Kenrick / Molecular Phylogenetics and Evolution 31 (2004) 852864 863
8/7/2019 Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL
13/13
bootstrap measures of phylogenetic reliability. Mol. Biol. Evol. 20,
248254.
Eriksson, T., 1999. AutoDecay Hypercard Program Distributed by the
Author. Bergius Foundation, Royal Swedish Academy of Sciences,
Stockholm.
Fan, C., Xiang, Q.-Y., 2001. Phylogenetic relationships within Cornus
(Cornaceae) based on 26S rDNA sequences. Am. J. Bot. 88, 1131
1138.
Farris, J.S., Kallersjo, M., Kluge, A.G., Bult, C., 1995. Testing
significance of incongruence. Cladistics 90, 315319.
Felsenstein, J., 1985. Confidence limits on phylogenies: an approach
using the bootstrap. Evolution 39, 783791.
Fishbein, M., Hibsch-Jetter, C., Soltis, D.E., Hufford, L., 2001.
Phylogeny of Saxifragales (Angiosperms, Eudicots): analysis of a
rapid, ancient radiation. Syst. Biol. 50, 817847.
Gaut, B.S., Morton, B.R., McCaig, B.C., Clegg, M.T., 1996. Substi-
tution rate comparisons between grasses and palms: synonymous
rate differences at the nuclear gene Adh parallel rate differences at
the plastid gene rbcL. Evolution 93, 1027410279.
Holmgren, P.K., Holmgren, N.H., Barnett, L.C., 1990. Index Herbar-
iorum 1: The herbaria of the world. Greuter W, Regnum
Vegetabile. New York Botanical Garden, New York.
Hillis, D.M., Bull, J.J., 1993. An empirical test of bootstrapping as a
method for assessing confidence in phylogenetic analysis. Syst.
Biol. 42, 182192.
Huelsenbeck, J.P., Larget, B., Miller, R.E., Ronquist, F., 2002.
Potential applications and pitfalls of Bayesian inference of
phylogeny. Syst. Biol. 51, 673688.
Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of
phylogenetic trees. Bioinformatics 17, 754755.
Jermy, A.C., 1986. Subgeneric names in Selaginella. Fern Gaz. 13,
117118.
Johnson, K.P., Whiting, M.F., 2002. Multiple genes and the mono-
phyly of Ischnocera (Insecta: Phthiraptera). Mol. Phylogenet. Evol
22, 101110.
Kenrick, P., Crane, P.R., 1997. The Origin and Early Diversification of
Land Plants: A Cladistic Study. Smithsonian Institution Press,
Washington.Korall, P., Kenrick, P., 2002. Phylogenetic relationships in selaginell-
aceae based on rbcL sequences. Am. J. Bot. 89, 506517.
Korall, P., Kenrick, P., Therrien, J.P., 1999. Phylogeny of Selaginell-
aceae: evaluation of generic/subgeneric relationships based onrbcL
gene sequences. Int. J. Plant Sci. 160, 585594.
Kranz, H.D., Huss, V.A.R., 1996. Molecular evolution of pterido-
phytes and their relationships to seed plants: evidence from
complete 18S rRNA gene sequences. Plant Syst. Evol. 202, 111.
Kuzoff, R.K., Sweere, J.A., Soltis, D.E., Soltis, P.S., Zimmer, E.A.,
1998. The phylogenetic potential of entire 26S rDNA sequences in
plants. Mol. Biol. Evol. 15, 251263.
Lanave, C., Preparata, G., Saccone, C., Serio, G., 1984. A new method
for calculating evolutionary substitution rates. J. Mol. Evol. 20,
8693.
Leach
e, A.D., Reeder, T.W., 2002. Molecular systematics of the easternfence lizard (Sceloporus undulatus): a comparison of parsimony,
likelihood, and Bayesian approaches. Syst. Biol. 51, 4468.
Manhart, J.R., 1994. Phylogenetic analysis of green plant rbcL
sequences. Mol. Phylogenet. Evol. 3, 114127.
Muse, S.V., 2000. Examining rates and patterns of nucleotide
substitution in plants. Plant Mol. Biol. 42, 2543.
Nandi, O.I., Chase, M.W., Endress, P.K., 1998. A combined cladistic
analysis of angiosperms using rbcL and non-molecular data. Ann.
Mo. Bot. Gard. 85, 137212.
Nylander, J.A.A., 2002. MrModeltest. Version 1.0b. Computer pro-
gram distributed by the author. Department of Systematic Zool-
ogy, Uppsala University, Uppsala, Sweden.
Ohyama, K., Fukuzawa, H., Kohchi, T., Shirai, H., Sano, T., Sano, S.,
Umesono, K., Shiki, Y., Takeuchi, M., Chang, Z., Aota, S.,
Inokuchi, H., Ozeki, H., 1986. Chloroplast gene organization
deduced from the complete sequence of the liverwort Marchantia
polymorpha chloroplast DNA. Nature 322, 572574.
Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of
DNA substitution. Bioinformatics 14, 817818.
Rambaut, A.,1996. SeAl, sequencealignmenteditor.Version 1.0alpha
1. Department of Zoology, University of Oxford, Oxford, UK.
Rodrguez, F., Oliver, J.L., Marn, A., Medina, J.R., 1990. The general
stochastic model of nucleotide substitution. J. Theor. Biol. 142,
485501.
Rydin, C., Wikstrom, N., 2002. Phylogeny of Isoetes (Lycopsida):
resolvingbasal relationships using rbcL sequences. Taxon 51, 8389.
Savolainen, V., Chase, M.W., Hoot, S.B., Morton, C.M., Soltis, D.E.,
Bayer, C., Fay, M.F., De Bruijn, A.Y., Sullivan, S., Qiu, Y.-L.,
2000. Phylogenetics of flowering plants based on combined analysis
of plastid atpB and rbcL gene sequences. Syst. Biol. 49, 306362.
Smedmark, J.E.E., Eriksson, T., 2002. Phylogenetic relationships of
Geum (Rosaceae) and relatives inferred from the nrITS and trnL-
trnF regions. Syst. Bot. 27, 303317.
Staden, R., 1996. The Staden sequence analysis package. Mol.
Biotechnol. 5, 233241.
Stefanovic, S., Jager, M., Deutsch, J., Broutin, J., Masselot, M., 1998.
Phylogenetic relationships of conifers inferred from partial 28S
rRNA gene sequences. Am. J. Bot. 85, 688697.
Sugiura, M., Iida, Y., Oono, K., Takaiwa, F., 1985. The complete
nucleotide sequence of a rice 25S rRNA gene. Gene 37, 255259.
Suzuki, M., Glazko, G.V., Nei, M., 2002. Overcredibility of molecular
phylogenies obtained by Bayesian phylogenetics. Proc. Natl. Acad.
Sci. USA 99, 1613816143.
Swofford, D.L., 2002. PAUP*: Phylogenetic Analysis Using Parsi-
mony (*and Other Methods). Version 4. Sinauer Associates,
Sunderland, MA.
Tavare, S., 1986. Some probabilistic and statistical problems on the
analysis of DNA sequences. Lect. Math. Life Sci. 17, 5786.
Therrien, J.P., Haufler, C.H., 2000. Phylogeny and biogeography of
Selaginella subg. Tetragonostachys based on nuclear ribosomal ITS
sequence data. Am. J. Bot. 87, 98.
Therrien, J.P., Haufler, C.H., Korall, P., 1999. Phylogeny andbiogeography of Selaginella subg. Tetragonostachys. In XVI
International Botanical Congress, abstracts. 120. St Louis, USA.
Thomas, B.A., 1992. Paleozoic herbaceous lycopsids and the begin-
nings of extant Lycopodium sens. lat. and Selaginella sens. lat. Ann.
Mo. Bot. Gard. 79, 623631.
Thomas, B.A., 1997. Upper Carboniferous herbaceous lycopsids. Rev.
Palaeobotan. Palynol. 95, 129153.
Wikstrom, N., 2001. Diversification and relationships of extant
homosporous lycopods. Am. Fern J. 91, 150165.
Wikstrom, N., Kenrick, P., 1997. Phylogeny of Lycopodiaceae
(Lycopsida) and the relationships of Phylloglossum drummondii
Kunze based on rbcL sequences. Int. J. Plant Sci. 158, 862871.
Wikstrom, N., Kenrick, P., 2000a. Phylogeny of epiphytic Huperzia
(Lycopodiaceae): paleotropical and neotropical clades corrobo-
rated by rbcL sequences. Nordic J. Bot. 20, 165171.Wikstrom, N., Kenrick, P., 2000b. Relationships of Lycopodium and
Lycopodiella based on combined plastid rbcL gene and trnL intron
sequence data. Syst. Bot. 25, 495510.
Wikstrom, N., Kenrick, P., 2001. Evolution of Lycopodiaceae (Lyc-
opsida): estimating divergence times from rbcL gene sequences by
use of nonparametric rate smoothing. Mol. Phylogenet. Evol. 19,
177186.
Wikstrom, N., Kenrick, P., Chase, M., 1999. Epiphytism and
terrestrialization in tropical Huperzia (Lycopodiaceae). Plant Syst.
Evol. 218, 221243.
Wilcox, T.P., Zwickl, D.J., Heath, T.A., Hillis, D.M., 2002. Phyloge-
netic relationships of the dwarf boas and a comparison of Bayesian
and bootstrap measures of phylogenetic support. Mol. Phylogenet.
Evol. 25, 361371.
864 P. Korall, P. Kenrick / Molecular Phylogenetics and Evolution 31 (2004) 852864
Recommended