Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL

8/7/2019 Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL

1/13

The phylogenetic history of Selaginellaceae based on DNAsequences from the plastid and nucleus: extreme substitution

rates and rate heterogeneity

Petra Koralla,* and Paul Kenrickb

a Department of Botany, Stockholm University, SE-106 91 Stockholm, Sweden, and Molecular Systematics Laboratory,

Swedish Museum of Natural History, Box 50007, SE-104 05 Stockholm, Swedenb Department of Palaeontology, The Natural History Museum, Cromwell Road, London, SW7 5BD, UK

Received 11 October 2002; revised 1 October 2003

Abstract

Molecular phylogenetic research on Selaginellaceae has focused on the plastid gene rbcL, which in this family has unusually high

substitution rates. Here we develop a molecular data set from the nuclear 26S ribosomal DNA gene with the aim of evaluating and

extending the results of previous phylogenetic research. The 26S rDNA and the rbcL regions were sequenced for a sample of 23

species, which represent the main elements of species diversity in the family. The data were analysed independently and in com-

bination using both maximum parsimony and Bayesian inference. Although several between genome differences were found, the

general pattern of relationships uncovered by all analyses was very similar. Results corroborate the previous study supporting new

groupings not previously recognised on morphological grounds. Substitution rates in the 26S rDNA were also found to be high

(26% informative) for the region analysed, but lower than for rbcL (37% informative). These data indicate that high substitution

rates might be widespread in all three genomes (i.e., plastid, mitochondrion, and nucleus).

2003 Elsevier Inc. All rights reserved.

Keywords: Selaginellaceae; Phylogeny; 26S rDNA; rbcL; Maximum parsimony; Bayesian inference; Long branches; Rate heterogeneity; Substitution

rate

1. Introduction

Lycopods hold a prominent position in the history of

plant life. The living members of this small but distinc-

tive group represent the remnants of a once diverse and

ancient clade which has a well documented fossil record

(DiMichele and Skog, 1992; Thomas, 1992, 1997). The

three living families (Lycopodiaceae, Selaginellaceae,

and Isoetaceae) are known to be monophyletic, but the

relationships among species and subfamily groupings

are poorly understood (Kenrick and Crane, 1997). Re-

cently, several molecular studies have begun to address

some basic systematic questions, and these have led to

the development of outline phylogenetic frameworks for

all three families; Lycopodiaceae (Wikstrom, 2001;

Wikstrom and Kenrick, 1997, 2000a,b, 2001; Wikstrom

et al., 1999), Selaginellaceae (Korall and Kenrick, 2002;

Korall et al., 1999), and Isoetaceae (Rydin and Wi-

kstrom, 2002). Within Selaginellaceae, molecular work

has focused on the plastid gene rbcL.

Our previous analysis of a representative sample of 62

species (approximately 10% of living species diversity)

concluded that current morphology based taxonomies

poorly reflect the evolutionary history of the group

(Korall and Kenrick, 2002). We found many new

groupings, some very well supported, others less so.

Some new clades recognised on molecular grounds also

appeared to correspond to morphological and perhaps

ecological entities. For example, species with rhizo-

phoresconspicuous aerial rootsform a large clade.

Within this clade, aspects of rhizophore development

also map onto a major subgroup. Adaptation to

drought, which in Selaginellaceae takes two extreme

forms, also has a phylogenetic component. Moss-like

xerophytes in the subgenus Tetragonostachys are

* Corresponding author. Fax: +46-8-51-95-42-21.

E-mail address: [email protected] (P. Korall).

1055-7903/$ - see front matter 2003 Elsevier Inc. All rights reserved.

doi:10.1016/j.ympev.2003.10.014

Molecular Phylogenetics and Evolution 31 (2004) 852864

MOLECULAR

PHYLOGENETICS

AND

EVOLUTION

www.elsevier.com/locate/ympev
http://mail%20to:%[email protected]/http://mail%20to:%[email protected]/


2/13

monophyletic, but the so-called resurrection plants are

polyphyletic.

One striking feature of Selaginellaceae is the extremely

high substitution rate in the rbcL gene. We found that566

of the 1299 available characters were phylogenetically

informative (Korall and Kenrick, 2002). Some branches

even exceed 100 characters in length. Taken as a whole,branch length variation within this family is greater than

that of all other land plants, and this leads to instability in

phylogenetic analysis. The position of two species, Se-

laginella australiensis and Selaginella sinensis, were par-

ticularly unstable. Under certain ingroup/outgroup

combinations, monophyly of Selaginellaceae would

break down, and this species pair would make an enor-

mous phylogenetic leap across thetree to group as sister to

Gnetales.

Here we attempt a critical evaluation of the results of

our previous study on chloroplast data by sampling a

more conserved region from the nuclear genome, 26S

nuclear ribosomal DNA. In plants, the 26S nuclear

ribosomal DNA region is approximately 3.4 kb in

length, and it is divided into rapidly evolving expansion

segments and more conservative core regions (Kuzoff et

al., 1998). Overall, 26S rDNA evolves at a slightly lower

rate than rbcL (Kuzoff et al., 1998). We chose to focus

on the 26S rDNA region because the anticipated lower

evolutionary rates would help address problems that we

had encountered with long branches in rbcL (Korall and

Kenrick, 2002). Also, 26S rDNA provides a comple-

mentary data set from a different genome (nucleus). This

has the advantage of side-stepping problems or pecu-

liarities specific to the plastid genome. We have alsochosen to analyse our data using both maximum parsi-

mony and Bayesian inference in an attempt to correct

for the effects of high substitution rates.

2. Materials and methods

2.1. Choice of taxa

A total of 23 ingroup species were chosen to represent

a sample of the 62 species included in our previous rbcL

analysis (Korall and Kenrick, 2002) (Table 1). Note that

Selaginella peruviana was previously misidentified and

was included in Korall and Kenrick (2002) under the

name S. sellowii. The misidentification does not affect

the results, since the same voucher and DNA extract

have been used in both studies.

The choice of outgroup was based on previous

morphological (Kenrick and Crane, 1997) and molec-

ular (Korall et al., 1999; Kranz and Huss, 1996; Wi-

kstrom and Kenrick, 1997) phylogenetic studies. These

indicate that Isoetaceae is the sister group to Selagi-

nellaceae. We included two species of Isoetaceae:

Isoetes lacustris and Isoetes andina. In the rbcL study,

Isoetes melanopoda was chosen as outgroup instead of

I. andina. In the combined analysis we have united the

rbcL sequence of I. melanopoda with the 26S rDNA

sequence of I. andina in a single OTU, here called I.

melanopoda/andina.

2.2. DNA extraction, amplification, and sequencing

With the exception of Selaginella lepidophylla, the

total DNA extractions were those used by Korall and

Kenrick (2002). Most of the extractions were made us-

ing the DNeasy Plant Mini Kit from Qiagen (Santa

Clarita, California, USA). The total DNA extraction of

S. lepidophylla was no longer available, and a new ex-

traction was made. Total DNA of I. andina was kindly

provided by Catarina Rydin (Department of Botany,

Stockholm university, Sweden).

Based on the results of Kuzoff et al. (1998) we de-

cided to amplify the first third of the 26S rDNA region

which is approximately 1200 bp. This required the

synthesis of more specific primers, which were con-

structed in the following way. PCR amplification of the

26S rDNA was performed using the primers N-nc26S1

and 1229rev (Table 2) from Kuzoff et al. (1998) and the

Ready-To-GoTM PCR beads from AmershamPhar-

macia Biotech (Uppsala, Sweden). The reactions were

run in a PerkinElmer Thermal Cycler with one cycle

of 95 C for 5 min and 30 cycles of 95 C for 30 s, 55 C

for 30 s, and 72C for 1.5 min. Since the primers were

unspecific, multiple sequences were produced. The

products were separated on a 4% agarose gel, and the

section of the gel containing the DNA of the correctlength was excised. The DNA was extracted by the

freeze and squeeze-method. The piece of gel with the

correct DNA was placed in a small package of para-

film open at one end, frozen for a few minutes

()80 C), and then the package was squeezed by hand.

The resulting drop of fluid containing the DNA was

collected. This was used as a template for a nested

PCR using internal primers. Cycle sequencing of the

PCR products was performed using an ABI kit [Big-

Dye Terminator-kit (PE Applied Biosystems, War-

rington, WA1, USA)] with the PCR primers as well as

the two internal sequencing primers 641R by Kuzoff

et al. (1998) and 380F constructed by Catarina Rydin

(Department of Botany, Stockholm university, Swe-

den). The resulting fragments were separated on an

ABI Prism 377 automated sequencer (PE Applied

Biosystems, Warrington, WA1, USA). These were used

to construct the Selaginella specific PCR and se-

quencing primers 60F and 1160R (Table 2). The new

primers were then used for PCR amplification and

sequencing using the protocol outlined above. Se-

quences were assembled and edited using the Staden

Package (Staden, 1996) and deposited in the EMBL

sequence database.

P. Korall, P. Kenrick / Molecular Phylogenetics and Evolution 31 (2004) 852864 853


3/13


4/13

2.3. Alignment

Multiple sequence alignment was made by eye using

the sequence alignment editor SeAl (Rambaut, 1996).

The 26S rDNA data matrix contained 1150 characters

corresponding to bases 241087 of the 26S rDNA se-

quence ofOryza sativa (Sugiura et al., 1985). Parts of the

26S rDNA sequences were very divergent, and 261

characters were excluded from the 26S rDNA matrix.

The rbcL sequences were easily aligned with no inser-

tions or deletions. The rbcL data matrix contained 1299

characters corresponding to bases 831382 of the rbcL

gene of Marchantia polymorpha (Ohyama et al., 1986).

The resulting alignment of 26S rDNA sequences is

available upon request from the corresponding author.

2.4. Phylogenetic analyses

Phylogenetic analyses were performed using maxi-

mum parsimony and Bayesian inference methods. The

26S rDNA and the reduced (as compared to the 62-taxon analysis in Korall and Kenrick, 2002) rbcL data

sets were analysed separately as well as in combination.

In all analyses, trees were rooted using both Isoetes

species and gaps were treated as missing data.

Parsimony analyses were performed using PAUP*

4.0 (Swofford, 2002). Analyses used the heuristic search

option, and the settings were random-sequence addi-

tion with 2000 replicates, TBR branch swapping, col-

lapse of zero length branches and MULTREES on. An

equal weighting scheme was employed with no transi-

tiontransversion bias (Albert and Mishler, 1992).

Support for individual clades was assessed using the

decay index (Bremer, 1988; Donoghue et al., 1992) and

bootstrap values (Felsenstein, 1985). Decay indices

were calculated using AutoDecay 4.0.2 (Eriksson,

1999) and PAUP* 4.0 (Swofford, 2002). PAUP* 4.0

settings used during decay analyses to find the tree

length of constrained trees were: heuristic search with

200 replicates of random addition sequence, TBR

branch swapping, collapse of zero length branches, and

MULTREES off. Bootstrap values were calculated

using PAUP* 4.0 by performing 30,000 replicates with

the following options selected: heuristic search, TBR

branch swapping, collapse of zero length branches,

random sequence addition with one replicate, and

MULTREES off.

Bayesian inference analyses were performed using

MrBayes 2.01 (Huelsenbeck and Ronquist, 2001). The

choice of evolutionary models was based on hierarchi-

cal likelihood ratio tests testing different hypotheses of

DNA substitution. These tests were performed using

the program MrModeltest 1.0b (Nylander, 2002) in

combination with PAUP* 4.0 (Swofford, 2002). This

program is a simplified version of Modeltest 3.06 (Po-

sada and Crandall, 1998), and includes a reduced set of

evolutionary models. Settings for the Bayesian inference

analyses of rbcL included General Time Reversible

model (GTR) (Lanave et al., 1984; Rodrguez et al.,

1990; Tavare, 1986) with a gamma distribution of

substitution rates (C). Base frequencies were estimated

for each analysis. Initial substitution rates for rbcL were

set to r(ac) 1.9232, r(ag) 5.5969, r(at) 0.5358,

r(cg) 0.5272, r(ct) 10.8304, r(gt) 1.000, and

had a C shape parameter of 0.3281. Settings for the

Bayesian inference analyses of 26S rDNA includedGTR+C and with a proportion of invariant sites (I).

Initial substitution rates for 26S rDNA were set to

r(ac) 0.5752, r(ag) 2.1017, r(at) 1.1106, r(c

g) 0.3655, r(ct) 5.0765, r(gt) 1.000, and had a C

shape parameter of 0.8347. Settings for the Bayesian

inference analyses of the combined data set were:

GTR+C+ I. Initial substitution rates were set to

r(ac) 1.2914, r(ag) 3.7017, r(at) 0.7952, r(c

g) 0.4653, r(ct) 8.2280, r(gt) 1.000, and a C

shape parameter of 0.9083. Furthermore, since the rbcL

gene is a protein coding gene, we performed an analysis

allowing for different rates of codon site substitution,

each described by a unique gamma distribution (the

ssgamma command in MrBayes). Substitution rates,

shape parameter, and base frequencies were all esti-

mated. The combined data set was also analysed using

the ssgamma command. This was performed in two

ways; (1) allowing for both separate distribution rates

for the two data sets, and (2) for separate rates for 26S

rDNA and each of the three codon positions in rbcL.

The default settings of MrBayes 2.01 (Huelsenbeck and

Ronquist, 2001) were used for parameters not men-

tioned above, which included running four simulta-

neous chains of which three were heated, the so-called

Table 2

Primers used in amplifying and sequencing 26S rDNA

Primer Direction 5030 sequence Reference/designed by

N-nc26S1a Forward CGACCCCAGGTCAGGCG Kuzoff et al. (1998)

60Fa Forward TTTAAGCATATCACTAAGCGGAGG Petra Korall

380F Forward CCGCGAGGGAAAGATGAAAAGGAC Catarina Rydin, Department of Botany, Stockholm University

1229reva Reverse ACTTCCATGACCACCGTCCT Kuzoff et al. (1998)

1160Ra Reverse CCAGTTCTGCTTACCAAAAATGGCCC Petra Korall

641rev Reverse TTGGTCCGTGTTTCAAGACG Kuzoff et al. (1998)

a Primers used both in PCR and sequencing.



5/13

Metropolis-coupled Markov chain Monte Carlo. In all

analyses, 200,000 generations were performed and every

10th tree was saved. Stationarity of the chains was

judged by examining the output files of the analyses.

The first 3000 trees sampled were discarded as burn-in

(corresponding to 30,000 generations which was well

beyond apparent stationarity in all analyses) and a 50%majority rule consensus tree was calculated for the re-

maining 17,000 trees.

Each Bayesian inference analysis was repeated three

times to test for convergence. Furthermore, we investi-

gated the variation found in the posterior probabilities

values obtained by running 10 replicates of the 26S rDNA

analysis (GTR +C+ I). The mean and the Monte Carlo

variance of the posterior probabilities were calculated.

The test for homogeneity among data sets with dif-

ferent origins implemented in PAUP* 4.0 (Swofford,

2002) and described by Farris et al. (Farris et al., 1995)

was performed, using 1000 heuristic searches each with

10 replicates of random addition sequence.

3. Results

The data sets were analysed separately and in

combination. Parsimony analyses are presented as

bootstrap trees (Figs. 1A, 2A, and 3A), and tree sta-

tistics are summarised in Table 3. The Bayesian infer-

ence analyses are presented as 50% majority rule

consensus trees (Figs. 1B, 2B, and 3B). The topologies

depicted here are those derived from the most complex

model for each data set. For rbcL this is GTR+C,with each codon position treated separately (Fig. 1B).

The model for the 26S rDNA data set is GTR+ C+ I

(Fig. 2B), and for the combined data set GTR +C with

four partitions treated separately (26S rDNA sequences

plus three codon positions) (Fig. 3B). All differences

in the results of the various analyses are summarised in

Table 4. The three replicates run in each Bayesian in-

ference analysis always produced the same topology. The

Monte Carlo variance found in posterior probability

values of the 26S rDNA analysis is presented in Table 5.

Names on clades follow Korall and Kenrick (2002).

Unnamed clades are referred to throughout the text by

the outermost (top and bottom) species as depicted in

the figures. Note that the circumscriptions are depen-

dent on how the trees are drawn and are only relevant

when compared to the figures in question.

3.1. rbcL data setchloroplast genome

Parsimony analysis places two species in basal posi-

tions within the family. S. sinensis is sister to all other

species, but this relationship has very low support with a

bootstrap value (bv) of 53% and a decay index (di) of 2

(Fig. 1A). The next basal lineage is composed of S. se-

laginoides (Fig. 1A). All other species fall into one of

two large clades (clades A and B), which have moderate

support (bv 88%/di 9 and bv 69%/di 4, respectively).

Groups with moderate or high support within clade A

include the subgenus Ericetorum (Selaginella uliginosa

and Selaginella gracillima, bv 100%/di 45) and the so-

called articulate species, excluding Selaginella exaltata(Selaginella diffusaSelaginella kraussiana, bv 78%/di 3).

Most internal nodes within the articulate group are well

supported. In clade B all of the main groups are well-

supported. The Asian species and species groups

(Selaginella brooksiSelaginella kerstingii, Selaginella

planaSelaginella willdenovii, Selaginella stauntoniana)

are paraphyletic to a clade of South and Central

American species (Selaginella haematodesSelaginella

acanthostachys, bv 81%/di 3).

The result of the Bayesian inference analyses (Fig. 1B,

Table 4) is broadly similar to maximum parsimony

(Fig. 1A), with notable exceptions (Table 4). The most

striking incongruence is the position of S. sinensis. The

Bayesian inference analyses always place this species in a

more crownward position within the rhizophoric clade.

Depending upon the model chosen, S. sinensis either

appears as sister to clade A (GTR +C, Table 4), or sister

to clade B (GTR+ C with three partitions, Fig. 1B,

Table 4). Both results have low posterior probability.

The relationships of the articulate species S. diffusa,

Selaginella lingulata, Selaginella suavis, and Selaginella

sericea, also differ with respect to each other.

3.2. 26S rDNA data setnuclear genome

Parsimony analysis places a single species, S. selagi-

noides, as sister to a clade containing all other species,

the rhizophoric clade (Fig. 2A, bv 67%/di 3). Relation-

ships among basal groups in the rhizophoric clade are

unresolved. Clade B is resolved with weak support (bv

57%/di 2). There is high support for a close relationship

between the problematic S. sinensis and clade B (bv

90%/di 7), with S. sinensis as either sister group to or

included in clade B. Clade A is not resolved in the

consensus tree (Fig. 2A). Within the rhizophoric group

there is a basal polytomy, which comprises clades and

species that other analyses (rbcL here, and Korall and

Kenrick, 2002) place in clade A. Bayesian inference

analyses yield a completely congruent but more resolved

phylogeny (Fig. 2B, Table 4). Here, clade A is resolved

as a monophyletic group. However, all nodes unique to

this more resolved phylogeny have low posterior prob-

ability.

3.3. Partition homogeneity test

The result of the test for homogeneity of partitioned

data sets indicates that the null hypothesis of congruence

856 P. Korall, P. Kenrick / Molecular Phylogenetics and Evolution 31 (2004) 852864


6/13

between the two data sets (26S rDNA versus rbcL) can

be rejected (P 0:016).

3.4. rbcL and 26S rDNAcombined analyses

Parsimony analysis of the combined data sets again

places S. selaginoides, as sister to the rhizophoric clade

(Fig. 3A, bv 52%/di 0). Clades A and B are both

resolved with comparatively high support (bv 94%/di 11

and bv 86%/di 5, respectively). The problematic S. sin-

ensis is placed within the rhizophoric clade, but its re-

lationship to clades A and B remains unresolved.

Within clade A, the basal most nodes are rather weakly

supported (bv/di 63%/2, 53%/1, and 56%/1, respec-

tively), but three clades have stronger support; S. le-

pidophylla and S. peruviana (bv 88%/di 8), the subgenus

Ericetorum (S. uliginosa and S. gracillima, bv 100%/

di 72), and the so-called articulate series, excluding

S. kraussiana and S. exaltata (S. diffusaS. fragilis, bv

Fig. 1. Alternative topologies for a Selaginella phylogeny based on rbcL gene sequences. S. sinensis is marked in bold to highlight its position in the

different analyses. (A) Maximum parsimony. Bootstrap consensus tree, support values above branches denote bootstrap values and below branches

decay indices; (B) Bayesian inference. Fifty percent majority rule consensus tree of 17,000 trees, support values denote posterior probabilities.



7/13

100%/di 55). In clade B all the main groups are

well-supported. The Asian species and species groups

(S. brooksiS. frondosa, S. planaS. willdenovii,

S. stauntoniana) are paraphyletic to a clade of South

and Central American species (S. haematodes

S. acanthostachys, bv 100%/di 13).

The Bayesian inference analysis is more resolved and

differs only slightly from the parsimony analysis (Fig. 3B,

Table 4). The support for the rhizophoric clade is high

and the basal polytomy is resolved with S. sinensis sister

to clade B. The single incongruence is the position of

S. exaltata which is resolved as sister group to the

Fig. 2. Alternative topologies for a Selaginella phylogeny based on 26S rDNA sequences. S. sinensis is marked in bold to highlight its position in the

different analyses. (A) Maximum parsimony. Bootstrap consensus tree, support values above branches denote bootstrap values and below branches

decay indices; (B) Bayesian inference. Fifty percent majority rule consensus tree of 17,000 trees, support values denote posterior probabilities. Nodes

are numbered, with figures to the right of the node corresponding to those in Table 5.



8/13

subgenus Ericetorum, but this result has low posterior

probability.

4. Discussion

The nuclear 26S rDNA sequence data broadly cor-

roborate the phylogenetic conclusions that emerged

from our earlier rbcL analysis of 62 species. The 26S

Fig. 3. Alternative topologies for a Selaginella phylogeny based on combined analyses ofrbcL and 26S rDNA sequences. S. sinensis is marked in bold

to highlight its position in the different analyses. (A) Maximum parsimony. Bootstrap consensus tree, support values above branches denote

bootstrap values and below branches decay indices; (B) Bayesian inference. Fifty percent majority rule consensus tree of 17,000 trees, support values

denote posterior probabilities.

Table 3

Tree statistics of the parsimony analyses

rbcL 26S rDNA Combined

No. of characters 1299 889 2188

No. of informative characters 477 235 712

No. of most parsimonious trees 1 4 3

Treelength 1623 910 2558

Islands 1 2 1

CI 0.48 0.44 0.46

RI 0.67 0.64 0.66



9/13

Table 4

Summary of all differences in results found using maximum Parsimony versus Bayesian inference

Analysisa Position of S. sinensisb Rhizophoric clade? Ericetorum (er), S. exaltata (ex),

Articulatae excl. S. exaltata (art)

rbcL

Parsimony (Fig. 1A) Sister to rest of ingroup bv 53% No - (ex(er, art)) bv 54%

Bayesian, GTR +C Sister to clade A pp 0.50 Yes pp 1.00 (ex, er, art) -

Bayesian, GTR +C, 3 parts (Fig. 1B) Sister to clade B pp 0.71 Yes pp 1.00 (ex(er, art)) pp 0.96

26S rDNA

Parsimony (Fig. 2A) Sister to clade B bv 57% Yes bv 67% In basal polytomy in rhizophoric c

Bayesian, GTR +C+ I (Fig. 2B) Sister to clade B pp 0.61 Yes pp 80 (art(er, ex)) pp 0.50

Combined

Parsimony (Fig. 3A) Trichotomy with clades A and B Yes bv 52% (ex(er, art)) bv 53%

Bayesian, GTR +C+ I Sister to clade B pp 0.96 Yes pp 1.00 (art(er, ex)) pp 0.80

Bayesian, GTR +C, 2 parts Sister to clade B pp 0.99 Yes pp 1.00 (art(er, ex)) pp 0.80

Bayesian, GTR +C, 4 parts (Fig. 3B) Sister to clade B pp 0.99 Yes pp 1.00 (art(er, ex)) pp 0.51

Analysisa (S. lepidophylla, S. peruviana)? S. brooksii (br),

S. kerstingii (ke),

S. frondosa (fr)

S. acanthostachys (ac),

S. bombycina (bo), S. erythropus (e

S. haematodes (ha)

rbcL

Parsimony (Fig. 1A) Collapsed (ke(br, fr)) bv 61% (ac(bo(er, ha))) bv 98%, 62%

Bayesian, GTR +C Yes pp 1.00 (ke(br, fr)) pp 0.67 (ac(bo(er, ha))) pp 1.00, 0.88

Bayesian, GTR +C, 3 parts (Fig. 1B) Yes pp 0.99 (ke(br, fr)) pp 0.95 (ac(bo(er, ha))) pp 1.00, 0.84

26S rDNA

Parsimony (Fig. 2A) Yes bv 84% (br, ke, fr) - (er(ac(bo, ha))) bv 74%, 76%

Bayesian, GTR +C+ I (Fig. 2B) Yes pp 1.00 (br(ke, fr)) pp 0.86 (er(ac(bo, ha))) pp 0.89, 0.86

Combined

Parsimony (Fig. 3A) Yes bv 88% (br, ke, fr) - (ac(er(bo, ha))) bv 74%, 67%

Bayesian, GTR +C

+ I Yes pp 1.00 (br(ke, fr)) pp 0.80 (ac(er(bo, ha))) pp 0.99, 0.72Bayesian, GTR+, 2 parts Yes pp 1.00 (br(ke, fr)) pp 0.82 (ac(er(bo, ha))) pp 0.99, 0.73

Bayesian, GTR +C, 4 parts (Fig. 3B) Yes pp 1.00 (br(ke, fr)) pp 0.69 (ac(er(bo, ha))) pp 0.99, 0.87

a See text for a description of the models used in Bayesian inference analyses.b Stability values presented denote the weakest node involved (bvbootstrap value, ppposterior probability).


10/13

rDNA data, when analysed independently or in com-

bination with rbcL, identify a major monophyletic

group uniting all species of Selaginellaceae, except S.

selaginoides, into a clade of rhizophore-bearing species.

The parsimony analysis of only the rbcL data set yielded

no support for this clade due to the inclusion of the

enigmatic species S. sinensis. Support for the rhizo-phoric clade ranged from low (combined analysis, bv

52%) to moderate (26S, bv 67%), but these were higher

than in the previous rbcL study (bv 50%) (Korall and

Kenrick, 2002). Species diversity within the rhizophoric

clade is partitioned into two major subclades, A and B,

neither of which is characterised by a clear morpho-

logical synapomorphy.

Clade A was not resolved in the 26S rDNA parsi-

mony analysis, yielding a basal polytomy in this part of

the tree, but it is comparatively well supported in the

rbcL (bv 88%) and the combined (bv 94%) analyses.

Similarly, there is support for monophyly of the Artic-

ulatae series (excluding S. exaltata), except for in the 26S

parsimony analysis in which relationships are unre-

solved. Monophyly of the small (three species) Austra-

lian/S African subgenus Ericetorum was called into

question in our previous rbcL study (Korall and Ken-

rick, 2002), which found this group to be paraphyletic to

three Madagascan species (Selaginella lyallii, Selaginella

moratii, and Selaginella polymorpha). All analyses unite

the Ericetorum species S. uliginosa and S. gracillima as

sister taxa, but the third species of this subgenus, Se-

laginella pygmaea, seems to be more distantly related.

We were unable to investigate this issue further because

of difficulties encountered in amplifying the 26S rDNA

region for S. pygmaea. Monophyly of subgenus Te-

tragonostachys was not explicitly tested, but it is un-

controversial and has been confirmed in several previous

studies (Korall and Kenrick, 2002; Therrien and Hau-

fler, 2000; Therrien et al., 1999). The sistergroup rela-

tionship between Tetragonostachys (here represented byS. peruviana) and the resurrection plant S. lepidophylla is

supported in all analyses, except for the parsimony

analysis of the reduced rbcL data set in which this

branch collapses. This unresolved topology can be ex-

plained by the reduced number of taxa sampled, because

the relationship is resolved in the 62-taxon analysis.

Support for the S. lepidophyllaS. peruviana clade is

rather high (26S bv 84%, combined bv 88%) and higher

than in the 62-taxon rbcL analysis (bv 70%). Clade B is

found in all analyses, and it has moderate to high sup-

port (rbcL bv 69%, 26S bv 57%, combined bv 86%).

Well-supported subclades include a group of South and

Central American species (S. haematodes, Selaginella

bombycina, Selaginella erythropus, and S. acanthosta-

chys) and a group of southeast Asian species (S.

brooksii, S. kerstingii, and S. frondosa).

The results of the 26S rDNA analysis do not support

monophyly of the dorsal rhizophoric clade. This is a

large group of species identified in the 62-taxon analysis

of rbcL (Korall and Kenrick, 2002). Species in this

group possess a distinctive form of rhizophore devel-

opment that begins on the upper rather than the lower

surface of a branch to produce an aerial root that loops

over to grow downwards. Of the species in this study,

dorsal rhizophores are found in S. peruviana (Tetrag-onostachys), S. lepidophylla, and in the articulate species

(i.e., S. diffusaS. kraussiana in, e.g., Fig. 3A). Support

for this clade was weak in the 62-taxon analysis and it

conflicts with most of the topologies found in this study.

However, support for all of these conflicting topologies

is weak. This relationship would certainly benefit from

further investigation and an expanded sample of species.

4.1. Partition homogeneity test

When combining two data sets of different origins,

such as two genes from different genomes, there is al-

ways the risk of analysing data that do not reflect the

same evolutionary history. We have used the test for

homogeneity among data sets with different origins im-

plemented in PAUP* 4.0 (Swofford, 2002) and described

by Farris et al. (1995) in order to test the null hypothesis

that the two data sets can be considered to be drawn

from the same population. We see this test not as a test

of combinability, but as a tool for recognising that there

may exist differences between the data sets. It does not

prevent us from analyse the combined data set (see e.g.,

Fishbein et al., 2001; Johnson and Whiting, 2002). A

combined analysis, evaluated with caution, may add

Table 5

Mean and Monte Carlo variance of the posterior probabilities found in

the 10 replicates of the Bayesian inference analysis of the 26S rDNA

region

Node in Fig. 2B Posterior

probability, mean

Monte Carlo

variance

1 100.0 0.0

2 83.4 4.5

3 82.3 4.7

4 64.3 12.9

5 62.2 30.4

6 100.0 0.0

7 97.1 0.1

8 99.5 0.3

9 100.0 0.0

10 57.4 30.5

11 100.0 0.0

12 100.0 0.0

13 100.0 0.0

14 64.5 13.2

15 100.0 0.0

16 100.0 0.0

17 91.6 2.0

18 83.0 3.8

19 100.0 0.0

20 86.4 2.3

21 100.0 0.0



11/13

insights to the phylogeny and should not, in our opin-

ion, be avoided. The null hypothesis is rejected

(P 0:016), but the test is not significant if S. sinensis is

excluded (P 0:36). These results are in line with the

different topologies found, where the major differences

concerns the position of S. sinensis, see below.

4.2. Genome and analytical differences

Consistent differences emerged in several areas be-

tween genomes and between methods of analysis. These

were generally found in parts of the tree where branch

support was weak. Incongruence may therefore reflect a

lack of signal or biases in analytical models rather than

fundamentally different evolutionary histories of orga-

nelle genomes. There is only one case in which all plastid

analyses yield one topology, whereas analyses of the

nuclear gene, irrespective of method, yield another one.

This concerns the internal relationships of the South and

Central American clade (S. acanthostachys, S. bomby-

cina, S. erythropus, and S. haematodes) in clade B (Figs.

1 and 2, Table 4). The combined analyses yield a third

topology (Fig. 3). There was no clear rise in indices of

branch support in analyses run on the combined data

set. Where incongruence occurred between genomes or

between analyses of the same genome, the combined

analyses yielded low support. Where the separate anal-

yses yielded the same topology, the branch support

values were high. The posterior probabilities were usu-

ally slightly higher in the combined analyses.

The most conspicuous phylogenetic conflicts con-

cerned the position of S. sinensis, which varied de-pending upon analytical method and gene sequence.

Parsimony analysis of the rbcL gene placed S. sinensis as

sister to a clade containing all other species in the family.

Bayesian inference however moved S. sinensis to posi-

tions within the rhizophoric clade, either as sister to

clade A or clade B. Both parsimony and Bayesian

analyses of the 26S rDNA alone and the combined data

indicated a position within the rhizophoric clade with

five out of six analyses placing S. sinensis as sister to

clade B. A position within the rhizophoric clade is

consistent with comparative morphology. S. sinensis

possesses the distinctive rhizophores as well as the de-

cussately arranged sporophylls that characterise the

rhizophoric clade. We attribute the anomalous result

obtained from maximum parsimony analysis of the rbcL

gene to branch length effects (see below).

Further differences in results that are attributable to

genome or analytical preference involve the position of

S. brooksii with respect to the Asian species S. frondosa

and S. kerstingii (clade B). In this case support is uni-

formly low. The position of S. exaltata is also ambigu-

ous. All analyses resolve the Articulatae series as

paraphyletic. However, none of the hypothesised

relationships for S. exaltata is strongly supported.

The position ofS. exaltata as sister to all other articulate

species (i.e., a monophyletic Articulatae) in the 62-taxon

analysis is also weakly supported.

Because the cases of incongruence outlined above

mainly involve nodes for which branch support is low, it

remains unclear whether the differences are real or just

the consequences of low phylogenetic signal masked bynoisy data. In the case of differences emerging from an-

alytical methods (e.g., relations among articulate species:

S. diffusa, S. lingulata, S. sericea, and S. suavis) there may

be problems with the assumptions underlying either the

maximum parsimony or Bayesian models of analysis. On

the other hand, the between genome differences observed

in the relationships of the South and Central American

species (S. haematodes, S. bombycina, S. erythropus, and

S. acanthostachys) could reflect fundamentally different

evolutionary histories. These species are all closely re-

lated, and in some areas they have sympatric distribu-

tions. Among other explanations, a hybridisation event

with accompanying introgression of chloroplast DNA

should be considered as a possible cause of the perceived

differences in phylogenetic histories.

In the Bayesian inference analysis, multiple Markov

chains were performed to minimise the risk of the al-

gorithm failing to converge. All replicates of each

analysis produced the same topology, and convergence

seems to have been reached. It should be noted that the

posterior probabilities of the different chains vary, with

lower posterior probabilities having a rather high Monte

Carlo variance (Table 5). Posterior probabilities above

97%, on the other hand, are almost constant in all

analyses, with a Monte Carlo variance less than 0.3.Thisstudy, as well as most previouslypublished studies

(see e.g., Douady et al., 2003; Leache and Reeder, 2002;

Smedmark and Eriksson, 2002; Wilcox et al., 2002), show

that the posterior probabilities of the Bayesian inference

analysis tend to be higher than nonparametric bootstrap

values. Simulation studies indicate that the posterior

probabilities tend to be overestimations of phylogenetic

accuracy, whereas bootstrap values tend to be conserva-

tive estimates (Hillis and Bull, 1993; Suzuki et al., 2002).

Wilcox et al. (2002), however, maintain that, based on

their results, the posterior probabilities are underesti-

mates as well, although less so than bootstrap values, and

they advocate the use of posterior probabilities.

Posterior probabilities also have a tendency to yield

high values for false nodes, as seen in simulation studies

where the true phylogeny is known (Douady et al.,

2003; Suzuki et al., 2002). This is especially true when

the chosen model of evolution is inappropriate (Douady

et al., 2003; Suzuki et al., 2002). Huelsenbeck et al.

(2002) also points out the importance of choosing a

correct model of evolution when using Bayesian infer-

ence for reconstructing phylogenies.

Bayesian inference of phylogeny is a rather new

method in phylogenetic reconstruction, with many



12/13

questions still unanswered. The conclusion by Douady

et al. (2003) seems very appropriate at this time: Both

PP and bootstrap supports are of great interest to

phylogeny as potential upper and lower bound of node

support, but they are surely not interchangeable and

cannot be directly compared.

4.3. Exceptional rates of molecular evolution

The results of the 26S rDNA analysis presented here

indicate that the high number of parsimony informative

characters previously observed in the plastid gene rbcL

(Korall and Kenrick, 2002) is to an extent mirrored also

in the nucleus. We found that 37% of the characters

were parsimony informative for rbcL and 26% for the

region of the 26S rDNA included in this study. Typi-

cally, this amount of variation would be associated with

analyses that include much larger numbers of species.

Phylogenetic analyses of 26S rDNA usually exhibit

lower levels of variation than we have observed in Se-

laginellaceae (e.g., Fan and Xiang, 2001; Stefanovic

et al., 1998). In an analysis of 147 species of angiosperms

Nandi et al. (1998) found that 40% of rbcL sites were

parsimony informative, and in a larger 357 species

analysis Savolainen et al. (2000) found 52% parsimony

informative characters. Another feature of the rbcL tree

is that branch length is unevenly distributed: there are

far more substitutions in clade Aa fast cladethan in

clade Ba slow clade (see Fig. 2 in Korall and Kenrick,

2002). Some branches are also extremely long, such as

the 155 character long terminal branch leading to S.

sinensis in the 62-taxon analysis (Korall and Kenrick,2002). This extreme branch length variation is not,

however, a feature of the 26S rDNA, in which the

number of substitutions are distributed more evenly

throughout the family. Both genes, therefore, have large

numbers of substitutions but the imbalance in the dis-

tribution of these substitutions is found only in rbcL.

The extraordinary large number of substitutions in

Selaginellaceae is most probably due to an elevated sub-

stitution rate, and the new evidence from the nuclear 26S

rDNA indicates that this is a phenomenon that is not

localised to the plastid. High substitution rates have been

observed in other regions as well. Unpublished data in-

dicate that within the chloroplast, not only the rbcL gene

but also atpB have a high substitution rate. Besides 26S

rDNA, the nuclear 18S rDNA region seems to evolve

quickly in Selaginellaceae compared to other land plants

(Kranz and Huss, 1996). The high rates of substitution in

Selaginellaceae are most likely not an effect of its long

evolutionary history. Although the family has ancient

origins dating back to the beginning of the Carboniferous

Period (Thomas, 1992, 1997) high rates of substitution

are not seen within and among closely related similarly

ancient groups such as Lycopodiaceae (Wikstrom and

Kenrick, 1997) and Isoetaceae (Rydin and Wikstrom,

2002). Furthermore, branch length heterogeneity within

the family itself (see Fig. 2 in Korall and Kenrick, 2002),

can not be explained simply by an ancient origin.

High substitution rates in plant genes are likely to

have a variety of causes, none of which is very well

understood (Muse, 2000). They will depend upon whe-

ther the rate differences are coupled to a specific gene, toa genome, or correlated in all three genomes (chloro-

plast, mitochondrion, and nucleus). Several plausible

mechanisms have been proposed (e.g., accuracy of DNA

replication, generation time, speciation rate, and popu-

lation size (Andreasen and Baldwin, 2001; Barraclough

and Savolainen, 2001; Bousquet et al., 1992; Britten,

1986; Gaut et al., 1996; Muse, 2000, and references

therein)), but the extent to which these mechanisms are

active individually or how they might interact to elevate

rates is very poorly understood. With its elevated and

heterogeneous rates of base substitution, Selaginellaceae

might provide a good model to study the relationship

between rate heterogeneity and gene function within and

among plant genomes and plant groups.

Acknowledgments

The authors thank Catarina Rydin for providing to-

tal DNA extract of Isoetes andina, and Mari Kallersjo,

PO Karis, and Johan Nylander for valuable comments

on the manuscript. This work was financially supported

by the Swedish Natural Science Research Council (NFR

research grant to Paul Kenrick and PO Karis: B 1393/

1999), and the foundation Lars Hiertas minne (grant

to Petra Korall).

References

Albert, V.A., Mishler, B.D., 1992. On the rationale and utility of

weighting nucleotide sequence data. Cladistics 8, 7383.

Andreasen, K., Baldwin, B.G., 2001. Unequal evolutionary rates

between annual and perennial lineages of checker mallows (Sidal-

cea, Malvaceae): evidence from 18S-26S rDNA internal and

external transcribed spacers. Mol. Biol. Evol. 18, 936944.

Barraclough, T.G., Savolainen, V., 2001. Evolutionary rates and

species diversity in flowering plants. Evolution 55, 677683.Bousquet, J., Strauss, S.H., Doerksen, A.H., Price, R.A., 1992.

Extensive variation in evolutionary rate of rbcL gene sequences

among seed plants. Proc. Natl. Acad. Sci. USA 89, 78447848.

Bremer, K., 1988. The limits of amino acid sequence data in

angiosperm phylogenetic reconstruction. Evolution 42, 795803.

Britten, R.J., 1986. Rates of DNA sequence evolution differ between

taxonomic groups. Science 231, 13931398.

DiMichele, W.A., Skog, J.E., 1992. The Lycopsida: a symposium.

Ann. Mo. Bot. Gard. 79, 447449.

Donoghue, M.J., Olmstead, R.G., Smith, J.F., Palmer, J.D., 1992.

Phylogenetic relationships of Dipsacales based on rbcL sequences.

Ann. Mo. Bot. Gard. 79, 333345.

Douady, C.J., Delsuc, F., Boucher, Y., Doolittle, W.F., Douzery,

E.J.P., 2003. Comparison of Bayesian and maximum likelihood



13/13

bootstrap measures of phylogenetic reliability. Mol. Biol. Evol. 20,

248254.

Eriksson, T., 1999. AutoDecay Hypercard Program Distributed by the

Author. Bergius Foundation, Royal Swedish Academy of Sciences,

Stockholm.

Fan, C., Xiang, Q.-Y., 2001. Phylogenetic relationships within Cornus

(Cornaceae) based on 26S rDNA sequences. Am. J. Bot. 88, 1131

1138.

Farris, J.S., Kallersjo, M., Kluge, A.G., Bult, C., 1995. Testing

significance of incongruence. Cladistics 90, 315319.

Felsenstein, J., 1985. Confidence limits on phylogenies: an approach

using the bootstrap. Evolution 39, 783791.

Fishbein, M., Hibsch-Jetter, C., Soltis, D.E., Hufford, L., 2001.

Phylogeny of Saxifragales (Angiosperms, Eudicots): analysis of a

rapid, ancient radiation. Syst. Biol. 50, 817847.

Gaut, B.S., Morton, B.R., McCaig, B.C., Clegg, M.T., 1996. Substi-

tution rate comparisons between grasses and palms: synonymous

rate differences at the nuclear gene Adh parallel rate differences at

the plastid gene rbcL. Evolution 93, 1027410279.

Holmgren, P.K., Holmgren, N.H., Barnett, L.C., 1990. Index Herbar-

iorum 1: The herbaria of the world. Greuter W, Regnum

Vegetabile. New York Botanical Garden, New York.

Hillis, D.M., Bull, J.J., 1993. An empirical test of bootstrapping as a

method for assessing confidence in phylogenetic analysis. Syst.

Biol. 42, 182192.

Huelsenbeck, J.P., Larget, B., Miller, R.E., Ronquist, F., 2002.

Potential applications and pitfalls of Bayesian inference of

phylogeny. Syst. Biol. 51, 673688.

Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of

phylogenetic trees. Bioinformatics 17, 754755.

Jermy, A.C., 1986. Subgeneric names in Selaginella. Fern Gaz. 13,

117118.

Johnson, K.P., Whiting, M.F., 2002. Multiple genes and the mono-

phyly of Ischnocera (Insecta: Phthiraptera). Mol. Phylogenet. Evol

22, 101110.

Kenrick, P., Crane, P.R., 1997. The Origin and Early Diversification of

Land Plants: A Cladistic Study. Smithsonian Institution Press,

Washington.Korall, P., Kenrick, P., 2002. Phylogenetic relationships in selaginell-

aceae based on rbcL sequences. Am. J. Bot. 89, 506517.

Korall, P., Kenrick, P., Therrien, J.P., 1999. Phylogeny of Selaginell-

aceae: evaluation of generic/subgeneric relationships based onrbcL

gene sequences. Int. J. Plant Sci. 160, 585594.

Kranz, H.D., Huss, V.A.R., 1996. Molecular evolution of pterido-

phytes and their relationships to seed plants: evidence from

complete 18S rRNA gene sequences. Plant Syst. Evol. 202, 111.

Kuzoff, R.K., Sweere, J.A., Soltis, D.E., Soltis, P.S., Zimmer, E.A.,

1998. The phylogenetic potential of entire 26S rDNA sequences in

plants. Mol. Biol. Evol. 15, 251263.

Lanave, C., Preparata, G., Saccone, C., Serio, G., 1984. A new method

for calculating evolutionary substitution rates. J. Mol. Evol. 20,

8693.

Leach

e, A.D., Reeder, T.W., 2002. Molecular systematics of the easternfence lizard (Sceloporus undulatus): a comparison of parsimony,

likelihood, and Bayesian approaches. Syst. Biol. 51, 4468.

Manhart, J.R., 1994. Phylogenetic analysis of green plant rbcL

sequences. Mol. Phylogenet. Evol. 3, 114127.

Muse, S.V., 2000. Examining rates and patterns of nucleotide

substitution in plants. Plant Mol. Biol. 42, 2543.

Nandi, O.I., Chase, M.W., Endress, P.K., 1998. A combined cladistic

analysis of angiosperms using rbcL and non-molecular data. Ann.

Mo. Bot. Gard. 85, 137212.

Nylander, J.A.A., 2002. MrModeltest. Version 1.0b. Computer pro-

gram distributed by the author. Department of Systematic Zool-

ogy, Uppsala University, Uppsala, Sweden.

Ohyama, K., Fukuzawa, H., Kohchi, T., Shirai, H., Sano, T., Sano, S.,

Umesono, K., Shiki, Y., Takeuchi, M., Chang, Z., Aota, S.,

Inokuchi, H., Ozeki, H., 1986. Chloroplast gene organization

deduced from the complete sequence of the liverwort Marchantia

polymorpha chloroplast DNA. Nature 322, 572574.

Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of

DNA substitution. Bioinformatics 14, 817818.

Rambaut, A.,1996. SeAl, sequencealignmenteditor.Version 1.0alpha

1. Department of Zoology, University of Oxford, Oxford, UK.

Rodrguez, F., Oliver, J.L., Marn, A., Medina, J.R., 1990. The general

stochastic model of nucleotide substitution. J. Theor. Biol. 142,

485501.

Rydin, C., Wikstrom, N., 2002. Phylogeny of Isoetes (Lycopsida):

resolvingbasal relationships using rbcL sequences. Taxon 51, 8389.

Savolainen, V., Chase, M.W., Hoot, S.B., Morton, C.M., Soltis, D.E.,

Bayer, C., Fay, M.F., De Bruijn, A.Y., Sullivan, S., Qiu, Y.-L.,

2000. Phylogenetics of flowering plants based on combined analysis

of plastid atpB and rbcL gene sequences. Syst. Biol. 49, 306362.

Smedmark, J.E.E., Eriksson, T., 2002. Phylogenetic relationships of

Geum (Rosaceae) and relatives inferred from the nrITS and trnL-

trnF regions. Syst. Bot. 27, 303317.

Staden, R., 1996. The Staden sequence analysis package. Mol.

Biotechnol. 5, 233241.

Stefanovic, S., Jager, M., Deutsch, J., Broutin, J., Masselot, M., 1998.

Phylogenetic relationships of conifers inferred from partial 28S

rRNA gene sequences. Am. J. Bot. 85, 688697.

Sugiura, M., Iida, Y., Oono, K., Takaiwa, F., 1985. The complete

nucleotide sequence of a rice 25S rRNA gene. Gene 37, 255259.

Suzuki, M., Glazko, G.V., Nei, M., 2002. Overcredibility of molecular

phylogenies obtained by Bayesian phylogenetics. Proc. Natl. Acad.

Sci. USA 99, 1613816143.

Swofford, D.L., 2002. PAUP*: Phylogenetic Analysis Using Parsi-

mony (*and Other Methods). Version 4. Sinauer Associates,

Sunderland, MA.

Tavare, S., 1986. Some probabilistic and statistical problems on the

analysis of DNA sequences. Lect. Math. Life Sci. 17, 5786.

Therrien, J.P., Haufler, C.H., 2000. Phylogeny and biogeography of

Selaginella subg. Tetragonostachys based on nuclear ribosomal ITS

sequence data. Am. J. Bot. 87, 98.

Therrien, J.P., Haufler, C.H., Korall, P., 1999. Phylogeny andbiogeography of Selaginella subg. Tetragonostachys. In XVI

International Botanical Congress, abstracts. 120. St Louis, USA.

Thomas, B.A., 1992. Paleozoic herbaceous lycopsids and the begin-

nings of extant Lycopodium sens. lat. and Selaginella sens. lat. Ann.

Mo. Bot. Gard. 79, 623631.

Thomas, B.A., 1997. Upper Carboniferous herbaceous lycopsids. Rev.

Palaeobotan. Palynol. 95, 129153.

Wikstrom, N., 2001. Diversification and relationships of extant

homosporous lycopods. Am. Fern J. 91, 150165.

Wikstrom, N., Kenrick, P., 1997. Phylogeny of Lycopodiaceae

(Lycopsida) and the relationships of Phylloglossum drummondii

Kunze based on rbcL sequences. Int. J. Plant Sci. 158, 862871.

Wikstrom, N., Kenrick, P., 2000a. Phylogeny of epiphytic Huperzia

(Lycopodiaceae): paleotropical and neotropical clades corrobo-

rated by rbcL sequences. Nordic J. Bot. 20, 165171.Wikstrom, N., Kenrick, P., 2000b. Relationships of Lycopodium and

Lycopodiella based on combined plastid rbcL gene and trnL intron

sequence data. Syst. Bot. 25, 495510.

Wikstrom, N., Kenrick, P., 2001. Evolution of Lycopodiaceae (Lyc-

opsida): estimating divergence times from rbcL gene sequences by

use of nonparametric rate smoothing. Mol. Phylogenet. Evol. 19,

177186.

Wikstrom, N., Kenrick, P., Chase, M., 1999. Epiphytism and

terrestrialization in tropical Huperzia (Lycopodiaceae). Plant Syst.

Evol. 218, 221243.

Wilcox, T.P., Zwickl, D.J., Heath, T.A., Hillis, D.M., 2002. Phyloge-

netic relationships of the dwarf boas and a comparison of Bayesian

and bootstrap measures of phylogenetic support. Mol. Phylogenet.

Evol. 25, 361371.


Documents

Korall===Phylogenetic History of Selaginellaceae===26S rDNA + RbcL