View
0
Download
0
Category
Preview:
Citation preview
1
The Vps/VacJ (Mla) ABC Transporter is required for intercellular 1
spread of Shigella flexneri 2
3
4
Chandra D. Carpentera 5
Benjamin J. Cooleyc 6
Brittany D. Needhama 7
Carolyn R. Fishera 8
M. Stephen Trentab 9
Vernita Gordonbc 10
Shelley M. Payneab* 11
12
aDepartment of Molecular Biosciences and bInstitute for Cellular and Molecular 13
Biology and cDepartment of Physics 14
University of Texas at Austin 15
Austin, TX 78712 16
17
* Corresponding author. Mailing address: Department of Molecular Biosciences, 18
1 University Station G2500, Austin, TX 78712. Phone: (512) 471-5204. Fax: 19
(512) 471 7088. E-mail: smpayne@austin.utexas.edu 20
21 22 Running title: vps (mla) is required for Shigella virulence 23
IAI Accepts, published online ahead of print on 25 November 2013Infect. Immun. doi:10.1128/IAI.01057-13Copyright © 2013, American Society for Microbiology. All Rights Reserved.
2
Abstract 24
The Vps/VacJ ABC transporter system is proposed to function in maintaining the 25
lipid asymmetry of the outer membrane. Mutations in vps or vacJ in Shigella 26
flexneri resulted in increased sensitivity to lysis by the detergent sodium dodecyl 27
sulfate (SDS), and the vpsC mutant showed minor differences in its phospholipid 28
profile compared to the wild type. vpsC mutants were unable to form plaques in 29
cultured epithelial cells, but this was not due to failure to invade, to replicate 30
intracellularly or to polymerize actin via IcsA for movement within the epithelial 31
cells. The addition of the outer membrane phospholipase gene, pldA, on a multi-32
copy plasmid in a vpsC or vacJ mutant restored its resistance to SDS, 33
suggesting a restoration of lipid asymmetry to the outer membrane. However, the 34
pldA plasmid did not restore the mutant’s ability to form plaques in tissue culture 35
cells. Increased PldA also failed to restore the mutant’s phospholipid profile to 36
that of wild type. We propose a dual function of the Vps/VacJ ABC transporter 37
system in S. flexneri in both maintenance of lipid asymmetry in the outer 38
membrane and a role in the intercellular spread of the bacteria between adjacent 39
epithelial cells. 40
41
3
Introduction 42
Shigella flexneri is the causative agent of bacillary dysentery in humans. 43
The bacteria invade the colonic epithelium, replicate intracellularly, and spread 44
cell-to-cell, provoking the acute inflammatory response that is characteristic of 45
the disease (1). While much is known about the initial invasion of epithelial cells 46
by Shigella, less is understood about the requirements for intracellular replication 47
and intercellular spread. 48
Many of the genes required for pathogenesis of S. flexneri are encoded on 49
a large plasmid (2, 3). Plasmid-encoded virulence factors include the invasion 50
plasmid antigen (Ipa) effector proteins required for S. flexneri to enter the host 51
cell and escape from the vacuole (4–6). These effector proteins are secreted by 52
a type III secretion system (TTSS) that is also encoded on the virulence plasmid. 53
When the effectors contact the epithelial cell, they induce cytoskeletal changes 54
leading to internalization of the bacteria (7, 8). Once engulfed by the epithelial 55
cell, the bacteria lyse the vacuole and replicate inside the cytosol of the host cell 56
(6). 57
Within the host cell cytoplasm, S. flexneri uses another virulence plasmid-58
encoded protein, IcsA, to polymerize actin at one pole of the cell resulting in the 59
propulsion of the bacteria throughout the host cell (9, 10). This actin-based 60
motility also promotes movement of the bacteria into adjacent epithelial cells. 61
Intercellular movement results in S. flexneri cells being surrounded by a double 62
membrane, one from the cell it is exiting and another from the membrane of the 63
cell it is entering (11). The secreted effector proteins are required for the bacteria 64
4
to escape this double membrane-bounded vacuole, and, once free in the 65
cytoplasm, the bacteria repeat the cycle of replication and intercellular spread 66
(12, 13). 67
An understanding of the mechanisms of invasion and spread of S. flexneri 68
has been facilitated by the use of cultured cells. When the wild-type bacteria are 69
added to a monolayer of cultured cells, they invade and replicate in the 70
cytoplasm. The initial invasion steps can by assayed by staining and visualizing 71
the bacteria within infected cells (14, 15). Replication in the cytoplasm and 72
subsequent intercellular spread can be assessed by a plaque assay, in which the 73
spread of the bacteria to adjacent cells over a period of several days results in 74
the localized destruction of the monolayer and the formation of plaques in the 75
monolayer (16). Mutants that are defective in the TTSS or secreted effectors, fail 76
to invade the cells (5, 17–21), while those that are defective in genes required for 77
intracellular growth or actin polymerization are invasive, but fail to form plaques 78
(9, 22–24). 79
In a screen for S. flexneri mutants that invaded mammalian cells but failed 80
to form plaques, we identified vpsC, which encodes a cytoplasmic membrane 81
protein (25). vpsC is in a putative operon with vpsA (predicted to encode an ABC 82
transporter), vpsB (predicted to encode an integral membrane protein), yrbC, 83
and yrbB (Fig. 1A) (25). Mutation of vpsC or vpsA resulted in loss of the ability to 84
form plaques in cultured cells; however, the mutants invaded at wild-type levels, 85
suggesting a defect in intracellular growth or cell-to-cell spread (25). Suzuki et 86
al. (26) had observed a similar phenotype for an S. flexneri vacJ mutant. While 87
5
the S. flexneri vacJ gene is not part of the vps operon, it is predicted to be part of 88
the Vps/VacJ ABC transporter system, since it is found in an operon with vps 89
homologs in other bacteria (27). 90
In addition to the defect in plaque formation, the S. flexneri vpsA and vpsC 91
mutants were more sensitive to sodium dodecyl sulfate (SDS) than wild-type S. 92
flexneri, suggesting an increase in outer membrane permeability of the mutants 93
(25). Greater sensitivity of the vpsC mutant to SDS did not appear to be due to 94
changes in the lipopolysaccharide (LPS) structure since the mutant had the same 95
LPS distribution as wild-type bacteria (25). 96
Malinverni et al. (28) analyzed the Escherichia coli homologs of the vps 97
genes and found that, similar to S. flexneri, a mutation in any of the vps/vacJ 98
ABC transporter genes resulted in increased sensitivity to SDS. By searching for 99
spontaneous mutations that restored SDS resistance, they discovered that 100
increased transcription of the outer membrane phospholipase gene pldA 101
suppressed the SDS sensitivity of the mutants. 102
PldA encodes phospholipase A (29, 30), which is thought to help maintain 103
the asymmetry of the outer membrane of Gram-negative bacteria by hydrolyzing 104
excess phospholipids in the outer leaflet (31). The outer membrane has LPS in 105
the outer leaflet, while the phospholipids are in the inner leaflet (32). 106
Phospholipid accumulation in the outer leaflet of the outer membrane decreases 107
the integrity of the outer membrane (33). Malinverni et al. (28) characterized the 108
effect of vps/vacJ mutations on the outer leaflet of the outer membrane, by using 109
the enzymatic activity of PagP, an outer membrane protein that is only active 110
6
when phospholipids are in the outer leaflet of the outer membrane (34), as a 111
reporter to assess the relative amounts of phospholipids in the outer leaflet (35, 112
36). The data from Malinverni et al. indicated an increase in phospholipids in the 113
outer leaflet of the outer membrane of the vps/vacJ mutants, which was reduced 114
by the presence of pldA on a multi-copy plasmid (28). Based on these 115
observations, Malinverni et al. proposed that the function of the vps/vacJ ABC 116
transport system is to maintain lipid asymmetry in Gram-negative outer 117
membranes and renamed the genes mlaA (vacJ), mlaB (yrbB), mlaC (yrbA), 118
mlaD (vpsC), mlaE (vpsB), mlaF (vpsA) (Figure 1A) for their role in maintenance 119
of outer membrane lipid asymmetry (28). 120
In this report, we demonstrate that the failure of a S. flexneri vpsC mutant 121
to form plaques in epithelial cell monolayers is due to an inability to spread 122
between cells but not due to an inability to replicate inside the cell or an inability 123
to polymerize actin at one pole for use in motility. To determine if membrane 124
instability is responsible for the inability of the S. flexneri vpsC (mlaD) mutant to 125
spread from cell to cell, we show that while introduction of a plasmid carrying 126
pldA suppresses the SDS sensitivity of the S. flexneri vpsC mutant, it did not 127
restore plaque formation in epithelial cell monolayers, nor did it restore the 128
phospholipid profile of the vpsC mutant to wild type. We propose that the 129
vps/vacJ system is required for intercellular spread of S. flexneri in addition to its 130
role in maintaining lipid asymmetry in the outer membrane. 131
132
7
Materials and Methods 133
Bacterial strains and growth conditions. All strains and plasmids used 134
in this study are listed in Table 1. S. flexneri was streaked onto Congo red agar 135
(Tryptic soy broth, 1.5% agar, 0.01% (wt/vol) Congo red dye (Sigma Chemical 136
Co., St. Louis, MO)), and Congo red binding colonies (Crb+) were selected (37). 137
Bacteria were grown in Luria-Bertani broth (LB) or on LB-agar at 37°C. 138
Antibiotics were used at following concentrations: 25 μg of ampicillin per ml and 139
50 μg of kanamycin per ml. 140
Construction of S. flexneri mutants. The S. flexneri pldA mutant was 141
created by bacteriophage P1 transduction of the pldA::kan allele from E. coli 142
strain JW3794 (Keio collection) (38) into S. flexneri strain SA100. The pldA 143
mutation was verified via PCR. 144
Recombinant DNA techniques. Primers used in this study are listed in 145
Table 2. Plasmids for expression of pldA, vpsC, and vpsABC (pPldA, pVpsC, 146
and pVpsABC, respectively) were constructed by amplifying the wild-type genes 147
from S. flexneri strain, SA100, using the indicated primers and ligating the 148
resulting PCR fragment into the SmaI site of pWKS30 (39). Primers pldAF and 149
pldAR were used to amplify pldA. Primers vpsAF and vpsCDR were used to 150
amplify vpsABC. pVacJ was constructed by amplifying the wild-type vacJ gene 151
from S. flexneri strain SA100 using primers vacJF and vacJR and ligating the 152
PCR fragment into pWKS30 digested with PstI and XhoI. Plasmid inserts were 153
sequenced at the University of Texas at Austin DNA sequencing facility using an 154
ABI 3130 sequencer (Applied Biosystems, Grand Island, New York). 155
8
SDS-EDTA sensitivity assays. SDS-EDTA sensitivity assays were 156
performed as described in Malinverni et al. (28). Briefly, S. flexneri cultures were 157
grown to mid-log phase (OD650 of 0.5-0.8). Two microliters of serial dilutions 158
were spotted onto L agar containing 0.1 or 0.25% SDS and 0.55 mM EDTA. The 159
plates were incubated overnight at 37°C. 160
Cell culture media and growth conditions. Henle cells (intestinal 407; 161
American Type Culture Collection, Manassas, VA) were cultured in minimal 162
essential medium (MEM; Gibco, Grand Island, NY) supplemented with 10 % 163
Bacto tryptone phosphate broth (Difco, Becton Dickinson and Company, Franklin 164
Lakes, NJ), 10 % fetal bovine serum (Gibco, Grand Island, NY), 2 mM glutamine, 165
and 1 X nonessential amino acids (Gibco, Grand Island, NY). Henle cells were 166
incubated at 37°C with 5% CO2. 167
Cell culture assays. Invasion assays were performed as described in 168
Hale and Formal (15) with the following modifications: Crb+ colonies were 169
inoculated into LB and grown overnight at 30°C with aeration, then diluted 1:50 or 170
1:100 into LB and grown at 37°C with aeration to mid-log phase (OD650 0.5-0.9). 171
Next, 2 x 108 bacteria were added to semi-confluent monolayers of Henle cells in 172
35-mm, 6-well, polystyrene plates (Corning, Corning, NY) and centrifuged for 10 173
min at 1000 x g. The plates were incubated at 37°C with 5% CO2 for 30 min then 174
washed 4 times with 2 ml of phosphate buffered saline (PBS-D: 1.98 g KCl, 8 g 175
NaCl, 0.02 g KH2PO4, K2HPO4), and 2 ml of MEM supplemented with 40 μg of 176
gentamycin per ml was added. The monolayers were incubated an additional 40 177
minutes, washed with PBS-D, and stained with Wright-Giemsa stain (Camco, Ft. 178
9
Lauderdale, FL). The infected Henle cells were visualized by bright-field 179
microscopy at 1000X magnification. Invasion rates were calculated by counting 180
at least 300 Henle cells per well and scoring those Henle cells with 3 or more 181
internal bacteria as positive for invasion. 182
Plaque assays were performed as described by Oaks et al. (16). Briefly, 183
103 to 105 bacteria were added to confluent monolayer of Henle cells in 35-mm, 184
6-well, polystyrene plates. The monolayers were incubated for 90 min at 37°C 185
with 5% CO2, washed with PBS-D, then overlaid with MEM containing 0.45% 186
(wt/vol) glucose and 20 μg gentamycin per ml. After incubation for 24 hours, the 187
medium was replaced with MEM containing only 20μg of gentamycin per ml and 188
the plates were incubated for another 48 hours before being washed with PBS-D 189
and stained with Wright-Giemsa stain. 190
Cell-to-cell spread assays were performed similar to invasion assays, 191
except the inoculum was 2 x 107 bacteria and the monolayers were incubated for 192
3 hours and 30 minutes after addition of MEM containing 20 μg of gentamycin 193
per ml. Cell-to-cell spread rates were calculated by counting 100 infected Henle 194
cells in close association with other Henle cells and scoring them as positive for 195
spread if any of the surrounding Henle cells also contained 3 or more internal 196
bacteria. 197
Intracellular bacteria were recovered as described by Hong et al. (25). 198
Briefly the cell monolayers were detached with trypsin (0.025% [wt/vol]) and 199
lysed using 0.5% sodium deoxycholate (DOC). The lysate was plated on tryptic 200
soy agar plates to determine bacterial CFU. Prior to lysis, the number of Henle 201
10
cells recovered was determined using a hemocytometer. The bacterial CFU per 202
infected Henle cell was calculated as total bacterial CFU/ total number of Henle 203
cells multiplied by the invasion rate. 204
Intracellular replication assays were performed similar to invasion assays, 205
except the monolayer was lysed at specific time intervals after the addition of 206
MEM containing 20 μg of gentamycin per ml. The intracellular bacteria were 207
recovered by detaching the Henle cell monolayers with trypsin (0.025% [wt/vol]), 208
centrifuging the cells at 12,000 x g for 5 minutes, and lysing the Henle cells in 209
distilled, deionized water. The lysate was plated on tryptic soy agar plates to 210
determine bacterial CFU. 211
Isolation and analysis of lipid species from 32Pi-labeled cells. Bacteria were 212
grown in the presence of 2.5 µCi/ml 32Pi to an OD650 of ~1.0 in LB. Both lipid A 213
and phospholipids were extracted by the method of Bligh and Dyer (40) and 214
spotted onto a Silica Gel 60 thin-layer chromatography plate as previously 215
described (41, 42). Phospholipids (50,000 counts/sample) were separated by 216
TLC using of chloroform, methanol, and acetic acid (65:25:10, vol/vol) solvent 217
system. Lipid A species (10,000 counts/sample) were separated using 218
chloroform, pyridine, formic acid, water (50:50:16:5, vol/vol). The TLC plates 219
were exposed overnight to a PhosphorImager screen, and lipids were detected 220
using a Bio-Rad Molecular Imager PhosphorImager equipped with Quantity One 221
software, which was used for densitometry quantification. 222
11
Polymerized Actin Staining. Henle cells grown on coverslips were 223
infected with S. flexneri strains containing the gfp-expressing plasmid pMRP9-1 224
(43) for 30 minutes at 37°C in 5% CO2. The monolayer was washed 4 times with 225
PBS-D, and medium containing 40 μg of gentamycin per ml was then added to 226
the monolayers. After incubating at 37°C in 5% CO2 for 1 hour, the monolayer 227
was washed 3 times with PBS-D. The Henle cells were fixed with 4% 228
paraformaldehyde for 5 minutes at room temperature and then permeabilized 229
with 0.1% (vol/vol) Triton X-100 for 5 minutes at room temperature. After 230
blocking in 1% bovine serum albumin (BSA) in PBS-D for 20 minutes, 50 μl of 0.2 231
μg/ml phalloidin-TRITC (Sigma-Aldrich, St. Louis, MO) was added to the 232
coverslip. After incubation for 20 minutes, the coverslip was washed and 233
mounted on a clean glass slide treated with Vectashield (Vector Laboratories, 234
Burlingame, CA). Fluorescence microscopy was performed with an Olympus 235
FluoView FV1000 confocal laser scanning microscope (CLSM) (Tokyo, Japan). 236
Images were obtained with a 60x, 1.42 N.A. oil-immersion objective. Images were 237
processed using ImageJ software (44). Images represent a Z projection of 238
average intensities. 239
240
12
Results 241
Increased pldA expression suppressed the SDS sensitivity of the vpsC and 242
vacJ mutants 243
Because the SDS sensitivity of the E. coli mlaD mutant was suppressed 244
by increasing the amount of the outer membrane phospholipase PldA (28), we 245
determined whether PldA would have the same effect in S. flexneri containing a 246
mutation in the mlaD homolog vpsC. To determine the sensitivity to detergent of 247
the mutants and wild type, bacterial cultures were diluted and spotted onto LB 248
agar plate containing SDS and EDTA (Fig. 1B). To control for the number of 249
bacteria added per spot, we spotted each dilution on LB agar plate that did not 250
contain SDS or EDTA (Fig. 1C). The vpsC mutant was more sensitive to SDS-251
EDTA than wild type (Fig. 1B, compare lane 2 to the wild type in lane 1), as we 252
had shown previously (25), and this sensitivity to SDS-EDTA was complemented 253
with the addition of vpsABC on a multi-copy plasmid (pVpsABC) (Fig. 1B, 254
compare lane 3 to lane 1). The SDS sensitivity of the S. flexneri vacJ mutant 255
(mlaA homolog) had not been determined previously. Therefore, the vacJ 256
mutant was included in the assay, and, it was shown to be more sensitive to 257
SDS-EDTA than wild type (Fig. 1B, compare lane 5 to the wild type in lane 1). 258
The addition of vacJ on a multi-copy plasmid (pVacJ) restored the vacJ mutant’s 259
sensitivity to SDS-EDTA to that of wild type (Fig. 1B, compare lane 6 to lane 1). 260
The SDS-EDTA sensitivity of S. flexneri carrying a mutation in pldA was also 261
determined. The pldA mutant was as sensitive to SDS-EDTA as wild type (Fig. 262
1B, compare lane 8 to lane 1). 263
13
pPldA, carrying S. flexneri pldA with its putative promoter downstream of 264
the lac promoter, was introduced into the vpsC mutant and the effect on 265
detergent sensitivity was determined (Fig. 1B). The presence of pPldA restored 266
SDS-EDTA resistance of the vpsC mutant to that of wild-type S. flexneri 267
(compare lane 4 to lane 1). The SDS-sensitivity of the vacJ mutant, like the vpsC 268
mutant, was suppressed by pPldA (compare lanes 5 and 7). The results of the 269
SDS-sensitivity assay indicate that an increase in PldA in S. flexneri, as in E. coli, 270
suppresses the increased sensitivity to SDS of vpsC and vacJ mutants. 271
272
Increased pldA did not restore plaque formation to vpsC or vacJ 273
If the inability of the S. flexneri vpsC and vacJ mutants to form plaques in 274
cell monolayers is due to increased outer membrane permeability within the 275
cytoplasm of the host cell, then reducing permeability by increasing PldA should 276
also suppress the plaque defect. To determine this, we performed plaque 277
assays with the vpsC and vacJ mutants containing either the vector, pWKS30, or 278
pPldA (Fig. 2). As expected, based on previous data (25, 26), neither the vpsC 279
mutant nor the vacJ mutant formed plaques in cultured cell monolayers. The 280
plaque-minus defect of the vpsC mutant was complemented by the addition of 281
pVpsABC (Fig.2). The plaque-minus defect of the vacJ mutant was 282
complemented by the addition of pVacJ (Fig.2). The plaque-minus defect of both 283
the vpsC and the vacJ mutants was not suppressed by the presence of the 284
plasmid carrying pldA (Fig. 2). It was possible that over-expression of pldA 285
interfered with plaque formation. Therefore, the wild-type strain, SA100, was also 286
14
transformed with pPldA to determine adverse effects of the plasmid. 287
SA100/pPldA formed wild-type plaques (Fig.2), indicating that the failure of pPldA 288
to suppress the plaque-minus defect of the vpsC and vacJ mutants was not due 289
to elevated PldA inhibiting plaque formation. These data showed that while the 290
increase in PldA is sufficient to restore SDS sensitivity, it does not overcome the 291
defect responsible for the inability of the mutants to form plaques. 292
It is possible that pPldA might not be able to compensate for the 293
deleterious effects of the vpsC mutant on membrane stability in the intracellular 294
environment. We had previously observed that the vpsC mutant was recovered 295
in much smaller numbers from detergent-lysed Henle cells than from wild type 296
(25). However, an in vitro-grown vpsC mutant treated with the same amount of 297
detergent (25) had a similar survival rate as wild type, suggesting that the 298
intracellular environment might exacerbate the membrane permeability of the vps 299
mutants. pPldA may not be able to suppress the detergent sensitivity of an 300
intracellular vpsC mutant due to an increase in permeability of the bacteria in 301
response to the intracellular environment. To determine if pPldA is capable of 302
suppressing the detergent sensitivity of the intracellular vpsC mutant infected 303
Henle cells were lysed in the presence of detergent. The lysate was plated onto 304
agar medium and the number of bacteria recovered per infected Henle cell was 305
calculated. As we had observed previously (25), there were significantly fewer 306
vpsC mutant bacteria recovered from the infected cells when the monolayers 307
were lysed with detergent as compared to wild type (Fig. 3). This difference in 308
recovery in the presence of detergent was suppressed when the vpsC mutant 309
15
carried pPldA. This indicates that the presence of pPldA is sufficient to maintain 310
the integrity of the outer membrane of the vpsC mutant in the intracellular 311
environment. 312
Although the presence of pPldA was not sufficient to overcome the 313
virulence defect of the vpsC and vacJ mutants, PldA could have a role in 314
maintaining lipid asymmetry and integrity of the outer membrane of intracellular 315
S. flexneri. Therefore, the effect of a pldA mutation on plaque formation by S. 316
flexneri was tested. The pldA mutant formed wild-type plaques in the monolayer 317
(Fig. 2), indicating that the role of PldA in maintaining lipid asymmetry is not 318
required for S. flexneri to spread cell-to-cell. 319
Increased PldA reduces palmitoylated lipid A, but not lyso-320
phosphatidylethanolamine to wild-type levels 321
Because increased PldA did not restore the vpsC mutant’s ability to form 322
plaques, it was likely that there were differences in the vpsC outer membrane 323
that were not suppressed by increased PldA. To further characterize the 324
membrane, we analyzed the phospholipids and lipid A of the wild type and 325
mutant. As shown in Fig. 4A, the major phospholipid species in the vpsC mutant 326
were similar to wild type. This is expected as the amount of phospholipids in the 327
outer leaflet of the outer membrane would only be a small portion of the total 328
phospholipids. Phospholipids in the outer leaflet are cleaved by PagP, which 329
transfers a palmitate residue from the sn-1 position of the phospholipid onto lipid 330
A, converting lipid A from hexa- to hepta-acylated. Therefore, the amount of 331
palmitoylated lipid A provides an indirect measurement of phospholipids in the 332
16
outer leaflet of the outer membrane. As seen in Fig. 4B, the vpsC mutant has 333
more hepta-acylated lipid A than the wild type. Complementation with pVpsABC 334
reduced the levels to wild type, as does pPldA. This is consistent with increased 335
PldA suppressing the detergent sensitivity of vpsC mutant by decreasing the 336
amount of phospholipids in the outer leaflet of the outer membrane. However, as 337
shown in Fig. 4A, pPldA does not fully restore the phospholipid profile of the 338
vpsC mutant to wild type. There is an increase in lysophosphoethanolamine in 339
the vpsC mutant compared to wild type. The level of lysophospholipid is reduced 340
by the addition of pVpsABC, but not by pPldA. The increase in lysophospholipids 341
may affect the stability of the bacteria when they are growing inside host cells or 342
the interaction between the bacteria and components of the eukaryotic cell. 343
344
The vpsC mutant invades and replicates at wild-type levels 345
To determine the point in the infection cycle at which the virulence defect 346
in the vpsC/vacJ mutants was manifest, we compared the mutants, with or 347
without pPldA, to the wild type for their ability to invade, replicate and spread 348
within cultured cell monolayers. Neither the vpsC mutant, as we had shown 349
previously (25), nor the vacJ mutant was defective for invasion, and introducing 350
pPldA had no effect on invasion of the mutants or wild type (Table 3). Therefore, 351
the inability of pPldA to restore plaque formation was not a result of an effect on 352
entry into the cell, and the primary virulence defect of the vpsC/vacJ mutants is 353
post-invasion. 354
17
To determine whether the defect in plaque formation resulted from 355
reduced replication of the vpsC mutant in the cytoplasm, the cells were lysed at 356
intervals after infection, and the lysate was plated to determine the number of 357
intracellular bacteria. The Henle cells were lysed with water, rather than 358
detergent, to avoid any deleterious effects on the vpsC mutant during recovery 359
from the Henle cells. There was no significant difference in doubling time of the 360
intracellular vpsC mutant (21 min) compared with intracellular wild-type bacteria 361
(25 min). These data are consistent with earlier estimates of the vpsC growth 362
rate determined by counting the increase in the number of intracellular bacteria 363
over time using microscopy (25). 364
365
The vpsC mutant polymerizes actin 366
The vpsC mutant is able to invade the epithelial cell, escape the initial 367
vacuole, and replicate in the cytoplasm, suggesting that it is the final step 368
required for plaque formation in cultured cells, the ability to spread from cell to 369
cell, that is defective in the vpsC mutant. For propulsion of S. flexneri through 370
the Henle cell, the formation of actin tails at one pole of the bacterium by the 371
protein, IcsA, is required (9, 10). Previously, we showed that IcsA is localized to 372
one pole of the vpsC mutant (25), a requirement for productive actin tail 373
polymerization (9, 10). However, it was not determined whether IcsA was 374
functional and led to formation of actin tails. To determine if the vpsC mutant 375
polymerized actin, we infected Henle cells with a gfp-expressing vpsC mutant 376
and stained the infected Henle cells with phalloidin, which binds polymeric actin, 377
18
conjugated to TRITC to visualize polymerized actin tails. As shown in Figure 4, 378
the vpsC mutant polymerized actin as well as wild type. Both wild type and vpsC 379
intracellular bacteria (green) have actin tails (red) extending from one pole of the 380
bacterium. In contrast, the icsA mutant bacteria, which lack the ability to 381
polymerize actin (10), do not have actin tails, as expected. This suggests that 382
the inability of intracellular vpsC mutant bacteria to spread to neighboring 383
epithelial cells is not due to an inability to form polymerized actin tails. 384
385
Cell-to-cell spread of vpsC and vacJ mutants is impaired 386
Because the intracellular vpsC mutant replicated intracellularly and formed 387
actin tails for movement, it appeared likely that the vpsC mutation was affecting 388
the bacteria’s ability to penetrate neighboring cells and continue the intracellular 389
infection cycle. To test this, nearly confluent monolayers of Henle cells were 390
infected with the wild type, vpsC mutant, or vacJ mutant. A relatively low 391
multiplicity of infection was used so that a minority of the Henle cells would be 392
infected. After 4 hours, at which time the bacteria should have begun to move 393
into adjacent cells, the monolayer was stained and viewed through a microscope. 394
To quantitate the cell-to-cell spread of the bacteria, 100 infected Henle cells were 395
observed, and, if any of the neighboring Henle cells were infected, then it was 396
scored as positive for spreading. If none of the neighboring Henle cells were 397
infected, then it was scored as negative for spreading (Fig. 5A). At the 4-hour 398
time point in the wild-type infection, almost 90% of the infected Henle cells were 399
surrounded by Henle cells that were also infected (Fig. 5B). In contrast, the icsA 400
19
mutant, which lacks the ability to spread to adjacent cells (10) showed far fewer 401
instances of adjacent cells being infected (~20%), consistent with occasional 402
independent infection of neighboring cells but limited or no cell-to-cell spread 403
(Fig. 5B). In the monolayer infected with the vpsC or vacJ mutants, the 404
percentage of infected Henle cells in contact with another infected cell was 405
significantly lower than in the wild-type infection, although the defect was not as 406
great as observed with the icsA mutant (Fig. 5B). This shows directly that the 407
vpsC and vacJ mutants are impaired in their ability to infect neighboring cells in 408
the Henle cell monolayer, likely accounting for the plaque negative phenotype of 409
these mutants. Both the vpsC mutant and the vacJ mutant were complemented 410
for intercellular spread by the addition of pVpsC and pVacJ, respectively (Fig. 411
5B). pPldA was unable to suppress the defect in intercellular spread of either the 412
vpsC or the vacJ mutant, consistent with its failure to suppress the plaque defect. 413
414
415
416
20
Discussion 417
The ability of S. flexneri to cause disease requires a complex series of 418
events in which the bacteria invade, replicate inside host cells, and eventually 419
spread to adjacent cells, causing significant cell damage and provoking 420
inflammation (1). In a screen for mutants that were unable to spread cell-to-cell 421
and produce plaques in monolayers of cultured cells, we identified mutations in 422
the vps (mla) operon (25). The recent identification of a function for the E. coli 423
Mla proteins prompted us to re-examine the role of these genes in Shigella 424
pathogenesis. 425
In E. coli, the Mla proteins are one of three known mechanisms 426
responsible for removing excess phospholipids from the outer leaflet of the outer 427
membrane (28, 31, 45). In the absence of the Mla system, the membrane 428
becomes less stable and more permeable to SDS and other detergents. 429
Increased expression of PldA, which removes outer leaflet phospholipids, 430
compensated for E. coli mla mutations and restored SDS resistance (28), and a 431
similar effect of PldA on detergent sensitivity was observed for S. flexneri vpsC or 432
vacJ mutants. Increased PldA suppressed the increase in palmitoylated lipid A in 433
the S. flexneri vpsC mutant, suggesting that PldA is removing the phospholipids 434
in the outer leaflet of the outer membrane of the vpsC mutant, resulting in 435
suppression of the detergent sensitivity of the mutant. 436
The product of PldA-mediated hydrolysis of phospholipid is 437
lysophospholipid, and increased PldA in the vpsC mutant carrying the plasmid 438
pPldA results in more lysophosphoethanolamine (lysoPE) compared to both the 439
21
wild type and the vpsC mutant. There is also an increase in lysoPE in the vpsC 440
mutant compared to wild type, which may be due to increased activity of PldA. 441
PldA activity has been shown to increase in bacteria whose outer membranes 442
are destabilized (46, 47). The increase in lysoPE in the vpsC mutant is not 443
responsible for the mutant’s increased SDS sensitivity, as the vpsC mutant 444
containing pPldA has more lysoPE than the vpsC mutant but is resistant to 445
detergent. While the increase of lysoPE is not responsible for the detergent 446
sensitivity of the mutant, these subtle differences in the membrane composition 447
of the vpsC mutant alone or carrying pPldA compared to wild type may be 448
sufficient to prevent the bacteria from forming plaques in the monolayer. 449
The effect of the vpsC mutation on plaque formation by S. flexneri is at a 450
late step in the intracellular growth cycle. Invasion, intracellular replication, and 451
formation of actin tails by the mutants were indistinguishable from wild type. The 452
notable difference was the reduced ability of the vpsC and vacJ mutants to 453
penetrate and infect adjacent cells. This suggests that the vpsC mutant is 454
impaired in its ability to push into the adjacent cell and lyse the resulting double 455
membrane to escape into the neighboring cell cytoplasm. It was reported 456
previously that the vacJ mutant is less able than wild-type S. flexneri to escape 457
the double membrane formed when the bacterium moves from one cell to 458
another; about 50% of the intracellular vacJ mutants were unable to escape the 459
double membrane (26). Since it has been suggested that vacJ and vpsC are 460
linked functionally (27), it is possible that the defect in cell-to-cell spread of the 461
22
vpsC mutant also can be attributed to an inability to escape the double-462
membrane vacuole. 463
It is not known at this time why a mutation in an mla gene would prevent 464
S. flexneri from escaping the double-membrane vacuole; however, given that the 465
type III secretion system is required for escape from that vacuole (13, 20), it is 466
possible that the differences in the membrane of a vpsC mutant compared to wild 467
type may affect proper assembly of the TTSS in the membrane or the timing of 468
secretion of the effector proteins. Because the vpsC and vacJ mutants invade at 469
wild-type levels, this indicates that the TTSS is functional when the bacteria are 470
initiating invasion of the Henle cells. Thus, the assembly defect would only occur 471
in the intracellular bacteria. It is also possible that once inside the double-472
membrane vacuole, a signal is relayed to the bacterium via the proposed ABC 473
transporter activity of the vps/vacJ system that triggers lysis of the vacuole and 474
entry into the next cell. There is evidence that the outer membrane of the 475
intracellular bacteria is in close contact with the membrane of the epithelial cell 476
while inside the double membrane vacuole (20, 48) and this interaction could be 477
sensed via the Vps/VacJ system. Further, Fukumatsu et al. (49) have shown 478
that Shigella targets tricellin-containing epithelial cell junctions for cell-to-cell 479
spread. The presence of VacJ in the outer membrane could play a role in 480
helping the bacteria target the appropriate sites for spread. Thus, the Vps/VacJ 481
ABC transporter may have a dual function in maintaining outer membrane 482
asymmetry and in transporting a signal inside the bacterium when it comes into 483
contact with the inner face of the epithelial cell membrane during intracellular 484
23
spread. Further study on the composition of the outer membrane of intracellular 485
S. flexneri compared to extracellular S. flexneri is needed to better understand 486
the role of the outer membrane and the proteins that maintain its integrity in the 487
virulence of this pathogen. 488
489
490
491
Acknowledgments 492
We thank Marvin Whiteley for generously providing plasmid pMRP9-1 and 493
Alexandra Mey and Elizabeth Wyckoff for discussions and critical reading of the 494
manuscript. This work was funded by grants AI16935 (to S.M.P.) and AI064184 495
(to M.S.T.) from the National Institutes of Health, and the Army Research Office 496
(grant W911NF-12-1-0390 to M.S.T.). 497
498 499 500 501 502
503 504
505
506
507
508
509
510
24
References 511
1. Philpott DJ, Edgeworth JD, Sansonetti PJ. 2000. The pathogenesis of 512
Shigella flexneri infection: lessons from in vitro and in vivo studies. Philos. 513
Trans. R. Soc. Lond., B, Biol. Sci. 355:575–586. 514
2. Sansonetti PJ, Kopecko DJ, Formal SB. 1982. Involvement of a plasmid in 515
the invasive ability of Shigella flexneri. Infect. Immun. 35:852–860. 516
3. Sansonetti PJ, Hale TL, Dammin GJ, Kapfer C, Collins HH Jr, Formal SB. 517
1983. Alterations in the pathogenicity of Escherichia coli K-12 after transfer of 518
plasmid and chromosomal genes from Shigella flexneri. Infect. Immun. 519
39:1392–1402. 520
4. High N, Mounier J, Prévost MC, Sansonetti PJ. 1992. IpaB of Shigella 521
flexneri causes entry into epithelial cells and escape from the phagocytic 522
vacuole. EMBO J. 11:1991–1999. 523
5. Ménard R, Sansonetti PJ, Parsot C. 1993. Nonpolar mutagenesis of the ipa 524
genes defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri entry into 525
epithelial cells. J. Bacteriol. 175:5899–5906. 526
6. Sansonetti PJ, Ryter A, Clerc P, Maurelli AT, Mounier J. 1986. 527
Multiplication of Shigella flexneri within HeLa cells: lysis of the phagocytic 528
vacuole and plasmid-mediated contact hemolysis. Infect. Immun. 51:461–469. 529
7. Ménard R, Sansonetti P, Parsot C. 1994. The secretion of the Shigella 530
flexneri Ipa invasins is activated by epithelial cells and controlled by IpaB and 531
IpaD. EMBO J. 13:5293–5302. 532
25
8. Francis CL, Ryan TA, Jones BD, Smith SJ, Falkow S. 1993. Ruffles 533
induced by Salmonella and other stimuli direct macropinocytosis of bacteria. 534
Nature 364:639–642. 535
9. Bernardini ML, Mounier J, d’ Hauteville H, Coquis-Rondon M, Sansonetti 536
PJ. 1989. Identification of icsA, a plasmid locus of Shigella flexneri that 537
governs bacterial intra- and intercellular spread through interaction with F-538
actin. Proc. Natl. Acad. Sci. U.S.A. 86:3867–3871. 539
10. Goldberg MB, Theriot JA. 1995. Shigella flexneri surface protein IcsA is 540
sufficient to direct actin-based motility. Proc. Natl. Acad. Sci. U.S.A. 92:6572–541
6576. 542
11. Prévost MC, Lesourd M, Arpin M, Vernel F, Mounier J, Hellio R, 543
Sansonetti PJ. 1992. Unipolar reorganization of F-actin layer at bacterial 544
division and bundling of actin filaments by plastin correlate with movement of 545
Shigella flexneri within HeLa cells. Infect. Immun. 60:4088–4099. 546
12. Allaoui A, Mounier J, Prévost MC, Sansonetti PJ, Parsot C. 1992. icsB: a 547
Shigella flexneri virulence gene necessary for the lysis of protrusions during 548
intercellular spread. Mol. Microbiol. 6:1605–1616. 549
13. Schuch R, Sandlin RC, Maurelli AT. 1999. A system for identifying post-550
invasion functions of invasion genes: requirements for the Mxi-Spa type III 551
secretion pathway of Shigella flexneri in intercellular dissemination. Mol. 552
Microbiol. 34:675–689. 553
14. Hale TL. 1986. Invasion of epithelial cells by shigellae. Ann. Inst. Pasteur 554
Microbiol. 137A:311–314. 555
26
15. Hale TL, Formal SB. 1981. Protein synthesis in HeLa or Henle 407 cells 556
infected with Shigella dysenteriae 1, Shigella flexneri 2a, or Salmonella 557
typhimurium W118. Infect. Immun. 32:137–144. 558
16. Oaks EV, Wingfield ME, Formal SB. 1985. Plaque formation by virulent 559
Shigella flexneri. Infect. Immun. 48:124–129. 560
17. Venkatesan MM, Buysse JM, Oaks EV. 1992. Surface presentation of 561
Shigella flexneri invasion plasmid antigens requires the products of the spa 562
locus. J. Bacteriol. 174:1990–2001. 563
18. Allaoui A, Sansonetti PJ, Parsot C. 1992. MxiJ, a lipoprotein involved in 564
secretion of Shigella Ipa invasins, is homologous to YscJ, a secretion factor of 565
the Yersinia Yop proteins. J. Bacteriol. 174:7661–7669. 566
19. Allaoui A, Sansonetti PJ, Parsot C. 1993. MxiD, an outer membrane protein 567
necessary for the secretion of the Shigella flexneri lpa invasins. Mol. Microbiol. 568
7:59–68. 569
20. Allaoui A, Sansonetti PJ, Menard R, Barzu S, Mounier J, Phalipon A, 570
Parsot C. 1995. MxiG, a membrane protein required for secretion of Shigella 571
spp. Ipa invasins: involvement in entry into epithelial cells and in intercellular 572
dissemination. Mol. Microbiol. 17:461–470. 573
21. Andrews GP, Hromockyj AE, Coker C, Maurelli AT. 1991. Two novel 574
virulence loci, mxiA and mxiB, in Shigella flexneri 2a facilitate excretion of 575
invasion plasmid antigens. Infect. Immun. 59:1997–2005. 576
27
22. Hong M, Payne SM. 1997. Effect of mutations in Shigella flexneri 577
chromosomal and plasmid-encoded lipopolysaccharide genes on invasion and 578
serum resistance. Mol. Microbiol. 24:779–791. 579
23. Sandlin RC, Lampel KA, Keasler SP, Goldberg MB, Stolzer AL, Maurelli 580
AT. 1995. Avirulence of rough mutants of Shigella flexneri: requirement of O 581
antigen for correct unipolar localization of IcsA in the bacterial outer 582
membrane. Infect. Immun. 63:229–237. 583
24. Makino S, Sasakawa C, Kamata K, Kurata T, Yoshikawa M. 1986. A genetic 584
determinant required for continuous reinfection of adjacent cells on large 585
plasmid in S. flexneri 2a. Cell 46:551–555. 586
25. Hong M, Gleason Y, Wyckoff EE, Payne SM. 1998. Identification of two 587
Shigella flexneri chromosomal loci involved in intercellular spreading. Infect. 588
Immun. 66:4700–4710. 589
26. Suzuki T, Murai T, Fukuda I, Tobe T, Yoshikawa M, Sasakawa C. 1994. 590
Identification and characterization of a chromosomal virulence gene, vacJ, 591
required for intercellular spreading of Shigella flexneri. Mol. Microbiol. 11:31–592
41. 593
27. Casali N, Riley LW. 2007. A phylogenomic analysis of the Actinomycetales 594
mce operons. BMC Genomics 8:60. 595
28. Malinverni JC, Silhavy TJ. 2009. An ABC transport system that maintains 596
lipid asymmetry in the Gram-negative outer membrane. PNAS 106:8009–597
8014. 598
28
29. Abe M, Okamoto N, Doi O, Nojima S. 1974. Genetic mapping of the locus for 599
detergent-resistant phospholipase A (pldA) in Escherichia coli K-12. J. 600
Bacteriol. 119:543–546. 601
30. Homma H, Kobayashi T, Chiba N, Karasawa K, Mizushima H, Kudo I, 602
Inoue K, Ikeda H, Sekiguchi M, Nojima S. 1984. The DNA sequence 603
encoding pldA gene, the structural gene for detergent-resistant phospholipase 604
A of E. coli. J. Biochem. 96:1655–1664. 605
31. Dekker N. 2000. Outer-membrane phospholipase A: known structure, 606
unknown biological function. Mol. Microbiol. 35:711–717. 607
32. Kamio Y, Nikaido H. 1976. Outer membrane of Salmonella typhimurium: 608
accessibility of phospholipid head groups to phospholipase c and cyanogen 609
bromide activated dextran in the external medium. Biochemistry 15:2561–610
2570. 611
33. Plésiat P, Nikaido H. 1992. Outer membranes of gram-negative bacteria are 612
permeable to steroid probes. Mol. Microbiol. 6:1323–1333. 613
34. Jia W, El Zoeiby A, Petruzziello TN, Jayabalasingham B, Seyedirashti S, 614
Bishop RE. 2004. Lipid trafficking controls endotoxin acylation in outer 615
membranes of Escherichia coli. J. Biol. Chem. 279:44966–44975. 616
35. Wu T, McCandlish AC, Gronenberg LS, Chng S-S, Silhavy TJ, Kahne D. 617
2006. Identification of a protein complex that assembles lipopolysaccharide in 618
the outer membrane of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 619
103:11754–11759. 620
29
36. Ruiz N, Gronenberg LS, Kahne D, Silhavy TJ. 2008. Identification of two 621
inner-membrane proteins required for the transport of lipopolysaccharide to the 622
outer membrane of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 105:5537–623
5542. 624
37. Payne SM, Finkelstein RA. 1977. Detection and differentiation of iron-625
responsive avirulent mutants on Congo red agar. Infect Immun 18:94–98. 626
38. Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, 627
Tomita M, Wanner BL, Mori H. 2006. Construction of Escherichia coli K-12 628
in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 629
2:2006.0008. 630
39. Wang RF, Kushner SR. 1991. Construction of versatile low-copy-number 631
vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 632
100:195–199. 633
40. BLIGH EG, DYER WJ. 1959. A rapid method of total lipid extraction and 634
purification. Can J Biochem Physiol 37:911–917. 635
41. Giles DK, Hankins JV, Guan Z, Trent MS. 2011. Remodelling of the Vibrio 636
cholerae membrane by incorporation of exogenous fatty acids from host and 637
aquatic environments. Mol. Microbiol. 79:716–728. 638
42. Needham BD, Carroll SM, Giles DK, Georgiou G, Whiteley M, Trent MS. 639
2013. Modulating the innate immune response by combinatorial engineering of 640
endotoxin. Proc. Natl. Acad. Sci. U.S.A. 110:1464–1469. 641
30
43. Davies DG, Parsek MR, Pearson JP, Iglewski BH, Costerton JW, 642
Greenberg EP. 1998. The involvement of cell-to-cell signals in the 643
development of a bacterial biofilm. Science 280:295–298. 644
44. Schneider CA, Rasband WS, Eliceiri KW. 2012. NIH Image to ImageJ: 25 645
years of image analysis. Nat Meth 9:671–675. 646
45. Bishop RE. 2008. Structural biology of membrane-intrinsic beta-barrel 647
enzymes: sentinels of the bacterial outer membrane. Biochim. Biophys. Acta 648
1778:1881–1896. 649
46. Audet A, Nantel G, Proulx P. 1974. Phospholipase A activity in growing 650
Escherichia coli cells. Biochim. Biophys. Acta 348:334–343. 651
47. Michel GP, Stárka J. 1979. Phospholipase A activity with integrated 652
phospholipid vesicles in intact cells of an envelope mutant of Escherichia coli. 653
FEBS Lett. 108:261–265. 654
48. Sansonetti PJ, Mounier J, Prévost MC, Mege RM. 1994. Cadherin 655
expression is required for the spread of Shigella flexneri between epithelial 656
cells. Cell 76:829–839. 657
49. Fukumatsu M, Ogawa M, Arakawa S, Suzuki M, Nakayama K, Shimizu S, 658
Kim M, Mimuro H, Sasakawa C. 2012. Shigella targets epithelial tricellular 659
junctions and uses a noncanonical clathrin-dependent endocytic pathway to 660
spread between cells. Cell Host Microbe 11:325–336. 661
50. Payne SM, Niesel DW, Peixotto SS, Lawlor KM. 1983. Expression of 662
hydroxamate and phenolate siderophores by Shigella flexneri. J. Bacteriol. 663
155:949–955. 664
31
51. Purdy GE, Hong M, Payne SM. 2002. Shigella flexneri DegP facilitates IcsA 665
surface expression and is required for efficient intercellular spread. Infect 666
Immun 70:6355–6364. 667
668
669
32
Table 1 Strains and plasmids 670 671 Strain or plasmid Description Reference 672
S. flexneri 2a strains 673
SA100 Wildtype (50) 674
SA5122 SA100 vpsC::TnphoA (25) 675
CDC200 SA100 vacJ::kan This study 676
CDC201 SA100 pldA::kan This study 677
SA511 Chloramphenicol-resistant SA100 derivative (22) 678
SA222-7 SA511 icsA::TnphoA (51) 679
Plasmids 680
pWKS30 Low-copy cloning vector (39) 681
pVpsABC vpsABC in pWKS30 This study 682
pPldA pldA in pWKS30 This study 683
pVacJ vacJ in pWKS30 This study 684
pMRP9-1 gfp expressing plasmid (43) 685
686 687 Table 2. Primers used in this study 688 689 Primer Sequence 690 vpsCR TGCAATCACCAGCAAAGCGACC 691
vpsAF ACGTCCTTTCTTCAGGTATACTCG 692
pldAF TTTTTAAAGGCCAGCTGTGCGAAC 693
pldAR TTTTTAAAGCGGTGAAACAACCACGG 694
vacJF ATCTTTCTCGAGCACCTAAACAGGCGGATACGGTATCG 695
vacJR TACCATCTGCAGTGTCGGTTTATCTCCTTTTACTTGTGG 696
33
697 698 Table 3: Invasion assays of S. flexneri mutants 699 700 Strain Relevant
characteristics
% Invasiona
SA100/pWKS30 Wild type 30.0 ± 6.0
SA100/pPldA Wild type, pPldA 28.0 ± 9.1
SA5122/pWKS30 vpsC- 26.7 ± 7.8
SA5122/pPldA vpsC-, pPldA 27.9 ± 2.2
CDC200/pWKS30 vacJ- 35.7 ± 4.3
CDC200/pPldA vacJ-, pPldA 33.4 ± 4.0
CDC201 pldA- 29.5 ± 7.4
701
a Percentage of Henle cells infected with 3 or more bacteria. At least 300 Henle 702
cells were observed per experiment, and means ± standard deviations of three 703
experiments are shown. 704
705
706
34
Figure legends 707
708
Figure 1: Map of S. flexneri vps/vacJ genes and SDS-EDTA Sensitivity Assay. 709
(A) This map is in accordance with S. flexneri serotype 2a sequences (GenBank 710
accession no. AE014073.1A) S. flexneri gene names are listed above the arrows 711
and E. coli gene names are listed beneath the arrows. (B) and (C) SDS-EDTA 712
Sensitivity Assay. Cultures were grown until mid-log phase, and 2 μl of each 713
dilution, indicated on the left, was spotted onto the agar plates. (B) LB agar 714
medium supplemented with 0.1% SDS and 0.55 mM EDTA, and (C) LB agar 715
medium. 716
717
Figure 2: Plaque formation of S. flexneri vpsC and vacJ mutants carrying pPldA. 718
Confluent Henle cell monolayers were infected with approximately 104 bacteria, 719
and the plaques were stained and photographed after 3 days. 720
721
Figure 3: Recovery of bacteria from infected Henle cells. Bacteria were grown to 722
mid-log phase and then added to Henle cell monolayers. After infection, bacteria 723
were harvested from the tissue culture monolayer by lysing Henle cells with DOC 724
and plating onto agar medium. The bacteria harvested per infected Henle cell 725
was calculated. Data presented are the mean values and standard deviations of 726
4 biological replicates. *, p value < 0.01 compared to wild type (by Student’s t 727
test). 728
729
35
Figure 4: TLC analysis of radiolabeled phospholipids and lipid A. Bacteria were 730
grown in LB in the presence of 2.5 µCi/ml 32Pi to an OD650 of ~1.0. Phospholipids 731
and lipid A were extracted then spotted and separated by TLC. (A) TLC of 732
phospholipids. Arrows indicate the origin, lyso-phosphatidylethanolamine 733
(lysoPE), phosphatidylethanolamine (PE), phosphatidylglycerol (PG), and 734
cardiolipin (CL). The percentage of lysoPE in the sample is indicated at the 735
bottom of each lane. (B) TLC of lipid A. Arrows indicate the origin, bis-736
phosporylated hexa-acylated lipid A (hexa-acyl), and the palmitoylated lipid A 737
(hepta-acyl). The percentage of palmitoylated lipid A within the sample is 738
indicated at the bottom of each lane. 739
740
Figure 5: Staining of polymerized actin. Henle cells were infected with gfp-741
expressing S. flexneri (green) for 30 minutes at 37°C. The monolayer was 742
washed and media containing gentamycin was added. After one hour 743
incubation at 37°C, the infected Henle cells were stained with phalloidin-TRITC 744
(red) which binds to polymerized actin. Samples were visualized using confocal 745
microscopy. White arrows point towards actin tails on bacterial cells. 746
747
Figure 6. Intercellular spread of wild type and vpsC mutant. Bacteria were 748
added to a semi-confluent layer of Henle cells, and, after 30 minutes incubation 749
at 37°C, the monolayer was washed and media containing gentamycin was 750
added. After 4 hours, the monolayers were stained with Giemsa and viewed 751
using bright field microscopy. (A) Images of intracellular spread for WT and vpsC 752
36
mutant. Arrows indicate infected Henle cells. (B) Graph of intercellular spread. 753
100 infected Henle cells were counted and were scored as positive for spread if 754
surrounding Henle cells were also infected. Data presented are the mean values 755
and standard deviations of 3 biological replicates. *, p value < 0.01 compared to 756
wild type (by Student’s t test). 757
758
WT
vpsC
vpsC/pVpsABC
vpsC/pPldA
vacJ/pPldA
vacJ/pVacJ
vacJ
pldA
pldA/pPldA
B.
C.
10-1
10-2
10-1
10-2
10-3
10-4
10-4
10-3
10-5
10-5
A. vpsCvpsA vpsByrbG yrbC yrbB yrbA
yfdC vacJhypotheticalprotein
mlaB mlaC mlaD mlaE mlaF
mlaA
10-6
1 2 3 4 5 6 7 8 9
1 2 3 4 5 6 7 8 9
Wild type pldA
vpsC/pPldAvpsC/pVpsABC
vacJ/pPldAvacJ/pVacJ
vpsC
vacJ
Wild type/pPldA
35
30
25
20
15
10
5
0
Ba
cte
ria
/in
fecte
d H
en
le c
ell
WT vpsC vpsC/pPldA
A.
*
CL
PG
PE
lysoPE
originorigin
WT
vpsC
vpsC/p
Vps
ABC
vpsC/p
Pld
A
WT
vpsC
vpsC/p
Vps
ABC
vpsC/p
Pld
A
% lysoPE 4.4 9.5 3.1 2.3
A B
0.8 3.4 1.0 4.3
hexa-acyl
hepta-acyl
% hepta
20
10
0
30
40
50
60
70
80
90
100
Pe
rce
nta
ge
of a
dja
ce
nt ce
lls in
fecte
d
WT icsA vpsC vpsCpVpsABC
vpsCpPldA
vacJ vacJ vacJpPldApVacJ
A. vpsC WT
B.
*
*
*
*
*
10 µm
Recommended