View
0
Download
0
Category
Preview:
Citation preview
i
GENETIC EVOLUTION AND DEVELOPMENT OF
RECOMBINANT VACCINE AGAINST NEWCASTLE DISEASE
FOR CHICKEN IN PAKISTAN
ABDUL WAJID
2009-VA-705
A THESIS SUBMITTED IN THE PARTIAL FULFILLMENT OF THE
REQUIREMENT FOR THE DEGREE
OF
DOCTOR OF PHILOSOPHY
IN
MOLECULAR BIOLOGY AND BIOTECHNOLOGY
UNIVERSITY OF VETERINARY AND ANIMAL SCIENCES,
LAHORE
2017
ii
To,
The Controller of Examination,
University of Veterinary and Animal sciences,
Lahore.
We, the Supervisory Committee, certify that the contents and form of the thesis,
submitted by Mr. Abdul Wajid, Regd. No. 2009-VA-705 have been found satisfactory and
recommend that it be processed for the evaluation by the External Examiner (s) for award of the
degree.
Supervisor:
____________________________________
Dr. Muhammad Wasim
Member:
____________________________________
Prof. Dr. Tahir Yaqub
Member:
____________________________________
Dr. Muhammad Tayyab
iii
iv
IN THE NAME OF ALLAH,
THE MOST COMPASSIONATE, THE MOST MERCIFUL
All praises and thanks are for
Almighty Allah,
The source of all knowledge and wisdom endowed
to mankind,
who guides us in darkness and helps us in
difficulties
And
all respects are for His last
Holy Prophet
HAZRAT MUHAMMAD
(Peace Be Upon Him)
Who enabled us to recognize our creator.
v
Dedicated
To
My Parents & My late Brother
Abdul Raziq (Jaan)
&
My Supervisor & Dr. SF Rehmani
Who always encouraged me to
Achieve higher goals in life
vi
ACKNOWLEDGEMENTS
I would like to give all my praises and humblest thanks to the Most Gracious, Merciful and
ALMIGHTY ALLAH, who guides us in darkness and thankful to my ALLAH, who has
conferred me with potential and ability to complete this research study. I offer mu humblest
thanks from the core of my heart to the Holy Prophet Muhammad (S.A.W.), who is forever a
torch of guidance and knowledge for humanity as a whole.
This thesis has been completed as a collaborative research project between South East Poultry
Research Laboratory (SEPRL), USA and Quality Operations Lab, University of Veterinary and
Animal Sciences, Pakistan, entitle “Molecular characterization of NDV and Development of
approaches to vaccination”USDA-ARS-BEP CRDF Newcastle Disease Virus program #31063
sponsored by theUnited States Department of State. I am thankful to this donor agency for
providing the financial support for the described work. I feel enormous intensity of obligation to
my respected Supervisor, Dr. Muhammad Wasim, Associate Prof. IBBt-UVAS, Lahore for his
valuable guidance, stimulating ideas and extreme patience with my work, which proved to be a
panacea in the completion of this thesis. I have no word to thank Dr. Shafqat Fatima Rehmani,
for not only support in studies, generous advice, inspiring guidance, and encouragement through
my research, she taught me everything about life. I have deep sense of appreciation to the
members of my Supervisory Committee, Prof. Dr. Tahir Yaqub, Department of Microbiology
and Dr. Muhammad Tayyab, for their personal interest and cooperation. I would especially like
to express my deep sense of gratitude to Prof. Dr. Claudio L Afonso, Newcastle disease Lead
Scientist, South East Poultry Research Laboratory (SEPRL), USA. Thank you Dr. Patti Miller,
Kiril Dimitrov and Poonam Sharma for your unconditional scientific support. I would
especially like to thank Asma Basharat for her inspiring attitude, kindness and help during this
research. I also would like to thank Saima Arif and Abdul Basit for helping and support
through this research work. I am very much thankful to my friends Kamran Abbas,
AhsanUllah, Zia Uddin, Asif Rahim and especial thanks to Dr. Andleeb Batool for their moral
support. I am grateful to my parents and whole family for their support and encouragement. I
would like to thank my late brother Abdul Raziq (Jaan), I know where I am today is due to
your’s prays. Now I know why you always told me to be strong because you knew, you knew
that one day I would need the strength to bear your loss. Thanks for making me laugh every time
as you were joking, singing and I love you so so much. Abdul Wajid
vii
CONTENTS
DEDICATION ------------------------------------------------------ i
ACKNOWLEDGEMENTS---------------------------------------- ii
TABLE OF CONTENTS ------------------------------------------ iii
ABSTRACT --------------------------------------------------------- iv
SR. NO. CHAPTER PAGE NO.
1 INTRODUCTION 1
2 REVIEW OF LITERATURE 6
3 EXPERIMENT 1 53
4 EXPERIMENT 2 73
5 EXPERIMENT 3 96
6 EXPERIMENT 4 113
7 EXPERIMENT 5 118
8 SUMMARY 140
viii
ABSTRACT
Newcastle disease (ND) is one of the most contagious diseases of poultry worldwide. The
disease is endemic in Pakistan and recurrent outbreaks have been reported in commercial poultry
flocks, domestic pet and migratory birds since 1963 an inception of commercial poultry farming
in the country. Disease surveillance is necessary to determine the incidence of the disease as well
as to identify the etiological agent of the disease status in the region. The analysis of the field
data provides a clue for the higher authorities to take steps for the remedy of the devastating
outbreak. A virulent strain (or variant) of Newcastle disease virus caused an outbreak in the
northern region of Pakistan during the mid of 2011. The virus was identified as a virulent
viscerotropic vvNDV and characterized, belonging to the sub genotype VIIi. However, the virus
of this genotype is still circulating in the field though the intensity of the strain to succumb the
chickens to cause mortality does not exist. The particular thing in this genotype was its
susceptibility to other avian species like pheasants, peafowls, ducks turkeys, peacocks, sparrows
and parakeets. As this genotype is circulating since 2011, until 2016 and occasionally still spill
over in these avian species. Thus for the last five years (2011-16), 3500 healthy, diseased and
dead chickens, pheasants, peacocks, turkeys, peafowls, ducks, sparrows, exotic parakeets, rosy-
faced parrots, pigeons, and partridges from 750 different locations were monitored. Samples
were collected from the Northern region of the country including Punjab, Khyber
Pakhtoonkhawa, Azad Kashmir, as well as Gilgit Baltitssan and from Southern region, Karachi,
Hyderabad, Mirpursakro and other small cities where the poultry farms are located. The samples
were collected by the local veterinarians, poultry assistants and animal health practitioners who
participated during the surveillance program. Samples were also collected from the farmers who
brought their birds for inspection in the lab with the details of the farm locations. Mostly,
sampling was done where there were reports of NDV outbreak, tissues were collected usually the
trachea, spleen and brain. In addition, the pharyngeal and cloacal swabs were also collected the
healthy birds living amongst the infected bird in order to assess the virus shedding in the flock.
Blood samples were also collected (1% of the birds at farm), and the sera were used to assess the
immune status of the flock using Haemagglutination Inhibition (HI) test and Enzyme linked
immunosorbant assay (ELISA). The Survey Form met the international standard was filled for
each farm for recording the information required to find the diagnostic clue as well as the
ix
molecular characterization of the isolates. Pool of five pharyngeal swabs were processed after the
passage into 9-day old chicken embryonated eggs and confirming the positive HA test and then
confirmed by real time PCR (RT-PCR). In addition, sera were tested against NDV by HI and
ELISA tests. The targeted samples were sequenced by complete fusion gene and whole genome,
using 22 pairs of overlapping primers. The observations indicated that the commercial broiler
industry is highly susceptible to virulent NDV and confirmed by data available in the laboratory
in the survey form. Contrary to that a little is known regarding the maintenance and enzootic
trends of vNDV infection level in domestic and wild birds. Poor strategy of the use of vaccines
and vaccination as well as the existence of virulent form of NDV in the domestic and pet birds
indicate a possibility of the root cause of the ND eruption in the developing countries. A
continuous isolation of virulent viruses of the panzootic Newcastle disease virus of sub-genotype
VIIi since (2011-2016) from commercial chickens and from various other avian species in the
country provide an evidence for the existence of epidemiological links intermingling of the strain
among them. Therefore, to avoid the huge economical losses in the commercial poultry, the
second largest industry in Pakistan, their close proximity should be strictly avoided. The mass
vaccination of the poultry flocks is a common practice in all commercial poultry farms in
Pakistan. However, the use and availability of a reliable and standard vaccine, as well as the
correct usage of vaccine dose of the live attenuated LaSota vaccine are the key factors to
improve their efficacy in the field. Minor outbreaks have been occurring in the field even though
a severe outbreak has occurred in 2011-12, that almost collapsed the poultry industry with other
pet and wild birds. To minimize the continuity of these minor outbreaks in the field for a long
time period, there is a need for more effective vaccine to control the particular genotype of the
ND virus. In the present study, DNA vaccine was developed using the SFR-55 NDV strain as an
antigens, in the form of fusion (F) and hemagglutinin-neuraminidase (HN), namely pcDNA3.1-F
and pcDNA3.1-HN. In vitro expression of both genes construct was assessed by reverse-
transcriptase-PCR (RT-PCR) and western blotting. In the trial an inactivated oil-based emulsion
vaccine was prepared using the field strain SFR-55 and compare with the commercial ND
vaccine (LaSota strain) commonly used by the poultry industry. Birds were divided into six
groups, the first two groups were immunized with pcDNA3.1-F and pcDNA3.1-HN alone
respectively and third group was vaccinated with both antigens pcDNA3.1-F+HN. The other two
groups were immunized with inactivated (wvSFR-55) and LaSota vaccines as described above,
x
the last group was injected with empty vector as control. The birds were immunized twice at 14
and 21 days of age with DNA vaccine intramuscularly, inactivated vaccine subcutaneously and
LaSota vaccine by eye-drop. The vaccinated birds were challenged with live virulent NDV strain
using a dose of 10,000 ELD50/0.1ml per chicken. Results indicate that Inactivated and LaSota
vaccines provided high protection (>80%), as compared to pcDNA3.1-F, pcDNA3.1-HN,
pcDNA3.1-F+HN gave 70%, 75% and 20% respectively. There was 100% mortality in control
chickens. The administration of two vectors expressing F and HN antigens induced good
immune response as compared to use separately. However, the groups immunized with
pcDNA3.1-F, pcDNA3.1-F+HN and inactivated vaccine resulted in lower amount of virulent
virus shed after challenge when compared to the group immunized with standard LaSota. In
summary, the co-administration of both NDV glycoprotein antigens increased protection than
used separately. DNA-based vaccine can be used safely to reduce mortality and most importantly
lower the risk of virus transmission due to decreased level of virulent virus shedding.
1
CHAPTER 1
INTRODUCTION
Newcastle disease is a common poultry disease worldwide (Alexander and Senne, 2013). In
developing countries, the low income families rely on the poultry solely to obtain inexpensive
and high quality protein. High mortality rate in poultry production facilities is due to ND
minimize the availability of eggs, meat and aggravate human consumption. The poultry industry
is one of the major agriculture industries in Pakistan, as a second largest after the cotton crop and
has an involvement of Rs.7 billion investment. Among the four provinces and Azad Jammu
Kashmir, the province of Punjab especially the North-Eastern region is very problematic. The
reason is the high density of poultry farms in close proximity and also an enormous contact with
backyard chickens and wild birds. A rigorous biosecurity policy, proper vaccination program and
construction of environmentally controlled sheds since late, 90’s did not stop the incidence of
disease outbreaks that cause prominent damage to the Industry (Rehmani et al. 2015).
NDV derives its name at a farm near Rani khet in India and Newcastle-upon-Tyne in England in
1927 (Miller et al. 2010), classified as an avian paramyxovirus type 1 (AMPV-1). The ND
viruses are from family paramyxoviridae, genus Avulavirus and order Mononegavirals (Mayo,
2002; Afonso et al. 2016). The ND virus has genome of negative sense RNA and is helical,
single stranded, enveloped and non-segmented in morphology (Miller et al. 2010). There are
three genomic sizes 15186, 15192, 15198 nucleotides) has encoded six transcriptional units
which include neucleoprotein (NP), phophoprotein (P), matrix protein (M), fusion protein (P),
hemagglutinin-neuraminidase protein (HN), and large protein (L) in 3’ to 5’ terminus (Miller et
al. 2010). However, due to the insertion of guanine nucleotide (Gn) during the post
transcriptional editing of the phosphate protein gene mRNA produce two further proteins V and
W respectively (Steward et al. 1993). On the basis of pathogenicity the ND viruses are classified
2
into five pathotypes asymptomatic enteric, lentogenic, masogenic and velogenic viruses. The
further types of velogenic include velogenic viscerotropic and velogenic neurotropic (Alexander
and Senne, 2013). The asymptomatic enteric viruses are usually described as without any sign or
symtoms of the disease like, Australian V4 and mild or sub-clinical respiratory infections are
witnessed in birds infected with lentogenic strains, mesogenic viruses cause respiratory signs, or
neurological signs but with low mortality in birds. Velogenic neurotropic strains induce
neutrological signs like tremor, torticollis and twisting of neck and usually cause high mortality
in birds, while in case of velogenic viscerotropic, hemorrhages in the intestine and lymphoid
tissues are frequently seen and cause mortality above 90%. The virulence of virus is calculated in
vivo through intracerebral pathogenicity index (ICPI) in day-old specific pathogenic free (SPF)
chickens, whereas the mean death time (MDT) is assessed in 9-10 day-old SPF chicken eggs.
According to OIE criteria, the NDV is considered virulent if there are three basic amino acids
between 112-116 amino acid residues at the fusion protein cleavage site with phenylalanine (F)
at 117 position (OIE, 2012). However, in low virulent ND viruses (loNDV) there are less than
three basic amino acid residues between 112-116 positions with leucine is present at position
117.
NDV is economically important virus of poultry affecting more than 240 domestic and wild
species of bird worldwide (Kaleta and Baldauf, 1988), among them the commercial poultry is
highly susceptible to the disease (Jindal et al. 2009). NDV may cause infection in human and
typical signs include redness, swelling and excessive lacrimation from eyelid and conjunctivitis
(OIE, 2012). Waterfowl, such as ducks and geese are commonly considered as a natural reservoir
without showing any clinical symptoms, however, transmission of these viruses into chickens
may cause clinical symptoms of NDV (Dai et a. 2014; Zhang et al. 2011). Sometimes certain
3
mutations change non-virulent strains into virulent one and they may cause infections in
domestic poultry. However, recent studies have been reported that the vNDV strains can capable
of causing clinical disease in waterfowls both in ducks and geese (Dai et al. 2014; Xu et al.
2016). Similar data was confirmed this hypothesis in the outbreak of NDV in Pakistan during the
year 2011.
The serotype is same in all strains of NDV, however, they are genetically diverse and several
genotypes and their sub-genotypes are recognized (Diel et al. 2012; Miller et al. 2016).
Historically, the ND viruses are classified into two main classes, class I and II, which are further
grouped into genotypes and sub-genotypes (Diel et al. 2012). Class I viruses (15,198 nucleotides
genomic size) are mainly isolated from waterfowl are usually avirulent in chickens and
distributed worldwide (Alexander et al. 1992; Kim et al 2007; Liu et al. 2009; Miller et al. 2009;
Miller et al. 2010; Afonso et al. 2013). Class II contains mostly of virulent NDV strains and also
non-virulent isolates are recovered from various species (Diel et al. 2012). Viruses from class I
possess a single genotype, while there are 18 different genotypes (I-XVIII) in viruses belonging
to class II (Diel et al. 2012).
ND control is based on strict hygiene, monitoring systems and stamping out or vaccination. All
NDV infected countries may have imposed national monitoring and vaccination policies
depending on the geographical areas and the trade situation. Several devastating ND outbreaks in
Pakistan have occurred since first time identified in 1963 in commercial as well as backyard
poultry. Recently, the most devastating outbreaks were occurred during 2011-12, was traced first
time in several wild life species including Pigeon, Peacocks, Pheasant and Parrots (Miller et al.
2015) were affected and died due to ND. Although virulent form of NDV have been circulating
in the field and they are periodically recovered from pet/wild birds and commercial poultry. A
4
continuity of the outbreaks in wild birds make question of biosecurity and control as these
incidence of vNDV become consistent threat for the Pakistan’s poultry industry. In Pakistan
numerous outbreaks of the disease have occurred recently, despite intense vaccination and
imposing the good biosecurity practices. A great demand for good quality meat, low in cost
production, easy to cook and no religious barrier for its consumption are the main reasons of
flourishing the poultry industry worldwide. The control of infectious disease in poultry has been
extremely instrumental to reach the targets that can be met through the development of
biosecurity and routine application of vaccines. Therefore, the utmost desired area of research is
to modify existing vaccines and vaccination practices and develop new strategies to limit viral
transmission and protect against the disease.
In Pakistan, rearing backyard poultry is very popular as people like to have their own fresh eggs
and meat for their families. Last few years the transmission/spread of ND from the backyard
poultry to commercial poultry led to high economic losses, due to inability to meet the target for
export, In addition, backyard poultry that are not properly vaccinated provide a place for vNDV
to replicate the feces/residues, these birds further contaminate the environment and act as a
reservoir to spread the vNDV (Rehmani et al. 2015). In the past, Newcastle Disease vaccines
have provided good protection against morbidity and mortality (Miller et al. 2010). However, an
increased number of outbreaks are reported in vaccinated animals in the globe, as well as in
Pakistan. It may suggest that currently available live attenuated and inactivated ND vaccines
neither produce enough clinical protection against new isolates, nor they prevent viral replication
and viral shedding in vaccinated birds (Rehmani et al. 2015). Limitation to use live ND vaccine
includes thermal sensitivity, residual pathogenicity, reversion into virulent form and
neutralization by homologous antibodies. Contrary to that an inability to distinguish between
5
vaccinated and non-infected chickens on the basis of serological test hindered the disease
eradication program. Moreover, there are some drawbacks with the presently available
commercial vaccines such as improper/over-inactivation of inactivated vaccines or reversion to
virulent form, cold chain maintenance and introduction of various strain of live vaccines
(Rehmani et al. 2016). However, it is considered that genetically engineered vaccines have some
expectation to overcome these problems. The recombinant vaccines have advantages over
conventional vaccines of providing immunity without possibility of reversion into virulent form
and minimize the accompanying safety concerns. Development of vaccine homologous to the
virulent field strain is considered to work better in case of minimizing viral replication and
shedding as compare to standard LaSota vaccine (Garcia et al. 2016; Firouzamandi et al. 2016;
Sawant et al. 2011). Few studies have been published on the efficacy of vaccine prepared against
virulent NDV on plasmid based expression of fusion (F) and hemagglutinin-neuraminidase (HN)
protein (Sakaguchi et al. 1996; Heckert et al. 2002; Loke et al. 2005; Rajawat et al. 2008;
Sawant et al. 2011; Cardenas-Garcia et al. 2016; Firouzamandi et al. 2016). Moreover, different
studies concluded variable protection efficacy in chicken immunized with F protein alone or
combined with HN protein. However, immunization with both NDV antigenic determinant
glycoprotein proteins could improve the immunogenicity of DNA vaccine against ND (Sawant et
al. 2011). Therefore, the present study was focused on the protection induce by plasmid
expressing F and HN gene protein separately and co-delivered comparing with homologous oil-
based-inactivated vaccine and commonly used LaSota vaccine. The immunized birds were
evaluated for morbidity, mortality, cellular and humoral immunity. Viral replication/load, viral
shedding and histopathology of various organs were also performed of the dead birds.
6
CHAPTER 2
REVIEW OF LITERATURE
2.1 Viruses
NDV also known as avian paramyxovirus type-1 (AMPV-1) is a common disease of various
avian species. The ND viruses belong to family paramyxoviridae, genus Avulavirus and in order
Mononegavirals Figure 2.1 (Moyo, 2002). The paramyxoviruses are divided into ten serotypes
designated as APMV-1 to 10 on the basis of serological testing. ND virus has pleomorphic shape
and it consists of negative sense RNA and has single stranded, enveloped, helical and non-
segmented morphology (Alexander and Senne, 2008). Depending on class and genotype, NDV
has at least three genome length 15186, 15192, 15198 nucleotides (nt) (Czegledi et al. 2006;
Alexander and Senne, 2008; Wajid et al. 2015). The six transcriptional units of NDV include 3’-
leader-NP-P-M-F-HN-L-trailer-5’ (Miller et al. 2010).
Figure 2.1: Taxonomic organization of the paramyxoviridae
2.2 Pathogenesis
7
The ND viruses pathogenicity depend on several factors, but most significant factor is the strain
of the infecting virus, other factors includes age of bird, immune status, host species, stress, the
amount of virus transmitted, environmental conditions, secondary infections and transmission
route (Alexander et al. 2004; Saif et al. 2008). However, mortality in birds most importantly
depends on host susceptibility and virulence of infecting ND strain (Alexander, 2001; 2003).
Chickens are more susceptible to ND than other species, other birds like ducks shows no or mild
clinical signs, however, water fowl and shore birds are most resistant to ND and concluded the
natural reservoir for low virulence to ND viruses.
There are five pathologic form of ND viruses based on the clinical signs present in the infected
birds: (1) Asymptomatic mostly enteric form cause no disease (2) lentogenic form creates mild
or sub-clinical respiratory signs, (3) mesogenic ND strains cause disease in birds with mild
respiratory signs and occasionally nervous signs but with low mortality, 4) velogenic form neuro
is highly pathogenic causing signs mostly neurotropic and respiratory then followed by mortality
5) velogenic viscerotropic cause short incubation period and severe signs like hemorrhages in
intestinal lesions, proventriculus, cecal tonsils and trachea and causes almost 100% mortality in
flocks with high susceptibility (Alexander, 1997; Alexander and Senne, 2008; Saif et al. 2008;
Miller et al. 2015) are divided into viscerotropic and neurotropic velogenic, (4) the viscerotrpic
velogenic NDV (vvNDV) strains causing hemorrhagic intestinal lesions, (5) velogenic
neurotropic NDV (nvNDV) form involves respiratory and neurological disease followed by high
mortality rate.
2.3 Clinical Signs
Different ND strains produce different clinical signs and symptoms in birds. The incubation
period of ND viruses 2-6 days, however, it can be 2-15 days (Alexander et al. 2004). Clinically
8
the ND viruses produce severe clinical signs of infection that mainly depend on the age and
species of host, viral strains, pre-existing immunity of the birds, environmental condition that
could increase the decrease the pathogenicity of viruses, length of incubation period and severity
of the disease (Jaganathan et al. 2015). Highly virulent ND viruses are producing high morbidity
and mortality in chickens, psittacines and other species. The clinical signs in chickens greatly
vary depending upon the virulent ND viruses responsible for infection. Velogenic viscerotropic
NDV (vvNDV) strains form has distinctive feature of acute lethal infections of the
gastrointestinal mucosa accompanied by hemorrhagic lesions and death. Clinical signs induced
by vvNDV include weakness, acute depression, fast breathing, greenish diarrhea, loss of appetite
and paralyzed wing and/or legs. Head become edematous and especially edema of tissue around
eye, particularly of the lower eyelid is commonly seen in chickens. The presence of hemorrhages
throughout the gastrointestinal tract and especially in the lining of proventriculus is strong
evidence in favor of vvND virus’s infection. Velogenic neurotropic NDV (vnNDV) forms are
dominated by acute respiratory distress soon followed by neurological signs predominate such as
torticollis, unilateral or bilateral wings and legs paralysis, muscular tremors. Drop in egg
production, sudden depression, and loss of appetite is also seen in birds infected with vnND
viruses.
2.4 Diagnostic Techniques
NDV is a notifiable transboundary animal disease and its diagnosis is indispensable to
understand the epidemiology of the ND viruses and to develop applicable control strategies. Both
virus isolation and laboratory characterization are indispensable for the conclusive diagnosis of
the disease.
9
2.5 Virus Isolation
The ND virus’s isolation can be easily isolated from the oropharyngeal or cloacal swabs of the
infected. The tissues from the visceral organs like cecal tonsil, trachea, spleen, bursa etc can be
used for the isolation of viruses. The intestinal and brain samples may be processed separately
while other samples may be collected as a pool. Virus isolated form pigeon (PPMV-1) are
replicates in brain, at laboratory it may be used for diagnosis purpose.
At laboratory, the field samples are processed in a separate place distant from vaccine production
unit to minimize the chance of contamination (OIE, 2012). For virus isolation, tissue samples or
swabs are placed in isotonic phosphate buffer saline (PBS) with pH ranging from 7.0 to 7.4 and
mixture of antibiotics such as pencillin (2000 units/ml), streptomycin (2 mg/ml), mycostatin
(1000 units/ml), and gentamycin (50 µg/ml). The bacterial contamination is completely
eliminated by incubating the samples with antibiotics for about fifty minutes. The antibiotic
concentration may be increased few fold for cloacal swabs. Other protein based media used for
transport of virus and tissue homogenization include tris-buffered tryptose broths (TBTB) or
brain-heart infusion (BHI).
The supernatant fluids obtained from swabs or tissues are clarified through centrifugation for 20
minutes at 2000 rpm and room temperature. Virus multiplication is carried out through
inoculation of 0.2 ml clear supernatant into the allantoic cavity of 9 to11-days-old specific
pathogen free (SPF) chicken eggs. The inoculated eggs are incubated for 72-96 hours at 37 ºC.
The eggs candling is performed every day post-inoculation, when the embryo is found dead
should be chill to 4 ºC overnight. The virus identification in allantoic fluids is performed through
routine laboratory technique hemagglutination (HA) activity.
10
2.6 Virus identification
Allantoic fluid collected from chilled eggs is tested for haemagglutination (HA) activity (OIE,
2012). It is routine practice of all ND laboratories globally. All the ten serotype of APMV
(APMV1-APMV10) including ND viruses could agglutinate the chicken red blood cells (RBCs).
The ability of haemagglutinin part of the haemagglutinin/ neuraminidase viral protein to bind
with receptors present on membrane of red blood cells, result in clumping which is also called
haemagglutination. Moreover, the bacterial contamination and 16 subtype of influenza A viruses
could give HA. Treatment of contamination involves incubation of samples with increased
concentrations of antibiotic for a period of 2-4 hours. Centrifugation of samples or incubation
with high concentration of antibiotic cannot help in case of heavy contamination. Filters of 0.45µ
and 0.2µ (micron) size can serve this purpose (OIE, 2012). However, the ND strains can be
confirmed through HI test using NDV specific antiserum.At present the increasingly common
used technique in viral diagnostic laboratories, quantitative real time-polymrase chain reaction
(qRT-PCR) test is quick and reliable assay for the detection and genotyping of NDV.
2.7 Serological Diagnosis
NDV- specific antibody detection is primarily performed to evaluate the immune status of
chicken against the infection (Alexander et al. 2004; Saif et al. 2008; Alexander and Senne,
2008). Among the several diagnostic tests commonly used at virology laboratories are
hemagglutinin-inhibition (HI) test and enzyme linked immunosorbant assay (ELISA) for
measuring theNDV-specific antibody titers. The other tests may be used for detections are plaque
neutralization, agar gel immunodiffusion (AGID), virus neutralization in chicks embryo. In the
presence of anti-NDV antibodies, it involves the inhibition of agglutination of RBCs by 4 units
11
NDV antigen. The NDV-specific antibody level are generally high in field samples after recent
infections (Alexander and Senne, 2008; OIE, 2012).
2.8 RR-PCR based Diagnosis
Molecular based identification of viruses is commonly used in diagnostic laboratories globally.
Until now, several laboratory procedures have been developed to detect the APMV-1 viruses
from the allantoic fluid of embryonated eggs and tissue homogenates. However, for the proper
diagnosis of viruses, it is critical to detect both the presence and pathogenicity of the virus. In
1991, first attempt was made for detecting of the ND viruses from infected embryonated eggs
allantoic fluid by qRT-PCR (Jestin and Jestin, 1991). Since then a variety of techniques
including gel-based conventional PCR (Jestin and Jestin, 1991; Seal et al. 1995; Kho et al. 2000;
), restriction enzyme based procedure, ligase chain reaction (LCR) (Collins et al. 2003), RT-
loop-mediated isothermal amplification assay (RT-LAMP) (Pham et al. 2005a; Li et al. 2009),
fluorescent dyes (SYBR green) (Pham et al. 2005b) and light-upon-extension (Antal et al. 2007),
fluorogenic probe-based real time PCR (RT-PCR) (Aldous et al. 2001; Khan et al. 2010) and
rapid sequencing is useful for the claasificiation and pathotyping of ND viruses are circulating
worldwide. The earlier procedures had some drawbacks to conveniently detect all the ND strains
and major obstacle of low sensitivity. The ideal concern was to discriminate between the low and
high virulent viruses, although those procedures could not potentially classify the viruses
(Nanthakumar et al. 2000).
The advent of real time PCR (RT-PCR) using fluorescently labeled TaqMan probe is highly
sensitive and rapid diagnostic test used to detect viruses and determined pathogenicity.
This technology integrates the mechanism of polymerase chain reaction (PCR) with utilization of
flourescent reporter molecules so that the amplification of products during each PCR reaction
12
cycle can be recorded. Set of attributes including exceptional specificity and sensitivity, lower
contamination risk, consistent data and reduced time duration give superiority to real time RT-
PCR over conventional PCR (Navarro et al. 2015). Molecular diagnostic assay serves to provide
specific, quick and instant procedure for quantification as well as detection of viral RNAs. These
features have made qRT-PCR is an obligatory laboratory tool for the diagnosis of predominant
animal and human viral pathogens (Hoffmann et al. 2009). The cleavage stie of F gene is a major
determinant for pathogenicity (Glickman et al 1988). So F is target gene for detection and
pathotyping of ND strains. In various laboratories, two types of USDA-validated RT-PCR assays
based on F and matrix (M) genes are extensively used for detection of APMV-1 viruses (Kim et
al. 2006; Kim et al. 2006, 2008; Farkas et al. 2009; Rue et al. 2010; Khan et al. 2010). The M
gene assay was designed mainly as a screening assay to detect most ND viruses, mainly class II,
regardless of pathotype (Miller et al. 2010). This assay can be used to detect low virulent NDV
(LoNDV), vNDV and pigeon paramyxovirus type-1 (PPMV-1). While the F gene assay can only
detect the vND strains by binding to cleavage site of F protein gene (Kim et al. 2006). However,
due to genetic variability in M gene probe binding site, the loND strains from class I isolated in
US were not detected by M gene probe (Kim et al. 2007, 2008). Lack of detection due to
genomic modification of ND strains that cause the loss of probe binding site. Recently, It has
been shown that F gene assay fail to detect PPMV-1 viruses (Kim et al. 2006). The sequence
analysis identified four mismatched nucleotides of the F probe binding site of few PPMV-1
strains apparently blamed for test failure (Miller et al. 2010). New designed probe was capable
of detecting the vPPMV-1 viruses from the dove (Kim et al. 2008).
13
2.9 Transmission
NDV is a contagious disease, primarily transmitted by shedding of viruses through bodily
secretions from the eye, nose and mouth of infected bird by direct contact with healthy birds.
Carrier birds are the main source of virus spreading through their feces that easily contaminated
the environment. Airborne vNDV transmission is also considered one of the substantial disease
spreading routes (Li et al. 2009). As reported in the ND epidemic in Northern Ireland (McFerran,
1989), and in England during 1970-71 (Hugh-Jpones et al. 1973). The environmental factors like
temperature, humidity, and stocking density could be considered over the transmission of NDV
through this route. The suitable climatic conditions are very important to establish this route (Li
et al. 2009). However, this could be a big threat to not only the commercial poultry, where the
farms are in close proximity, it could also affect the free-roaming backyard poultry. Movement
of infected birds and human among poultry flocks and contaminated equipment and materials are
the main source of virus transmission.
2.10 Newcastle disease virus classification
The two systems utilized for classification of NDV worldwide includes Aldous and Diel groups.
According to Aldous and his coworkers, ND viruses comprised of six lineages and further
divided into thirteen sub-lineages and also latterly included three more sub-linages (Aldous et al.
2003; Snoeck et al. 2009). The second system suggested by Diel groups based on the complete
fusion protein gene nucleotides diversity or full genome sequences, ND viruses are distributed
into two common classes, class I, II. Currently, there is a sinlge sub-genotype belongs to class I
and 18 genotypes in class II and some genotypes further divided into sub-genotypes (Diel et al.
2012; de Almeida et al. 2013; Courtney et al 2013; Snoeck et al. 2013; Miller et al. 2015; Wajid
et al. 2015). Basedon the new classification system, 10% (at nucleotide level) is needed on the
14
mean inter population evolutionary distance among group of ND viruses is used as a standard for
assigning a new genotypes and sub-genotypes. Second point of the criteria of the requirement at
least four viruses form distinct taxonomic group with phylogenetic bootstrap of the define node
>60 with the above cutoff value. Highly pathogenic influenza viruses were classified using the
bootstrap and value and mean inter-population evolutionary distance (WHO/OIE/FDA and
Evolution Working Group, 2008). Class I in chickens is mainly avirulent and has historically
been isolated from domestic and waterfowl (Kim et al. 2007; Diel et al. 2012). However, vast
majority of vNDV strains are belongs to class II in the globe.
2.11 Epidemiology
ND is considered pest of Asia, endemic in most part of Asia, Africa and some countries of South
and North America. Some countries are free of ND in poultry including Canada and America,
maintained their strict import of materials and eradication program of infected animals. After
discovered simutaneously in Java, Indonesia and Newcastle upon Tyne region in England during
1926 (Kraneveld, 1926; Doyle, 1927), the vNDV was spread throughout the world and causing
disease in birds (Seal et al. 2000; Alexander et al. 2004; Saif et al.2008). Some avian species are
commonly infected with vNDV e.g. pigeons, cormorants, and parrots also known as psittacine
species are considered the main source of infection in poultry. NDV strains with low virulence
are coomonly isolated from waterfowls that play an important role in spreading these viruses.
Virulent strains of NDV could infect animals other than birds, i.e. causing conjunctivitis in Man.
The vNDV infection is reported in more than 250 species belonging to 27 out of 50 orders of
class birds.
Several panzootic have occurred in birds in the world since 1926. The first panzootic was spread
very slowly and it took over twenty years to become the proper panzootic. In 1920s, the ND
15
viruses of genotypes II, III, and IV, class II were responsible for first ND panzootic (Ballagi-
Pordany et al. 1996). The second panzootic was caused by ND viruse mainly of genotype V
during 1970s and it was spread throughout the world within four years (Herczeg et al. 2001;
Czegledi et al. 2002; Cac et al. 2003). During 1970s, the viruses emerged for the very first time
in Central and South America; the similar viruses appeared and caused disease in Europe same
time. The genotype V viruses also caused disease in Florida during 1971 and 1993 and California
1971 to 2002, the similar viruses still circulating in Central America and Mexico where the
viruses isolated recently were designated as a new sub-genotype Vc (Perozo et al. 2008; Absalon
et al. 2012; Absalon et al. 2014). In Belize, the ND viruses isolated in 2008 were belonging to
sub-genotype Vb in genotype V (Susta et al. 2014). During late 1970s, genotype VI of virus was
originated from affected pigeons and resulted in the third ND panzootic (Czegledi et al. 2002).
These viruses were primarily reported in various regions of the Middle East and laterally were
spread into Europe (Biancifiori and Fioroni, 1983), where the similar viruses were isolated and
responsible for many outbreaks in avian species (Alexander et al. 1985). The emergence of
viruses is still unknown, however, multiple events occurred for transmission of PPMV-1 viruses
from chicken to pigeon (Ujvari et al 2003; Aldous et al. 2004). vND viruses of genotype VI
mostly associated with pigeon and dove, however are found in multiple species (Alexander,
2011). The fourth panzootic of ND was started in early 1990s, the vNDV strains from genotype
VII was responsible (Yu et al. 2001; Liang et al. 2002; Lien et al. 2007; Liu et al. 2007). Other
genotypes of NDV i.e. IX, X and XIII are isolated in few countries of Southern Africa (Herczeg
et al. 1999), China (Liu et al. 2003), and Taiwan (Tsai et al. 2004).
In 2011, virulent strains of NDV of new sub-genotype VIIi of genotype VII rapidly spread in
Middle East and Asia and caused outbreaks in many avian species suggesting the existence of 5th
16
panzootic of ND viruses (Rehmani et al. 2015; Wajid et al. 2015, 2016; Miller et al. 2015).
During the same time, the highly similar viruses were isolated mainly from many avian species
in Pakistan, Indonesia and Israel during 2011-12. The emergence of rapidly spreading of this
new sub-genotype VIIi represents a significant thread to the poultry industry. The higher similar
viruses have been detected in East European countries including Turkey, Georgia, Bulgaria
(Fuller et al. 2015) and also in Indian peafowl (Desingu et al. 2016). However it is unknown or
little has been to understand the evolution and maintenance of new genotype (Alexander et al.
2012).
2.12 Pakistan scenario
The ND is endemic in Pakistan, continues outbreaks of vND viruses have been reported from
commercial poultry flocks, domestic and wild birds during 2011-16 ( Rehmani et al. 2015; Wajid
et al. 2016a; Wajid et al. 2016b; Wajid et al. 2015; Rehmani et al. 2015; Miller et al. 2015).
NDV strains isolated from birds in Pakistan all are virulent in nature on the basis of ICPI, MDT
and fusion gene cleavage site. Interestingly, in our current studies spanning over six years of
disease monitoring no avirulent strains have been isolated from any investigated bird.
Virulent NDV in Pakistan has been reported since 1971 as the commercial poultry began in
Karachi, the southern coastal region of Pakistan. However, the mortality due to NDV outbreaks
remained as an endemic disease in the country though the annual growth rate in the commercial
poultry production has been ranged from 10% to 20% since 1975 to date. Due to unavailability
of the high technical skills and expertise in the field till late 1990’s, the LaSoat and ND clone are
commonly used vaccines in poultry sector. However, the Muktesware strain (mesogenic)
prepared by the local production units used for vaccinating backyard poultry. This strain was not
characterized on molecular basis up to 2008 (Khan et al. 2010). The ongoing research work on
17
ND in collaboration with SEPRL provides an opportunity to submit the epidemiological work on
the recent outbreak (from 2011 to date) emerged in the northern areas of Pakistan. The intensity
of the disease has slowed down after May, 2012; however, the reporting of cases with disease is
still continued from different parts of the country. This outbreak was peculiar in the sense that
for the first time the disease affected the wild birds like pheasants, peacocks and different breeds
of parrots reared in captivity and resulted in heavy mortality of 40% to 60% and morbidity in the
public and private zoos. Interestingly, the peacocks in Thar (Sindh), the southern region of
country, reported to be affected by the disease during late 2012 and early 2013. Virulent NDV is
widely distributed in different geographic environments, latitudes and production systems across
Pakistan. However, the mortality and morbidity greatly varied depending on the vaccination
using live attenuated vaccines either prior to the incubation period or during the early post
outbreak may cause uneven ( more or less) losses to the farm. Most notably, high mortality
>60% is in broiler production flocks, even with intensive vaccination practices. However, the
infection is occasionally observed in small poultry flcoks and in non-poultry avian species.
Moreover, the percentage mortality was higher and infection was more common in the flocks
under controlled environment than the opened houses in Punjab province. But no confirm data is
available on this issue except one factor that farmers try to keep the temperature of the house
warmer or higher in winter season, may cause the disturbances in cross ventilation and the birds
remain under stress. Most of the reported outbreaks (60-80%) occur during winter season, the
other optimum weather suitable for the onset of the disease is when there is a variation of 10 to15
°C in ambient temperatures during the day and night. ND is considered endemic in the country,
however the epidemiology of the vNDV is not well understood. The evidence supports the idea
18
that the viruses shed by vaccinated birds may act as virus reservoir of poultry (Rehmani et al.
2015).
2.13 Vaccine based on Biotechnology
The emphases are needed to learn more about the vaccine development that prevent infection,
and replication and shedding of virus. Numerous efforts have been made to developed the
genotype-matched vaccine (homologous to field virulent NDV strain), that reduced viral
shedding more efficiently than commercially used LaSota vaccine (Kim et al. 2013; Cardenas-
Garcia et al. 2015). Although, the classical live or inactivated vaccines may protect birds from
vNDV infection in adequate doses, but failed to completely prevent the viral replication and
shedding (Marangon et al. 1997; Alexander, 2001; Kapczynski et al. 2005; Cornax et al. 2012;
Dortmans et al. 2012). The current ND vaccines strains phylogenetically belong to genotype II
have been used for more than 60 years. The failure of vaccination to control ND in the field is
controversial, some studies argued the inadequate application (Dormans et al. 2012), however,
others studies have suggested genotype-matched (homologous) vaccine could significantly
reduse the challenge virus shedding when challenge with phylogenetically similar field ND strain
(Miller et al. 2009).
The approaches reverse genetics system has been widely used with the aim of generating
attenuated NDV, potentially applicable as vaccine. Attenuated mutant NDV generated by site
directed mutagenesis of nucleotide sequences encoding specific amino acid in NDV structural F
protein. Though and not quite unexpected the reversion into virulent form. Although,
engineering of safe live viral ND vaccines may require a number of attenuating mutations which
are distributed throughout the genome (Panda et al. 2004). NDV was rescued by reverse genetic,
which provide protection against infection. Chimeric viruses, with genomic region in challenge
19
strains replace by the corresponding ones of the vaccine strains, were shown to have no impact
on property of the virus.
Although, the alteration of cleavage site alone in F protein from lentogenic/avirulent strain to
that of virulent NDV strain didn’t convert the virulent strain into virulent after checked by a
natural route of infection (Panda et al. 2004). However, HN, W, V protein of NDV have reported
to be responsible for virulence of virus (Park et al. 2003). The viral infectivity is greatly
influenced by interaction of HN with the F protein (Takimoto et al. 2002). Recent studies have
concluded that the HN protein affects pathotype of virus and might also have a contribution in
the NDV virulence (Millar et al. 1988). However, the great sequence similarity has been reported
in the core neuraminidase (NA) domain of HN proteins taken from different paramyxoviruses.
The amino acids (aa) length of hemagglutinin-neuroaminidase (HN) protein of NDV strains
greatly vary and different strains have a length of 571, 577, 580, 581, 585 and 616 aa. The
sequence analysis of HN gene has revealed large open reading frame (ORF) (616 aa long) in low
virulent enteric strains of NDV and at its C-terminus have additional 45 aa in comparison with
virulent (571 aa) and less virulent (577 aa) NDV strains. In avirulent NDV strains (D26, Ulster
and Queensland), the precursor HN is of 616 aa residues and it is converted into biologically
active HN protein after post translational cleavage.
2.13.1 DNA vaccine
DNA vaccines are bacterial plasmid constructs which has been described as a third generation of
vaccines (Hasson et al. 2015). DNA vaccine has several advantages like ease of transport and
administration, reduced cost, works in the face of maternal antibodies, vaccinated and infected
animals can be differentiated from each other, reduce the risk of infection in animals, ability to
induce both cellular and humoral immunity (Cardenas-Garcia et al. 2016). In addition, several
20
plasmids have the ability to express different genes can be incorporated into a DNA vaccine. The
DNA vaccines exhibit the potential advantage of expressing a specific immunizing protein gene
of the infectious agent.
The ND viruses contain two surface functional glycoproteins F and HN play important role in
virus virulence and virus-cell interaction (Heiden et al. 2014). They form spike-like projections
on cell surface and are the NDV neutralizing antigens. The fusion protein alone or with HN
protein is the primary target of ND DNA vaccine development. The NDV glycoprotein, the
fusion (F), encoded by fusion gene and derived by inactive precursor F0 is glycosylated and
proteolytically cleaved by host proteases into disulfide-linked functionally avtive F1 and F2form.
Cleavage is major NDV virulence determinant and necessary to initiate infection. Cleavage of
virulent viruses is determined by uniquitous subtilisin like protease, whereas, in avirulent viruses
is occurs by trypsin like enzyme. The varying NDV pathogenicity (velogenic, mesogenic and
lentogenic) is attributed to difference inaa residues at cleavage site (Rehmani et al. 2015). Theaa
residues at F protein cleavage site of vNDV at position 112-R-K/R-Q-K/R-R↓F-117 (OIE 2012).
The fewer basic aa residues are present at those positions in less virulent viruses (loNDV) and
leucine at position 117.
The HN protein of NDV is glycoprotein with multiple functions and plays significant role in the
progression of infection including virus attachment to the host cells and also fusion promotion
activities. It recognizes the sialic acid containing host cell surface receptor followed by fusion
with host cell membrance (Connaris et al. 2002). The NDV-HN is type II homotetramateric
membrance protein and it contains transmembrane domain at N-terminal, stalk region and
neuroaminidase (NA) domain with enzymatic activation. Both proteins are the main target for
DNA immunization against NDV (Morgan et al. 1992). However, plasmid expressing F protein
21
alone or/with HN protein provide variable immunity in birds against vND viruses (Sakaguchi et
al. 1996; Loke et al. 2005; Rajawat et al. 2008; Arora et al. 2010; Sawant et al. 2011;
Firouzamandi et al. 2016; Cardenas-Garcia et al. 2016). Sawant et al (2011) demonstrated that
co-administered of both plasmids expressing NDV antigenic determinant proteins F and HN
have been described induces high protection in birds than alone. The previous results obtained by
Arora et al (2010) also concluded that the co-administration of NDV/F and NDV/HN proteins
induced 73% protection as compare to 66% and 20% by NDV/F and NDV/HN respectively
alone. Another study by Gowrakkal et al (2015), the birds immunized with F and HN alone
revealed 60% and 20% survival rate as compared to co-administration of both proteins was 80%.
Recently study by Cardenas-Gracia (2016) observed 83% protection when birds were immunized
with F protein alone after two vaccine application.
2.13.2 Mechanism of DNA vaccine
DNA immunization is a technique that used to efficiently induce the potent cellular and humoral
immunity to target antigen when injected into the host cells. It is well documented that the DNA
plasmid encoding a gene of interest when transfected into the host cell, it results in the
subsequent synthesis of encoded polypeptide that lead to the stimulation of humoral and cellular
immune response. When injecting the genetic material, very small amount of host cells receive
the antigen and produced its product. The desired gene within the plasmid DNA is typically
under the control of mammalian promoter i.e. SV40 or CMV for transcription. However, the
precise mechanisms that use the molecular and cellular pathways for processing of internalized
antigens and their presentation to T cells are not fully understood (Liu, 2003). There are several
factors that affects the immune response induced by plasmid DNA immunization are site of gene
delivery, method used for DNA vaccine transfer, dose of plasmid DNA and the administration of
22
booster vaccination. The plasmid can be directly administered into the resident somatic cells
(myocytes and keratinocytes) at the site of plasmid DNA injection or it can be directly injected
into antigen presenting cells (dendritic cells, DC). If plasmid DNA is directly delivered into DC
and processed in, then the encoded antigens are directly exposed on the cell surface by both
MHC class I and II to CD4+ and CD8+ T lymphocytes respectively. The APCs have a dominant
role in presenting the encoded antigen of interest on MHC molecules to induce cellular and
humoral immunity. Through the lymphatic vessels, the antigen loaded APCs travel to the
draining lymph node, where they presented the processed protein antigen to naïve T lymphocytes
through MHC pathways. This migration of class II MHC molecules rich APCs offer an effective
mechanism through which the protein antigens from the muscle, mucosa and skin to T helper
lymphocytes located in the lymph nodes. If the plasmid DNA is taken up by the stromal cells at
the immunization site, then the encoded protein antigens processed in and secreted from
transfected muscle cells and indirectly captured by the APC cells such as DC and then cross
presented on MHC II molecules to CD8+ T lymphocytes.
23
Figure 2.1: The scheme of antigen presentation to immune system and transfection into muscle
cells (myocytes) and direct transfection of Antigen presenting cells (APC).
2.13.3 Delivery Pathways
Several mechanisms have been described regarding the uptake of plasmid DNA into animal
cells. Among several approaches, one approach, through standard hypodermic needle injection
into various animal tissues is the most effective. Plasmid DNA has been introduced into the
animal cells by two most fundamentally various approaches, the saline injection (Chuang et al.
2013) and Gene gun delivery (Wahren ad Liu, 2014; Ault et al. 2012) of plasmid DNA. The
intramuscular delivery of plasmid DNA containing transgene is usually through in hind leg
quadriceps or tibialis anterior muscles of animals is commonly used since early 1990s (Chuang
et al. 2013). Another method the plasmid DNA vaccine containing F gene encapsulated in a 500
nanometer (nm) Ag@SiO2 hollow inorganic nanoparticles were used in mucosal immunity. The
nanoparticles based DNA delivery method expressed in vitro and sustainably released the
plasmid DNA after initial burst release. In vivo experiment revealed high titers serum antibody
after intranasal immunization of birds with Ag@SiO-NPs-pFDNA. This could be an efficient
and safe delivery method of plasmid DNA to induce mucosal immunity.
2.13.4 Components of a DNA Plasmid
The DNA vaccine which is also known as genetic vaccine requires some essential component for
the expression of desired gene. Optimizing plasmid is needed for the high expression of
immunogene in the transfected cells. The plasmid is composed of gene of interest is under the
control of strong viral promoter to get the optimal expression in the transfected cells, i.e. simian
virus 40 (SV40) or cytomegalovirus (CMV). Rabbit beta-globulin and bovine growth hormone
polyadenylation sequences are added into plasmid for transcriptional termination signal (Alarcon
24
et al. 1999; Robinson et al. 2000). Plasmid can also construct as multicistronic vector for the
expression of more than on gene of interest and sometime one desired gene and other
immunostimulatory protein i.e. cytokines and chemokine genes as adjuvant (Lewis and Babiuk,
1999; Sawant et al. 2011; Cardenas-Garcia et al. 2016). Second, the origin of replication
allowing plasmid to propagated within the transfected cell. For plasmid selection during bacterial
culture, it consists of a bacterial antibiotic resistant gene (selectable marker). A polylinker, where
gene of interest is clone, also called multiple cloning sites contain restriction enzymes site to
cleave.
2.13.5 Approved DNA Vaccine for Animal Use
DNA vaccines have made significant developments in veterinary practices where four DNA
vaccines have already been approved to treat some animal disease. One of them is used for gene
therapy application, one is available for cancer immunotherapy and two are prophylactic
vaccines against animal infectious diseases (Pereira et al. 2014). These veterinary DNA vaccines
were recently licensed in USA, Canada and Australia. In 2003, Center for Disease Control
(CDC) of United State developed an equine DNA vaccine, the purpose was to protect horses
against a zoonotic mosquito transmitted airborne West Nile Virus (WNV). In 2005, the US
Department of Agriculture (USDA) licensed this vaccine and manufactured by West Nile—
Innovator®/ Firt Dodge Animal Health Laboratories, Fort Dodge Lowa. This vaccine encoded
two WNV E glycoproteins, prM and E protein from the NY99 strain of were paste into VR-1012
expression vector with promoter CMV. In 2005, another DNA vaccine was licensed by Canadian
Food Inspection Agency (CFIA) against Infectious Hematopoitic Necrosis Virus (IHNV)-is
responsible for infectious diseases in Salmonid fish industry in Canada and USA. A portion of
IHNV-G proteins gene was encoded in expression vector under the control of CMV and with
25
rainbow trout interferon regulatory factor (IRF1A) promoter also disclosed, it was helped to
express the encoded gene in fish cells. Aqua Health Ltd (Canada) with affiliation of Novartis had
developed a DNA vaccine (Apex-IHN®) for IHNV against Salmon.
Another plasmid DNA-based hormone releasing hormone (GHRH) was constructed for gene
therapy for Swine by Australian Pesticides and Veterinary Medicines Authority approved and
licensed in 2008 (Draghia-Alki et al. 2003). The plasmid encoded GHRH was administered in
pig via electroporation for the expression of growth hormone. The first licensed therapeutic
plasmid based vaccine is commercially known as LifeTide® SW5 (VGX Animal Health). In
2010, US Department of Agriculture (USDA) approved and licensed commercially first
therapeutic DNA vaccine known as ONCEPTTM (Merial) against dog oral melanoma with
purpose to increase the survival time of dog with stage II and III of disease. The plasmid-based
DNA vaccine was developed with non-canine gene for tyrosinase was inserted in plasmid
backbone. The human melanocyte protein tyrosinase gene was encoded in plasmid; this type of
protein is present on melanoma cancer cells in dog and human. The plasmid with human
melanocyte protein tyrosinase gene was administered to dog, the dog immune system triggered
against the encoded gene in plasmid. Tyrosinase protein of human is very similar to dog, after
immunization it trigger an immune response against dog’s tumor (Bergman et al. 2003; Liao et
al. 2006).
Table 2.1: Approved DNA vaccine for Animal health
Type Vaccine target Species Product Name
Licensed
Country and
Date
Route Benefits
Prophylactic Vaccine
West Nile Virus (WNV)
Horses
West Nile—
Innovator®/ Firt Dodge Animal
Health
USA, 2005 Intramuscular
Protective antibodies
production in immunized
horses
Prophylactic
Vaccine
Infectious hematopoietic
necrosis virus
(IHNV)
Salmon Apex-IHN®) Canada, 2005 Intramuscular Improves animal welfare
Gene Therapy Melanoma Dogs ONCEPTTM Merial Australia, 2008
Intramuscular
followed by
electroporation
Treat oral tumor in canine
and improves survival time in
dogs
26
Immunotherpy of cancer
Growth hormone
releasing hormone
(GHRH)
pig
LifeTide® SW5
(VGX Animal
Health)
USA, 2010 Intradermal
Decrease morbidity and
mortality and increase
productivity
2.14 Live viral vector recombinant vaccine
Live attenuated recombinant vaccine contains virus in one or more than one inactivated or
deleted genes or a foreign gene from another disease causing agent, called as vaccine vector. The
infectious agents became attenuated and have no more potential to cause the disease. So the
vaccines will remain stable and the infectious agent cannot be reverted to its pathogenic form
(Uzzau et al. 2005). Live viral vectors are now proved to be effective vaccine against infectious
diseases including NDV in poultry. The successful licensing of viral vector vaccine for
prevention and immunization of infectious diseases of poultry proves that the technology can
work. Reverse genetic technology having question, is whether the issue of safety, efficacy,
vector immunity, genetic stability, ease of use and cost of manufacturing can be addressed
adequately and satisfactorily. Compared to the conventional vaccines, viral vector have some
advantages i.e. induction of both humoral and cellular immunity, more vigorous than inactivated
vaccines or subunit vaccines.
Live virus vector is most preferred way for expressing or replicating the said proteins in
vaccinated birds. Many live virus vectors like pox viruses, herpes viruses of turkey (HVT),
infectious bursal disease viruses (IBDV) and avian retroviruses harboring genes encoding fusion
(F) protein or hemagglutinin-neuroaminidase (HN) protein has been reported in the art. Pox
viruses which are species specific like, pox virus is vaccinia, fowl pox virus (PFV) and pigeon
27
pox virus (PPV) are considered suitable vectors harboring an immunogenic NDV gene (Ogawa
et al. 1990).
Recently, novel approaches have been introduced, Zhao and his colleagues (2014) made
NDV/ILTV (Infectious Laryngotracheitis virus) live attenuated vaccines based on LaSota
vaccine strain, with expression of glycoprotein D (gD) and B (gB) of ILTV using reverse genetic
technology. At the same time another study by Basavarajappa et al. (2014) using the strategy of
bivalent recombinant vaccine containing NDV/ILTV using NDV backbone by designing rNDV
gB, rNDV gC and rNDV gD which expressed ILTV glycoproteins gB, gC and gD respectively.
This novel bivalent recombinant vaccine was safe, stable, immunogenic and provided complete
protection against challenge with NDV and ILTV (Zhao et al. 2014).
2.14.1 Herpes virus of turkey (HVT)
Herpes of turkeys (HVT) is an alpha herpesvirus, nonpathogenic virus of domestic turkeys
(Witter and Solomon, 1972). It is widely used live vaccine against Marek’s diseases (MD), three
serotypes including virulent MDV-1 (etiological agent of MD), MDV-2 (Gallid herpesvirus 3)
(Cui et al. 2013), and MDV-3 (Herpes virus of turkey, HVT) (also known as Meleagrid
herpesvirus 1. MDV-1 is pathogenic in chicken and causes contagious neoplastic disease while
the other two types is nonpathogenic or of low pathogenicity in chickens (Calnek and Witter,
1991).
HVT has been used as vaccine vector for expression of protective antigens, typically the F and
HN glycoprotein (or both) of NDV (Morgan et al. 1992; Morgan et al. 1993; Palya et al. 2012);
HA gene of highly pathogenic avian influenza (HPAI) H5N1; highly pathogenic H7N1; NA gene
of H9N2 or of a cytokines to manipulate the cytokine’s immune response (Tarpey et al. 2007).
Currently many commercial vaccines are available in the market that comprises HVT as a vector
28
expressing a foreign gene, for example: for NDV, Vectormune® HVT/NDV F-antigen (Ceva),
Innovax® ND-SB (MSD Animal Health), for IBDV, Vectormune® HVT/IBD VP2-antigen
(Ceva), Vaxxitek® HVD/IBD (Merial), for infectious laryngotracheitis virus, Innovax® ILT
(MSD Animal Health).
HVT is commonly produced in vitro culture of chicken embryo fibroblast cells (CEFs) for large
scale production. In vitro and in vivo replication of HVT is carried out in monolayered CEF’s
and lymphoid cells peripheral blood lymphocytes (PBL’s). HVT induces an immune response of
long duration, typically intended at the cellular, not at the humoral immune response.
Recombinant HVT (rHVT) has been used as a vaccine vector expressed F or HN glycoprotein or
both of NDV (Morgan et al. 1992; Morgan et al. 1993; Sondermeijer et al. 1993; Heckert et al.
1996; Reddy et al. 1996). The rHVT vaccines are advantageous as they induce strong cell-
mediated immunity (CMI) and are safe for in ovo administration (Reddy et al. 1996). A vaccine
against any pathogenic disease in poultry, comprising HVT vector will generate an immune
response against the expressed heterologous gene, as well as against vector itself.
2.14.2 Infectious bursal disease virus (IBDV)
Different approaches of vaccination have been investigated to overcome NDV in the globe.
Numerous tactics have been applied to control the incidence of vNDV outbreaks in the countries
where the disease is endemic. Recent studies showed that the IBDV as a potential antigen
delivery system have been explored as a novel vaccine vector (Li et al. 2014). The virus belongs
to genus Avibirnavirus (family Birnaviridae) and has dsRNA genome (Delmas et al. 2004).
Recombinant IBDV (rIBDV) have been used to express epitope of foot and mouth disease
(FMDV) and human hepatitis C virus (HCV) (Upadhyay et al. 2011). Recently Li et al. (2014)
successfully recovered recombinant IBDVs expressing HN neutralizing epitopes of NDV in the
29
PBC and PHI loops of the VP2 and VP5 regions with the aim of developing safe and efficient
vaccine vector against NDV. The NDV epitopes were successfully recovered and were
neutralizing antibody against both NDV and IBDV in immunized chickens (Li et al. 2014).
IBDV involved in the destruction of B lymphoid cells thus lead to immunosuppression, the
major role of vaccine failures and susceptibility to other infectious agents (Lukert and Saif,
1991). Many characteristics build the avirulent IBDV stain as significant vaccine vectors. IBDV
provides a low cost vaccine with high efficacy, safety, natural heat stability, easy production,
easy to use through drinking water or spraying makes it widespread vaccine across the globe.
Viral vector such as pox virus and herpesvirus encode a large number of proteins, whereas the
genome of IBDV is very simple and encodes only few proteins. Hence, offers less competition
between foreign expressed antigen and the vector proteins to generate immune response (Li et al.
2014). The IBDV replicates in cytoplasm so integration into the host genome do not occur.
Using reverse genetic system, it was demonstrated that recombinant IBDV viruses have the
potential of serving as bivalent vaccines.
2.14.3 Fowl pox virus (FPV)
Recombinant fowl pox virus (rFPV) used as a vector to express immunogenic proteins from
NDV had licensed as the first commercial recombinant vectored vaccine (McMillen et al. 1994;
Yamanouchi et al. 1998). Fowl pox virus (FPV) and canary pox virus (CPV) belonging to the
genus Avipoxviruse and subfamily Chordopoxviridae of the Poxviridae family. The virus causes
disease in domestic, wild birds and poultry, however, in later mortality is usually low, can reach
up to 50% in flocks under stress (due to secondary infection). FPVs have been used as viral
vaccine vector against diseases in human and veterinary animals, its ability to endure multiple
30
genes inserts the most significant characteristic that make the FPVs as auspicious vaccine vector
(Weli and Tryland, 2011).
FPVs are oval shaped, large, enveloped dsDNA viruses and easily replicate in the infected avian
cell’s cytoplasm and on the chorioallantoic membrane of embryonated eggs. FPVs cause skin
lesion which vary greatly from papules to nodules in infected wild and domestic birds (Tripathy
et al. 2000). A recombinant fowl pox virus have been used against several poultry disease like
avian influenza (Taylor et al. 1988), NDV (Taylor et al. 1990) and IBD or Gumboro disease
(Bayliss et al. 1991), and confer protective immunity in chicken.
Genetic engineering of FPVs as a vaccine vectors have a significant application in the poultry
industry. Recombianant fowl pox virus (rFPV) was successfully constructed for the expression
of fusion and hemagglutinin-neuraminidase proteins from velogenic strains of NDV to protect
chicken against NDV (Taylor et al. 1996; Sun et al. 2008; Sun et al. 2006). A single inoculation
of rFPV expressing NDV-F and HN in SPF birds at one day of age protected commercial broiler
chickens by inducing significant level of hemagglutinin-inhibiting antibody for their life time
(maintained to 8 week post inoculation), even in the presence of maternal immunity against
NDV or its vector (Paoletti, 1996; Taylor et al. 1996). TROVAC vector derived from FPV
vaccine strains have been licensed by the USDA (TROVAC-NDV), has been used as a vector in
broiler chickens against NDV, replicating safe, efficacious, and economically feasible at typical
dose of 1X104 pfu given at day-of-age.
The FPV-NDV vaccine safety and efficacy has been evaluated both in vitro and in vivo and its
cell culture and chicken embryonated eggs passage genetic and phenotypic stability have been
demonstrated (McMillen et al. 1994). The FPV-NDV vaccine was administered intramuscular or
through eye drop, effectively immunized against vNDV and virulent FPV (vFPV) challenge. The
31
recombinant FPV-NDV vaccine has been found effective and safe vaccine for poultry as can be
witnessed through lack of shed and spread and failure to reversion into virulent form (McMillen
et al. 1994). The results of study have shown that FPV has potential to provide vector system for
the delivery of foreign epitopes (F or HN) of NDV. In term of protective immunity to NDV by
rFPV as concluded by Boursnell et al. (1990), the chickens tested were 100% protected against
challenge with vNDV strain.
2.14.4 Avian Adeno-Associated virus (AAAV)
The avian adeno-associated virus (family Parvoviridae) is a replication-defective non-pathogenic
virus and is a viral vector successfully used for delivery of foreign gene (Perozo et al. 2008a).
During the last decade, the parvoviruses established as a leading trend in human medicine, as 15
different adeno-associated viruses (AAV) vector in at least 20 clinical trials had been
accomplished (Snyder and Francis, 2005). They are nonpathogenic, can accommodate a long
DNA fragment and can infect wide range of cell types without interfering with the maternal
antibodies. Therefore, they can act as a suitable viral vector for transgenic expression of foreign
genes (Synder, 1999; Muzyczka, 2001). The avian AAAV, a parvoviruses family member, has
been characterized completely and is being used as reporter gene delivery in embryo cells of
chicken (Estevez and Villegas, 2004; Estevez and Villegas, 2006). Previous studies demonstrated
that AVVV can be a promising candidate used for the gene therapy in human, based on the lack
of pathogenicity and long lasting high level of trans-gene expression (Wright et al. 2003; Synder
and Francis, 2005). The generation of rAAAV for transgenic expression of HN protein of NDV
and their ability to generate protective immunity in chickens has been assessed by Perozo et al.
(2008a). When serum of birds vaccinated with rAAAV-HN (NDV) was tested through Enzyme
linked immunosorbent assay (ELIZA) and hemagglutinin inhibition (HI) test, revealed a
32
systemic immune response. The challenge study with virulent viscerotropic NDV (vvNDV)
strains in commercial broiler chickens provided up to 80% protection bird vaccinated primed
inovo. Long lasting high levels of transgenic expression and lack of pathogenicity represent a
rAAAV promising candidate for poultry vaccination (Wright et al. 2003).
The study objectives are:
1. Biological and genetic characterization of NDV circulating in Pakistan will be accomplished
through two different sub-objectives.
A) Nucleotide sequencing of 30 isolates through complete fusion (F) and hemagglutinin-
neuroaminidase (HN) gene.
B) Biological characterization of 30 isolates using pathogenicity assays to test the virulence,
mean death time (MDT) and intracerebral pathogenicity index (ICPI).
2. Phylogenetic analysis will accomplish to trace the evolution in circulating strains and store
the genetic information in GenBank for future studies.
3. Development of recombinant Newcastle disease vaccines homologous to circulating NDV
strains.
4. Comparative evaluation of homologous vs commercial vaccine induces protective immune
response.
References
Abolnik C, Horner RF, Bisschop SP, Parker ME, Romito M, Viljoen GJ. 2004. A
phylogenetic study of South African Newcastle disease virus strains isolated between
1990 and 2002 suggests epidemiological origins in the Far East. Arch Virol. 149(3): 603-
619.
33
Absalon AE, Mariano-Matias A, Garcia LJ, Morales-Garzon A, Toscano-Contreras A, Lucio-
Decanini E, Cortes-Espinosa DV. 2014. Complete genome analysis of velogenic
Newcastle disease virus reference strain “Chimalhuacan”: evolution of viral lineages in
Mexico. Virus genes. 49(2): 233-236.
Absalon AE, Mariano-Matias A, Vasquez-Marquez A, Morales-Garzon A, Cortes-Espinosa DV,
Ortega-Garcia R, Lucio-Decanini E. 2012. Complete genome sequence of a velogenic
Newcastle disease virus isolated in Mexico. Virus genes. 45(2): 304-310.
Afonso CL, Amarasinghe GK, Banyai K, Bao Y, Basler CF, Bavari S, Bejerman N, Blasdell KR,
Briand FX, Briese T, Bukreyev A, Calisher CH, Chandran K, Cheng J, Clawson AN,
Collins PL, Dietzgen RG, Dolnik O, Domier LL, Durrwald R, Dye JM, Easton AJ,
Ebihara H, Farkas SL, Freitas-Astua J, Formenty P, Fouchier RA, Fu Y, Ghedin E,
Goodin MM, Hewson R, Horie M, Hyndman TH, Jiang D, Kitajima EW, Kobinger GP,
Kondo H, Kurath G, Lamb RA, Lenardon S, Leroy EM, Li CX, Lin XD, Liu L, Longdon
B, Marton S, Maisner A, Muhlberger E, Netesov SV, Nowotny N, Patterson JL, Payne
SL, Paweska JT, Randall RE, Rima BK, Rota P, Rubbenstroth D, Schwemmle M, Shi M,
Smither SJ, Stenglein MD, Stone DM, Takada A, Terregino C, Tesh RB, Tian H,
Tomonaga K, Tordo N, Towner JS, Vasilakis N, Verbeek M, Volchkov VE, Wahl-Jensen
V, Walsh JA, Walker PJ, Wang D, Wang LF, Wetzel T, Whitfield AE, Xie JT, Yuen KY,
Zhang YZ, Kuhn JH. 2016. Taxonomy of the order Mononegavirales: update 2016. Arch
Virol. 161(8): 2351–2360.
Alarcon JB, Waine GW, McManus DP. 1999. DNA vaccines: technology and application as
anti-parasite and anti-microbial agents. Adv Parasitol. 42: 343–410.
34
Aldous EW, Collins MS, McGoldrick A, Alexander DJ. 2001. Rapid pathotyping of Newcastle
disease virus (NDV) using fluorogenic probes in a PCR assay. Vet Microbiol. 80(3):
201–212.
Aldous EW, Fuller CM, Mynn JK, Alexander DJ. 2004. A molecular epidemiological
investigation of isolates of the variant avian paramyxovirus type 1 virus (PPMV-1)
responsible for the 1978 to present panzootic in pigeons. Avian Pathol. 33(2): 258-269.
Aldous EW, Mynn JK, Banks J, Alexander DJ. 2003. A molecular epidemiological study of
avian paramyxovirus type 1 (Newcastle disease virus) isolates by phylogenetic analysis
of a partial nucleotide sequence of the fusion protein gene. Avian Pathol. 32(3): 239–256.
Alexander DJ, Aldous EW, Fuller CM. 2012. The long view: a selective review of 40 years of
Newcastle disease research. Avian Pathol. 41(4): 329–335.
Alexander DJ, Bell JG, Alders RG. 2004. A Technology Review: Newcastle Disease—with
Special Emphasis on Its Effects on Village Chickens. Chapter 1–3, Food and Agriculture
Organization of the United Nations, Rome, Italy.
Alexander DJ, Campbell G, Manvell RJ, Collins MS, Parsons G, McNulty MS.
1992.Characterisation of an antigenically unusual virus responsible for two outbreaks of
Newcastle disease in the Republic of Ireland in 1990. Vet Rec. 130(4): 65–68.
Alexander DJ, Senne DA. 2008. Newcastle disease virus and other avian paramyxoviruses. In:
Dufour-Zavala, Swayne DE, Glisson JR et al., editors. A Laboratory Manual for the
Isolation, Identification and Characterization of Avian Pathogens.5th ed. American
Association of Avian Pathologists, Jacksonville, Fla, USA. p. 135-141.
Alexander DJ, Senne DA. 2008. Newcastle Disease, other avian paramyxoviruses, and
pneumovirus infections. In: Saif YM, Fadly AM, Glisson JR, McDougald LR, Nolan LK,
35
Swayne DE, editors. Diseases of Poultry. 12th ed. Iowa State University Press, Ames. p.
75–116.
Alexander DJ, Wilson GW, Russell PH, Lister SA, Parsons G. 1985.Newcastle disease outbreaks
in fowl in Great Britain during 1984. Vet Rec. 117(17): 429-434.
Alexander DJ. 2001. Gordon memorial lecture. Newcastle disease. Br Poult Sci. 42(1): 5-22.
Alexander DJ. 2003. Newcastle disease, other avian paramyxoviruses, and pneumovirus
infections. In: Saif YM, Barnes HJ, Glisson IR, Fadly AM, McDougald JR, Swayne DE,
editors. Disease of Poultry.11th ed. Iowa State University Press Ames. p. 63–87.
Alexander DJ. 2011. Newcastle disease in the European Union 2000 to 2009. Avian Pathol.
40(6): 547-558.
Antal M, Farkas T, German P, Belak S, Kiss I. 2007.Real-time reverse transcription-polymerase
chain reaction detection of Newcastle disease virus using light upon extension
fluorogenic primers. J Vet Diagn Invest. 19(4): 400–404.
Arora P, Lakhchaura BD, Garg SK. 2010. Evaluaion of immunogenic potential of 75kDa and
56kDa proteins of newcastle disease virus (NDV). Indian J Exp Biol. 48(9): 889-895.
Ault A, Zajac AM, Kong WP, Gorres JP, Royals M, Wei CJ, Bao S, Yang ZY, Reedy SE,
Sturgill TL, Page AE, Donofrio-Newman J, Adams AA, Balasuriya UB, Horohov DW,
Chambers TM, Nabel GJ, Rao SS. 2012. Immunogenicity and clinical protection against
equine influenza by DNA vaccination of ponies.Vaccine.30(26): 3965-3974.
Ballagi-Pordany A, Wehmann E, Herczeg J, Belak S, Lomniczi B. 1996. Identification and
grouping of Newcastle disease virus strains by restriction site analysis of a region from
the F gene. Arch Virol. 141(2): 243-261.
36
Bayliss CD, Peters RW, Cook JK, Reece RL, Howes K, Binns MM, Boursnell ME. 1991. A
recombinant fowlpox virus that expresses the VP2 antigen of infectious bursal disease
virus induces protection against mortality caused by the virus. Arch Virol. 120(3-4): 193-
205.
Bergman PJ, McKnight J, Novosad A, Charney S, Farrelly J, Craft D, Wulderk M, Jeffers Y,
Sadelain M, Hohenhaus AE, Segal N, Gregor P, Engelhorn M, Riviere I, Houghton AN,
Wolchok JD. 2003. Long-term survival of dogs with advanced malignant melanoma after
DNA vaccination with xenogeneic human tyrosinase: a phase I trial. Clin Cancer Res.
9(4): 1284-1290.
Biancifiori F, Fioroni A. 1983. An occurrence of Newcastle disease in pigeons: virological and
serological studies on the isolates. Comp Immunol Microbiol Infect Dis. 6(3): 247-252.
Boursnell ME, Green PF, Samson AC, Campbell JI, Deuter A, Peters RW, Millar NS, Emmerson
PT, Binns MM. 1990. A recombinant fowlpox virus expressing the hemagglutinin-
neuraminidase gene of Newcastle disease virus (NDV) protects chickens against
challenge by NDV. Virology. 178(1): 297-300.
Calnek BW, Witter RL. 1991. Marek's disease. 9th ed. Iowa State University Press, Ames, Iowa.
Cardenas-Garcia S, Dunwoody RP, Marcano V, Diel DG, Williams RJ, Gogal RM Jr, Brown
CC, Miller PJ, Afonso CL. 2016. Effects of Chicken Interferon Gamma on Newcastle
Disease Virus Vaccine Immunogenicity.PLoS One. 11(7): e0159153.
doi:10.1371/journal. pone.0159153.
Cardenas-Garcia S, Navarro Lopez R, Morales R, Olvera MA, Marquez MA, Merino R, Miller
PJ, Afonso CL. 2013. Molecular epidemiology of Newcastle disease in Mexico and the
37
potential spillover of viruses from poultry into wild bird species. Appl Environ
Microbiol. 79(16): 4985-4992.
Chuang I, Sedegah M, Cicatelli S, Spring M, Polhemus M, Tamminga C, Patterson N, Guerrero
M, Bennett JW, McGrath S, Ganeshan H, Belmonte M, Farooq F, Abot E, Banania JG,
Huang J, Newcomer R, Rein L, Litilit D, Richie NO, Wood C, Murphy J, Sauerwein R,
Hermsen CC, McCoy AJ, Kamau E, Cummings J, Komisar J, Sutamihardja A, Shi M,
Epstein JE, Maiolatesi S, Tosh D, Limbach K, Angov E, Bergmann-Leither E, Bruder JT,
Doolan DL, King CR, Carucci D, Dutta S, Soisson L, Diggs C, Hollingdale MR,
Ockenhouse CF, Richie TL. 2013. DNA prime/Adenovirus boost malaria vaccine
encoding P. falciparum CSP and AMA1 induces sterile protection associated with cell-
mediated immunity. PLoS One.8(2): e55571. doi: 10.1371/journal.pone.0055571.
Connaris H, Takimoto T, Russell R, Crennell S, Moustafa I, Portner A, Taylor G. 2002. Probing
the sialic acid binding site of the hemagglutinin-neuraminidase of Newcastle disease
virus: Identification of key amino acids involved in cell binding, catalysis, and fusion.J
Virol. 76(4): 1816–1824.
Cornax I, Miller PJ, Afonso CL. 2012. Characterization of live LaSota vaccine strain-induced
protection in chickens upon early challenge with a virulent Newcastle disease virus of
heterologous genotype. Avian Dis. 56(3): 464-470.
Courtney SC, Susta L, Gomez D, Hines NL, Pedersen JC, Brown CC, Miller PJ, Afonso CL.
2013. Highly divergent virulent isolates of Newcastle disease virus from the Dominican
Republic are members of a new genotype that may have evolved unnoticed for over 2
decades. J Clin Microbiol. 51(2): 508–517.
38
Cui H, Gao H, Cui X, Zhao Y, Shi X, Li Q, Yan S, Gao M, Wang M, Liu C, Wang Y. 2013.
Avirulent Marek’s disease virus type 1 strain 814 vectored vaccine expressing avian
influenza (AI) virus H5 haemagglutinin induced better protection than turkey herpesvirus
vectored AI vaccine. PLoS One 8(1): e53340. doi:10.1371/journal.pone.0053340.
Czegledi A, Herczeg J, Hadjiev G, Doumanova L, Wehmann E, Lomniczi B. 2002. The
occurrence of five major Newcastle disease virus genotypes (II, IV, V, VI and VIIb) in
Bulgaria between 1959 and 1996. Epidemiol Infect. 129(3): 679-688.
Czegledi A, Ujvari D, Somogyi E, Wehmann E, Werner O, Lomniczi B. 2006. Third genome
size category of avian paramyxovirus serotype 1 (Newcastle disease virus) and
evolutionary implications. Virus Res. 120(1-2): 36–48.
de Almeida RS, Hammoumi S, Gil P, Briand F-X, Molia S, Gaidet N, Cappelle J, Chevalier V,
Balanca G, Traore A, Grillet C, Maminiaina OF, Guendouz S, Dakouo M, Samake K,
Bezeid Oel M, Diarra A, Chaka H, Goutard F, Thompson P, Martinez D, Jestin V, Albina
E. 2013. New avian paramyxoviruses type I strains identified in Africa provide new
outcomes for phylogeny reconstruction and genotype classification. PLoS
One.8(10):e76413. doi: 10.1371/journal.pone.0076413.
Delmas B et al. 2004. Birnaviridae. In Facquet CM, Mayo MA, Maniloff J, Desselberger U, Ball
AL, editors. Virus taxonomy.Academic Press, London, United Kingdom. p. 561-569.
Desingu PA, Singh SD, Dhama K, Karthik K, Vinodh Kumar OR, Malik YS. 2016. Phylogenetic
analysis of Newcastle disease virus isolates occurring in India during 1989–2013.
Virusdisease. 27(2): 203-206.
39
Diel DG, da Silva LH, Liu H, Wang Z, Miller PJ, Afonso CL. 2012. Genetic diversity of avian
paramyxovirus type 1: proposal for a unified nomenclature and classification system of
Newcastle disease virus genotypes. Infect Genet Evol. 12(8): 1770–1779.
Dortmans JC, Peeters BP, Koch G. 2012. Newcastle disease virus outbreaks: vaccine mismatch
or inadequate application? Vet Microbiol. 160(1-2): 17-22.
Doyle TM. 1927. A hitherto unrecorded disease of fowls due to a filter-passing virus. J Comp
Pathol Ther. 40: 144-169.
Draghia-Akli R, Ellis KM, Hill LA, Malone PB, Fiorotto ML. 2003. High-efficiency growth
hormone-releasing hormone plasmid vector administration into skeletal muscle mediated
by electroporation in pigs. FASEB J. 17(3): 526–528.
Estevez C, Villegas P. 2004. Sequence analysis, viral rescue from infectious clones and
generation of recombinant virions of the avian adeno-associated virus. Virus Res. 105(2):
195–208.
Estevez C, Villegas P. 2006. Recombinant avian adeno-associated virus: transgene expression in
vivo and enhancement of expression in vitro. Avian Dis. 50(2): 216–221.
Farkas T, Szekely E, Belak S, Kiss I. 2009. Real-time PCR-based pathotyping of Newcastle
disease virus by use of TaqMan minor groove binder probes. J Clin Microbiol. 47(7):
2114–2123.
Firouzamandi M, Moeini H, Hosseini D, Bejo MH, Omar AR, Mehrbod P, Ideris A. 2016.
Improved immunogenicity of Newcastle disease virus inactivated vaccine following
DNA vaccination using Newcastle disease virus hemagglutinin-neuraminidase and fusion
protein genes. J Vet Sci. 17(1): 21-26.
40
Fuller C, Löndt B, Dimitrov KM, Lewis N, van Boheemen S, Fouchier R, Coven F, Goujgoulova
G, Haddas R, Brown I. 2015. An Epizootiological Report of the Re-emergence and
Spread of a Lineage of Virulent Newcastle Disease Virus into Eastern
Europe.Transbound Emerg Dis. doi:10.1111/tbed.12455.
Glickman RL, Syddall RJ, Iorio RM, Sheehan JP, Bratt MA. 1988. Quantitative basic residue
requirements in the cleavage-activation site of the fusion glycoprotein as a determinant of
virulence for Newcastle disease virus. J Virol. 62(1): 354–356.
Hasson SSAA, Al-Busaidia JKZ, Sallam TA. 2015. The past, current and future trends in DNA
vaccine immunisations. Asian Pac J Trop Biomed. 5(5): 344–353.
Heckert RA, Elankumaran S, Oshop GL, Vakharia VN. 2002. A novel transcutaneous plasmid-
dimethylsulfoxide delivery technique for avian nucleic acid immunization. Vet Immunol
Immunopathol. 89(1-2): 67–81.
Heckert RA, Riva J, Cook S, McMillen J, Schwartz RD. 1996. Onset of protective immunity in
chicks after vaccination with a recombinant herpesvirus of turkeys vaccine expressing
Newcastle disease virus fusion and hemagglutinin-neuraminidase antigens. Avian Dis.
40(4): 770-777.
Heiden S, Grund C, Röder A, Granzow H, Kühnel D, Mettenleiter TC, Romer-Oberdorfer A.
2014. Different regions of the newcastle disease virus fusion protein modulate
pathogenicity. PLoS One. 9(12): e113344. doi:10.1371/journal.pone.0113344.
Herczeg J, Pascucci S, Massi P, Luini M, Selli L, Capua I, and Lomniczi B. 2001. A longitudinal
study of velogenic Newcastle disease virus genotypes isolated in Italy between 1960 and
2000.Avian Pathol. 30(2): 163-168.
41
Herczeg J, Wehmann E, Bragg RR, Travassos Dias PM, Hadjiev G, Werner O, Lomniczi B.
1999. Two novel genetic groups (VIIb and VIII) responsible for recent Newcastle disease
outbreaks in Southern Africa, one (VIIb) of which reached Southern Europe.Arch Virol.
144(11): 2087-2099.
Hugh-Jones M, Allan WH, Dark FA, Harper GJ. 1973. The evidence for the airborne spread of
Newcastle disease. J Hyg (Lond). 71(2): 325–339.
Jestin V, Jestin A. 1991. Detection of Newcastle disease virus RNA in infected allantoic fluids
by in vitro enzymatic amplification (PCR). Arch Virol. 118(3-4): 151–161.
Jindal N, Chander Y, Chockalingam AK, de Abin M, Redig PT, Goyal SM. 2009. Phylogenetic
analysis of Newcastle disease viruses isolated from waterfowl in the upper midwest
region of the United States. Virol J. 6: 191 doi: 10.1186/1743-422X-6-191.
Kaleta EF, Baldeuf C. 1988. Newcastle disease in free-living and pet birds. In: Alexander DJ,
editor. Newcastle Disease.Kluwer Academic Publishers, Boston. p. 197–246.
Kanabaqatte Basavarajappa KM, Kumar S, Khattar SK, Gebreluul GT, Paldurai A, Samal SK.
2014. A recombinant Newcastle disease virus (NDV) expressing infectious
laryngotracheitis virus (ILTV) surface glycoprotein D protects against highly virulent
ILTV and NDV challenges in chickens. Vaccine. 32(28): 3555-3563.
Kapczynski DR, King DJ. 2005. Protection of chickens against overt clinical disease and
determination of viral shedding following vaccination with commercially available
Newcastle disease virus vaccines upon challenge with highly virulent virus from the
California 2002 exotic Newcastle disease outbreak. Vaccine. 23(26): 3424-3433.
42
Khan TA, Rue CA, Rehmani SF, Ahmed A, Wasilenko JL, Miller PJ, Afonso CL. 2010.
Phylogenetic and biological characterization of Newcastle disease virus isolates from
Pakistan. J Clin Microbiol. 48(5): 1892–1894.
Kho CL, Mohd-Azmi ML, Arshad SS, Yusoff K. 2000.Performance of an RT-nested PCR
ELISA for detection of Newcastle disease virus.J Virol Methods.86(1): 71–83.
Kim LM, Afonso CL, Suarez DL. 2006. Effect of probe-site mismatches on detection of virulent
Newcastle disease viruses using a fusion-gene real-time reverse transcription polymerase
chain reaction test. J Vet Diagn Invest. 18(6): 519–528.
Kim LM, King DJ, Curry PE, Suarez D, Swayne DE, Stallknecht DE, Slemons RD, Pedersen JC,
Senne DA, Winker K, Afonso CL. 2007. Phylogenetic diversity among low-virulence
Newcastle disease viruses from waterfowl and shorebirds and comparison of genotype
distributions to those of poultry-origin isolates. J Virol. 81(22): 12641–12653.
Kim LM, King DJ, Guzman H, Tesh RB, Travassos da Rossa AP, Bueno R Jr, Dennet JA,
Afonso CL. 2008a. Biological and phylogenetic characterization of pigeon
paramyxovirus serotype 1 circulating in wild North American pigeons and doves. J Clin
Microbiol. 46(10): 3303–3310.
Kim LM, King DJ, Suarez DL, Wong CW, Afonso CL. 2007. Characterization of class I
Newcastle disease virus isolates from Hong Kong live bird markets and detection using
real-time reverse transcription-PCR. J Clin Microbiol. 45(4): 1310–1314.
Kraneveld FC. 1926. A poultry disease in the Dutch East Indies. Nederlands-Indische Bladen
voor Diergeneeskunde 8: 448-450.
Lewis PJ, Babiuk LA. 1999. DNA vaccines: a review. Adv Virus Res. 54: 129–188.
43
Li K, Gao L, Gao H, Qi X, Gao Y, Qin L, Wang Y, Wang X. 2014. Recombinant infectious
bursal disease virus expressing Newcastle disease virus (NDV) neutralizing epitope
confers partial protection against virulent NDV challenge in chickens. Antiviral Res.
101:1–11.
Li Q, Xue C, Qin J, Zhou Q, Chen F, Bi Y, Cao Y. 2009. An improved reverse transcription
loop-mediated isothermal amplification assay for sensitive and specific detection of
Newcastle disease virus.Arch Virol. 154(9): 1433–1440.
Li X, Chai T, Wang Z, Song C, Cao H, Liu J, Zhang X, Wang W, Yao M, Miao Z. 2009.
Occurrence and transmission of Newcastle disease virus aerosol originating from infected
chickens under experimental conditions. Vet Microbiol. 136(3-4): 226–232.
Liang R, Cao DJ, Li JQ, Chen J, Guo X, Zhuang FF, Duan MX. 2002. Newcastle disease
outbreaks in western China were caused by the genotypes VIIa and VIII. Vet Microbiol.
87(3): 193-203.
Liao JC, Gregor P, Wolchok JD, Orlandi F, Craft D, Leung C, Houghton AN, Bergman PJ. 2006.
vaccination with human tyrosinase DNA induces antibody responses in dogs with
advanced melanoma. Cancer Immun. 6: 8.
Lien YY, Lee JW, Su HY, Tsai HJ, Tsai MC, Hsieh CY, Tsai SS. 2007. Phylogenetic
characterization of Newcastle disease viruses isolated in Taiwan during 2003-2006. Vet
Microbiol. 123(1-3): 194-202.
Liu H, Wang Z, Wu Y, Zheng D, Sun C, Bi D, Zuo Y, Xu T. 2007. Molecular epidemiological
analysis of Newcastle disease virus isolated in China in 2005.J Virol Methods. 140(1-2):
206-211.
Liu MA. 2003. DNA vaccines: a review. J Intern Med. 253(4): 402-410.
44
Liu XF, Wan HQ, Ni XX, Wu YT, Liu WB. 2003. Pathotypical and genotypical characterization
of strains of Newcastle disease virus isolated from outbreaks in chicken and goose flocks
in some regions of China during 1985-2001. Arch Virol. 148(7):1387-1403.
Loke CF, Omar AR, Raha AR, Yusoff K. 2005.Improved protection from velogenic Newcastle
disease virus challenge following multiple immunizations with plasmid DNA encoding
for F and HN genes. Vet Immunol Immunopathol. 106(3-4): 259–267.
Lomniczi B, Wehmann E, Herczeg J, Ballagi-Pordany A, Kaleta EF, Werner O, Meulemans G,
Jorgensen PH, Mante AP, Gielkens AL, Capua I, Damoser J. 1998. Newcastle disease
outbreaks in recent years in western Europe were caused by an old (VI) and a novel
genotype (VII). Arch Virol. 143(1): 49-64.
Lukert PD, Saif YM. 1991. Infectious bursal disease. In: Calnek BW, Barnes HJ, Beard CW,
Reid WM, Yoder Jr. HW, editors. Diseases of poultry. Iowa State University Press,
Ames. p. 648-663.
Marangon S, Busani L. 2007. The use of vaccination in poultry production. Rev Sci Tech. 26(1):
265-274.
Mayo MA. 2002. A summary of taxonomic changes recently approved by ICTV. Arch Virol.
147(8): 1655– 1663.
Mayo MA. 2002. Virus taxonomy—Houston 2002. Arch Virol. 147(5): 1071–1076.
McFerran. 1989. Control of Newcastle disease in Northern Ireland. In: Proceedings of the Avian
Exotic Disease Control Seminar. Animal Health Report 2, NSW Agriculture and
Fisheries, Glenfield, NSW, Australia. p. 16–21.
McMillen JK, Cochran MD, Junker DE, Reddy DN, Valencia DM. 1994.The safe and effective
use of fowlpox virus as a vector for poultry vaccines.Dev biol Stand.82: 137-145.
45
Mia Kim L, Suarez DL, Afonso CL. 2008. Detection of a broad range of class I and II Newcastle
disease viruses using a multiplex real-time reverse transcription polymerase chain
reaction assay. J Vet Diagn Invest. 20(4): 414–425.
Miller PJ, Decanini EL, Afonso CL. 2010. Newcastle disease: evolution of genotypes and the
related diagnostic challenges. Infect Genet Evol. 10(1): 26–35.
Miller PJ, Estevez C, Yu Q, Suarez DL, King DJ. 2009. Comparison of viral shedding following
vaccination with inactivated and live Newcastle disease vaccines formulated with wild-
type and recombinant viruses. Avian Dis. 53(1): 39–49.
Miller PJ, Haddas R, Simanov L, Lublin A, Rehmani SF, Wajid A, Bibi T, Khan TA, Yaqub T,
Setiyaningsih S, Afonso CL. 2015. Identification of new sub-genotypes of virulent
Newcastle disease virus with potential panzootic features. Infect Genet Evol. 29: 216 –
229.
Miller PJ, Kim LM, Ip HS, Afonso CL. 2009.Evolutionary dynamics of Newcastle disease
virus.Virology. 391(1): 64–72.
Miller PJ, King DJ, Afonso CL, Suarez DL. 2007. Antigenic differences among Newcastle
disease virus strains of different genotypes used in vaccine formulation affect viral
shedding after a virulent challenge. Vaccine. 25(41): 7238–7246.
MORGAN et al. 1992. Avian Dis. 36: 858 – 870.
MORGAN et al. 1993. Avian Dis. 37: 1032 – 1040.
Muzyczka NAKB. 2001. Parvoviridae: the viruses and their replication. In: Field’s virology
Knipe DAHPE, editor. Lippincott-Raven, Philadelphia, PA. p. 2327–2379.
46
Nanthakumar T, Kataria RS, Tiwari AK, Butchaiah G, Kataria JM. 2000. Pathotyping of
Newcastle disease viruses by RT-PCR and restriction enzyme analysis. Vet Res
Commun. 24(4): 275–286.
Ogawa R, Yanagida N, Saeki S, Saito S, Ohkawa S, Gotoh H, Kodama K, Kamogawa K,
Sawaguchi K, Iritani Y. 1990. Recombinant fowlpox viruses inducing protective
immunity against Newcastle disease and fowlpox viruses. Vaccine. 8(5): 486–490.
OIE. 2012. Manual of diagnostic tests and vaccines for terrestrial animals: mammals, birds and
bees. In: Biological Standards Commission. World Organization for Animal Health,
Paris. p. 1–19.
Palya V, Kiss I, Tatár-Kis T, Mató T, Felföldi B, Gardin Y. 2012. Advancement in vaccination
against Newcastle disease: recombinant HVT NDV provides high clinical protection and
reduces challenge virus shedding with the absence of vaccine reactions. Avian Dis. 56(2):
282–287.
Paoletti E. 1996. Applications of pox virus vectors to vaccination: an update. Proc Natl Acad Sci
U S A. 93(21): 11349-11353.
Pereira VB, Zurita-Turk M, Saraiva TDL, De Castro CP, Souza BM, Agresti PM, Lima FA,
Pfeiffer VN, Azevedo MSP, Rocha CS, Pontes DS, Azevedo V, Miyoshi A. 2014. DNA
Vaccines Approach: From Concepts to Applications. WJV. 4: 50-71.
Perozo F, Merino R, Afonso CL, Villegas P, Calderon N. 2008. Biological and phylogenetic
characterization of virulent Newcastle disease virus circulating in Mexico. Avian Dis.
52(3): 472-479.
47
Perozo F, Villegas P, Estevez C, Alvarado IR, Purvis LB, Saume E. 2008. Avian adeno-
associated virus-based expression of Newcastle disease virus hemagglutinin-
neuraminidase protein for poultry vaccination. Avian Dis. 52(2): 253–259.
Pham HMa, Nakajima C, Ohashi K, Onuma M. 2005. Loop-mediated isothermal amplification
for rapid detection of Newcastle disease virus.J Clin Microbiol. 43(4): 1646–1650.
Pham HMb, Konnai S, Usui T, Chang KS, Murata S, Mase M, Ohashi K, Onuma M. 2005. Rapid
detection and differentiation of Newcastle disease virus by real-time PCR with melting-
curve analysis.Arch Virol. 150(12): 2429–2438.
Rajawat YS, Sundaresan NR, Ravindra PV, Kantaraja C, Ratta B, Sudhagar M, Rai A, Saxena
VK, Palia SK, Tiwari AK. 2008. Immune responses induced by DNA vaccines encoding
Newcastle virus haemagglutinin and/or fusion proteins in maternal antibody-positive
commercial broiler chicken. Br Poul Sci. 49(2): 111—117.
Reddy SK, Sharma JM, Ahmad J, Reddy DN, McMillen JK, Cook SM, Wild MA, Schwartz RD.
1996. Protective efficacy of a recombinant herpesvirus of turkeys as an in ovo vaccine
against Newcastle and Marek’s diseases in specific-pathogen-free chickens.Vaccine.
14(6): 469–477.
Rehmani SF, Wajid A, Bibi T, Nazir B, Mukhtar N, Hussain A, Lone NA, Yaqub T, Afonso CL.
2015. Presence of virulent Newcastle disease virus in vaccinated chickens in farms in
Pakistan.J Clin Microbiol. 53(5): 1715–1718.
Robinson HL, Pertmer TM. 2000. DNA vaccines for viral infections: basic studies and
applications. Adv Virus Res. 55: 1–74.
Rue CA, Susta L, Brown CC, Pasick JM, Swafford SR, Wolf PC, Killian ML, Pedersen JC,
Miller PJ, Afonso CL. 2010. Evolutionary changes affecting rapid identification of 2008
48
Newcastle disease viruses isolated from double-crested cormorants.J Clin Microbiol.
48(7): 2440–2448.
Saif YM, Fadly AM, Glisson JR, McDougald LR. 2008. Newcastle disease, other avian
paramyxoviruses, and pneumovirus infections. In: Diseases of Poultry. 12th ed. Blackwell
Publishing Professional, Ames, Iowa, USA. p. 75-93.
Sakaguchi M, Nakamura H, Sonoda K, Hamada F, Hirai K. 1996. Protection of chickens from
Newcastle disease by vaccination with a linear plasmid DNA expressing the F protein of
Newcastle disease virus.Vaccine. 14(8): 747–752.
Sawant PM, Verma PC, Subudhi PK, Chaturvedi U, Singh M, Kumar R, Tiwari AK. 2011.
Immunomodulation of bivalent Newcastle disease DNA vaccine induced immune
response by co-delivery of chicken IFN-Ƴ and IL-4 genes. Vet Immunol Immunopathol.
144(1-2): 36-44.
Seal BS, King DJ, Bennett JD. 1995. Characterization of Newcastle-disease virus isolates by
reverse transcription PCR coupled to direct nucleotide sequencing and development of
sequence database for pathotype prediction and molecular epidemiological analysis. J
Clin Microbiol. 33(10): 2624–2630.
Seal BS, King DJ, Sellers HS. 2000. The avian response to Newcastle disease virus. Dev Comp
Immunol. 24(2-3): 257–268.
Snoeck CJ, Ducatez MF, Owoade AA, Faleke OO, Alkali BR, Tahita MC, Tarnagda Z,
Ouedraogo JB, Maikano I, Mbah PO, Kremer JR, Muller CP. 2009. Newcastle disease
virus in West Africa: new virulent strains identified in non-commercial farms. Arch
Virol. 154(1): 47–54.
49
Snoeck CJ, Owoade AA, Couacy-Hymann E, Alkali BR, Okwen MP, Adeyanju AT, Komoyo
GF, Nakouné E, Le Faou A, Muller CP. 2013. High genetic diversity of Newcastle
disease virus in poultry in West and Central Africa: cocirculation of genotype XIV and
newly defined genotypes XVII and XVIII. J Clin Microbiol. 51(7): 2250–2260.
Snyder RO, Francis J. 2005. Adeno-associated viral vectors for clinical gene transfer studies.
Curr Gene Ther. 5(3): 311–321.
Snyder RO. 1999. Adeno-associated virus-mediated gene delivery. J Gene Med. 1: 166–175.
Sondermeijer PJ, Claessens JA, Jenniskens PE, Mockett AP, Thijssen RA, Willemse MJ,
Morgan RW. 1993. Avian herpesvirus as a live viral vector for the expression of
heterologous antigens. Vaccine. 11(3): 349-358.
Steward M, Vipond IB, Millar NS, Emmerson PT. 1993. RNA editing in Newcastle disease
virus.J Gen Virol. 74(Pt 12): 2539–2547.
Sun HL, Wang YF, Miao DY, Zhang PJ, Zhi HD, Xu LL, Wang M, Tong GZ, Wang M. 2006.
Construction and characterization of a recombinant fowlpox virus co-expressing F, HN
genes of Newcastle disease virus and gB gene of infectious larygnotracheitis virus. Sheng
Wu Gong Cheng Xue Bao. 22(6): 931–939.
Sun HL, Wang YF, Tong GZ, Zhang PJ, Miao DY, Zhi HD, Wang M, Wang M. 2008.
Protection of chickens from Newcastle disease and infectious laryngotracheitis with a
recombinant fowlpox virus co-expressing the F, HN genes of Newcastle disease virus and
gB gene of infectious laryngotracheitis virus. Avian Dis. 52(1): 111–117.
Susta L, Hamal KR, Miller PJ, Cardenas-Garcia S, Brown CC, Pedersen JC, Gongora V, Afonso
CL. 2014. Separate evolution of virulent newcastle disease viruses from Mexico and
Central America. J Clin Microbiol. 52(5): 1382-1390.
50
Tarpey I, van Loon AA, de Haas N, Davis PJ, Orbell S, Cavanagh D, Britton P, Casais R,
Sondermeijer P, Sundick R. 2007. A recombinant turkey herpesvirus expressing chicken
interleukin-2 increases the protection provided by in ovo vaccination with infectious
bursal disease and infectious bronchitis virus. Vaccine. 25(51): 8529-8535.
Taylor J, Christensen L, Gettig R, Goebel J, Bouquet JF, Mickle TR, Paoletti E. 1996. Efficacy
of a recombinant fowl pox-based Newcastle disease virus vaccine candidate against
velogenic and repiratory challenge. Avian Dis. 40(1): 173–180.
Taylor J, Edbauer CE, Rey-Senelonge A, Bouquet JF, Noroton E, Goebel S, Desmettre P,
Paoletti E. 1990. Newcastle disease virus fusion protein expressed in a fowlpox virus
recombinant confers protection in chickens. J Virol. 64(4): 1441-1450.
Taylor J, Weinberg R, Kawaoka Y, Webster RG, Paoletti E. 1988. Protective immunity against
avian influenza induced by a fowlpox virus recombinant.Vaccine. 6(6): 504-508.
Tripathy DN, Schnitzlein WM, Morris PJ, Janssen DL, Zuba JK, Massey G, Atkinson CT. 2000.
Characterization of poxviruses from forest birds in Hawaii. J Wildl Dis. 36(2): 225-230.
Tsai HJ, Chang KH, Tseng CH, Frost KM, Manvell RJ, Alexander DJ. 2004. Antigenic and
genotypical characterization of Newcastle disease viruses isolated in Taiwan between
1969 and 1996. Vet Microbiol. 104(1-2): 19-30.
Ujvari D, Wehmann E, Kaleta EF, Werner O, Savic V, Nagy E, Czifra G, Lomniczi B. 2003.
Phylogenetic analysis reveals extensive evolution of avian paramyxovirus type 1 strains
of pigeons (Columba livia) and suggests multiple species transmission. Virus Res. 96(1-
2): 63-73.
Upadhyay C, Ammayappan A, Patel D, Kovesdi I, Vakharia VN. 2011. Recombinant infectious
bursal disease virus carrying hepatitis C virus epitopes. J Virol. 85(3): 1408–1414.
51
Uzzau S, Marogna G, Leori GS, Curtiss R 3rd, Schianchi G, Stocker BA, Rubino S. 2005.
Virulence attenuation and live vaccine potential of aroA, crp cdt cya, and plasmid-cured
mutants of Salmonella enterica serovar Abortusovis in mice and sheep. Infect Immun.
73(7): 4302-4308.
Wahren B, Liu MA. 2014. DNA Vaccines: recent developments and the future. Vaccines. 2(4):
785-796.
Wajid A, Wasim M, Rehmani SF, Bibi T, Ahmed N, Afonso CL. 2015. Complete genome
sequence of a recent panzootic virulent Newcastle disease virus from Pakistan. Genome
Announc.3(3).pii: e00658-15. doi: 10.1128/genomeA.00658-15.
Wajid Aa, Rehmani SF, Wasim M, Basharat A, Bibi T, Arif S, Dimitrov KM, Afonso CL. 2016.
Complete genome sequence of a virulent Newcastle disease virus strain isolated from a
clinically healthy duck (Anas platyrhynchos domesticus) in Pakistan. Genome
Announc.4(4).pii: e00730-16. doi:10.1128/genomeA.00730-16.
Wajid Ab, Rehmani SF, Sharma P, Goraichuk IV, Dimitrov KM, Afonso CL. 2016. Complete
genome sequence of genotype VI Newcastle disease viruses isolated from pigeons in
Pakistan. Genome Announc.4(4).pii: e00845-16. doi:10.1128/genomeA.00845-16.
Wehmann E, Ujvari D, Mazija H, Velhner M, Ciglar-Grozdanic I, Savic V, Jermolenko G, Cac
Z, Prukner-Radovcic E, Lomniczi B. 2003. Genetic analysis of Newcastle disease virus
strains isolated in Bosnia-Herzegovina, Croatia, Slovenia and Yugoslavia, reveals the
presence of only a single genotype, V, between 1979 and 2002. Vet Microbiol. 94(4):
269-281.
Weli SC, Tryland M. 2011. Avipoxviruses: infection biology and their use as vaccine vectors.
Virol J. 8:49.
52
Witter RL, Solomon JJ. 1972. Experimental infection of turkeys and chickens with a herpesvirus
of turkeys (HVT). Avian Dis. 16(1): 34–44.
World Organization for Animal Health (OIE). 2012. Newcastle disease. In Manual of diagnostic
tests and vaccines for terrestrial animals.7th ed. World Organization for Animal Health,
Paris, France. p. 1-19.
Wright JF, Qu G, Tang C, Sommer JM. 2003. Recombinant adeno-associated virus: formulation
challenges and strategies for a gene therapy vector. Curr Opin Drug Discov Devel. 6(2):
174–178.
Yu L, Wang Z, Jiang Y, Chang L, Kwang J. 2001. Characterization of newly emerging
Newcastle disease virus isolates from the People's Republic of China and Taiwan. J Clin
Microbiol. 39(10): 3512-3519.
Zhao W, Spatz S, Zhang Z, Wen G, Garcia M, Zsak L, Yu Q. 2014. Newcastle disease virus
(NDV) recombinants expressing infectious laryngotracheitis virus (ILTV) glycoproteins
gB and gD protect chickens against ILTV and NDV challenges. J Virol. 88(15): 8397-
8406.
53
CHAPTER 3
EXPERIMENT 1
Repeated isolation of virulent Newcastle disease viruses in poultry and captive non-poultry
avian species in Pakistan from 2011 to 2016
Abdul Wajida,b, Kiril M. Dimitrovc, Muhammad Wasima, Shafqat Fatima Rehmanib, Asma
Basharatb, Tasra Bibib, Saima Arifb, Tahir Yaqubd, Muhammad Tayyaba, Mustafa Ababnehe,
Poonam Sharmac, Patti J. Millerc, Claudio L. Afonsoc*
aInstitute of Biochemistry and Biotechnology (IBBt), University of Veterinary and Animal
Sciences, Lahore, Pakistan
bQuality Operations Laboratory (QOL), University of Veterinary and Animal Sciences, Lahore,
Pakistan
cExotic and Emerging Avian Viral Disease Research Unit, Southeast Poultry Research
Laboratory, US National Poultry Research Laboratory, ARS, USDA, Athens, Georgia, USA
dDepartment of Microbiology, University of Veterinary and Animal Sciences, Lahore, Pakistan
eFaculty of Veterinary Medicine, Jordan University of Science and Technology, Irbid, Jordan
Running head: Virulent NDV in Pakistani poultry and captive pet birds
*Corresponding author E-mail address: Claudio.Afonso@ars.usda.gov
Telephone: (706) 546-3642; Fax: (706) 546-3161
Published in: Preventive Veterinary Medicine 142 (2017) 1–6
54
Abstract
Virulent viruses of the panzootic Newcastle disease virus of sub-genotype VIIi were repeatedly
isolated (2011-2016) from commercial chickens and from multiple non-poultry avian species in
Pakistan. These findings provide evidence for the existence of epidemiological links between
Newcastle disease outbreaks in commercial poultry and infections with virulent NDV strains in
other avian species kept in proximity to poultry. Our results suggest that the endemicity of
Newcastle disease in Pakistan involves multiple hosts and environments.
Keywords
Newcastle disease virus; NDV; APMV-1; Pakistan; captive birds; epidemiology; endemicity
Introduction
Newcastle disease (NDi) is a highly contagious and fatal disease affecting poultry and a wide
range of wild birds worldwide that is caused by infections with virulent strains of Newcastle
disease virus (NDVii) (Miller et al. 2010)(Miller et al. 2010; Dimitrov et al. 2016c). Despite
intensive vaccination, endemicity of ND is a significant problem across Asia, Africa, and Central
America. Recent reports have documented that some of the newly identified viruses of sub-
genotype VIIi are rapidly spreading from Southeast Asia, into the Middle East, to Eastern Europe
and North Africa and can cause mortality in poorly vaccinated poultry(Miller et al. 2015b;
Rehmani et al. 2015; Dimitrov et al. 2016c). The presence of virulent viruses in vaccinated birds
in commercial farms (Rehmani et al. 2015) and their constant evolution over time (Miller et al.
2009) suggest the existence of a high environmental viral load with continuous replication of
these virulent NDV strains in endemic countries. However, the nature of the endemicity and the
mechanisms of panzootic viral spread for NDV are largely unknown.
55
For the successful control of ND it is important to identify the factors that contribute to its
endemicity. The spillover (in the current paper the term “spillover” is used as the bi-directional
transmission of closely related NDV) of NDV between poultry and wild bird species has been
reported previously (Vidanovic et al. 2011; Cardenas Garcia et al. 2013; Ayala et al. 2016).
Exotic birds kept in captivity and pet birds have also been infected with virulent NDV strains
(Nolen, 2002; Pedersen et al., 2004) and are considered a biosecurity threat to domestic and
commercial chickens. Avian influenza studies have identified wild bird species that could be
considered “bridge hosts” for the transmission of viruses between poultry and wild birds (Caron
et al. 2014; Caron et al. 2015). We have recently shown that backyard chickens are an important
component in the circulation of genotype VII virulent NDVs in Bulgaria and Ukraine (Dimitrov
et al. 2016b).
Pakistan presents a unique opportunity to study mechanisms of viral maintenance and spread in
endemic countries. In Pakistan, ND was first detected in 1963 (Khan and Huq, 1963) and since
then outbreaks have been observed repeatedly in both commercial and backyard poultry flocks.
There is a wide variety of non-poultry birds (both free-living and kept in captivity) in Pakistan;
however, limited information is available concerning the potential role of these avian species in
the dissemination of NDV. To understand the relationship among the circulating viruses and to
identify the avian species and the husbandry systems that might contribute to ND endemicity, we
have isolated and characterized NDV from different avian species and production systems in
Pakistan over a five year period. Here, we describe the repeated isolation of highly related
virulent NDV strains from poultry, non-poultry species kept in captivity, and wild birds
(chickens, pheasants, peafowls, pigeons, exotic parakeets [Australian parakeets locally known as
56
Bajri], and Black Swan) at multiple locations and in different types and sizes of flocks in
Pakistan between 2011 and 2016.
Materials and methods
Sample collection, clinical observation and pathogenicity tests
Samples from sick or dead birds from broiler and layer commercial poultry farms, along with
additional information, were collected from flocks experiencing either above average mortality
or appearance of clinical signs ND-like disease. The samples from non-poultry species were
collected from birds kept in captivity in zoo or farm exhibitions, as family pets, or as racing
birds, except for one free-living pigeon. The samples from the Zoo Park were collected during
routine visits by the Veterinary Officer from zoo birds with clinical signs of ND under
quarantine at the zoo. Backyard samples were collected across different neighborhood
experiencing increased poultry mortality.
In total, between 2011 and 2016, 52 NDV were isolated; 21 from non-poultry species and 31
from poultry. The latter were isolated from either vaccinated commercial flocks or non-
vaccinated backyard chickens. Detailed information on the isolates is presented in Supplemental
Table S3.1. Twenty one of the isolates (marked with asterisks in Supplemental Table S3.1) were
submitted to the Southeast Poultry Research Laboratory (SEPRL) of the USDA in Athens, GA
and 20 of them underwent evaluation to establish intracerebral pathogenicity index (ICPIiii)
values following routine procedures (OIE, 2012). Following the same procedure, the
pathogenicity of eight additional viruses was assessed by intracerebral inoculation of NDV- and
AIViv-free 1-day-old chickens at University of Veterinary and Animal Sciences, Lahore,
Pakistan (UVASv) (marked with # in Supplemental Table S4.1).
57
Figure 3.1: Locations in Pakistan where the studied Newcastle disease viruses were isolated.
The provided scale bar is not valid for the general map of Pakistan in the top left corner of the
figure.
RNA extraction and sequencing
For the samples analyzed at SEPRL viral RNA was isolated from the allantoic fluid using TRIzol
LS reagent (Invitrogen, USA) and the QIAamp RNA viral mini kit (Qiagen, USA) and further
processed by next-generation sequencingas reported by Shittuet al.(Shittu et al. 2016). Thirty
one samples were analyzed at UVAS and viral RNA was extracted from infected allantoic fluid
using the TRIzol LS reagent (Invitrogen, USA) following the manufacturer's instructions.
58
Sequencing of the complete coding region of the fusion (F) protein gene was performed as
described previously (Munir et al. 2010; Miller et al. 2015a; Miller et al. 2015b).
Phylogenetic analyses
All available complete F-gene coding sequences of class II NDV (n=1542) were downloaded
from GenBank(Benson et al. 2015) as of September 2016 and analyzed together with the
sequences obtained in the current study. A smaller dataset of closely related previously
characterized NDV (n=19) and the isolates sequenced here (n=52), were further analyzed
phylogenetically using MEGA6 (Tamura et al. 2013). For comparison purposes, five additional
sequences of more distant genotype VII viruses were also added. The evolutionary history was
inferred by using the Maximum Likelihood method based on the Tamura-3 model, selected by
corrected Akaike Information Criterion, with 1000 bootstrap replicates as implemented in
MEGA6 (Tamura, 1992). Evolutionary analyses were conducted in MEGA6 (Tamura et al.,
2013).
Results
Clinical signs and in vivo characterization
Number of dead birds and clinical signs varied widely in different flocks and species with some
large vaccinated chicken flocks and non-vaccinated pet birds showing high numbers of survivors
(Supplemental Table S3.1). Infected birds of different species were of different ages and isolated
at different locations (Figure 3.1). Infected birds presented with respiratory, neurological and/or
enteric clinical signs typical for ND. In pheasants respiratory signs and greenish diarrhea were
observed. Diseased peafowls showed nervous signs with torticollis, tremors, disorientation and
weakness and a few birds also had wing and leg paralysis. Upon post mortem examination
hyperemic and hemorrhagic spleens were found. In parakeets no clinical signs except sudden
59
death were observed. Infected pigeons had tremor and torticollis that are typical for the disease in
this species (Vindevogel and Duchatel, 1988). The infected Black Swan had depression and
greenish watery diarrhea along with nervous signs including circular movements of the neck and
head 4 to 5 hours prior to death. Birds in vaccinated poultry flocks showed clinical signs typical
for ND (Miller and Koch, 2013).
In pathogenicity studies performed with SPF chickens (Supplemental Table S3.1) 20 selected
viruses presented ICPI assay values between 1.75 and 1.96, typical for velogenic NDV
(Alexander and Swayne, 1998) and demonstrating that there was no increase in virulence of the
NDV strains obtained from the non-poultry species. Host-related patterns relating to the ICPI
values were not observed. All of the viruses whose pathogenicity was tested in NDV- and AIV-
free 1-day-old chickens caused severe clinical signs and death within 2-3 days post inoculation
for all inoculated birds, also suggesting the presence of virulent NDV.
Molecular characterization and epidemiology
The amino acid sequence at the cleavage site of the fusion protein of all studied viruses was
found to be typical for virulent NDV strains with three basic amino acids between position 113
and 116 and a phenylalanine at position 117 (113RQKR↓F117) (OIE, 2012) and consistent with the
determined ICPI values. The distance and phylogenetic analyses compared the complete F-gene
of these and other viruses that circulated previously in Pakistan. The nucleotide distance between
most of the viruses from captive non-poultry species and those from poultry varied between
0.1% and 0.9% with some of the viruses being almost identical (0.1% to 0.3%). Based on
specific criteria set by Dielet al.(Diel et al. 2012) all of the studied isolates (bold font in the
phylogenetic tree) were classified as members of sub-genotype VIIi (Fig. 2). The constructed
phylogenetic tree demonstrates the very close phylogenetic relationship between virulent NDV
60
from poultry and viruses from pet or other non-avian species kept in captivity during a period of
five years. Most of the NDV isolates from captive birds grouped in monophyletic branches
together with the viruses from chickens. In addition, two clearly distinct branches (1.4%
nucleotide distance) of viruses from different species were identified and highlighted in boxes in
the phylogenetic tree (Fig. 2). While the first branch contained viruses isolated between 2011 and
2016 predominantly from pigeons and chickens, the second branch consisted of viruses mainly
from peafowl and chickens from 2013 to 2015.
61
62
Figure 3.2. Maximum likelihood phylogenetic tree of the fusion protein gene complete coding
sequences of the Newcastle disease viruses isolated in Pakistan between 2011 and 2016 from
poultry and non-poultry avian species.The tree with the highest log likelihood (-7775.3243) is
shown. The Roman numerals presented in the taxa names in the phylogenetic tree represent the
respective genotype for each isolate, followed by the GenBankaccession number, host name (if
available), year of isolation, strain designation and country of isolation. Embolden taxa were
sequenced in the present study. Taxa enclosed in highlighted boxes have higher genetic distance
between them (1.4% nucleotide distance).
Accession numbers
The complete F-gene sequences (n=52) of virulent NDV obtained in this study were submitted to
GenBank and are available under the accession numbers KU862283 to KU862296, KX496962 to
KX496967, KX791183 and KY076030 to KY076044.
Discussion
Infection with virulent NDV in captive non-poultry species of birds has been previously reported
in Pakistan and other countries; however, most studies have reported outbreaks that occurred
over short period of time and were considered to be caused by accidental spillover from a poultry
outbreak (Seal et al. 1998; Vijayarani et al. 2010; Shabbir et al. 2012; Cardenas Garcia et al.
2013; Kumar et al. 2013; Dimitrov et al. 2016c). Here, over a five year period, we demonstrated
the repeated isolation of genetically very closely related virulent NDV strains from domestic and
commercial poultry and captive non-poultry birds. These viruses were mostly isolated from
samples taken from locations with increased mortality of poultry or clinical signs of ND-like
disease, but in a few instances were from farms and zoos with lower numbers of dead poultry
63
(Supplemental Table S3.1). Interestingly, phylogenetic evaluation of the viruses isolated during
this period demonstrates the existence of clades of highly related viruses infecting different
species and different types of production systems (see highlighted boxes in phylogenetic tree,
Fig. 3.2).
These new data point to a significant role of non-poultry species kept in captivity in the same
vicinity as poultry in the circulation of NDV in Pakistan.It is unclear if each one of these cases
corresponds to a specific spillover event from poultry farms or from other unknown reservoirs.
However, the high similarity of sequences (above 99.7 %) and the close distances separating
some poultry farms to sites of isolation in pet birds and backyard birds point to the existence of
epidemiological connections (Figure 3.1). The continuous circulation of NDV in non-poultry
species suggests the need to develop additional control strategies that would include active
surveillance in pet rearing sites and or sites in which exhibition birds and wild birds are kept in
captivity (e.g. zoos and parks). Recently, wild birds species that are more likely to be in contact
with poultry (“bridge hosts”) have been identified in avian influenza transmission studies (Caron
et al. 2014). A similar type of study would be needed to better understand the dynamics of
transmission of Newcastle disease viruses. The grouping of peafowl with poultry isolates during
2013-2015 suggests the interaction of these two groups of birds and is an example of an area
where increased knowledge and biosecurity parameters could be enacted to prevent the
transmission of NDV between the two groups of birds. The demonstration of clinical signs and
the first isolation of virulent NDV in a Black Swan suggest that the range of possible hosts may
be extending.
The epidemiological situation observed in Pakistan is likely to be similar to that of many
countries in the developing world. Asia, Africa and Latin America are currently undergoing
64
extensive transformation on their protein production systems toward intensive poultry farming.
Large farms without adequate biosecurity are often surrounded by existing rudimentary
production systems such as backyard flocks or non-poultry avian species kept for other reasons.
Among these, backyard poultry has played and still does play a significant role in the economy
of the villagers in rural areas where it is primarily kept for the production of meat and eggs. The
majority of backyard poultry farming in Pakistan consists of small scale (10-15 birds) units. As
they are predominantly free-ranging, generally there is complete deficiency of biosecurity and
good husbandry practices that could prevent spread of NDV. In addition, traditions such as
keeping exotic pet birds as status symbol, cock fighting, and for hobbies (pigeon racing) may
facilitate the movement of infected pet birds. Although presently uncommon, similar strategies
as those used in poultry, such as vaccination, may contribute to the better control of ND.
Vaccination is not likely to prevent viral replication; however, most existing vaccines are shown
to reduce virus replication and shedding up to 2 logs in comparison to naïve birds, which would
help decrease the amount of NDV shed into the environment (Dimitrov et al. 2016a).
Acknowledgements
We would like to acknowledge Tim Olivier and Dawn Williams-Coplin for their technical
assistance. This work was supported by the Department of State Biosecurity Engagement
Program (BEP, NDV 31063), the Defense Threat Reduction Agency Cooperative Biological
Engagement Program, USDA/ARS #685/FRCALL 12-6-2-0005, USDA CRIS 6040-32000-064-
00D.
References
Alexander DJ, Swayne DE. 1998. Newcastle disease virus and other avian paramyxoviruses. In:
Swayne DE, Glisson JR, Jackwood, MW, Pearson JE, Reed WM (Eds.), A Laboratory
65
Manual for the Isolation and Identification of Avian Pathogens. The American
Association of Avian Pathologists, Kennett Square, PA, 156-163.
Ayala AJ, Dimitrov KM, Becker CR, Goraichuk IV, Arns CW, Bolotin VI, Ferreira HL,
Gerilovych AP, Goujgoulova GV, Martini MC, Muzyka DV, Orsi MA, Scagion GP,
Silva RK, Solodiankin OS, Stegniy BT, Miller PJ, Afonso CL. 2016. Presence of
vaccine-derived Newcastle disease viruses in wild birds. PLOS One.11: e0162484.
Benson DA, ClarkK, Karsch-Mizrachi I, Lipman DJ, Ostell J, Sayers EW. 2015. GenBank.
Nucleic Acids Res.43: D30.
Cardenas Garcia S, Lopez RN, Morales R, Olvera MA, Marquez MA, Merino R, Miller PJ,
Afonso CL. 2013. Molecular epidemiology of Newcastle disease in Mexico and the
potential spillover of viruses from poultry into wild bird species. Appl Environ
Microbiol.79: 4985-4992.
Caron A, Cappelle J, Cumming GS, de Garine-Wichatitsky M, Gaidet N. 2015. Bridge hosts, a
missing link for disease ecology in multi-host systems. Vet Res.46: 83.
Caron A, Grosbois V, Etter E, Gaidet N, de Garine-Wichatitsky M. 2014. Bridge hosts for avian
influenza viruses at the wildlife/domestic interface: an eco-epidemiological framework
implemented in southern Africa. Prev Vet Med.117: 590-600.
Diel DG, da Silva LH, Liu H, Wang Z, Miller PJ, Afonso CL. 2012. Genetic diversity of avian
paramyxovirus type 1: proposal for a unified nomenclature and classification system of
Newcastle disease virus genotypes. Infect Genet Evol.12: 1770-1779.
Dimitrov KM, Afonso CL, Yu Q, Miller PJ. 2016a. Newcastle disease vaccines - a solved
problem or a continuous challenge? Vet Microbiol.In
press.http://dx.doi.org/10.1016/j.vetmic.2016.12.019.
66
Dimitrov KM, Bolotin V, Muzyka D, Goraichuk I, Solodiankin O, Gerilovych A, Stegniy B,
Goujgoulova GV, Silko NY, Pantin-Jackwood MJ, Miller PJ, Afonso CL. 2016b.
Repeated Isolation of Virulent Newcastle Disease Viruses of Sub-genotype VIId from
Backyard Chickens in Bulgaria and Ukraine Between 2002 and 2013. Arch
Virol.161(12):3345-3353
Dimitrov KM, Ramey AM, Qiu X, Bahl J, Afonso CL. 2016c. Temporal, geographic, and host
distribution of avian paramyxovirus 1 (Newcastle disease virus). Infect Genet Evol.39,
22-34.
Khan MZ, Huq MM. 1963. Infectious respiratory diseases of poultry in Pakistan. Bulletin Office
International Epizootics60: 983-987.
Kumar A, Maan S, Mahajan NK, Rana VP, Jindal N, BatraK, Ghosh A, Mishra SK, Kapoor S,
Maan NS. 2013. Detection and molecular characterization of Newcastle disease virus in
peafowl (Pavo cristatus) in Haryana State, India. Indian J Virol.24: 380-385.
Miller PJ, Decanini EL, Afonso CL. 2010. Newcastle disease: Evolution of genotypes and the
related diagnostic challenges. Infect Genet Evol.10: 26-35.
Miller PJ, Dimitrov KM, Williams-Coplin D, Peterson MP, Pantin-Jackwood MJ, Swayne DE,
Suarez DL, Afonso CL. 2015a. International biological engagement programs facilitate
Newcastle disease epidemiological studies. Front Public Health.3: 235.
Miller PJ, Haddas R, Simanov L, Lublin A, Rehmani SF, Wajid A, Bibi T, Khan TA, Yaqub T,
Setiyaningsih S, Afonso CL. 2015b. Identification of new sub-genotypes of virulent
Newcastle disease virus with potential panzootic features. Infect Genet Evol.29: 216-229.
Miller PJ, Kim LM, Ip HS, Afonso CL. 2009. Evolutionary dynamics of Newcastle disease virus.
Virol.391: 64-72.
67
Miller PJ, Koch G. 2013. Newcastle disease. In: Swayne, D.E., Glisson, J.R., McDougald, L.R.,
Nolan, L.K., Suarez, D.L., Nair, V. (Eds.), Diseases of Poultry. Wiley-Blackwell,
Hoboken, New Jersey, 89-138.
Munir M, Linde AM, Zohari S, Stahl K, Baule C, Holm K, Engstrom B, Berg M. 2010.
Complete genome analysis of an avian paramyxovirus type 1 strain isolated in 1994 from
an asymptomatic black-headed gull (Larus ridibundus) in southern Sweden. Avian
Dis.54: 923-930.
Nolen RS. 2002. Exotic Newcastle disease strikes game birds in California. J Am Vet Med
Assoc.221: 1369-1370.
OIE. 2012. Newcastle disease. Manual of diagnostic tests and vaccines for terrestrial animals:
mammals, birds and bees., Biological Standards Commission. World Organization for
Animal Health, Paris, France, 555-574.
Pedersen JC, Senne DA, Woolcock PR, Kinde H, King DJ, Wise MG, Panigrahy B, Seal BS.
2004. Phylogenetic relationships among virulent Newcastle disease virus isolates from
the 2002-2003 outbreak in California and other recent outbreaks in North America. J Clin
Microbiol.42: 2329-2334.
Rehmani SF, Wajid A, Bibi T, Nazir B, Mukhtar N, Hussain A, Lone NA, Yaqub T, Afonso CL.
2015. Presence of virulent Newcastle disease virus in vaccinated chickens in farms in
Pakistan. J Clin Microbiol.53: 1715-1718.
Seal BS, King DJ, Locke DP, Senne DA, Jackwood MW. 1998. Phylogenetic relationships
among highly virulent Newcastle disease virus isolates obtained from exotic birds and
poultry from 1989 to 1996. J Clin Microbiol.36: 1141-1145.
68
Shabbir MZ, Goraya MU, Abbas M, Yaqub T, Shabbir MA, Ahmad A, Anees M, Munir M.
2012. Complete genome sequencing of a velogenic viscerotropic avian paramyxovirus 1
isolated from pheasants (Pucrasia macrolopha) in Lahore, Pakistan. J. Virol.86, 13828-
13829.
Shittu I, Sharma P, Joannis TM, Volkening JD, Odaibo GN, Olaleye DO, Williams-Coplin D,
Solomon P, Abolnik C, Miller PJ. 2016. Complete Genome Sequence of a Genotype
XVII Newcastle Disease Virus, Isolated from an Apparently Healthy Domestic Duck in
Nigeria. Genome Announc.4: e01716-01715.
Tamura K. 1992. Estimation of the number of nucleotide substitutions when there are strong
transition-transversion and G+C-content biases. Mol Biol Evol.9: 678-687.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: molecular evolutionary
genetics analysis version 6.0. Mol Biol Evol.30: 2725-2729.
Vidanovic D, Šekler M, Ašanin R, Milic N, Nišavic J, Petrovic T, Savic V. 2011.
Characterization of velogenic Newcastle disease viruses isolated from dead wild birds in
Serbia during 2007. J Wildl Dis.47: 433-441.
Vijayarani K, Muthusamy S, Tirumurugaan KG, Sakthivelan SM, Kumanan K. 2010.
Pathotyping of a Newcastle disease virus isolated from peacock (Pavo cristatus). Trop
Anim Health Prod.42: 415-419.
Vindevogel H, Duchatel JP. 1988. Panzootic Newcastle disease virus in pigeons. In: Alexander,
D.J. (Ed.), Newcastle disease. Kluwer Academic Publishers, Boston 184-196.
69
Supplemental Table 3.1.Background information of Newcastle disease virus isolates used in
this study.
No. GenBank
acc.# Isolate name
Host name Isolation
date Location Husbandry
ICP
I
Flock
size
Number of
dead birds§ Common Scientific
1. KR676389 Kohat/122 Chicken Gallus
gallusdomesticus
December
2011 Kohat, KPK
Broiler
farm NP 900 180
2. KY076032* Kasur/998/26A Chicken Gallus
gallusdomesticus
December
2011 Kasur, KPK
Broiler
farm 1.96 30000 300
3. KU862286 Lahore/AW-175 Peafowl Pavo
cristatus
January
2012 Safari Park, Lahore Zoo/Park NP 300 60
4. KU862285 Lahore/AW-145 Peafowl Pavo
cristatus
January
2012 Safari Park, Lahore Zoo/Park NP 300 60
5. KR676390 Peshawar/121 Chicken Gallus
gallusdomesticus
January
2012 Peshawar, KPK
Broiler
farm NP 600 120
6. KU862283# Lahore/AW-130 Pheasant Phasianus
colchicus
February
2012 Safari Park, Lahore Zoo/Park NP 800 640
7. KR676391 Narowal/329 Chicken Gallus
gallusdomesticus August 2012 Narowal, Punjab
Broiler
farm NP 27500 4125
8. KR676392 Waziabbad/431 Chicken Gallus
gallusdomesticus
December
2012
Waziabbad,
Gujranwala
Broiler
farm NP 30000 6000
9. KR676393 Attock/437 Chicken Gallus
gallusdomesticus
December
2012 Attock, Punjab Layer farm NP 3000 600
10. KR676394 Lahore/AP Chicken Gallus
gallusdomesticus March 2013 Lahore, Punjab
Broiler
farm NP 100 10
11. KU862287 Lahore/AW-7 Peacock Pavo
cristatus July 2013 Faisal Town Lahore Pet NP 02 02
12. KR676400 Sheikhpura/MNA Chicken Gallus
gallusdomesticus
January
2014 Sheikhpura, Punjab
Broiler
farm NP 30000 15000
13. KR676401 Lahore/821 Chicken Gallus
gallusdomesticus
January
2014 Lahore, Punjab Backyard NP 06 06
14. KR676395 Lahore/649 Chicken Gallus
gallusdomesticus
February
2014 Lahore, Punjab
Broiler
farm NP 2200 1210
15. KR676396 Lahore/736 Chicken Gallus
gallusdomesticus March 2014 Lahore, Punjab
Broiler
farm NP 6500 3250
16. KR676397 Attock/7-411 Chicken Gallus
gallusdomesticus March 2014 Attock, Pujab Layer farm NP 42000 61800
17. KR676398 Multan/5-125 Chicken Gallus
gallusdomesticus March 2014 Multan, Punjab Layer farm NP 1500 1200
18. KR676399 Gujranwala/2-101 Chicken Gallus
gallusdomesticus March 2014 Gujranwala, Punjab
Broiler
farm NP 29000 23200
19. KU862284# Lahore/AW-NF Pheasant Phasianus
colchicus April 2014 Raiwind, Lahore Pet NP 450 135
20. KU862288# Lahore/AW-3 Peacock Pavo
cristatus April 2014 Raiwind, Lahore Pet NP 600 150
70
21. KU862289# Lahore/AW-4 Peacock Pavo
cristatus April 2014 Raiwind, Lahore Pet NP 600 150
22. KU862290# Lahore/AW-5 Peacock Pavo
cristatus April 2014 Raiwind, Lahore Pet NP 600 150
23. KU862293 Karachi/AW-1 Exotic
Parakeet
Melopsittacus
undulatus August 2014 Korangi, Karachi Pet NP 30 05
24. KU862294# Sheikh Pura/AW-
2
Exotic
Parakeet
Melopsittacus
undulatus
September
2014
MirajPura,SheikhPu
ra Pet NP 80 80
25. KR676404 Gujranwala/FB/2 Chicken Gallus
gallusdomesticus
January
2015 Gujranwala, Punjab
Broiler
farm NP 4000 1200
26. KU862292# Kamoki/AW-2 Peacock Pavo
cristatus
February
2015
Kamoki,
Gujranwala Pet NP 09 04
27. KR676402 Lahore/12 Chicken Gallus
gallusdomesticus
February
2015 Lahore, Punjab Backyard NP 10 02
28. KX496965* Lahore/1084 Racing
pigeon
Columba
livia
February
2015 GhariShahu Lahore Pet 1.88 150 60
29. KY076035* Pattoki/1002/1A Chicken Gallus
gallusdomesticus
February
2015 Pattoki, Kasur Layer farm 1.88 19000 100
30. KY076036* Buner/KPK/1003/
2A Chicken
Gallus
gallusdomesticus
February
2015 Buner, KPK
Broiler
farm 1.88 2000 400
31. KY076040* Buner/KPK/1078/
3A Chicken
Gallus
gallusdomesticus
February
2015 Buner, KPK
Broiler
farm 1.88 1600 280
32. KY076041* Buner/KPK/1079/
4A Chicken
Gallus
gallusdomesticus
February
2015 Buner, KPK
Broiler
farm 1.88 2200 600
33. KY076037* Buner/KPK/1004/
5A Chicken
Gallus
gallusdomesticus
February
2015 Buner, KPK
Broiler
farm 1.88 2700 50
34. KU862295 Karachi/AW-3 Exotic
Parakeet
Melopsittacus
undulatus March 2015 Karongi, Karachi Pet NP 08 04
35. KR676403 Lahore/GM/24 Chicken Gallus
gallusdomesticus March 2015 Lahore, Punjab Backyard NP 100 30
36. KU862296 Lahore/AW-1 Black
Swan
Cygnus
atratus April 2015 Johar Town, Lahore Pet NP 22 02
37. KX496964* Lahore/997 Racing
pigeon
Columba
livia April 2015
Lahore Cantt,
Punjab Racing 1.88 200 125
38. KX496963* Lahore/1001 Racing
pigeon
Columba
livia April 2015
BadamiBagh,
Lahore Pet 1.88 30 02
39. KY076038* BhaiPhairu/1007/6
A Chicken
Gallus
gallusdomesticus April 2015 BhaiPhairu, Kasur
Broiler
farm 1.88 30000 200/day
40. KY076042* Lahore/1080/8A Chicken Gallus
gallusdomesticus April 2015 Lahore, Punjab
Broiler
farm 1.89 60 60
41. KX496967* Lahore/1085 Racing
pigeon
Columba
livia May 2015
Gulshane Ravi,
Lahore Pet 1.75 250 50
42. KX496966* Islamabad/1087 Exotic
Parakeet
Melopsittacus
undulatus May 2015 Charah, Islamabad
Broiler
Farm 1.88 250 02
43. KY076043* NarangMandi/100
5/10A Chicken
Gallus
gallusdomesticus May 2015
NarangMandi,
Gujranwala
Broiler
farm NP 20000 10/day
71
44. KY076030* Sheikhupura/994/1
2A Chicken
Gallus
gallusdomesticus May 2015
Sheikhupura,
Punjab
Broiler
farm 1.89 50000 60
45. KY076039* Gujranwala/1009/
13A Chicken
Gallus
gallusdomesticus May 2015 Gujranwala, Punjab Layer farm 1.76 23000 3500
46. KY076033* Badhana/999/27A Chicken Gallus
gallusdomesticus May 2015 Badhana, Islamabad Layer farm 1.89 3300 10/day
47. KY076044* Badhana/1086/28
A Chicken
Gallus
gallusdomesticus May 2015 Badhana, Islamabad Layer farm 1.88 1200 2/day
48. KY076034* ChakShahzad/100
0/30A Chicken
Gallus
gallusdomesticus May 2015
ChakShahzad,
Islamabad
Broiler
farm 1.88 30000 10/day
49. KU862291# Patoki/AW-1 Peacock Pavo
cristatus June 2015 Patoki, Kasur Pet NP 07 02
50. KX496962* Lahore/996 Rock
Pigeon
Columba
livia June 2015 UVAS, Lahore Wildlife# 1.93 NA NA
51. KY076031* Wazirabad/995/15
A Chicken
Gallus
gallusdomesticus June 2015
Wazirabad,
Gujranwala Layer farm 1.89 8000 900
52. KX791183 R-Pindi/SFR-16 Exotic
Parakeet
Melopsittacus
undulatus May 2016 Rawalpindi, Punjab Pet NP NA NA
NA = data not available; NP = not performed; #=found dead; *=characterized at SEPRL;
#=pathogenicity test was performed in non-specific-pathogen-free birds; §=not all dead birds
were sampled and it has not been shown that all birds died of Newcastle disease
Supplemental Table 3.2.Class II complete fusion protein gene sequences used for constructing
ML phylogenetic tree in this study.
Genotype GenBank acc.# Host Country Isolate Year
VII i KF113339 chicken Pakistan Lahore/30 2011
VII i KF113341 chicken Pakistan Lahore/43 2011
VII i KF113342 chicken Pakistan Lahore/50 2011
VII i KF113343 chicken Pakistan Gujranwala/56 2011
VII i KF113344 chicken Pakistan Okara/103 2011
VII i KF113345 chicken Pakistan KhyberPukhtunKhawa/117 2011
VII i KF113347 chicken Pakistan KhyberPukhtunKhawa/119 2012
VII i KF113348 chicken Pakistan KhyberPukhtunKhawa/162 2012
VII i KF113349 chicken Pakistan Kasure/191 2012
VII i KF113350 chicken Pakistan Lahore/200 2012
VII i HQ697254 chicken Indonesia Banjarmasin/10 2010
VII i KF792019 chicken Israel KY/50/826 2012
VII i KF792020 parrot Israel 84/824 2012
VII i KP776462 chicken Pakistan AW/14 2014
72
VII i KM670337 chicken Pakistan SFR/611/13 2013
VII i KR676389 chicken Pakistan Kohat/122 2011
VII i KR676390 chicken Pakistan Peshawar/121 2012
VII i KR676391 chicken Pakistan Narowal/329 2012
VII i KR676392 chicken Pakistan Waziabbad/431 2012
VII i KR676393 chicken Pakistan Attock/437 2012
VII i KR676394 chicken Pakistan AP/2013 2013
VII i KR676395 chicken Pakistan Lahore/649 2014
VII i KR676396 chicken Pakistan Lahore/736 2014
VII i KR676397 chicken Pakistan Attock/7/411 2014
VII i KR676398 chicken Pakistan Multan/5/125 2014
VII i KR676399 chicken Pakistan Gujranwala/2/101 2014
VII i KR676400 chicken Pakistan Sheikhpura/MNA 2014
VII i KR676401 chicken Pakistan Lahore/821 2014
VII i KR676402 chicken Pakistan Lahore/12 2015
VII i KR676403 chicken Pakistan Lahore/GM/24 2015
VII i KR676404 chicken Pakistan Gujranwala/FB/2 2015
VII i KP780878 chicken Pakistan Gujranwala/649 2013
VII i KP780879 chicken Pakistan Gakkhar/609 2013
VII i KU845252 duck Pakistan AW/123 2015
VII i KY076030 chicken Pakistan Sheikhupura/994/12A 2015
VII i KY076031 chicken Pakistan Wazirabad/995/15A 2015
VII i KY076032 chicken Pakistan Kasur/998/26A 2011
VII i KY076033 chicken Pakistan Badhana/999/27A 2015
VII i KY076034 chicken Pakistan ChakShahzad/1000/30A 2015
VII i KY076035 chicken Pakistan Pattoki/1002/1A 2015
VII i KY076036 chicken Pakistan Buner/KPK/1003/2A 2015
VII i KY076037 chicken Pakistan Buner/KPK/1004/5A 2015
VII i KY076038 chicken Pakistan BhaiPhairu/1007/6A 2015
73
CHAPTER 4
EXPERIMENT 2
Complete genomic analysis of Newcastle Disease Virus of a recent panzootic isolated from
vaccinated poultry flock in 2014 in Pakistan
Abdul Wajid1,2, Muhammad Wasim2, Andleeb Batool3, Haleema Sadia2, Asma Basharat1,
TasraBibi1, Saba Manzoor2, Tahir Yaqub4, Muhammad Tayyab2, Shafqat Fatima Rehmani1*
1Quality Operations Lab, University of Veterinary and Animal Sciences, Lahore, Pakistan
2Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences,
Lahore, Pakistan
3Department of zoology, Government College University, Lahore, Pakistan
4Department of Microbiology, University of Veterinary and Animal Sciences, Lahore, Pakistan
Corresponding author: Shafqat Fatima Rehmani
Address: Quality Operations Lab, University of Veterinary and Animal Sciences, Lahore,
Pakistan
Contact: +92-334-4075315
Email: rehmani.shafqat@uvas.edu.pk
Published in: Journal of Plant and Animal Sciences 27 (5): 2017
74
ABSTRACT
Newcastle disease (ND) is one of the most important OIE listed disease that causes a huge
economic losses in the poultry sector worldwide. The disease is endemic in Pakistan and
recurrent outbreaks are being reported in vaccinated and non-vaccinated commercial poultry
flocks. Sequence analysis shows several amino acid substitutions at the functional domains of F
and HN protein. The current study proposed that the vaccination is leading to pressure on the
NDV to mutate into more virulent strains. We noticed that the host range of NDV is extending to
pet and other species and suggest it could be due more virulent strains emerging. The NDV strain
Chicken/NDV/Pak/AW-14 was isolated from the vaccinated chicken from a poultry farm located
near Lahore, Punjab. The isolate was biologically analyzed using intra-cerebral pathogenicity
index (ICPI) and genetically characterized by the real-time PCR. To better understand the
epidemiology of ND outbreak, the full genome was sequenced and phylogenetic analysis was
performed on the basis of full F and genome sequencing. AW-14 isolate was categorized as a
velogenic strain assessed biologically by the intracerebral pathogenicity index (ICPI), and the
polybasic amino acid sequence at the fusion protein cleavage site. The complete genome is
15,192 nucleotides (nt) long, consisting of six genes in the order of 3’-NP-P-M-F-HN-L-5’.
Several mutations were identified in the functional domain of F and HN proteins, including
signal peptide, transmembrane domain, heptad repeat region and N-glycosylation site,
transmembrane domain, neutralizing epitope respectively. Phylogenetic analysis showed that the
AW-14 belongs to sub-genotype VIIi, the newly emerging NDV strain has been implicated in the
recent outbreaks in Pakistan, Indonesia and Israel and becoming established in poultry sector
through Asia and Middle East. Here, we provide a summary of the genetic evolution and
molecular epidemiology of the vNDV strain suggesting responsible of a fifth panzootic.
75
Keywords: Newcastle disease virus, complete genome, vaccinated commercial chickens,
phylogenetic analysis and Pakistan
Introduction
Newcastle disease (ND) a highly contagious disease worldwide and has enormous adverse
impact in the poultry industry. ND remains to be one of the major threats to the poultry
producers in the developed and under developed countries including Pakistan. The disease is
endemic associated with huge economical losses for the national poultry sector due to concurrent
outbreaks in the country. Apart from the fact that much advancement has been made in the field
of diagnosis and vaccinology. The damage to the commercial poultry due to NDV is enormous.
Newcastle disease (ND) has the ability to infect more than 250 species of birds and can spread
easily via various routes. The virus is non-segmented enveloped, single stranded with negative
sense RNA genome. The genome has at least three genomic lengths, 15186 (Paldurai et al.
2010), 15189 (Yurchenko et al. 2015), 15192 (Wajid et al. 2015, Umali et al. 2014) and 15198
(Kim et al. 2012) and encodes for six proteins, nucleocaspid (NP), phosphoprotein (P), matrix
protein (M), fusion protein (F), haemagglutinin-neuraminidase (HN) and RNA polymerase
(Miller et al. 2010). The HN and F are enveloped glycoproteins, earlier mediates attachment to
the host cell sialic acid receptor and later one is responsible for virus penetration and virus-
induced cell fusion and haemolysis (McGinnes et al. 2006). The virulence of the virus may be
related to the amino acid sequence at the proteolytic cleavage site of the F0, the precursor of F
glycoprotein, cleft by enzyme like trypsin/subtilisin and the ability of the cellular protease to
cleave protein of different viral pathogens.
76
At present the NDV isolates are grouped into class I and class II, and into one genotype for class
I and there are eighteen genotypes for class II NDV isolates (Diel et al. 2012, Snoeck et al. 2013,
Courting et al. 2013). The genotypes I, II, VI and VII are further divided into sub-genotypes, I
into Ia and Ib; genotype II into IIaandIIb; genotype VI into VIa to VIf and genotype VII into
VIIa to VIIi (Wajid et al. 2015, Miller et al. 2010, Yu et al. 2001, Kim et al. 2007, Miller et al.
2015). Since first detection in 1926, there are four different panzootics were occurred worldwide.
Different NDV genotypes and sub-genotypes are responsible for these panzootics (Alexander,
2001, 2003; Miller and Koch, 2013; Perozo et al. 2012).
The novel sub-genotype VIIi in genotype VII, class II viruses are rapidly spreading through
Middle East and Asia to Easter Europe coutries causing severs ND outbreaks suggesting the
existence of 5thpanzootic(Miller et al. 2015). The particular concern of these viruses has
demonstrated causing severe illness in vaccinated flocks (Wajid et al. 2015, Rehmani et al.
2015). However, ND is endemic in Pakistan, the epidemiology, the mechanism of maintenance
and evolution of the new genotypes are not well understood. Despite the vigorous vaccination in
the region, ND outbreaks have been reported from all areas of Pakistan since 1963 (Khan and
Huq, 1963), affecting not only the commercial poultry but also wild birds in zoos and backyards.
The epidemiological and clinical findings demonstrated that the birds affected during the
outbreaks occurred in 2011-12, is still causing disease to susceptible birds either vaccinated or
non-vaccinated. A continuous outbreak of ND in Pakistan needs nonstop research work to find
the various reasons either the usage of un-matched vaccine strain, or any immunological stress
using various vaccines with short span or selection of breeds, highly susceptible to NDV. This
study would assist us to compare the NDV full genome described during the period of outbreak
and the changes after two years period its effect on the economy of poultry industry.
77
Material and Method
Isolate
The chicken/NDV/Pak/AW-14, was isolated from the vaccinated chicken in 2014 in Punjab. The
isolate was propagated in 9-11-day old embryonated SPF (33 incubated at 37 °C and monitored
for viability up to 72 hours. The allantoic fluid was extracted and screened for hemagglutination
assay (HA). The HI was performed as described previously (OIE, 2008). All the positive fluids
were collected and stored at -80 °C till further use.
Characterization
Intracerebral pathogenicity index (ICPI) as described ealrlier(OIE, 2008) was used to evaluate
the pathogenicity. For this test, day-chicks were injected intracerebraly with 50 µl of a 10 fold
dilution in PBS. At the same time, 50 uL of PBS was inoculated to 1 day old chickens as control.
The chickens were monitored every 24 h for 8 days, scoring 0, 1, 2 for normal, sick and dead
respectively.
RNA extraction and sequencing
Nucleic acid was extracted from infected allantoic fluids using TriZol reagent (Invitrogen, USA)
as per manufacturer’s protocol. Reverse transcription was carried out using the Thermo
Scientific cDNA synthesis kit (Thermo Scientific, USA). Oligonucleotide primers were designed
for amplifying the complete genome of isolate as overlapping fragments (Sequences of primers
are upon requested). The complete genome sequence of chicken/NDV/Pak/AW-14 isolate was
determined using high fidelity Platinum ®supermix PCR kit (Invitrogen, Carlsbad, CA,USA).The
PCR ampliconswere run on 1% agarsoe gel and were purified by using the QIAquick clean gel
extraction kit (Qiagen, Valencia, CA). The purified products were cloned into TOPO TA
vactorand sequenced using ABI 3130 automated sequencer.
78
Nucleotide sequencing and Phylogenetic Analysis
Assembly and editing of sequencing of chicken/NDV/Pak/AW-14 isolate was performed using
the BioEdit software v 7.2.5 (Hall, 1999) and compared to the published strains by using the
software Clustalw 2.2.Alignment and phylogenetic analysis were performed using MEGA
software (MEGA, version 6), inferred by the Maximum Likelihood method with standard error
being calculated based on 1000 bootstrap replicates (Tamura et al. 2013). The
chicken/NDV/Pak/AW-14 genome sequence was compared against 64 complete genome
sequences of class I and II (genotypes I-XVIII) available at GenBank. In order to construct the
complete fusion gene based phylogenetic tree, the F gene of chicken/NDV/Pak/AW-14 was
analyzed with 96 sequence of viruses belong to class I and II (genotypes I-XVIII).
Nucleotide Sequence Accession Number
The complete genome sequence of NDV isolate chicken/NDV/Pak/AW-14 is available in
GenBank under accession numberKP776462.
Results
Biological characteristics
The strain chicken/NDV/Pak/AW-14 was found pathogenic as assessed by the standard ICPI test
and sequencing of the fusion (F) protein cleavage site. Intracerebral inoculation of the AW-14
isolate in day old chicks free of NDV antibodies resulted in an ICPI value 1.8. Moreover,
sequencing of the F protein cleavage site showed the presence of three basic aa residues at
positions 113, 115 and 116 and a phenylalanine at position 117 (112-R-R-Q-K-R-F117), which is
typical of vNDV strain (Miller et al. 2015, Rehmani et al. 2015).
Genomic analysis and deduced protein
79
A summary of the complete genomic feature of NDV strain chicken/NDV/Pak/AW-14 is
presented in Table 4.1. The isolate have the similar characteristics to those presented by other
virulent APMV-1. The nucleotide (nt) and amino acid (aa) sequences comparisons between
chicken/NDV/Pak/AW-14 isolate and selected class II reference strains representing genotypes I-
XIII, XVI and XVIII of NDV are presented in Table 4.2. Nucleotide sequences comparison of
this newly emerging strain (chicken/NDV/Pak/AW-14) has 99% homology with Indonesian
NDV strains chicken/Banjarmasin/010/2010 (genotype VIIi). Contrary to that,
chicken/NDV/Pak/AW-14showed lowest nucleotide homology with LaSota vaccine strain (83%;
genotype II).
Analysis of the functional domain of cleavage site was contained three basic aa residues with
phenylalanine at position 117, (112-R-R-Q-K-R-F-117), this motif is considered as highly
virulent strain of NDV in chicken. Comparisons with consensus sequence the seven neutralizing
epitopes (D72, E74, A75, K78, A79, L343, 151ILRLKESIAATNEAVHEVTDG171), believed to be
critical for structure and function of F protein, and were conserved in chicken/NDV/Pak/AW-14
strain. The Signal and fusion peptides almost conserved in chicken/NDV/Pak/AW-14 isolate
except a single substitution at position C25→Yin signal peptide. Analysis of heptad repeat
regions (HR; HRa, HRb, HRc) revealed a total of four substitutions in HRa (143-185 aa) with
change A176→S; HRb (268-299 aa) with change N272→Y and HRc (471-500 aa) with two
changes E482→T; K494→R.Analysis of chicken/NDV/Pak/AW-14 strain’s transmembrane
domain showed four substitutions at positions V506→A; V513→F; A516→V and V520→G.
The HN gene of NDV strain chicken/NDV/Pak/AW-14 is 1716 nt in length and encode for 571
aa, characteristics of the vNDV strain. Twelve aa (174, 175, 198, 236, 258, 299, 317, 401,
416,498, 526, and 547) constituting the sialic acid binding site of HN protein were completely
80
conserved (Table 4.3). Cysteine residues (123, 172, 186, 196, 238, 247, 251, 344, 455, 461, 465,
531, and 542) and N-glycosylation sites (119, 341, 433, 481, 508, and 538) were almost
conserved except for the loss of N-glycosylation at position 508 in chicken/NDV/Pak/AW-14
isolate. There were two substitutions at position V34→I and T36→I in transmembrane domain of
HN protein of chicken/NDV/Pak/AW-14 strain, in comparison with the consensus aa sequences.
Analysis of the ten neutralizing epitopes in the HN protein identified a single aa change at
position E347→K, have been observed in region 14 of seven antigenic sites (1, 2, 3, 4, 12, 14, and
23) within HN protein of chicken/NDV/Pak/AW-14 isolate (Table 4.4).
Table 4.1: Genome features and protein characteristics of NDV strain chicken/NDV/Pak/AW-14
Genomic Characteristics Deduced protein
Protein Intergenic sequence
(IS)
Nucleotide length
(nt) 5UTR ORF length (nt) 3UTR %G+C Size (aa) MW (kDa)
NP 2 1752 66 1470 216 50.81 489 53.2
P 1 1451 83 1188 180 55.05 395 42.3
M 1 1241 34 1095 112 48.58 364 39.6
F 31 1792 46 1662 84 45.42 553 59.0
HN 47 2002 91 1716 195 45.86 571 67.6
L - 6703 11 6615 77 44.47 2204 248.6
Genome - 15,192 - - - 47.07 - -
81
Table 4.2: Nucleotide and amino acid comparison between the vNDV isolate
chicken/NDV/Pak/AW-14 and viruses representing other genotypes within class II
Genotype I II III IV V VI VII VIII IX X XI XII XIII XVI XVIII
Strain Ulster LaSota Muktaswar Herts/33 Largo/71 Fontana/72
Banjarmas
in/010/10
QH4 JS/1/2/Du
Mullard/
US/4-
411/04
MG-1992
Poultry/P
eru
1918-
03/08
Sterna/As
tr
2755/200
1
D-
Republic/
4993/200
8
NDV/chi
ck/
Tog/Ak0
18
Access
No
AY562991 AY845400 EF201805 AY741404 AY562990 AY562988
HQ69725
4
FJ751919 FJ436306
GQ28837
7
HQ26660
3
JN800306
AY86565
2
JX119193
JX39060
9
% % % % % % % % % % % % % % %
nt aa Nt Aa nt aa nt aa nt aa nt aa nt aa nt aa nt aa nt aa nt aa nt aa nt aa nt aa nt aa
NP 88 94 85 92 87 95 89 97 89 96 91 97 99 99 89 96 88 94 86 93 86 95 90 97 90 97 86 95 90 96
P 84 83 83 82 84 86 86 84 87 85 88 88 99 99 86 84 84 83 82 81 84 81 89 86 89 86 83 82 88 88
M 85 90 84 88 86 90 88 93 88 95 92 96 99 99 88 93 85 90 83 91 85 92 91 96 91 97 86 93 89 95
F 87 91 84 89 87 92 89 94 88 93 92 96 99 99 89 94 87 92 86 92 84 88 87 95 91 95 85 91 90 95
HN 85 90 82 87 85 89 87 90 89 91 90 94 99 99 86 92 84 89 83 90 84 88 89 92 90 92 84 92 89 93
L 87 95 85 92 86 94 89 95 90 96 92 96 99 99 89 95 88 94 86 95 85 94 90 96 91 96 87 94 90 95
Genome 85
83
86
87
88
90
99
87
85
84
84
89
89
84
89
Table 4.3: Amino acid substitution in the functional domain of HN protein
Genotype
Trans membrane domain
25-45
Receptor recognition
174, 175, 198, 236, 258,
299, 317, 401, 416,498,
526, 547
N-linked
glycosylation sites
119, 341, 433, 481,
508, 538
Cysteine residues
123, 172, 186, 196, 238,
247, 251, 344, 455, 461,
465, 531, 542
Consensus F R I A V L L L I V M T L A I S A A A L V
R I D K E Y Y E
R R Y E
Lost at 508
-
I (AY562991) - - - - I - - - T - V - - - - - - - - - A - -
II AY845400 - - - - I - F - T - V - - - - - V - S - L - -
III EF201805 - - - - A - - - M - I - - - V - - V - - A - -
IV AY741404 - - - - I - - - - - I - - - - - - - - - - - -
V AY562990 - - - - - - S - - - M - - - - - V - - - - - -
VI AY562988 - - - - - - - - - - M - - T - - - - - - - - -
VII chicken/NDV
/Pak/AW-14
- - - - - - - - M I M I - - - - - - -
A - -
82
Table 4.4: Amino acid constituting the neutralizing epitopes of the HN protein
Sites 23 3 4 14 4 12 2 and 12 2
Genotype 193-201 263 287 321 332-333 346-353 356 494 513-521 569
Consensus L S G C R D H S H N D K G K D E Q D Y Q I R K G/D R I T R V S S S S D
I (AY562991) - - - - - - - - - - - - - - - - - - - - - - - D - - - - - - - - - -
II (AY845400) - - - - - - - - - - - - - - - - - - - - - - R G - - - - - - - - - -
III (EF201805) - - - - - - - - - K - - - R - - - - - - - - - D - - - - - - - - - -
IV (AY741404) - - - - - - - - - S - - - - - - - - - - - - - D - - - - - - - - - -
V (AY562990) - - - - - - - - - K - R - - - - - - - - V - - N - - - - - - - - - N
VI (AY562988) - - - - - - - - - - - - - - - - - - - - - - - N - V - - - - - - - D
VII(chicken/NDV
/Pak/AW-14)
- - - - - - - - - N - - - - - K - - - - - - - D - I - - - - - - - -
Phylogenetic analysis
The phylogenetic analysis of the chicken/NDV/Pak/AW-14 isolate is presented in Figure 4.1,
4.2. On the basis of complete coding sequence of F gene and full genome, the AW-14 strain
belonging to newly emerged panzootic virus’s sub-genotype VIIi in genotype VII. The AW-14
strain was clustered together with recently isolated NDV viruses from poultry production
facilities and pet birds throughout Pakistan, Indonesia and Israel. This newly emerged sub-
genotype VIIi was recently described by our group (Wajid et al. 2015, Miller et al. 2015,
Rehmani et al. 2015). The genotype VIIi become the predominant sub-genotype causing ND
outbreaks in vaccinated and non-vaccinated poultry farming, backyards flock and pet birds since
a severe outbreak occurred in 2011-12. The VIIi strains are highly virulent in all type of species
and have replaced the NDV isolates of genotype XIII, which were commonly isolated in 2009-
11. The NDV isolates previously characterized in the country were also included in the
phylogenetic analysis to ascertain the genetic diversity with the isolate characterized in the
current study. The phylogenetic analysis of complete genome sequence of strain
chicken/NDV/Pak/AW-14 with other NDV strains available from GenBank were used revealed
the same topology of the tree as constructed with full coding sequences (1662 nt) for the F gene
83
analysis. The degree of nucleic acid variation between the AW-14 strain and NDV strains in
genotype VIIiwas 0.3-1.6% for the F gene (0.0-1.4% for protein). On the basis of complete
genome the chicken/NDV/Pak/AW-14 strain was closely related to (>99% homology)
Indonesian strain chicken/Banjarmasin/010/10 (HQ697254).
84
Figure 4.1: The phylogenetic analysis based on the complete fusion gene sequences of 96
isolates from class I and II available in GenBank. The new vNDV isolate
(chicken/Pak/NDV/AW-2014) is denoted with a Black circle in the tree.
Figure 4.2: Molecular phylogenetic analysis of selected full genome isolates was inferred by
using the maximum likelihood method based on the General Reversible model (38). A total of 64
nucleotide sequences of various genotypes were involved in the analysis. There are a total of
~15192 positions in the final data set.
Discussion
ND remains one of the most economically significant burdens on poultry production globally
despite stringent vaccination by most poultry producers. In Pakistan occasional outbreaks have
been reported in poultry production facilities as well as the backyard and wild birds. The
85
presence of vNDV with similar fusion protein cleavage site are commonly isolated from the
infected birds, however, few viruses are highly virulent under experimental conditions. Due to
non-availability of data regarding the pre-immune status, it remains uncertain whether the
clinical signs in infected birds by vND viruses results either due to failure of vaccination
program or due to latent infection of NDV in the birds. The second assumption in the current
situation is that the viruses currently circulating in Pakistan belong to a new sub-genotype VIIi,
where vaccine from genotype II used in the industry since a long time that could raise a question
the efficacy of vaccine used in Pakistan. Notably, the evolutionary distance between
chicken/NDV/Pak/AW-14and vaccine viruses of genotype II is the largest distance (17%
divergence) observed between all genotypes.
Newcastle disease is associated with seasonal outbreaks in vaccinated and non-vaccinated
chickens either from commercial or backyards farming. High prevalence of ND has been noted
during winter season and moderate mortality during spring, however the occasional outbreaks
continue for the whole years both in commercial, backyard production facilities as well as in
wild and pet birds. Stress associated with harsh conditions/environment has been suggested to
exacerbate the outbreaks of NDV (Abdu et al. 1992). Frequent fluctuation in ambient
temperature, humidity and high virus load act as stress factors, caused the immune status of the
birds worse; make the room for vNDV infection. Due to booster dose of live attenuated
vaccination against IB, IBD and NDV at the age of the chickens 2 to 3 weeks, they are not
immuno competent to resist the viruses load and may lead to the reason of outbreaks of vNDV.
No doubt, that in Pakistan the chickens from the hatchery irrespective of the immune status, the
vaccination schedule followed by the farmers as subscribed by the veterinary officer, who are
hired by the owners of the farms. Little is known about whether these outbreaks are associated
86
with a single or multiple viral genotypes and whether the quick changes/mutation in the genome
evolves new genotypes during disease transmission.
Epidemiological and sequencing analysis reveals that five distinct genotypes (II, III, VI, VII,
&XIII) circulated among the birds in Pakistan since mid1990’s, where VII are present in
chickens with novel sub-genotype VIIi and have replaced genotype XIII, which were commonly
isolated in 2009-11 (Wajid et al. 2015, Miller et al. 2015, Rehmani et al. 2015). The previous
study conducted on NDV, isolated genotype VI from Karachi, Sindh (Khan et al. 2010), and
genotype II and III are vaccine strains. Genotype II commonly used in commercial poultry and
the route of vaccination is drinking water whereas, genotype III is manufactured locally and
economical to purchase for the backyard farming. Furthermore, the extensive use of vaccines of
different origin makes the situation further auspicious for genetic modification in virulent strains.
We report here the full genome sequencing of circulating field NDV isolate from recent outbreak
in Pakistan. The virus belongs to genotype VII, always thought to be endemic in many Asian
countries (Munir et al. 2012). However, a distinct sub-genotype VIIi has been circulating since a
severe outbreak reported during 2011-12 suggesting a novel viral origin. The data present here
provide evidence that a genetically distinct virus, most closely related to Indonesian and Israeli
strains caused the concurrent outbreaks in the region.
The F and HN glycoproteins are the critical virus neutralizing antigen and thus the major
protective antigens (Taylor et al. 1990). Comparison of functional domains of F and HN proteins
with consensus sequences derived from NDV strains of different genotypes recognized several
amino acid substitutions. F gene has been mostly considered for the genetic characterization of
NDV strains, major determinant of virulence and particular emphasis given on the variable
region (47-421 nt), because it codes for a functionally significant structure such as signal peptide
87
(aa 1-31), cleavage activation sequence (aa 112-116), and fusion inducing hydrophobic region
(aa 117-142) (Umali et al. 2013). A standard criterion for NDV genotyping is also using the
variable region (nt 47-420) of F gene (Qin et al. 2008). The F protein cleavage activation
sequence (aa 112-116) at the C-terminus of the F2 protein and L (leucine) or F (phenylalnine) at
the N-terminus of F1 protein (aa 117) are major determinants of NDV virulence (Alexander,
2008, Alexander, 2009). The cleavage site motif 112-R-R-Q-K-R-F117 was present in Aw-14
strain, which is typical of vNDV strain (Miller et al. 2015, Rehmani et al. 2015). Seven major
neutralizing epitopes at position D, E, A, K, A, and L, and a stretch of aa from residues 151-171
believed to be critical for structure and function of F protein (Neyt et al. 1989, Yusoff et al.
1989), and all were conserved in AW-14 strain. Comparison of functional domain of F protein
with consensus sequences identified several amino acid substitutions in signal peptide with a
single substitution, total of four substitutions in heptad repeat regions (HRa,HRb,HRc) and
transmembrane domain had four substitutions.
The HN gene sequence of the chicken/NDV/Pak/AW-14 strain was 571 aa, characteristics of the
vNDV strain (Tsai et al. 2004, Habib et al. 2015, Maminiaina et al. 2010). The sialic acid
binding site and cysteine residues of HN protein were completely conserved as compared to
consensus sequences, however loss of N-glycosylation at position 508 was observed in AW-14
strain (Table 4.3).Analysis of the ten neutralizing epitopes in the HN protein identified a single
aa change at position 347 (E→K), observed in region 14 of seven antigenic sites within HN
protein, useful marker of antigenic variant and enables the field virus to evade neutralizing by a
specific MAbs (Gotoh et al. 1988) (Table 4.4).The earlier studies have demonstrated that the
amino acid substitutions in neutralizing epitopes play a significant role in formation of antigenic
epitope and could result in neutralizing escape variants (Cho et al. 2007, Cho et al. 2008, Hu et
88
al. 2010). Though the poultry industry has revolution during the last two decades in Pakistan, but
the selection of vaccine strain and route of vaccination still remained the same. There are
chances that a continuous use of LaSota strain (genotype II) unable to protect the chickens got
stricken by the newly emerging virulent form of genotype VIIi. The reason might be the
variation at the antigenic sites of newly emerging NDV strains. As compared to the vaccine
strain used in the field and the past pandemic NDV viruses in Pakistan, recently identified
viruses reveal amino acids substitutions at neutralizing epitopes, which in previous studies have
been suggested that these variations may lead to antigenic change and have effect on viral
attachment to the receptor on host cells (Iorio et al. 1989, Iorio et al. 1991). In such case, the
antibody recognition its neutralizing activity may be altered, resulted the escaping of specific
antigen and the release of virus as a virulent strains in the systemic circulation and developed as
an outbreak.
The full genome of AW-14 strain was compared with the viruses from genotype 1-XVIII, the
highest nucleotide identity (>99%) was found with chicken/Banjarmasin/010/2010 and
chicken/Pak/Quality Operations Lab/SFR-611/13(genotype VIIi; GenBank accession number
HQ697254 and KM670337 respectively) and the lowest similarity with LaSota strain (genotype
II; GenBank accession number AY845400) (Table 4.2). Although the full fusion of AW-14
strain has highest nucleotide similarities (99%-100%) with NDV isolates from Middle East,
Indonesian and previously characterized Pakistani NDV strains (genotype VIIi). These close
identities were also figured out by phylogenetic analysis (Figure 4.1, 4.2). Over-all, the data
confirmed that the commercial poultry production facilities and pet birds in Pakistan, Indonesia
and Middle East were affected by identical vNDV strains since 2011-12, leading to fifth
panzootic.
89
In summary, whole genome sequencing of NDV has enable us to study the dynamics of NDV
transmission and evolution during a localized outbreak in Pakistan in 2014. Furthermore, whole
genomic study is not only important for diagnosis and pathogenicity assessment but also
important in vaccine strain selection as a master seed virus for the region.
Acknowledgment
We are thankful to the Pakistan Agriculture Research Board (PARB) for their technical
assistance for the research project. We are also thankful to AbidHussain and his team, Poultry
Disease Diagnostic Lab, Gakkhar, Gujranwala for his assistance in collection of samples.
References
Abdu PA, Mera UM, Saidu L. 1992.A study on chicken mortality in Zaria, Nigeria.In
Proceedings. 19th World Poultry Congress, Amsterdam, the Netherlands, 20-24
September 1992. 2: 151.
Alexander DJ. 2001. Ecology and epidemiology of Newcastle disease. In Avian influenza and
Newcastle disease.Edited by Capua I, Alexander DJ. Milan: Springer; 2009:19-26.
Alexander DJ. Gordon Memorial Lecture. Newcastle disease. Br Poult Sci. 42(1): 5–22.
Alexander DJ. 2003. Newcastle disease, 64–87. In Saif YM, et al. (ed), Disease of poultry. Iowa
State Press, Ames, IA.
Alexander DJ. 2008. Newcastle disease, other avian paramyxoviruses and pneumovirus
infection. In Diseases of poultry.12th edition.Edited by Saif YM. Iowa: Blackwell
Publishing; 2008:75-93.
Cho SH, Kwon HJ, Kim TE, Kim JH, Yoo HS, Kim SJ. 2008. Variation of a Newcastle disease
virus hemagglutinin-neuraminidase linear epitope. J ClinMicrobiol. 46(4): 1541–1544.
90
Cho SH, SJ Kim, HJ Kwon 2007.Genomic sequence of an antigenic variant Newcastle disease
virus isolated in Korea. Virus Genes, 35(2): 293–302.
Courtney SC, L Susta, D Gomez, NL Hines, JC Pedersen, CC Brown, PJ Miller, CL Afonso
2013. Highly divergent virulent isolates of Newcastle disease virus from the Dominican
Republic are members of a new genotype that may have evolved unnoticed for over 2
decades. J ClinMicrobiol. 51(2): 508–517.
Diel DG, da Silva LH, Liu H, Wang Z, Miller PJ, Afonso CL. 2012. Genetic diversity of avian
paramyxovirus type 1: proposal for a unified nomenclature and classification system of
Newcastle disease virus genotypes. Infect Genet Evol. 12(8): 1770–1779.
Gotoh B, Sakaguchi T, Nishikawa K, Inocencio NM, Hamaguchi M, Toyoda T, Nagai Y. 1988.
Structural features unique to each of the three antigenic sites on the hemagglutinin-
neuraminidase protein of Newcastle disease virus.Virol. 163(1):174-182.
Habib H, Rehmani SF, Mukhtar N, Bibi T, Wajid A. 2015. Biological and molecular
characterization of Newcastle disease virus through haemagglutinin-neuraminidase gene
isolated from Lahore district. J InfMol Biol. 3(2): 28-33.
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucl Acid S., 41: 95- 98.
Hu S, Wang T, Liu Y, Meng C, Wang X, Wu Y, Liu X. 2010. Identification of a variable epitope
on the Newcastle disease virus hemagglutinin-neuraminidase protein. Vet Microbiol.
140(1-2): 92–97.
Iorio RM, Syddall RJ, Sheehan JP, Bratt MA, Glickman RL, Riel AM. 1991. Neutralization map
of the hemagglutinin-neuraminidase glycoprotein of Newcastle disease virus: domains
91
recognized by monoclonal antibodies that prevent receptor recognition. J Virol. 65:4999–
5006.
Iorio RM, Glickman RL, Riel AM, Sheehan JP, Bratt MA. 1989. Functional and neutralization
profile of seven overlapping antigenic sites on the HN glycoprotein of Newcastle disease
virus: monoclonal antibodies to some sites prevent viral attachment. Virus Res. 13(3):
245–261.
Kaleta EF, Alexander DJ, Russell PH. 1985. The first isolation of the avian PMV-1 virus
responsible for the current panzootic in pigeons?Avian Pathol. 14(4): 553-557.
Khan MZ, Huq MM. 1963. Infectious respiratory diseases of poultry in Pakistan.Bulletin Office
International des Epizooties. 60:983-987.
Khan TA, Rue CA, Rehmani SF, Ahmed A, Wasilenko JL, Miller PJ, Afonso CL. 2010.
Phylogenetic and biological characterization of Newcastle disease virus isolates from
Pakistan. J ClinMicrobiol. 48(5):1892– 1894.
Kim LM, King DJ, Curry PE, Suarez DL, Swayne D, Stallknecht DE, Slemons RD, Pedersen JC,
Senne DA, Winker K, Afonso CL. 2007. Phylogenetic diversity among low-virulence
Newcastle disease viruses from waterfowl and shorebirds and comparison of genotype
distributions to those of poultry-origin isolates. J Virol. 81(22): 12641–12653.
Kim, SH, Nayak S, Paldurai A, Nayak B, Samuel A, Aplogan GL, Awoume KA, Webby RJ,
Ducatez MF, Collins PL, Samal SK. 2012. Complete genome sequence of a novel
Newcastle disease virus strain isolated from a chicken in West Africa. J Virol.86(20):
11394-11395.
92
Maminiaina OF, Gil P, Briand FX, Albina E, Keita D, Andriamanivo HR, Chevalier V, Lancelot
R, Martinez D, Rakotondravao R, Rajaonarison JJ, Koko M, Andriantsimahavandy AA,
Jestin V, Servan de Almeida R. 2010. Newcastle disease virus in Madagascar:
identification of an original genotype possibly deriving from a died out ancestor of
genotype IV. PLoS One. 5(11): 1-12.
McGinnes LW, Morrison TG. 2006. Inhibition of Receptor Binding Stabilizes Newcastle
Disease Virus HN and F Protein-Containing Complexes. J Virol. 80(6): 2894-2903.
Miller PJ, Koch G. 2013. Newcastle disease, other avian paramyxoviruses, and avian
metapneumovirus infections; Newcastle disease. In: Swayne DE, Glisson JR, McDougald
LR, Nolan LK, Suarez DL, Nair V (Eds.), Diseases of Poultry 13 ed. Wiley-Blackwell,
Hoboken, New Jersey, 89–138.
Miller PJ, EL Decanini, CL Afonso 2010. Newcastle disease: evolution of genotypes and the
related diagnostic challenges. Infect. Genet.Evol., 10(1): 26-35.
Miller PJ, Haddas R, Simanov L, Lublin A, Rehmani SF, Wajid A, Bibi T, Khan TA, Yaqub T,
Setiyaningsih S, Afonso CL. 2015. Identification of new sub-genotypes of virulent
Newcastle disease virus with potential panzootic features. Infect Genet Evol. 29:216–
229.
Munir M, Abbas M, Khan MT, Zohari S, Berg M. 2012. Genomic and biological
characterization of a velogenic Newcastle disease virus isolated from a healthy backyard
poultry flock in 2010. Virol J. 9:46.
Nei M, Kumar S. 2000. Molecular evolution and phylogenetics. Oxford University Press, New
York (333pp).
93
Neyt C, Geliebter J, Slaoui M, Morales D, Meulemans G, Burny A. 1989. Mutations located on
both F1 and F2 subunits of the Newcastle disease virus fusion protein confer resistance to
neutralization with monoclonal antibodies. J. Virol., 63(2): 952-954.
OIE 2008.Manual of Diagnostic Tests and Vaccinesfor Terrestrial Animals.Office International
des Epizooties, Paris, France, 1092-1106.
Paldurai A, Kumar S, Nayak B, Samal SK. 2010. Complete genome sequence of highly virulent
neurotropic Newcastle disease virus strain Texas GB. Virus Gen. 41:67–72.
Perozo F, Marcano R, Afonso CL. 2012. Biological and phylogenetic characterization of a
genotype VII Newcastle disease virus from Venezuela: efficacy of field vaccination. J
ClinMicrobiol. 50(4): 1204–1208.
Qin ZM, Tan LT, Xu HY, Ma BC, Wang YL, Yuan XY, Liu WJ. 2008. Pathotypical
characterization and molecular epidemiology of Newcastle disease virus isolates from
different hosts in China from 1996 to 2005. J ClinMicrobiol. 46(2): 601-611.
Rehmani SF, Wajid A, Bibi T, Nazir B, Mukhtar N, Hussain A, Lone NA, Yaqub T, Afonso CL.
2015. Presence of Virulent Newcastle Disease Virus in Vaccinated Chickens in Farms in
Pakistan.J ClinMicrobiol. 53(5): 1715-1718.
Snoeck CJ, Owoade AA, Couacy-Hymann E, Alkali BR, Okwen MP, Adeyanju AT, Komoyo
GF, Nakoune E, Le Faou A, Muller CP. 2013. High genetic diversity of Newcastle
disease virus in poultry in West and Central Africa: cocirculation of genotype XIV and
newly defined genotypes XVII and XVIII. J ClinMicrobiol. 51(7): 2250–2260.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: Molecular evolutionary
genetics analysis version 6.0. MolBiolEvol. 30(12): 2725–2729.
94
Tamura K, Nei M, Kumar S. 2004. Prospects for inferring very large phylogenies by using the
neighbor-joining method. Proc. NatlAcad Sci. 101(30):11030-11035.
Taylor J, Edbauer C, Rey-Senelonge A, Bouquet J, Norton E, Goebel S, Desmettre P, Paoletti E.
1990. Newcastle disease virus fusion protein expressed in a fowlpox virus recombinant
confers protection in chickens. J Virol. 64(4):1441-1450.
Tsai HJ, Chang KH, Tseng CH, Frost KM, Manvell RJ, Alexander DJ. 2004. Antigenic and
genotypical characterization of Newcastle disease viruses isolated in Taiwan between
1969 and 1996. Vet Microbiol. 104(1-2): 19–30.
Umali DV, Ito H, Shirota K, Katoh H, Ito T. 2014. Characterization of complete genome
sequence of genotype VI and VII velogenic Newcastle disease virus from Japan. Virus
Gen. 49(1): 89-99.
Umali DV, Ito H, Suzuki T, Shirota K, Katoh H, Ito T. 2013. Molecular epidemiology of
Newcastle disease virus isolates from vaccinated commercial poultry farms in non-
epidemic areas of Japan. Virol J. 10:330.
Wajid A, Wasim M, Rehmani SF, Bibi T, Ahmed N, Afonso CL. 2015. Complete genome
sequence of a recent panzootic virulent Newcastle disease virus from Pakistan. Genome
Announc. 3(3): 1-2.
Yu L, Wang Z, Jiang Y, Chang L, Kwang J. 2001. Characterization of newly emerging
Newcastle disease virus isolates from the People’s Republic of China and Taiwan. J
ClinMicrobiol. 39(10): 3512–3519.
Yurchenko KS, Sivay MV, Glushchenko AV, Alkhovsky SV, Shchetinin AM, Shchelkanov MY,
Shestopalov AM. 2015. Complete Genome Sequence of a Newcastle Disease Virus
95
Isolated from a Rock Dove (Columba livia) in the Russian Federation. Genome Announc.
3: 1514-14.
Yusoff K, Nesbit M, McCartney H, Meulemans G, Alexander DJ, Collins MS, Emmerson PT,
Samson AC. 1989. Location of neutralizing epitopes on the fusion protein of Newcastle
disease virus strain Beaudette C. J Gen Virol. 70: 3105-3109.
96
CHAPTER 5
EXPERIMENT 3
Continuous circulation of panzootic strains of Newcastle disease virus in domestic and wild
birds in Pakistan, shows potential epidemic trends
Abdul Wajid1,2, Muhammad Wasim1, Asma Basharat2, Haleema Sadia3, Muhammad Farooq
Tahir4, Saba Manzoor1,Taseer Ahmed Khan5, Nazir Ahmed Lone6, Tahir Yaqub2, Muhammad
Tayyab1, Shafqat Fatima Rehmani2#
1Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Science,
Lahore, Pakistan
2Quality Operation Laboratory, University of Veterinary and Animal Science, Lahore, Pakistan
3Center for Applied Molecular Biology, University of Punjab, Lahore, Pakistan
4Disease diagnostic center, Poultry Research Institute, Rawalpindi, Pakistan
5Department of Physiology, University of Karachi, Sindh, Pakistan
6Shantou University Medical College, Shantou, Guangdong- 515041, PR-China
#Corresponding Author:
Shafqat Fatima Rehmani: rehmani.shafqat@uvas.edu.pk
Submitted in Pakistan Veterinary Journal: PVJ-16-340
97
Abstract
Newcastle disease (ND) is considered as a highly infectious disease of poultry worldwide. The
commercial broiler industry is highly susceptible to virulent NDV, the data indicating heavy
losses and documentary proof is available on NDV surveillance program. However, a little is
known regarding the maintenance and enzootic trends of vNDV infection level in domestic and
wild birds. Poor vaccination strategy as well as the existence of virulent form of NDV in the
domestic birds indicates a root cause of the occurrence of disease eruption in the developing
countries. Here, we report the eleven complete genome sequences of NDV from lovebird parrot
(n=1) and exotic parakeets (n=3), backyard chickens (n=5), peacock (n=1) and pheasant (n=1).
The complete genome lengths of all isolates were 15,192 nucleotides (nt) with same virulence-
associated cleavage site (112-RRQKRF-117) and selected ones have intracerebral pathogenicity
index (ICPI) values ranging from 1.50 to 1.86, which is typical of vNDV. The deduced amino
acid residues analyses have shown a number of substitution mutations in the functional domains
of fusion and hemagglutinin-neuraminidase proteins. Phylogenetic analysis showed all NDV
isolates belong to sub-genotypes VIIi within the genotype VII of class II. The isolation of highly
similar viruses (98-99%) during 2011-16 provides the evidence of an epidemiological links
between poultry, domestic and wild birds. Our results also support the existence of fifth
panzootic as these viruses primarily isolated from South Asia, Middle East and Indonesia and
recently spread into Eastern Europe. Active surveillance of these newly emerging viruses to
determine their evolution is one of the most realistic strategies for preventing and controlling
NDV outbreaks.
Key words: Newcastle disease, birds, complete genome, Phylogenetic analysis, Pakistan
98
Introduction
Newcastle disease (ND) is a highly significant disease of poultry caused by virulent strains of
avian paramyxovirus type -1 (AMPV-1) also known as Newcastle disease virus (NDV). APMV-
1 is a member of paramyxoviridae family, Avulavirus genus under the order Mononegaviral.
APMV-1 is enveloped, single stranded negative sense RNA genome with at least three genomic
lengths 15186, 15192, 15198 nucleotides (nt) (Czegledi et al. 2006; Wajid et al. 2015). The
genome is consist of six encoding genes in order 3’-NP-P-M-F-HN-L-5’. Historically, there are
two genetically divergent classes, I and II, classified on the bases of complete fusion gene and
complete genome sequences. There is single genotype of class I and 18 genotypes in class II,
some of genotype in class II have sub-genotypes (Diel et al. 2012).
Disease eruption mostly vNDV adversely affect the commercial poultry sector, however, loses of
domestic birds/backyard usually not documented though contributed a major production sector
and always suffer due to vNDV outbreaks in the developing countries (Alexander, 2011). During
the major outbreak in 2012, the ND had spread from Northern region to Southern part of the
country in a short period of time affected various species of birds. Moreover, the prevalence of
the same genotype was confirmed by the isolation of virus from the occasional outbreaks during
the year 2013-2016.
The studies carried out during the last six years at our laboratory (Quality Operations
Laboratory) not only characterized the virulent strains of NDV from commercial poultry flocks
were isolated, the samples from other avian species like, pigeon, ducks, peacock, pheasant,
parrots and exotic parakeets were also tested and characterized (Wajid et al. 2015; Miller et al.
2015; Rehmani et al. 2015; Wajid et al. 2016a, 2016b; 2016c). However, in this study NDV
isolates from three species, the lovebird parrot, exotic parakeet and backyards chicken confirmed
99
having vNDV. The main idea was to investigate the possibility of the route of inter-transmission
of domestic pet birds with scavenger chicken population at the backyards. As the vNDV strains
established in the backyard chicken population may easily cause the epidemic situation in the
commercial chicken population in Pakistan as reported in 2011-12. This study emphasized the
need for better understand the distribution tracks as well as the disease epidemiology in domestic
and wild birds in the region.
Material and Method
Sample collection and virus isolation
The detailed information of different species collected during 2015-16 is mentioned in Table 5.1.
Tracheal tissue suspensions (10% w/v) and Oropharyngeal/cloacal swabs were prepared using
phosphate buffered saline (PBS) containing antibiotic, penicillin (1000 IU/ml) and streptomycin
(1000µg/ml). Each sample was inoculated into the allantoic cavity of 9-10-day-old chicken
embryonated eggs (Specific NDV antibody free) according to the standard procedure (OIE,
2012). The allantoic fluid was harvested and presence of NDV was identified by
hemagglutination (HA) assay. All the viruses were confirmed by hemagglutination inhibition
(HI) assay to be APMV-1.
Intracerebral pathogenicity index (ICPI) assay
The virulency of nine isolates was determined from allantoic fluid by ICPI test using day-old
chickens (Specific NDV antibody free) as previously described (OIE, 2012).
RNA extraction, Detection, PCR amplification and Sequencing
The genomic RNA was extracted through TRIzol LS reagent (Invitrogen, USA). The detection
and pathotyping of clinical samples using protocol of USDA-validated RT-PCR assays as
described previously (Khan et al. 2010). Complementary DNA (cDNA) was synthesized using
100
random hexamer (Themro Scientific, USA) according to the manufacturer’s recommendations.
For complete genome of the isolates, 22 overlapping primers were used as previously used by
Wajid et al. (2015) using Platinum PCR Super Mix high-fidelity polymerase (Invitrogen, USA)
in Bio-Rad thermocycler. Gene JET gel extraction kit was used for purification of amplified PCR
products as per manufacturer’s instructions and cloned into the TOPOTA vector (Invitrogen,
USA) according to the manufacturer’s instructions. The amplified products were sequenced by
ABI 3130 XL genetic analyzer (ABI, Inc., CA. USA).
Evolutionary and Phylogenetic analysis
Phylogenetic analysis was performed by MEGA6 software (Tumara et al. 2013). Initial
phylogenetic analysis was done with complete coding sequence of fusion protein gene with 1558
nucleotide (nt). We performed phylogenetic analysis with complete genome sequences of strains
obtained in the current study and available sequences downloaded from GenBank (data not
shown). The final datasets of complete genome (n=83) and complete fusion protein gene coding
sequences (n=82) were generated.
Accession number
The complete genome sequences of virulent NDV isolates obtained in this study were submitted
into GenBank under accession number parrot/parakeets from KX268688 to KX268691, backyard
chicken KX791184 –KX791188, pheasant (KY290561), and peacock (KY290560 ).
Result
Epidemiological description of the current NDV isolates
The oropharyngeal and cloacal swabs were collected from backyard chickens after the
appearance of typical NDV signs and symptoms, i.e. depression with greenish white diarrhea,
torticollis and tremor with a mortality rate of almost 90%. Necropsy indicates typical lesions like
101
hemorrhages on Proventriculus, cecal tonsils and trachea. They were kept as non-vaccinated and
free-ranging birds in houses. It is important to note that usually these birds were kept as free
ranging and non-vaccinated. As the birds reared as scavenging birds, they remained in closed
contact with other pet and domestic birds and using food and water in common sources. The
close contact of the susceptible birds makes them more vulnerable to transmit the ND virus to
other host but for themselves and succumbed to death by the virulent ND virus.
The NDV isolate namely parakeet/Pak/Rawalpindi/SFR-RP15/2015 was isolated from clinically
healthy parakeet; the farm was operated on commercial basis and located at distance of 100 feet
near to the commercial poultry sheds. The parakeets were vaccinated with live attenuated LaSota
vaccine, and the HI antibody titre was assessed and found almost 5 log2. The titre indicating the
presence of specific antibodies against NDV; however it is difficult to assess that the HI antibody
titre was either due to LaSota ND vaccine or the persistence of the ND virus for long time. Other
three NDV strains parakeet/Pak/Lahore/SFR-148A/2015, parakeet/Pak/Lahore/SFR-148B/2015,
parrot/Pak/Lahore/SFR-129/2015 were isolated from dead birds from different premises reported
to our laboratory. The information gathered from the farmers indicates no illness; however the
mortality was 100% within 48-72 hours without any noteable symptoms. However, the laziness
and loss of appetite was the most common signs prior to mortality. The NDV strains
pheasant/Pak/Lahore/AW-pht/2015, peacock/Pak/Lahore/AW-pck/2015 were isolated from a
public zoo died within 48 hours after showing typical signs of vvNDV signs.
Initial characterization and pathogenicity assessment of isolates
Haemagglutination assay i.e HA titre of allantoic fluid was determined and recorded as 1:256
(log2 7). The initial detection of all clinical isolates was targeted by using protocol of USDA-
validated matrix gene RT-PCR assay. The result showed that all the isolates had Ct value ≤ 20.
102
Furthermore fusion gene RT-PCR assay was used for pathotyping of current isolates, all had Ct
value range from 25 to 28. To evaluate the pathogenic nature of the isolates, the standard assay
was used to determine the intracerebral pathogenicity index (ICPI) in day old NDV-specific free
antibodies chicks. The values varied from 1.50 to 1.86, indicating that all isolates were
velogenic.
Genomic organization of the complete genome sequences
In the current study, we obtained the complete genome of eleven isolates and genome
arrangement is summarized in Table 5.2. All eleven strains had genome length of 15,192 nt with
six transcriptional units in the order of 3’-NP-P-M-F-HN-L-5’. The genome length of earlier
genotype I, II, III, IV had 15,186 nt, comparatively the eleven APMV-1 strains had a six nt
insertion (1648CCCCGC1653, the similar sequences detected in all eleven isolates) at 5’ end of the
non-coding region of NP gene. The G + C content of complete genome of all isolates were range
from 46.2 to 46.5.
Characterization of the non-coding region
The leader and trailer sequences located at the 3 and 5 end of the genome play a significant role
in virus replication, transcription, packaging of the genome and anti-genomic RNA were
composed of 55 and 114 nt respectively. Start gene (GS) of the NP, P, M, F, HN genes was
identical (ACGGGTAGAA), except the GS of the L gene was different (ACGGGTAGGA) in all
isolates. The gene end (GE) of the NP gene was TTAGAAAAAAA identical in all isolates, the
GE of the M and L gene was identical (TTAGAAAAAA) also similar in all strains, however, the
GE of F and HN gene (TTAAGAAAAAA) was identical in all isolates. The length of Intergenic
spaces (IGS) of the N-P, P-M, and M-F was found 1 nucleotide, F-HN IGS was 31 nucleotides
and HN-L IGS was 47 nucleotides were observed in all isolates.
103
Gene identities and protein analysis
The deduced amino acid sequences of the F2/F1 cleavage site of fusion protein revealed that all
eleven isolates had typical virulent motifs 112RRQKRF117 with multiple basic amino acids and
phenylalanine residue at position 117, which is a characteristic of velogenic NDV. All eleven
isolates was found to have fusion gene coding sequence (CDS) comprising of 1662 nt coding for
553 amino acids (aa). Major functional domains of F protein was analyzed here, several deduced
amino acid substitutions were identified when compared with consensus sequences (Umali et al.
2014). The neutralizing (D72, E74, A75, K78, A79, and L343) believed to be critical for
structure and function of F protein, and were conserved in all isolates. The signal peptide (1-31
aa) had total of three aa substitutions, C25Y change was common in all four different species,
T17P substitution was only observed in parrots, while I26T was found in pheasant, peacock and
parrots sequences. Analysis of three heptad regions revealed several aa substitutions, HRa region
had single aa changed A176S common in all obtained isolates, HRb had three aa substitutions
(N272Y, I282L, T288N) in all isolates however, only N296K was specific to all five isolates
obtained from backyard chickens, moreover, SFR-144B (backyard) showed 3 (Y276D; Q281P;
I285T) additional aa substitutions in the same region. HRc region had two aa substitutions
(A482T, K494R) common in all isolates, however, except one additional substitution (I474D)
was observed in parakeet/Pak/Rawalpindi/SFR-RP15/2015. Transmembrane domain reveals four
aa substitutions at position V506A, V513F, I516V, and V520G observed in all isolates obtained
in the study. The HN gene length of all isolates had 1716 nt encodes for 571 aa characteristics
feature of virulent NDV. The neutralizing epitopes in HN protein is critically evolved and
revealed four aa substitutions (N199H, N263K, I514V, D569N) observed in all studied isolates.
The HN protein had six potential glycosylation sites at position 119, 341, 433, 481, 508, 538,
104
which were all conserved except at position 508 (N508D) observed in all strains.
Transmembrane domain of HN protein had four aa substitutions (I33M; V34I; T36I; V45A)
(Table 5.3).
Phylogenetic analysis
The phylogenetic analysis of eleven ND isolates obtained in this study and available sequences
from GenBank were carried out on the bases of complete coding sequences of F gene and
complete genome sequences. Utilizing established criteria, all the eleven isolates from different
species were classified as member of sub-genotype VIIi within the genotype VII of class II. Fig
5.1 and Fig 5.2 illustrate that the NDV isolates obtained in this study were clustered together
with the closely related viruses isolated previously from the commercial poultry flocks in Middle
East, Indonesia and Pakistan during 2011-12. The highly similar viruses (98.2-99.7% on the
basis of F gene protein) have been detected in Eastern European countries like Turkey, Georgia
and Bulgaria and Indian peafowl support the existence of fifth panzootic.
Discussion
Northern region of Pakistan may be considered to be a virus epicenter, though for the last two
decades 1970-1990 the southern region of the country was the hub of the poultry industry.
However, the shifting of the industry up North was due to political and law and order situation of
the region. The shifting also change the practice of poultry management as the small size and
open poultry houses vanished and large poultry sheds build as environmentally controlled with a
capacity of half million birds. Moreover, the change of big farming capacity does not affect the
multitude of small backyard farms. The farming includes ducks, geese, parrots and pigeons and
marketed in live birds markets on daily basis. The close proximity of poultry farms and to the
populated areas plays a major role in the transmission and easy access for its multiplication to
105
erupt the NDV. Therefore, the study was designed and proposed to conduct routine surveillance
of ND viruses in the area in different species to prevent the intra- and interspecies vNDV
transmission.
Here, we primarily report the molecular characterization of eleven complete genome of ND
viruses from backyard chickens (n=5), rosy-faced lovebird parrot (n=1), Australian type exotic
parakeets (n=3), pheasant (n=1) and peacock (n=1). Whole genome sequences of field strains of
APMV-1 viruses and later phylogenetic analysis confirmed belonging to potential panzootic
strains of sub-genotype VIIi within genotype VII. These viruses likely originated from Middle
East, Pakistan and Indonesia during 2011-12 (Miller et al. 2015; Wajid et al. 2015) and recently
have been identified in Eastern Europe. The eleven ND viruses in the study revealed high level
of genetic similarity among them (98.2-99.4%) indicating strong epidemiological connection and
suggested introduction from a common source. These isolates are genetically resembled with the
viruses isolated during 2011-2014 from non-poultry species (ducks, peacock and pheasant) and
commercial poultry. Maintenance of the same genotype viruses in the environment up to six
years is puzzling. Wild birds constitute a reservoir of virulent ND viruses of other genotype is
disputable and there is less evidence for its support (Dimitrov et al. 2016). However, it has been
suggested that the vNDV may be maintained in vaccinated poultry (Rehmani et al. 2015).
Peacock and pheasant in this study collected from a public zoo in Lahore city were died due to
vNDV. The same zoo was affected first time in 2011-12 showing the mortality 40-60% (Miller et
al. 2015). Since then application of proper vaccination program minimized the eruption of ND
cases during 2013 to early 2015, however mini-outbreaks could not be stopped during the
investigation period. The immune status assessed by measuring the mean hemagglutinin
inhibition (HI) titers from serum during the study (log2) showed high values ranging from 4.5 to
106
6.7. It has been suggested that antibody titers of log2 HI>4 should protect against the disease
(Van-Boven et al. 2008). The data showed that despite a high level of anti-NDV antibodies titers
of log2 HI>5 in birds, minimized the number of outbreaks but could not stopped the viral
replication.
The repeated isolation of vNDV from these birds suggesting the possibility of urban cycle of
maintenance of vNDV and may be involved in spill-over into other susceptible species. Exotic
parakeets are free ranging birds and have continuious contact with other birds in houses. In the
current study, the NDV isolate parakeet/Pak/Rawalpindi/SFR-RP15/2015 was isolated from
clinically healthy and vaccinated exotic parakeet; the farm was located at vicinity of 100 feet to
the commercial poultry sheds. Interestingly, the virus isolated from the parakeets farm was
genetically closed to the chicken virus that was causing 15% mortality at the poultry farm but not
in the parakeets. The data clearly indicated the interspecies transmission of vNDV from poultry
to parakeet and vice versa, however, genetically closed viruses (99.9%) isolated from both
species indicated that the virus had been transmitted previously. Three NDV isolates from dead
parakeets but from other premises were reported to our laboratory. The farmers who kept these
birds reported no illness, however the mortality was 100% within 48-72 hours with mild signs
and symptoms.
The current scenario of the fifth panzootic is alarming as non-poultry species like pheasants,
peacocks, and parrots; those have never been reported before with such a high incidence rate and
mortality. To the safety of these precious species a strict implementation of the biosecurity rules
and regulations and awareness to the farmers and caretakers is important to minimize the
exposure of vNDV at the farms. The management should hire well trained workers to manage
107
the shed by imposing the strict rules to minimize the virus circulation of virulent NDV in the
enviornment.
Acknowledgment
We thank to Dr. Claudio L Afonso (Newcastle Disease Lead Scientist: SEPRL, Athens, GA,
USA) for his guidance and generous support in active surveillance program for Newcastle
Disease in Pakistan. This is part of collaborative research between South East Poultry Research
Laboratory (SEPRL), Athens, GA and Quality Operations Lab (QOL), University of Veterinary
and Animal Sciences, Lahore, Pakistan.
FUNDING INFORMATION:
The funding for this work was supported by the U.S. Department of Agriculture (agreement 58-
0210-3-009) to Dr. Shafqat Fatima Rehmani and Abdul Wajid for Quality Operation Lab of the
University of Veterinary and Animal Sciences, Lahore, Pakistan.
Authors Contribution
SFR, AW, AB conceived and designed the study. AW, AS, SB, TAK, MFT involved in samples
collection. AW, AB executed the experiment and analyzed the data. All authors interpreted the
data, critically revised the manuscript for important intellectual contents and approved the final
version.
References
Alexander DJ. 2011. Newcastle disease in the European Union 2000 to 2009. Avian Pathol.
40:547-58.
Czeglédi A, Ujvári D, Somogyi E, Wehmann E, Werner O, Lomniczi B. 2006. Third genome
size category of avian paramyxovirus serotype 1 (Newcastle disease virus) and
evolutionary implications. Virus Res. 120: 36–48.
108
Diel DG, da Silva LH, Liu H, Wang Z, Miller PJ, Afonso CL, 2012a. Genetic diversity of avian
paramyxovirus type 1: proposal for a unified nomenclature and classification system of
Newcastle disease virus genotypes. Infect Genet Evol. 12:1770–79.
Khan TA, Rue CA, Rehmani SF, Ahmed A, Wasilenko JL, Miller PJ and Afonso CL. 2010.
Phylogenetic and biological characterization of Newcastle disease virus isolates from
Pakistan. J ClinMicrobiol. 48:1892–94.
Dimitrov KM, Bolotin V, Muzyka D, Goraichuk IV, Solodiankin O, Gerilovych A, Stegniy B,
Goujgoulova GV, Silko NY, Pantin-Jackwood MJ, Miller PJ and Afonso CL. 2016.
Repeated Isolation of Virulent Newcastle Disease Viruses of Sub-Genotype VIId From
Backyard Chickens in Bulgaria and Ukraine Between 2002 and 2013.Arch Virol.
161:3345-53.
Miller PJ, Haddas R, Simanov L, Lublin A, Rehmani SF, Wajid A, Bibi T, Khan TA, Yaqub T,
Setiyaningsih S, Afonso CL. 2015. Identification of new sub-genotypes of virulent
Newcastle disease virus with potential panzootic features. Infect Genet Evol. 29:216 –29.
OIE, 2012.Manual of diagnostic tests and vaccines for terrestrial animals, 7th ed. Office
International des epizooties, Paris, France.
Rehmani SF, Wajid A, Bibi T, Nazir B, Mukhtar N, Hussain A, Lone NA, Yaqub T and Afonso
CL. 2015. Presence of virulent Newcastle disease virus in vaccinated chickens in farms in
Pakistan.J ClinMicrobiol. 53:1715–18.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: molecular evolutionary
genetics analysis version 6.0. MolBiolEvol. 30:2725–2729.
109
Umali DV, Ito H, Shirota K, Katoh H, Ito T. 2014. Characterization of complete genome
sequence of genotype VI and VII velogenic Newcastle disease virus from Japan.Virus
Gen. 49:89–99.
van-Boven M, Bouma A, Fabri TH, Katsma E, Hartog L, Koch G. 2008. Herd immunity to
Newcastle disease virus in poultry by vaccination. Avian Pathol. 37:1–5.
Wajid A, Wasim M, Rehmani SF, Bibi T, Ahmed N, Afonso CL. 2015. Complete genome
sequence of a recent panzootic virulent Newcastle disease virus from Pakistan. Genome
Announc. 3:e00658-15.
Wajid A, Basharat A, Khan TA, Wasim M, Rehmani SF. 2016b. Complete Genome Sequence of
a Velogenic Newcastle Disease Virus isolated from Clinically Healthy Exotic Parakeet
(Melopsittacusundulatus) in Pakistan. Re: genome Announc. A01581-16
Wajid A, Rehmani SF, Sharma P, Goraichuk IV, Dimitrov KM, Afonso CL. 2016c. Complete
genome sequence of genotype VI Newcastle disease viruses isolated from pigeons in
Pakistan. Genome Announc. 4:e00845-16.
Wajid A, Rehmani SF, Wasim M, Basharat A, Bibi T, Arif S, Dimitrov KM, Afonso CL. 2016a.
Complete genome sequence of a virulent Newcastle disease virus strain isolated from a
clinically healthy duck (Anasplatyrhynchosdomesticus) in Pakistan. Genome Announc.
4(4):e00730-16.
Table 5.1: Description of virulent isolates recovered from domestic and zoo birds in 2015-16
Species Ecotype Scientific
Name Isolate
Year of
Isolation
Sample
type
aClinical
signs
Vaccination
history
Cleavage site
(aa 112–117) bICPI
Accession
number
Chicken Domestic
Gallus
gallusdomesti
cus
BY/Pakistan/Lahore/
SFR-144A/2016 2016 cOS, dCS Yes eNA f112-RRQKRF-117 176 KX791184
Chicken Domestic
Gallus
gallusdomesti
cus
BY/Pakistan/Lahore/
SFR-144B/2016 2016 OS, CS Yes NA 112-RRQKRF-117 179 KX791185
Chicken Domestic
Gallus
gallusdomesti
cus
BY/Pakistan/Lahore/
SFR-144C/2016 2016 OS, CS Yes NA 112-RRQKRF-117 171 KX791186
Chicken Domestic Gallus BY/Pakistan/Lahore/ 2016 OS, CS Yes NA 112-RRQKRF-117 171 KX791187
110
gallusdomesti
cus
SFR-144D/2016
Chicken Domestic
Gallus
gallusdomesti
cus
BY/Pakistan/Lahore/
SFR-144E/2016 2016 OS, CS Yes NA 112-RRQKRF-117 1.86 KX791188
Pheasant Zoo Phasianus
colchicus
Pheasant/Pakistan/Lahore/
AW-Pht/2015 2015 gTra Yes Yes 112-RRQKRF-117 NA KY290561
Peacock Zoo Pavo
cristatus
Peacock/Pakistan/Lahore/
AW-Pck/2015 2015 Tra Yes Yes 112-RRQKRF-117 NA KY290560
Lovebird-parrot Pet Agapornis
roseicollis
Parrot/Pak/Lahore/SFR-129
/2015 2015 Tra NA NA 112-RRQKRF-117 1.70 KX268691
Exotic-Parakeet Pet Melopsittacus
undulates
Parakeet/Pak/Rawalpindi/
SFR-RP15/2015 2015 OS, CS No Yes 112-RRQKRF-117 1.63 KX268688
Exotic-parakeet Pet Melopsittacus
undulates
Parakeet/Pak/Lahore/
SFR-148A/ 2015 2015 Tra Yes NA 112-RRQKRF-117 1.50 KX268689
Exotic-parakeet Pet Melopsittacus
undulates
Parakeet/Pak/Lahore/
SFR-148B/ 2015 2015 Tra Yes NA 112-RRQKRF-117 1.52 KX268690
aClinical signs: Neurological, respiratory and digestive signs were observed with different severity bICPI: Intracerebral pathogenicity index cOS: Oropharyngeal swab dCS: Cloacal swab eNA: Not Applicable fAmino acid symbols: R = arginine, Q = glutamine, K= lysine, F= phenylalanine. gTra: Trachea
Table 5.2: Genome length characteristics of ND viruses isolated from backyard, pet and wild
birds
Table 5.3: Amino acid substitutions in the functional domains of HN and F proteins HN F
23 3 4 14 4 12 2&12 2 Transm. Domain
Signal peptide HRa HRb HRc Transmission
Domain
193-
201 263 287 321
332-
333
346-
353 356 494
513-
521 569 25-45
1-31 143-185 268-299 471-500 501-521
aConsensus LSG
CRD
HSH
N D K GK
DEQ
DYQ
IR
K G/D
RITR
VSSS
S
D
FRIAVLL
LIVMTLA
ISAAALV
MGSKPSTRIPVP
LMLITRIMLILSC
ICLTSS
QANQNAANILRL
KESIAATNEAVHEVTDGLSQLAVA
VGKMQQF
LITGNPILYDSQTQL
LGIQVNLPSVGNLN
NMR
NNSISNALDK
LAESNSKLDKVN
VKLTSTSA
LITYIVLTVISLVFGALSLVL
Lahore/144A - K - - - - - - I514V N I33M;V34I;
T36I;V45A C25Y A176S N272Y;N296K A482T;K494R
V506A;V513F;
A516V;V520G
Lahore/144B - K - - - - - - I514V N I33M;V34I;
T36I;V45A C25Y A176S
N272Y;Y276D;Q281P
;I285TN296K A482T;K494R
V506A;V513F;
A516V;V520G
Lahore/144C - K - - - - - - I514V N I33M;V34I;
T36I;V45A C25Y A176S N272Y;N296K A482T;K494R
V506A;V513F;
A516V;V520G
Lahore/144D - K - - - - - - I514V N I33M;V34I;
T36I;V45A C25Y A176S N272Y;N296K A482T;K494R
V506A;V513F;
A516V;V520G
Lahore/144E - K - - - - - - I514V N I33M;V34I;
T36I;V45A C25Y A176S N272Y;N296K A482T;K494R
V506A;V513F;
A516V;V520G
Lahore/AW-Pht - K - - - - - - I514V N I33M;V34I;
T36I;V45A C25Y A176S N272Y A482T;K494R
V506A;V513F;
A516V;V520G
Lahore/AW-Pck - K - - - - - - I514V N I33M;V34I;
T36I;V45A C25Y A176S N272Y A482T;K494R
V506A;V513F;
A516V;V520G
Lahore/SFR-129 - K - - - - - - I514V N I33M;V34I;
T36I;V45A T17P;C25Y;I26T A176S N272Y A482T;K494R
V506A;V513F;
A516V;V520G
Region Gene start Length of
3′ UTR
Coding
sequence
positions
Coding
Sequence
Length
Length of
5′ UTR Gene end
Intergenic
regions
Length of
complete
gene
Amino acid
length
Leader 1–55 bNA NA NA NA NA NA 55 NA
NP 56-65 56 122-1591 1470 206 1798-1808 1 1753 489
P 1810-1819 73 1893-3080 1188 169 3250-3260 1 1451 395
M 3262-3271 24 3296-4390 1095 102 4493-4502 1 1241 364
F 4504-4513 36 4550-6211 1662 73 6285-6295 31 1792 553
HN 6327-6336 81 6418-8133 1716 185 8319-8328 47 2002 571
L 8376-8385 1 8387-14001 6615 67 15069-15078 NA 6703 2204
Trailer 15079-15192 NA NA NA NA NA NA 114 NA
Complete
Genome 15192
111
R. Pindi/SFR-RP15 - K - - - - - - I514V N I33M;V34I;
T36I;V45A T17P;C25Y;I26T A176S N272Y
I474D;A482T;
K494R
V506A;V513F;
A516V;V520G
Lahore/SFR-148A - K - - - - - - I514V N I33M;V34I;
T36I;V45A T17P;C25Y;I26T A176S N272Y A482T;K494R
V506A;V513F;
A516V;V520G
Lahore/SFR-148B - K - - - - - - I514V N I33M;V34I;
T36I;V45A T17P;C25Y;I26T A176S N272Y A482T;K494R
V506A;V513F;
A516V;V520G
aConsensus: The consensus sequences are copied from the Umali et al. 2014
Figure 5.1:Phylogenetic analysis of NDV isolates was based on complete fusion gene sequence
(1662 nt). The viruses isolated in this study are indicated as Black Square.
KX268689-parrot/Pak/Lahore/SFR-148A/2015 KX268690-parrot/Pak/Lahore/SFR-148B/2015 KX268691parrot/Pak/Lahore/SFR-129/2015 KX268688-parrot/Pak/Rawalpindi/SFR-RP15/2015
KF113339-chicken/Pakistan/Lahore/30/2011 KF113340-chicken/Pakistan/Lahore/32/2011 KF792018-hiken/Israel/2011/1115 818 HQ697254-chicken/Banjarmasin/010/10 KF792020-parrot/Israel/2012/841 824 KF792019-hicken/KY-Israel/2012/50 826 KF113350-chicken/Pak/Lahore/200/2012
KF113346-chicken/Pakistan/Khyber PK/118/2011 KF113348-chicken/Pakistan/Khyber PK/162/2012 KF113350-chicken/Pakistan/Khyber PK/200/2012 HQ697260-chicken/Kudus/018/2010 HQ697259-chicken/Kudus/017/2010 HQ697258-chicken/Sragen/014/2010 HQ697257-chicken/Gianyar/013/2010 KF113343-chicken/Pakistan/Gujranwala/56/2011
KX791184-backyard/Pakistan/Lahore/SFR-144A/2016 KX791185-backyard/Pakistan/Lahore/SFR-144B/2016
KX791187-backyard/Pakistan/Lahore/SFR-144D/2016 KX791186-backyard/Pakistan/Lahore/SFR-144C/2016 KX791188-backyard/Pakistan/Lahore/SFR-144E/2016
KP776462-chicken/Pakistan/Lahore/AW-14/2014 KY290561-pheaant/Pak/Lahore/AW-pht/2015 KY290560-peacock/Pak/Lahore/AW-pck/2015
KF113353-pheasant/Pakistan/Lahore/136/2012
VIIi
AY288998-cockatoo/Indonesia/14698/90 Ancestral JN986837-APMV-1/chicken/NL/152608/93 Ancestral
KF767105-Lory/indonesia/1988/88-08989-523 Ancestral AB605247-chicken/NDV/Bali-1/2007 JX193074-egret/China/Guangxi/2011
HQ697256-chicken/Makassar/003/2009 HQ697261-chicken/bali/020/2010
VIIh
KF767104-cockatoo/Indonesia/1988/87-36724-524 Ancestral KF767106parrot/Indonesia/1976/C300(19625)-520 Ancestral
VIIf-AY028995-chicken/China/A7/1996 VIIf-AF140343-chicken/ND/03/018/2009 VIIf-GQ338310-chicken/China/NDV/03/044/2010 VIIf-DQ858357-chicken/China/YG03/2006
VIIg-FJ608347-chicken/China/XD/Shandong/2008 VIIg-GQ994433-chicken/China/XD/Shandong/2008
VIIg-Q417112-chicken/China/SRZ/2003 VIIg-FJ608337-chicken/China/QG/Hebei/2007
VIIe-DQ485256-chicken/China/Guangxi2/2000 VIIe-DQ485258-chicken/China/Guangxi4/2000
VIIe-EF589134-fowl/China/Guizhou/H2/2000 VIIe-DQ363537-chicken/China/Jinan/2004
VIIb-EF592501-mallard/China/HLJ/34/2005 VIIb-FJ480779-accipiter gularis/China/HLJ070/2006 VIIb- FJ480774-buzzard/China/HLJ009/2006 VIIb-FJ480805-chicken/China/JL/2/2003 VIId-GQ245792-chicken/China/SY-17/2007
VIId-DQ363536-chicken/China/TJ/2005 VIId-FJ480803-chicken/China/JL/2/2003
VIId-DQ363534-chicken/China/SF/2002
VIIb, VIId, VIIe, VIIf, VIIg
XIII-|FJ772494-chicken/Burundi/4132-20/2008 XIII-GU585905-chicken/Sweden/1997 XIII
XII-KC152048-goose/China/GD/450/2011 XII-KC152049-goose/China/GD/1003/2010 XII
Class I: DQ097393 DE-R49/1999
112
Figure 5.2: Phylogenetic analysis of NDV isolates was based on complete genome sequence
(15192 nt). The viruses isolated in this study are indicated as Black Square.
JQ015296 Chicken/China/SD04/2011 JQ015295 Chicken/China/SDWF07/2011
JQ015297 Chicken/China/SDYT03/2011 KJ607170 qu/CH/LJS/101107
JN400895 Duck/China/SD03/2009 JN400897 Chichen/China/SDLY01/2010
JN631747 JS-5-05-Go JN618349 JS-3-05-Ch DQ485231 chicken/China/Guangxi11/2003
JF343539 chicken/China/Guangxi9/2003 DQ485230 chicken/China/Guangxi9/2003
DQ485229 chicken/China/Guangxi7/2002
VIIb
JN986838 APMV-1/chicken/ZA/AL495/04 F473851 Goose paramyxovirus SF02
FJ872531 Muscovy duck/China(Fujian)/FP1/02 JN400896 Chichen/China/SDSG01/2011
JX867334 YZCQ/Liaoning/08 KC461214 chicken/TC/9/2011
KJ600785 Ch/CH/SD/2008/128 GU143550 Go/CH/HLJ/LL01/08
VIId
VIIe KJ607169 go/CH/LHLJ/1/06 JN618348 XJ-2/97 Ancestral
GQ338310 ND/03/044 JF343538 ND/03/018
GQ338309 ND/03/018VIIf
JN986837 APMV-1/chicken/NL/152608/93 HQ697255 chicken/Sukorejo/019/10 VIIh
AY562985 cockatoo/Indonesia/14698/90 Ancestral JX854452 Pheasant/MM20/Pakistan/2011
JX532092 MM19 KY290561-peacock/Pakistan/Lahore/AW-pck/2015 KY290560-pheasant/Pakistan/Lahore/AW-pht/2015
chicken/NDV/Pak/P-14/2014 HQ697254 chicken/Banjarmasin/010/10
KX268689-parakeet/Pakistan/Lahore/SFR-148A/2015 KX268690-parakeet/Pakistan/Lahore/SFR-148B/2015 KX268691-parrot/Pakistan/Lahore/SFR-129/2015
KX268688-parakeet/Pak/AW-RP/2015 KX791184-backyard/Pakistan/Lahore/SFR-144A/2016 KX791187-backyard/Pakistan/Lahore/SFR-144D/2016 KX791185-backyard/Pakistan/Lahore/SFR-144B/2016 KX791186-backyard/Pakistan/Lahore/SFR-144C/2016 KX791188-backyard/Pakistan/Lahore/SFR-144E/2016
VIIi
AB853926 APMV1/chicken/Japan/Osaka/2440/1969 FJ766529 ZhJ-3/97
FJ410147 PPMV-1/Maryland/1984 FJ410145 PPMV-1/New York/1984
AY562988 chicken/U.S.(CA)/1083(Fontana)/72 AY562990 mixed species/U.S./Largo/71
KJ577585 NDV/Chicken/Bareilly/01/10 KF727980 Bareilly KF740478 NDV2K35/CH/TN/2003
KC152048 GD450/2011 KC152049 GD1003/2010 KC551967goose/Guangdong/2010
VI, XII, XIII
113
CHAPTER 6
EXPERIMENT 4
Complete genome sequence of a virulent Newcastle disease virus strain isolated from
clinicallyhealthy duck (Anasplatyrhynchosdomesticus) in Pakistan
Abdul Wajid,a,bShafqat F Rehmani,a Muhammad Wasim,bAsmaBasharat,aTasraBibi,aSaima
Arif,aKiril M Dimitrov,c Claudio L Afonsoc#
Quality Operations Lab, University of Veterinary and Animal Sciences Lahore 54000, Pakistana;
Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences
Lahore 54000, Pakistanb; Exotic and Emerging Avian Viral Disease Research Unit, Southeast
Poultry Research Laboratory, US National Poultry Research Center, ARS, USDA, Athens,
Georgia, USAc
#Address correspondence to Claudio L. Afonso,
Claudio.Afonso@ars.usda.gov
Southeast Poultry Research Laboratory
934 College Station Road
Athens, GA 30605
Phone: (706) 546-3642
FAX: (706) 546-3161
Published in: Genome Announcement 4(4): e00730-16
114
Here we report the complete genome sequence of a virulent Newcastle disease virus
(vNDV)strain, duck/Pakistan/Lahore/AW-123/2015, isolated from apparently healthy laying
ducks (Anasplatyrhynchosdomesticus) from the province of Punjab, Pakistan. The virus has a
genome lengthof 15,192 nucleotides and is classified as member of sub-genotype VIIi, class II.
Newcastle disease (ND) is a highly contagious viral disease in birds caused by virulent strains
ofavian paramyxovirus serotype 1 (APMV-1), also known as Newcastle disease virus (NDV)
(Dimitrov et al. 2016).NDV has a single-stranded negative-sense RNA genome with six
transcriptional units (3ˊ-NP-P-M-F-HN-L-5ˊ). Multiple avirulent and virulent ND viruses have
been isolated from domestic andwild bird species and wild waterfowl are considered to be
natural reservoir of NDVs of lowvirulence (Kim et al. 2007). Although there are some
exceptions (Liu et al. 2003; Wan et al. 2004), generally ducks show no clinical signsof ND when
infected with highly virulent NDV isolates (Miller and Koch, 2013).
As a result of ND surveillance program in different avian species in Pakistan, we isolatedvirulent
NDV strains classified as members of a recently identified sub-genotype VIIi circulatingin
poultry and pet birds in Pakistan (Wajid et al. 2015; Rehmani et al. 2015; Miller et al. 2015).
These viruses are already spread through Asia, theMiddle East and East Europe causing
outbreaks of Newcastle disease with significant illness andhigh mortality in poultry, suggesting
the existence of a fifth panzootic (Dimitrov et al. 2016; Miller et al. 2015). Here we report
thelack of significant genetic changes in the complete genome of viruses previously reported
inchickens that apparently spilled over into ducks. Swabs samples collected from
apparentlyhealthy domestic ducks reared inside a poultry farm were inoculated in 9-to-11-day
115
oldembryonating chicken eggs (NDV specific antibody free). A hemagglutinating sample
wasconfirmed as APMV-1 by hemagglutination inhibition (HI) assay (OIE, 2012). Viral RNA
was extractedfrom the allantoic fluid using TRIzol LS as per manufacturer’s recommendations
(Invitrogen, USA). Reverse transcription was performed using random hexamers and Revert Aid
Premium RT following manufacturer’s protocol (Thermo Scientific, USA). Complete genome
was sequenced as described previously (Wajid et al. 2015) and BioEdit software was used for
sequence assembly and editing (Hall, 1999).The complete genome length of the isolated virus
(designated as duck/Pakistan/Lahore/AW-123/2015) was 15,192 nucleotides. The sequence
analysis of duck/Pakistan/Lahore/AW-123/2015 revealed polybasic amino acid residues between
positions 113 and 116 of the fusion protein cleavage sites and a phenylalanine at position 117
(113RRQKR↓F117). Such amino acid motif of the fusion protein cleavage site is considered typical
for virulent NDV (OIE, 2012). Phylogenetic and comparative analysis revealed high genetic
identity (99.11 and 99.11%) to recently isolated and characterized sub-genotype VIIi strains from
chickens in Pakistan (GenBank accession numbers KM670337 and KP776462, respectively), and
Indonesia - 99.18 % (GenBank accession number HQ697254). Detection of subgenotypeVIIi
viruses in ducks indicates the possibility of transmission of the virus into waterfowl. Current
scenario highlights the importance of a vigilant surveillance program in this region where ND is
endemic.
Nucleotide sequence accession number: The complete genome sequence of NDV strain
duck/Pakistan/Lahore/AW-123/2015 has been deposited inGenBank under the accession
number KU845252.
AKCNOWLEDGEMENTS: Mention of trade names or commercial products in this
publication is solely for the purpose ofproviding specific information and does not imply
116
recommendation or endorsement by the U.S.Department of Agriculture. USDA is an equal
opportunity provider and employer.
FUNDING INFORMATION
USDA| Agricultural Research Service (ARS) provided funding to Claudio L. Afonso under ARS
CRIS project 6040-32000-064. This work was supported by the U.S. Department of State
(USDA/ARS/BEP/CRDF) grants NDV 31063 31063.
REFERENCES
Dimitrov KM, Ramey AM, Qiu X, Bahl J, Afonso CL. 2016. Temporal, geographic, and host
distribution of avian paramyxovirus 1 (Newcastle disease virus). Infect Genet Evol.
39:22-34.
Kim LM, King DJ, Curry PE, Suarez DL, Swayne DE, Stallknecht DE, Slemons RD, Pedersen
JC, Senne DA, Winker K, Afonso CL. 2007. Phylogenetic Diversity among Low
Virulence Newcastle Disease Viruses from Waterfowl and Shorebirds and Comparison of
Genotype Distributions to Poultry-Origin Isolates.J Virol. 81:12641-12653.
Liu XF, Wan HQ, Ni XX, Wu YT, Liu WB. 2003. Pathotypical and genotypical characterization
of strains of Newcastle disease virus isolated from outbreaks in chicken and goose flocks
in some regions of China during 1985-2001. Arch Virol. 148:1387-1403.
Wan HQ, Chen LG, Wu LL, Liu XF. 2004. Newcastle disease in geese: natural occurrence and
experimental infection. Avian Pathol.33: 216 221.
Miller PJ, Koch G. 2013. Newcastle disease, p 89-138.In Swayne DE, Glisson JR, McDougald
LR, Nolan LK, Suarez DL, Nair V (ed), Diseases of Poultry, 13th ed. Wiley-Blackwell,
Hoboken, New Jersey.
117
Miller PJ, Haddas R, Simanov L, Lublin A, Rehmani SF, Wajid A, Bibi T, KhanTA, Yaqub T,
Setiyaningsih S, Afonso CL. 2015. Identification of new sub-genotypesof virulent
Newcastle disease virus with potential panzootic features. Infect Genet Evol.29:216-229.
Rehmani SF, Wajid A, Bibi T, Nazir B, Mukhtar N, Hussain A, Lone NA, Yaqub T,Afonso CL.
2015. Presence of virulent Newcastle disease virus in vaccinated chickens infarms in
Pakistan.J ClinMicrobiol. 53:1715-1718.
Wajid A, Wasim M, Rehmani SF, Bibi T, Ahmed N, Afonso CL. 2015. CompleteGenome
Sequence of a Recent Panzootic Virulent Newcastle Disease Virus from Pakistan.
Genome announcements.3. http://dx.doi.org/10.1128/genomeA.00658-15.
World Organization for Animal Health (OIE). 2012. Newcastle disease. Manual ofdiagnostic
tests and vaccines for terrestrial animals: mammals, birds and bees., Volume 1,Part 2,
Chapter 2.3.14:p 555-574. Biological Standards Commission.World Organizationfor
Animal Health, Paris, France.
Hall TA 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids SympSer 41:95–98.
118
CHAPTER 7
EXPERIMENT 5
Development and evaluation of plasmid DNA vaccine against Newcastle disease virus: A
comparative study with inactivated and classical vaccines after a virulent challenge
Abdul Wajid1,2, Asma Basharat2, Saima Arif2,3, Abdul Basit3, Javed Muhammad4, Muhammad
Tayyab1, Tahir Yaqub4, Muhammad Wasim1, Shafqat Fatima Rehmani2#
1Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences,
Lahore Pakistan
2Quality Operations Lab, University of Veterinary and Animal Sciences, Lahore Pakistan
3School of Biological Sciences, University of Punjab, Pakistan
4Department of Microbiology, University of Veterinary and Animal Sciences, Lahore Pakistan
Corresponding Author: Shafqat Fatima Rehmani
Quality Operations Lab, University of Veterinary and Animal Sciences, Lahore
119
Abstract
To ful fill the need of an effective vaccine to control the disease outbreak, DNA vaccine was
developed using the local field strain from the recent outbreak of ND, namely Chicken/
SFR/55/NDV/Thokar/Lahore/2012. In the present study, DNA vaccine was developed using the
SFR-55 NDV strain antigens, fusion (F) and hemagglutinin-neuraminidase (HN), namely
pcDNA3.1-F and pcDNA3.1-HN. In vitro expression of both genes construct was assessed by
reverse-transcriptase-PCR (RT-PCR) and western blotting. An inactivated vaccine using the
above mentioned strain (SFR-55) and compare with a commercial NDV LaSota starain for
comparative study. One hundred twenty (120) chcikens were divided into six groups, the first
two groups were immunized with pcDNA3.1-F and pcDNA3.1-HN, respectively, third group
was co-administered with both antigens pcDNA3.1-F and HN. The remaining two groups were
immunized with inactivated (wvSFR-55), through subcutaneously and live attenuated LaSota
vaccines through Eye drop method. The last group was injected with a vector alone. Results
showed that the inactivated and LaSota vaccines provided higher protection (>80%), as
compared to pcDNA3.1-F, pcDNA3.1-HN, pcDNA3.1-Fand HN gave 70%, 75% and 20%
respectively. The co-administration of vector expressing F and HN antigens induced high
immune response, when used alone. No doubt that the protective efficacy of the F construce
based was lower than the conventional LaSota vaccine in commercial poultry. However, the
virus shedding after challenge was low in groups immunized with pcDNA3.1-F, pcDNA3.1-
F+HN when compared with third group immunized with standard LaSota. In summary, the co-
administration of both NDV glycoprotein antigens increased protection than used alone. DNA-
based vaccine can be used safely to reduce mortality and most importantly lower the risk of virus
transmission due to low level of virulent virus shedding.
120
Key words: Newcastle disease, DNA vaccine, fusion protein, hemagglutinin-neuraminidase
protein, inactivated vaccine, LaSota vaccine
Introduction
ND is one of the most devastating diseases of birds in the globe can lead to 100% mortality in
birds susceptible to NDV (Rehmani et al. 2015). Recently, it has been concluded that the
circulating ND virus not only can cause disease in vaccinated birds but can shed the infected
virus in the environment and those birds may act as a reservoir (Rehmani et al. 2015). The
causative agent is avian paramyxovirus type 1 (AMPV-1) is also known as Newcastle disease
virus (NDV) (Wajid et al 2015; Miller et al 2015). All the strains of NDV belongs to a single
serotype in family Paramyxoviridae, genus Avulavirus of the order Mononegavirales(Afonso et
al. 2016). The AMPV-1 viruses are enveloped, non-segmented, negative sense-single stranded
RNA genome of approx. 15.2 kb in length. The genome is containing six protein coding genes
for 3’ leader-NP, P, M, F, HN, L-trailer-5’. NDV has two surface trans-membrane glycoproteins
are F and HN, which form spike like projections. The HN protein is a multifunctional protein is
not only requires for fusion promotion activity (Morrison et al. 1991), also host cell surface sialic
acid-containing receptors attachment. The neuraminidase activity (HA) of HN protein helps in
releasing progeny from the viral infected cells by cleavage the sialic acid-containing cellular
receptors from sugar-side chains (Lamb and Parks, 2007).
The F protein is the main determinant of ND viruses’ pathogenicity. It is synthesized primarily as
a precursor F0 and later activated by the host proteases into disulfide-linked subunits F1 and F2
by recognizing the mono and multi-basic amino acids at F protein cleavage site (Klenk and
Garten, 1994). The fusion protein cleavage site of ND viruses is major determinant of virulence.
121
The ND viruses are divided into three clinicopathologic form, lentogenic (viruses of low
pathogenicity), mesogenic (moderate pathogenicity), the velogenic strains are highly pathogenic
causing severe signs in birds with high mortality up to 100% in fully susceptible flocks (Saif et
al. 2008; Alexander and Senne, 2008). The velogenic strains are further divided into
viscerotropic and neurotropic forms, the viscerotrpic velogenic NDV (vvNDV) strains causing
hemorrhages in the enteric region like Proventriculus, caecal tonsils intestinal lesions, velogenic
neurotropic NDV (nvNDV) form involves respiratory and neurological disorder like tremor and
twisting of neck then followed by moderate mortality rate (Diel et al. 2012). All the strains of
NDV are belongs to a single serotype. The genetic and antigenic diversity is existing in AMPV-1
viruses, historically, there are two major classes, I and II (Diel et al. 2012). Class I contains a
single genotype and class II contains 18 genotypes and some genotypes further divided into sub-
genotypes (Diel et al 2012; Miller et al 2015). Different sub-genotypes in genotype VII, class II
are pre-dominantly found in Asian countries, where it causing high mortalities in susceptible
animals. In Pakistan, since a severe outbreak occurred in Northern regions in 2011-12, a novel
sub-genotype VIIi in genotype VII was identified and now spread and spill-over into pet and
wild birds. The similar viruses were also identified in Indonesia and Middle East and spreading
into East European countries, causing outbreaks of ND with high mortality and support the
existence of fifth panzootic.
The Newcastle disease is endemic in Pakistan, the development of an effective ND vaccine is a
top priority for the country. For decades, Pakistani poultry industry is under threats of ND not
only in commercial poultry production facilities also causing high mortalities in domestic and
wild animals (Wajid et al. 2015; Miller et al. 2015; Wajid et al 2016a, 2016b, 2016c). The recent
severe outbreak of ND during 2011-12, the disease was re-emerged with high severity and
122
caused the loss of 7 M USD. Using the intensive vaccination strategy in the field the incidence of
disease was not low (Rehmani et al. 2016). Since long time, ND LaSota vaccine is commonly
used in the field, several studies have concluded that the currently available ND live attenuated
vaccine formulated from the ND viruses of genotype II, when injected into clinically healthy
animals in adequate vaccine doses offered substantial protection but didn’t prevent viral
replication and shedding (Alexander, 2001; Kapczysnki and King, 2005; Marangon and Busani,
2007; Miller et al 2007, 2013; Cornax et al 2012; Rehmani et al 2015). The failure of standard
vaccines is controversial, as some previous studies suggested the inadequate application of
current vaccines (Dortmans et al. 2012), other studies concluded that the classical vaccine used
in the field genetically divergent from the ND strains causing disease in the field (Miller et al.
2007, 2013; Rehmani et al. 2017). Studies suggested the most reliable avian vaccine is needed
that prevent infection, viral shedding and replication of viruses (Cardenas-Garcia et al. 2016).
Plasmid based DNA vaccine is new-generation vaccines that may overcome the deficits the
traditional antigen-based vaccines. Like live attenuated vaccines, the DNA vaccine has ability to
induce both humoral and cellular immune responses, may act as suitable alternative (Gurunathan
et al. 2000). Several attempts have been made to formulated and evaluated the potential of
plasmid DNA vaccine against challenge ND viruses targeting surface glycoprotein F protein only
or in combination with HN protein (Arora et al. 2010; Sawant et al. 2011; Gowrakkal et al 2015;
; Cardenas-Garcia et al. 2016). Various protection efficacy of plasmid DNA vaccine was
obtained using varied doses, intramuscular route and mostly with two applications (primary and
booster) (Arora et al. 2010; Sawant et al. 2011; Gowrakkal et al 2015; ; Cardenas-Garcia et al.
2016). In the present study, DNA vaccine was developed expressing two surface glycoproteins F
and HN separately in expression vector. The inactivated vaccine was prepared from the NDV
123
strain (SFR-55; sub-genotype VIIi) causing disease in the field. The objective of the current
study was to compare the protection induced by DNA vaccines (in different formulation),
inactivated vaccine and a live attenuated LaSota by assessing viral shedding and post-challenge
morbidity and mortality. Two applications were performed for each group except control
(injected empty vector) and challenged them with live vNDV strain SFR-55.
Material and Method
Viruses
Virulent NDV strain (chicken/Pak/Lahore/SFR-55/2012) shortly designed as SFR-55 was used in
this study as source of fusion (F) and hemagglutinin-neuraminidase (HN) genes to prepare
plasmid DNA vaccine. The SFR-55 virus was isolated from ND outbreak occurred in 2011-12 in
Northern region of Pakistan (Wajid et al 2017), has been classified into a new panzootic sub-
genotype VIIi of genotype VII into class II. The same virus (SFR-55) was used for the
preparation of inactivated oil-based emulsion vaccine and also used as a challenge virus in the
vaccination trials. The intracerebral pathogenicity index (ICPI) in day-old specific NDV-
antibody free chicks of this ND strain was 1.89. The LaSota vaccine, genotype II: company
Medivac LaSota origin Indonesia is used worldwide as a live vaccine and thus is used as a group
of live vaccine in the trial.
Chicken and cells
Two weeks (14 day old) specific NDV-antibody free chickens were used to immunize and
challenge in the said experiment. All chickens in various groups were kept separately. Vero cells
(Extracted from the epithelial cells of African Green Monkey cell) were grown and maintained in
high glucose Dulbecco’s modified Eagle’s media (DMEM) supplemented with 10% fetal bovine
serum (FB Life Technologies/Gibco to Sigma Products), 400 ug/ml geneticin and passage the
124
cells 2 to 4 times to prepare a sufficient number of cell culture and incubated at 37 ˚C under 5%
CO2 incubator. This cell line was used for in vivo experiments and protein expression assay. To
prepare a batch of vaccine working seed for preparing the vaccine batch was prepared. A
sufficient volume according to the required period was prepared in aliquot of master seed.
RNA extraction and Amplification of genes
Total RNA from the HA positive allantoic fluid was extracted using TriZol LS reagent
(Invitrogen, USA). First strand complementary DNA (cDNA) was synthesized using random
hexamer primers through RT-PCR kit (Themro Scientific, USA) as per manufacturer’s protocol.
The NDV F and HN genes were amplified using SuperScript III with Platinum Taq High Fidelity
kit (Invitrogen, USA). The primer sets used for the amplification of targeted F and HN genes
were designed from the published sequences with accession number KM670337 are shown in
Table 1. Both sets of primer specific for F and HN genes were flanked by the same restriction
sites HindIII and XhoI (Table 1). The PCR condition was optimized contain initial denaturation
temperature of 94 ̊C for 5 mints followed by 30 cycles, denaturation at 94 ̊C for one mint,
annealing at 62 ̊C for F gene and 58 ̊C for HN gene and for one mint, polymerization at 68 ̊C for
2 mints and followed by final extension step at 68 ̊C for 10 mints and 4 ̊C as storage step.
Construction of plasmid expressing NDV F and HN genes
NDV F and HN genes were amplified from cDNA of SFR-55 strain and amplicons of both genes
were then subjected to electrophoresis in 1% agarose gel and purified by QIAquick clean
extraction kit (Qiagen, Valencia, CA). The eukaryotic expression vector, the pcDNA™3.1(+)
(cat # V790-20, Invitrogen, USA) was used as back bone for plasmid DNA vaccine. The plasmid
was propagated in DH5α cells and were extracted using GeneJET Plasmid Miniprep Kit
(Thermos scientific). The amplicons of both genes digested with XhoI and HindIII restriction
125
enzymes and then ligated them into the cloning site of pcDNA™3.1(+) was digested with the
similar enzymes. The formulated vector containing SFR-55 F and HN protein genes were named
pcDNA3.1-F and pcDNA3.1-HN. The resulted recombinant plasmids were then transformed into
DH5α cells. Subsequently, single colonies of both genes were grown in LB broth supplemented
with 100 µg/ml ampicillin antibiotic for overnight. The orientation of inserted genes was
confirmed through enzymes as described above and subsequently by sequencing. The
recombinant plasmids were purified using Qiagen Endotoxin Free Plasmid Mega Prep Kit (cat #
12381) as per manufacturer’s recommendations, re-suspended in low TE buffer and quantified
by Nano drop (Thermo Scientific, USA). The purified recombinant plasmids were used in
protein expression and vaccination experiments.
The recombinant plasmids pcDNA3.1-F and pcDNA3.1-HN, while empty pcDNA3.1 vector was
used as negative control were individually transferred 4 μg/well of 6 well plate into 70-80%%
confluent monolayer of Vero cells using lipofectamine 2000 reagent as per manufacturer’s
instructions for transient expression. After 72 hours post transfection, the total RNA of each
replicate of both genes was extracted using TriZol reagent. Primarily, the NDV F and HN genes
expression in the transfected vero cells were tested by RT-PCR via genes specific primer set. The
translated protein expression and production was tested via western blotting using anti-NDV
polyclonal antibodies raised in chickens and anti-Newcastle disease virus antibody, clone HN14f
(cat # MAB80118, Merck Millipore) as primary antibody for F and HN proteins respectively.
Goat anti-chicken Ig Y conjugated to alkaline phosphatase (Abcam, USA) as secondary
antibody.
DNA immunization and challenge experiments
126
Plasmid containing F and HN protein genes used as vaccines and were prepared by diluting into
TE buffer. One vaccine dose of each protein contained 100µg of recombinant plasmid in 200 μl
of TE buffer when immunized separately, while 70µg of each recombinant plasmid in 200 μl of
TE buffer when injected co-administered. Two weeks old 120 NDV-specific antibody free
chickens were divided into six groups, containing 20 birds in each group. Group I was
immunized with pcDNA3.1-F (100 μg/200 μl), group 2 with pcDNA3.1-HN (100 μg/200 μl),
group 3 was co-administered with pcDNA3.1-F (70 μg/100 μl) + pcDNA3.1-HN (70 μg/100 μl),
group 4 with oil-based inactivated vaccine whole virus (wvSFR-55) group 5 with live attenuated
LaSota vaccine and group 6 was kept as control (injected with empty vector alone).
Chickens were immunized through DNA vaccine intramuscularly in the right pectoral muscles.
The inactivated oil-based vaccine was injected subcutaneously, whereas live LaSota vaccine was
used through eye drop method. Two weeks after primary vaccination, all groups were boosted
except control group using the same dose. On 5th day after primary and boosted vaccination 1ml
of blood was drawn from all birds through brachial vein without anticoagulant for serum
collection. Two weeks after booster vaccination, all groups were challenge with virulent NDV
strain SFR-55 (106 EID50/bird) by ocular route. Oropharyngeal and cloacal swabs were collected
from all birds and all groups at 3rd day post-challenge (dpc) for measurement of viral shedding
through quantitative real time PCR (qRT-PCR). Birds were monitored for twelve dpc for clinical
NDV symptoms, morbidity and mortality. At the end of experiment all survived birds were bled
for serology.
Assessment of humoral immune response by HI and ELISA
All the birds from all groups were bled at 5th day after primary and boosted vaccinations. The
hemagglutinin inhibition (HI) test was used as previously defined by OIE (2012). Serial 2-fold
127
dilutions of serum samples were prepared in micro-titer V- shaped plates (Corning, USA). An
equal volume of ND virus containing 4HA units/25 µl was used prior to adding 1% r b c’s
suspension in each well. The HI titer has been expressed as log2, the serum samples highly
immune to NDV causing the complete inhibition of hem agglutination of 1% RBCs up to 7-9
log2. NDV specific antibodies were also assessed by commercially available IDEXX ELISA kit
(IDEXX Laboratories) according to the manufacturer’s recommendation
Statistical analysis
All the experimental data obtained was analyzed using analysis of variance (ANOVA) and
statistical difference was considered at P<0.05. Long Rank test was used to analyze the survival
curve. Two-tailed Z test was performed for evaluation of morbidity results. The significant
differences among groups were denoted by different letters.
Result
Identity of pcDNA3.1-NDVF and pcDNA3.1-NDVHN
The identity of the pcDNA3.1 vector containing NDV F and HN genes were confirmed by DNA
sequencing using a BigDye Terminator v1.1 cycle sequencing kit, yielded 1662 and 1716
nucleotides respectively, which is similar with other ND viruses. Vector and gene-specific
primers were used to sequence full SFR55-F and SFR55-HN genes were found in right region
and orientation in pcDNA 3.1+ vectors.
In vitro expression
The 70% to 80% vero cells in 6 well plates were transfected with pcDNA3.1-F and pcDNA3.1-
HN constructs through lipofectamine reagent as well as empty pcDNA3.1+ vector as a negative
control. At 72 hours post transfection total RNA was isolated through TriZol reagent (Invitrogen,
USA) from the culture cells and were subject to confirmation by RT-PCR using gene-specific
128
primers. Further, we tested the translated recombinant F and HN proteins in cultured cells by
western blotting analysis. The pcDNA3.1-SFR55-F and pcDNA3.1-SFR55-HN recombinant
proteins were detected in supernatants of cell culture were assayed using polyclonal antibodies
specific for F protein and Anti-Newcastle disease virus antibody, clone HN14f (cat #
MAB80118, Merck Millipore) for HN protein. The supernatant of cell culture transfected with
empty pcDNA 3.1 vector was detected with no protein (Fig 1A, 1B).
Assessment of humoral immune response by HI and ELISA test
All birds were bled before vaccination, and the HI titer of all birds was zero to 1, they were
monitored till 14th day pre-vaccination, showed zero titer. On 5th day after primary and boosted
vaccination, all birds were bled from each group and serums were tested for NDV-specific
antibodies by HI and ELISA tests to determine the differences level of immune response among
among pcDNA-F, pcDNA-HN, pcDNA-F+HN, wvSFR55 and LaSota groups (Fig 2A). The non-
vaccinated birds (control group) showed no anti-NDV immune response. After primary
vaccination wvSFR55 (oil-based emulsion) and LaSota groups showed highest HI titer as
compared to any DNA-based vaccine groups. The booster vaccination was done one week after
primary vaccination revealed the same pattern of HI antibody titers. However, in both
applications, the pcDNA3.1-HN vaccinate group showed significantly lower HI antibody titer as
compared to pcDNA3.1-F and pcDNA3.1-F+HN groups (p<0.009). Through ELISA was
evaluated at a serum dilution of 1:500 using an IDEXX ELISA kit (IDEXX Laboratories), Anti-
NDV specific antibodies were detected in all vaccinated groups except pcDNA3.1+ (control
group) and were showed the same pattern as achieved via HI (Fig 2B). All the vaccinated groups
after primary and booster vaccination, the anti-NDV specific antibodies were detected and were
significantly higher as compared to control group (p<0.0001).
129
Assessment of protection by DNA vaccine against challenge by vNDV SFR-55
The groups immunized with different vaccines were observed for morbidity and mortality after
challenge with vNDV strain SFR-55. The mortality in non-vaccinated group was started sharp
after 48 hours, birds showed typical ND signs such as dizziness, floppy wings and stretched legs,
coughing and sneezing accompanied with nasal discharge, greenish diarrhea, the most commonly
signs caused by viscerotropic NDV strains. During observation, 100% of birds injected with
pcDNA3.1 vector were died by 3 dpc with SFR-55. It suggests that the challenge strain was
highly virulent to control birds. The group immunized with pcDNA3.1-HN was led to
significantly higher morbidity (85%) upon challenge than the administration of pcDNA3.1-F,
pcDNA3.1-F+HN, wvSFR55, LaSota vaccines that showed no significance difference in
percentage of morbidity (Fig 1D). The vaccinated group pcDNA3.1-HN revealed only 20%
survival rate against the challenge vNDV, very low as compare to survival rate of LaSota
vaccine (85%) was high as compare to pcDNA3.1-F, pcDNA3.1-F-HN, oil-based emulsion
wvSFR55 with 70%, 75%, 80% respectively (Fig 1C).
Assessment of oral and cloacal viral shedding after post-challenge
Oral and cloacal swabs from all animals at 3 dpc were collected to compare the challenge virus
shed from vaccinated and non-vaccinated birds. The birds in groups vaccinated with pcDNA3.1-
F, pcDNA3.1-F+HN and oil-based emulsion wvSFR-55 were shed the challenge virus
significantly low as compare to control group at 3 dpc. Most importantly, the groups vaccinated
with plasmid DNA either pcDNA3.1-F alone or co-administered with pcDNA3.1-HN shed less
virus than the LaSota group and pcDNA3.1-HN vaccinated group (Fig 3A, 3B). However, there
was no significant difference was observed between groups vaccinated with pcDNA3.1-F,
130
pcDNA3.1-F+HN and oil-based emulsion wvSFR-55 in term of oral and cloacal viral shedding
at 3 dpc.
Discussion
In the present study, we focused on the efficacy of different vaccines including the DNA
vaccines, prepared from the circulating ND virus, an oil based inactivated vaccine and
commercially available LaSota vaccine. The study was aimed to determine the antibody titers
induce by DNA vaccine formulated with two surface glycoprotein genes of SFR-55 NDV strain,
co-administered or injected separately. Second objective was to determine the amount of virus
shed by various vaccinated groups after challenge with live virulent ND strain SFR-55 and study
the effect of these vaccines on immune status and protection against challenge virus in chickens.
A rapid growth in the poultry industry during the last three decades the challenges faced by the
industry also became ambigious. Newcastle disease is endemic in this region, a common man
who kept the chickens is familiar with the sign and symptoms of the disease. However, the
scenario is changed when the chiken farming became a second largest industry in the country.
The investment of more than Rs.10 billion shook the industry due to a severe outbreaks of ND in
the Northern region of the country in 2011-12, The outbreak causing losses in the broiler
industry, pet and wild birds (Miller et al 2015) and lossese were more tha US $ 6,00 M. The
incidence of disease has continued in poultry production facilities despite the intensive
vaccination program,
The currently available classical live attenuated vaccine is able to induce sufficient antibodies
level (log2 >4) and protect the birds from morbidity and mortality but could not stop the disease
incidence (Rehmani et al 2015). The current incidence of ND in all production facilities is the
proof of classical vaccine failure. The ND strains belong to these classic live vaccine is from
131
genotype II isolated in 1940s (Goldhaft, 1980). The classical vaccine strain is genetically distant
from the virulent ND viruses currently circulating in the field in most region of the world (V, VI,
VII, XIII) (Miller et al 2015; Wajid et al 2016b). Several studies concluded that the currently
available ND live vaccine when administered into healthy birds, offer substantial protection but
do not stop viral replication and shedding (Miller et al 2009).
In this study, we developed plasmid DNA vaccine expressing NDV fusion (F), hemagglutinin-
neuraminidase (HN) protein genes identical to the circulating NDV strains (SFR-55, belongs to
sub-genotype VIIi, genotype VII). The results in case of morbidity, mortality, anti-NDV
antibody titer and viral shedding were compared with an oil emulsion inactivated vaccine of
(sub-genotype VIIi) and commercial live LaSota ND vaccine. The survival rate of birds
vaccinated with pcDNA3.1-F, pcDNA3.1-F+HN, whole virus SFR55 (wvSFR55) and LaSota
strain was varied as 70%, 75%, 80% and 85% respectively after two doses of vaccines. However,
the group vaccinated with the plasmid expressed pcDNA3.1-HN group showed only 20%
protection. Our resulst are more or less similar to the findings of Sawant et al (2011). The results
indicate that co-administeration of both plasmids expressing NDV antig enic determinant
proteins F and HN induced high protection in birds than alone. The present research work also
showed the similar result as obtained previously by Arora et al (2010), co-administration of
NDV/F and NDV/HN proteins induced 73% protection as compare to 66% and 20% by NDV/F
and NDV/HN respectively alone. Another study by Gowrakkal et al (2015), the birds immunized
with F and HN alone revealed 60% and 20% survival rate as compared to co-administration of
both proteins was 80%. Recently study by Cardenas-Gracia (2016) observed 83% protection
when birds were immunized with F protein alone after two vaccine application.
132
The birds were bled at 5th day after first and second application for serum antibody level by
hemagglutination-inhibition (HI) and ELISA assays. The birds after having two applications,
inactivated vaccine and LaSota groups showed highest serum NDV-specific antibody titer as
compared to any DNA-based vaccine groups. However, in both applications, the pcDNA3.1-HN
vaccinate group showed significantly lower antibody titer as compared to pcDNA3.1-F and
pcDNA3.1-F+HN groups (p<0.009). Most interestingly, the group vaccinated with only the
vector expressing the F protein showed low serum antibody titer as compared to when co-
administered with pcDNA3.1-HN, it may be due to broader spectrum of epitopes contained in
two immunizing antigens (Sawant et al 2011). However, there was no significant difference in
the geometric mean antibody titer between these two groups. Previous studies also indicate that
two applications with plasmid encoding both NDV glycoproteins F and HN required to induce
higher serum antibody level and could protect the birds when challenged with virulent NDV
strain (Loke et al 2005; Sawant et al 2011).
The trial for the viral shedding, via the oral secretions and fecal samples collected from all
groups of birds, at 3 dpc to examine and compare the virus load from vaccinated and non-
vaccinated birds. The viral shedding was quantified by RT-PCR using gene specific primers and
probe-based for F gene from extracted mRNA. Vaccination with pcDNA3.1-F, pcDNA3.1-
F+HN and oil-based emulsion wvSFR-55 groups had significantly reduced the viral shedding
from oral and cloacal swabs as compared to the control group at 3 dpc (Fig 3A, 3B). Most
importantly, the groups vaccinated with plasmid DNA either pcDNA3.1-F alone or co-
administered with pcDNA3.1-HN shed less virus than the LaSota group and pcDNA3.1-HN
vaccinated group, the later may be due to low NDV-specific antibodytitres/protection level (Fig
3A, 3B). However, there was no significant difference was observed between groups vaccinated
133
with pcDNA3.1-F, pcDNA3.1-F+HN and oil-based emulsion wvSFR-55 in term of oral and
cloacal viral shedding at 3 dpc. However, high oral and cloacal viral shed while using
commercial LaSota vaccine may be due to antigenic distance of the vaccine strain as compared
to field virus as defined by the genetic distance and phylogenetic analysis (Miller et al 2007). It
can influence the amount of virus shed when challenged with NDV strain isolated from the field.
So the vaccinated birds with LaSota may be protected from morbidity and mortality, they can
transmit the challenge NDV to unvaccinated birds and cause outbreak.
In conclusion, the co-administration of both NDV glycoprotein antigens enhanced the protection
than a singled one. DNA-based vaccine can be used safely to reduce mortality and most
importantly lower the risk of virus transmission through virus shedding as well as the reversion
of vaccine strain into virulent form of NDV to challenge the susceptible poultry population in the
field.
Funding
All this work was done under the grant 58-0210-3-009 supported by U.S. Department of
Agriculture to Dr. Shafqat Fatima Rehmani, Abdul Wajid and Asma Basharat for Quality
Operation Laboratories, UVAS, Lahore
Acknowledgment
The authors would like to thank to Dr. Claudio L Afonso (Newcastle Disease lead Scientist,
SEPRL, Athens, GA, USA) for his plentiful support, ideas and guidance in disease control
program in Pakistan. We also thank to Mr. Mudassar Hussain for his technical assistance and
help in animal care.
References
134
Afonso CL, Amarasinghe GK, Banyai K, Bao Y, Basler CF, Bavari S, Bejerman N, Blasdell KR,
Briand FX, Briese T, Bukreyev A, Calisher CH, Chandran K, Cheng J, Clawson AN,
Collins PL, Dietzgen RG, Dolnik O, Domier LL, Durrwald R, Dye JM, Easton AJ,
Ebihara H, Farkas SL, Freitas-Astua J, Formenty P, Fouchier RA, Fu Y, Ghedin E,
Goodin MM, Hewson R, Horie M, Hyndman TH, Jiang D, Kitajima EW, Kobinger GP,
Kondo H, Kurath G, Lamb RA, Lenardon S, Leroy EM, Li CX, Lin XD, Liu L,
Longdon B, Marton S, Maisner A, Muhlberger E, Netesov SV, Nowotny N, Patterson
JL, Payne SL, Paweska JT, Randall RE, Rima BK, Rota P, Rubbenstroth D, Schwemmle
M, Shi M, Smither SJ, Stenglein MD, Stone DM, Takada A, Terregino C, Tesh RB,
Tian H, Tomonaga K, Tordo N, Towner JS, Vasilakis N, Verbeek M, Volchkov VE,
Wahl-Jensen V, Walsh JA, Walker PJ, Wang D, Wang LF, Wetzel T, Whitfield AE, Xie
JT, Yuen KY, Zhang YZ, Kuhn JH. 2016. Taxonomy of the order Mononegavirales:
update 2016. Arch Virol. 161(8): 2351–2360.
Alexander DJ, Senne DA. 2008. Newcastle disease virus and other avian paramyxoviruses. In:
Dufour-Zavala, Swayne DE, Glisson JR et al., editors. A Laboratory Manual for the
Isolation, Identification and Characterization of Avian Pathogens.5th ed. American
Association of Avian Pathologists, Jacksonville, Fla, USA. p. 135-141.
Alexander DJ. 2001. Gordon memorial lecture. Newcastle disease. Br Poult Sci. 42(1): 5-22.
Arora P, Lakhchaura BD, Garg SK. 2010. Evaluaion of immunogenic potential of 75kDa and
56kDa proteins of newcastle disease virus (NDV). Indian J Exp Biol. 48(9): 889-895.
Cardenas-Garcia S, Dunwoody RP, Marcano V, Diel DG, Williams RJ, Gogal RM Jr, Brown
CC, Miller PJ, Afonso CL. 2016. Effects of Chicken Interferon Gamma on Newcastle
135
Disease Virus Vaccine Immunogenicity. PLoS One. 11(7): e0159153.
doi:10.1371/journal. pone.0159153.
Cornax I, Miller PJ, Afonso CL. 2012. Characterization of live LaSota vaccine strain-induced
protection in chickens upon early challenge with a virulent Newcastle disease virus of
heterologous genotype. Avian Dis. 56(3): 464-470.
Diel DG, da Silva LH, Liu H, Wang Z, Miller PJ, Afonso CL. 2012. Genetic diversity of avian
paramyxovirus type 1: proposal for a unified nomenclature and classification system of
Newcastle disease virus genotypes. Infect Genet Evol. 12(8): 1770–1779.
Goldhaft TM. 1980. Historical note on the origin of the La Sota strain if Newcastle disease virus
Avian Dis. 24: 297–30.
Gowrakka M, Vijayarani K, Kumanan K, Uttarkumar A. 2015. Determination of immune
potentials of recombinant fusion and recombinant haemagglutinin-neuraminidase
antigens of Newcastle Disease virus (NDV). 4 (1): 575-588.
Kapczynski DR, King DJ. 2005. Protection of chickens against overt clinical disease and
determination of viral shedding following vaccination with commercially available
Newcastle disease virus vaccines upon challenge with highly virulent virus from the
California 2002 exotic Newcastle disease outbreak. Vaccine. 23(26): 3424-3433.
Klenk HD, Garten W. 1994. Host cell proteases controlling virus pathogenicity.Trends
Microbiol. 2: 39-43.
Lamb RA, Parks GD. 2007. Paramyxoviridae: The viruses and Their Replication. In:
KnipeDM,Howley PM, editors. Fields Virology. Philadelphia: Lippincott Williams&
Wilkins, a Wolters Kluwer Business. pp. 1449–1496
136
Loke CF, Omar AR, Raha AR, Yusoff K. 2005.Improved protection from velogenic Newcastle
disease virus challenge following multiple immunizations with plasmid DNA encoding
for F and HN genes. Vet Immunol Immuno pathol. 106(3-4): 259–267.
Marangon S, Busani L. 2007. The use of vaccination in poultry production. Rev Sci Tech. 26(1):
265-274.
Miller PJ, Afonso CL, Attrache JE, Dorsey KM, Courtneya SC, Guoc Z, Kapczynski DR. 2013.
Effects of Newcastle disease virus vaccine antibodies on the shedding and transmission
of challenge viruses. Devel Comp Immun. 41(4): 505–513
Miller PJ, Estevez C, Yu Q, Suarez DL, King DJ. 2009. Comparison of viral shedding following
vaccination with inactivated and live Newcastle disease vaccines formulated with wild-
type and recombinant viruses. Avian Dis. 53(1): 39–49.
Miller PJ, Haddas R, Simanov L, Lublin A, Rehmani SF, Wajid A, Bibi T, Khan TA, Yaqub T,
Setiyaningsih S, Afonso CL. 2015. Identification of new sub-genotypes of virulent
Newcastle disease virus with potential panzootic features. Infect Genet Evol. 29: 216 –
229.
Miller PJ, King DJ, Afonso CL, Suarez DL. 2007. Antigenic differences among Newcastle
disease virus strains of different genotypes used in vaccine formulation affect viral
shedding after a virulent challenge. Vaccine. 25(41): 7238–7246.
Morrison T, McQuain C, McGinnes L. 1991. Complementation between avirulent Newcastle
disease virus and a fusion protein gene expressed from a retrovirus vector: requirements
for membrane fusion. J. Virol. 65:813–822
137
Rehmani SF, Wajid A, Bibi T, Nazir B, Mukhtar N, Hussain A, Lone NA, Yaqub T, Afonso CL.
2015. Presence of virulent Newcastle disease virus in vaccinated chickens in farms in
Pakistan. J ClinMicrobiol. 53(5): 1715–1718.
RehmaniSF, AWajid, T Bibi, TA Khan, NA Lone, H Habib, S Naureen 2017. Effect and
preparation of Newcastle disease vaccine from different genotypes to evaluate their
efficacy and viral shedding after a virulent challenge.Accepted in J Anim Plant Sci.
Saif YM, FadlyAM, Glisson JR, McDougald LR. 2008. Newcastle disease, other avian
paramyxoviruses, and pneumovirus infections. In: Diseases of Poultry. 12th ed.
Blackwell Publishing Professional, Ames, Iowa, USA. p. 75-93.
Sawant PM, Verma PC, Subudhi PK, Chaturvedi U, Singh M, Kumar R, Tiwari AK. 2011.
Immunomodulation of bivalent Newcastle disease DNA vaccine induced immune
response by co-delivery of chicken IFN-Ƴ and IL-4 genes. Vet ImmunolImmunopathol.
144(1-2): 36-44.
Wajid A, Dimitrov KM, Wasim M, Rehmani SF, Basharat A, Bibi T, Arif S, Yaqub T, Tayyab
M, Ababneh M, Sharma P, Miller PJ, Afonso CL. 2017. Repeated isolation of virulent
Newcastle disease viruses in poultry and captive non-poultry avian species in Pakistan
from 2011 to 2016.Prev Vet Med.In press.
Wajid A, Wasim M, Rehmani SF, Bibi T, Ahmed N, Afonso CL. 2015. Complete genome
sequence of a recent panzootic virulent Newcastle disease virus from Pakistan. Genome
Announc.3(3).pii: e00658-15. doi: 10.1128/genomeA.00658-15.
WajidAa, Rehmani SF, Wasim M, Basharat A, Bibi T, Arif S, Dimitrov KM, Afonso CL. 2016.
Complete genome sequence of a virulent Newcastle disease virus strain isolated from a
138
clinically healthy duck (Anasplatyrhynchosdomesticus) in Pakistan. Genome
Announc.4(4).pii: e00730-16. doi:10.1128/genomeA.00730-16.
Wajid Ab, Rehmani SF, Sharma P, Goraichuk IV, Dimitrov KM, Afonso CL. 2016. Complete
genome sequence of genotype VI Newcastle disease viruses isolated from pigeons in
Pakistan. Genome Announc.4(4).pii: e00845-16. doi:10.1128/genomeA.00845-16.
Wajid Ac, Basharat A, Khan TA, Wasim M, Rehmani SF. 2017. Complete genome sequence of a
velogenic Newcastle disease virus strain isolated from clinically healthy exotic parakeet
(Melopsittacus undulatus) in Pakistan. Genome Announc. 0(999):e01581-16.
Table 1: Sequence of Primers used in the study
Primers Sequences (5’-3’)
Flanked by
restriction enzyme
Accession number &
Reference
NDV-F-F AGGAAGCTTATGGGCTCCAAACCTTCTAC HindIII KM670337, this study
NDV-F-R GCGCTCGAGTCACGCTCTTGTGGTGGCTC XhoI KM670337, this study
NDV-HN-F AGGAAGCTTATGAGCCGCGCGGTCAA HindIII KM670337, this study
NDV-HN-R GCGCTCGAGTTAAGCCCTATTATCCTTGAGGA XhoI KM670337, this study
139
Figure 1: Characterization and evolution of DNA vaccination system. Vero cell culture
supernatants were tested by western blotting for the presence of F (A), and HN protein (B).
Mortality curve (C) and morbidity (D) were evaluated of different vaccinated groups. The
statistical difference was considered with a p<0.05.
Figure 2: NDV-specific mean HI antibody titer in the pre-chalnege serum samples of all
immunized groups (A), and ELISA was also performed (B). The statistical difference was
considered with a p<0.05.
Figure 3: Oropharyngeal (A) and Cloacal (B) swabs samples were collected 3dpc to measure the
amount of challenge viru shed. The statistical difference was considered with a p<0.05.
140
CHAPTER 8
SUMMARY
Newcastle disease (ND) is one of the most contagious diseases of poultry worldwide. The
disease is endemic in Pakistan and recurrent outbreaks have been reported in commercial poultry
flocks, domestic pet and migratory birds since 1963 an inception of commercial poultry farming
in the country. Disease surveillance is necessary to determine the incidence of the disease as well
as to identify the etiological agent of the disease status in the region. The analysis of the field
data provides a clue for the higher authorities to take steps for the remedy of the devastating
outbreak. A virulent form of Newcastle disease virus caused an outbreak in the northern region
of Pakistan during the mid of 2011. The virus was identified as a virulent viscerotropic vvNDV
and characterize, belonging to the sub genotype VIIi. However, the virus of this genotype is still
circulating in the field though the intensity of the strain to succumb the chickens to cause
mortality does not exist. The particular thing in this genotype was its susceptibility to other avian
species like pheasants, peafowls, ducks turkeys, peacocks, sparrows and parakeets. As this
genotype is circulating since 2011 2016 and still spill over in these avian species. Thus for the
last five years (2011-16), 3500 healthy, diseased and dead chickens, pheasants, peacocks,
turkeys, peafowls, ducks, sparrows, exotic parakeets, rosy-faced parrots, pigeons, and partridges
from 750 different locations s were monitored. Samples were collected from the Northern region
of the country Punjab, Khyber Pakhtoonkhawa, Azad Kashmir, including Gilgit,Baltitssan and
from Southern region, Karachi, Hyderabad , Mirpursakro and other small cities where the poultry
farms are located. The samples were collected by the local veterinarians, poultry Assistants and
Animal health practitioners who assist during the surveillance program. Samples were also
collected from the farmers who brought their birds for inspection in the lab with the details of the
141
farm. Mostly sampling was done where there was reports of NDV outbreak, tissues were
collected usually the trachea, spleen and brain, moreover, the pharyngeal and cloacal swabs not
only from the infected birds but also from the healthy birds were collected to assess the virus
shedding in the flock. Blood samples were also collected (1% of the birds at farm), for serum
collection to assess the immune status of the flock using Haemagglutination Inhibition (HI) test
and Enzyme linked immunosorbant assay (ELISA). The Survey Form meet the international
standard was filled for each farm for recording the information required to find the diagnostic
clue as well as the molecular characterization of the isolates. Pool of five pharyngeal swabs were
processed after the passage into 9-day old chicken embryonated eggs and confirming the positive
HA test and then confirmed by real time PCR (RT-PCR). In addition, sera were tested against
NDV by HI and ELISA tests. The targeted samples were sequenced by complete fusion gene and
whole genome using 22 pairs of overlapping primers. The observations indicated that the
commercial broiler industry is highly susceptible to virulent NDV and confirmed by data
available in the laboratory in the survey form. Contrary to that a little is known regarding the
maintenance and enzootic trends of vNDV infection level in domestic and wild birds. Poor
strategy of the use of vaccines and vaccination as well as the existence of virulent form of NDV
in the domestic and pet birds indicate a possibility of the root cause of the ND eruption in the
developing countries. A continuous isolation of virulent viruses of the panzootic Newcastle
disease virus of sub-genotype VIIi since (2011-2016 from commercial chickens and from various
other avian species in the country provide evidence for the existence of epidemiological links
intermingling of the strain among them. Therefore, to avoid the huge economical losses in the
commercial poultry the second largest industry in Pakistan, their close proximity should be
strictly avoided. The mass vaccination of the poultry flocks is in practice in all commercial
142
poultry farms in Pakistan. However, the use and availability of a reliable and standard vaccine, as
well as the correct usage of vaccine dose of the live attenuated LaSota vaccine are the key factors
to improve their efficacy in the field. Minor outbreaks have been occurring in the field even
though a severe outbreak was occurred in 2011-12 collapsed the poultry industry with other pet
and wild birds. To minimize the continuity of these minor outbreaks in the field for long time
there is a need for more effective vaccine to control the particular genotype of the ND virus. In
the present study, DNA vaccine was developed using the SFR-55 NDV strain antigens, in the
form of fusion (F) and hemagglutinin-neuroaminidase (HN), namely pcDNA3.1-F and
pcDNA3.1-HN. In vitro expression of both genes construct was assessed by reverse-
transcriptase-PCR (RT-PCR) and western blotting. In the trial an inactivated oil-based emulsion
vaccine was prepared using the field strain SFR-55 and compare with the commercial vaccine
LaSota strain commonly used by the poultry industry. Birds were divided into six groups, the
first two groups were immunized with pcDNA3.1-F and pcDNA3.1-HN alone respectively and
third group with was vaccinated with both antigens pcDNA3.1-F+HN. The other two groups
were immunized with inactivated (wvSFR-55) and LaSota vaccines as described above, the last
group was injected with empty vector as control. The birds were immunized twice at 14 and 21
days of age intramuscularly (DNA vaccine), subcutaneous and eye-drop by inactivated and
LaSota vaccines respectively. The birds were challenged with live virulent NDV strain using a
dose of 10,000 ELD50/0.1ml per chicken. Results indicate that Inactivated and LaSota vaccines
provided high protection (>80%), as compared to pcDNA3.1-F, pcDNA3.1-HN, pcDNA3.1-
F+HN gave 70%, 75% and 20% respectively. There was 100% mortality in control chickens.
The administration of two vectors expressing F and HN antigens induced high immune response,
and provide protection than when used separately. However, the groups immunized with
143
pcDNA3.1-F, pcDNA3.1-F+HN and inactivated vaccine resulted in lower amount of virulent
virus shed after challenge when compared to the group immunized with standard LaSota. In
summary, the co-administration of both NDV glycoprotein antigens increased protection than
use separately. DNA-based vaccine can be used safely to reduce mortality and most importantly
lower the risk of virus transmission due to decreased level of virulent virus shedding.
144
APPENDICES
Recommended