i

GENETIC EVOLUTION AND DEVELOPMENT OF

RECOMBINANT VACCINE AGAINST NEWCASTLE DISEASE

FOR CHICKEN IN PAKISTAN

ABDUL WAJID

2009-VA-705

A THESIS SUBMITTED IN THE PARTIAL FULFILLMENT OF THE

REQUIREMENT FOR THE DEGREE

OF

DOCTOR OF PHILOSOPHY

IN

MOLECULAR BIOLOGY AND BIOTECHNOLOGY

UNIVERSITY OF VETERINARY AND ANIMAL SCIENCES,

LAHORE

2017

ii

To,

The Controller of Examination,

University of Veterinary and Animal sciences,

Lahore.

We, the Supervisory Committee, certify that the contents and form of the thesis,

submitted by Mr. Abdul Wajid, Regd. No. 2009-VA-705 have been found satisfactory and

recommend that it be processed for the evaluation by the External Examiner (s) for award of the

degree.

Supervisor:

____________________________________

Dr. Muhammad Wasim

Member:

____________________________________

Prof. Dr. Tahir Yaqub

Member:

____________________________________

Dr. Muhammad Tayyab

iii

iv

IN THE NAME OF ALLAH,

THE MOST COMPASSIONATE, THE MOST MERCIFUL

All praises and thanks are for

Almighty Allah,

The source of all knowledge and wisdom endowed

to mankind,

who guides us in darkness and helps us in

difficulties

And

all respects are for His last

Holy Prophet

HAZRAT MUHAMMAD

(Peace Be Upon Him)

Who enabled us to recognize our creator.

v

Dedicated

To

My Parents & My late Brother

Abdul Raziq (Jaan)

&

My Supervisor & Dr. SF Rehmani

Who always encouraged me to

Achieve higher goals in life

vi

ACKNOWLEDGEMENTS

I would like to give all my praises and humblest thanks to the Most Gracious, Merciful and

ALMIGHTY ALLAH, who guides us in darkness and thankful to my ALLAH, who has

conferred me with potential and ability to complete this research study. I offer mu humblest

thanks from the core of my heart to the Holy Prophet Muhammad (S.A.W.), who is forever a

torch of guidance and knowledge for humanity as a whole.

This thesis has been completed as a collaborative research project between South East Poultry

Research Laboratory (SEPRL), USA and Quality Operations Lab, University of Veterinary and

Animal Sciences, Pakistan, entitle “Molecular characterization of NDV and Development of

approaches to vaccination”USDA-ARS-BEP CRDF Newcastle Disease Virus program #31063

sponsored by theUnited States Department of State. I am thankful to this donor agency for

providing the financial support for the described work. I feel enormous intensity of obligation to

my respected Supervisor, Dr. Muhammad Wasim, Associate Prof. IBBt-UVAS, Lahore for his

valuable guidance, stimulating ideas and extreme patience with my work, which proved to be a

panacea in the completion of this thesis. I have no word to thank Dr. Shafqat Fatima Rehmani,

for not only support in studies, generous advice, inspiring guidance, and encouragement through

my research, she taught me everything about life. I have deep sense of appreciation to the

members of my Supervisory Committee, Prof. Dr. Tahir Yaqub, Department of Microbiology

and Dr. Muhammad Tayyab, for their personal interest and cooperation. I would especially like

to express my deep sense of gratitude to Prof. Dr. Claudio L Afonso, Newcastle disease Lead

Scientist, South East Poultry Research Laboratory (SEPRL), USA. Thank you Dr. Patti Miller,

Kiril Dimitrov and Poonam Sharma for your unconditional scientific support. I would

especially like to thank Asma Basharat for her inspiring attitude, kindness and help during this

research. I also would like to thank Saima Arif and Abdul Basit for helping and support

through this research work. I am very much thankful to my friends Kamran Abbas,

AhsanUllah, Zia Uddin, Asif Rahim and especial thanks to Dr. Andleeb Batool for their moral

support. I am grateful to my parents and whole family for their support and encouragement. I

would like to thank my late brother Abdul Raziq (Jaan), I know where I am today is due to

your’s prays. Now I know why you always told me to be strong because you knew, you knew

that one day I would need the strength to bear your loss. Thanks for making me laugh every time

as you were joking, singing and I love you so so much. Abdul Wajid

vii

CONTENTS

DEDICATION ------------------------------------------------------ i

ACKNOWLEDGEMENTS---------------------------------------- ii

TABLE OF CONTENTS ------------------------------------------ iii

ABSTRACT --------------------------------------------------------- iv

SR. NO. CHAPTER PAGE NO.

1 INTRODUCTION 1

2 REVIEW OF LITERATURE 6

3 EXPERIMENT 1 53

4 EXPERIMENT 2 73

5 EXPERIMENT 3 96

6 EXPERIMENT 4 113

7 EXPERIMENT 5 118

8 SUMMARY 140

viii

ABSTRACT

Newcastle disease (ND) is one of the most contagious diseases of poultry worldwide. The

disease is endemic in Pakistan and recurrent outbreaks have been reported in commercial poultry

flocks, domestic pet and migratory birds since 1963 an inception of commercial poultry farming

in the country. Disease surveillance is necessary to determine the incidence of the disease as well

as to identify the etiological agent of the disease status in the region. The analysis of the field

data provides a clue for the higher authorities to take steps for the remedy of the devastating

outbreak. A virulent strain (or variant) of Newcastle disease virus caused an outbreak in the

northern region of Pakistan during the mid of 2011. The virus was identified as a virulent

viscerotropic vvNDV and characterized, belonging to the sub genotype VIIi. However, the virus

of this genotype is still circulating in the field though the intensity of the strain to succumb the

chickens to cause mortality does not exist. The particular thing in this genotype was its

susceptibility to other avian species like pheasants, peafowls, ducks turkeys, peacocks, sparrows

and parakeets. As this genotype is circulating since 2011, until 2016 and occasionally still spill

over in these avian species. Thus for the last five years (2011-16), 3500 healthy, diseased and

dead chickens, pheasants, peacocks, turkeys, peafowls, ducks, sparrows, exotic parakeets, rosy-

faced parrots, pigeons, and partridges from 750 different locations were monitored. Samples

were collected from the Northern region of the country including Punjab, Khyber

Pakhtoonkhawa, Azad Kashmir, as well as Gilgit Baltitssan and from Southern region, Karachi,

Hyderabad, Mirpursakro and other small cities where the poultry farms are located. The samples

were collected by the local veterinarians, poultry assistants and animal health practitioners who

participated during the surveillance program. Samples were also collected from the farmers who

brought their birds for inspection in the lab with the details of the farm locations. Mostly,

sampling was done where there were reports of NDV outbreak, tissues were collected usually the

trachea, spleen and brain. In addition, the pharyngeal and cloacal swabs were also collected the

healthy birds living amongst the infected bird in order to assess the virus shedding in the flock.

Blood samples were also collected (1% of the birds at farm), and the sera were used to assess the

immune status of the flock using Haemagglutination Inhibition (HI) test and Enzyme linked

immunosorbant assay (ELISA). The Survey Form met the international standard was filled for

each farm for recording the information required to find the diagnostic clue as well as the

ix

molecular characterization of the isolates. Pool of five pharyngeal swabs were processed after the

passage into 9-day old chicken embryonated eggs and confirming the positive HA test and then

confirmed by real time PCR (RT-PCR). In addition, sera were tested against NDV by HI and

ELISA tests. The targeted samples were sequenced by complete fusion gene and whole genome,

using 22 pairs of overlapping primers. The observations indicated that the commercial broiler

industry is highly susceptible to virulent NDV and confirmed by data available in the laboratory

in the survey form. Contrary to that a little is known regarding the maintenance and enzootic

trends of vNDV infection level in domestic and wild birds. Poor strategy of the use of vaccines

and vaccination as well as the existence of virulent form of NDV in the domestic and pet birds

indicate a possibility of the root cause of the ND eruption in the developing countries. A

continuous isolation of virulent viruses of the panzootic Newcastle disease virus of sub-genotype

VIIi since (2011-2016) from commercial chickens and from various other avian species in the

country provide an evidence for the existence of epidemiological links intermingling of the strain

among them. Therefore, to avoid the huge economical losses in the commercial poultry, the

second largest industry in Pakistan, their close proximity should be strictly avoided. The mass

vaccination of the poultry flocks is a common practice in all commercial poultry farms in

Pakistan. However, the use and availability of a reliable and standard vaccine, as well as the

correct usage of vaccine dose of the live attenuated LaSota vaccine are the key factors to

improve their efficacy in the field. Minor outbreaks have been occurring in the field even though

a severe outbreak has occurred in 2011-12, that almost collapsed the poultry industry with other

pet and wild birds. To minimize the continuity of these minor outbreaks in the field for a long

time period, there is a need for more effective vaccine to control the particular genotype of the

ND virus. In the present study, DNA vaccine was developed using the SFR-55 NDV strain as an

antigens, in the form of fusion (F) and hemagglutinin-neuraminidase (HN), namely pcDNA3.1-F

and pcDNA3.1-HN. In vitro expression of both genes construct was assessed by reverse-

transcriptase-PCR (RT-PCR) and western blotting. In the trial an inactivated oil-based emulsion

vaccine was prepared using the field strain SFR-55 and compare with the commercial ND

vaccine (LaSota strain) commonly used by the poultry industry. Birds were divided into six

groups, the first two groups were immunized with pcDNA3.1-F and pcDNA3.1-HN alone

respectively and third group was vaccinated with both antigens pcDNA3.1-F+HN. The other two

groups were immunized with inactivated (wvSFR-55) and LaSota vaccines as described above,

x

the last group was injected with empty vector as control. The birds were immunized twice at 14

and 21 days of age with DNA vaccine intramuscularly, inactivated vaccine subcutaneously and

LaSota vaccine by eye-drop. The vaccinated birds were challenged with live virulent NDV strain

using a dose of 10,000 ELD50/0.1ml per chicken. Results indicate that Inactivated and LaSota

vaccines provided high protection (>80%), as compared to pcDNA3.1-F, pcDNA3.1-HN,

pcDNA3.1-F+HN gave 70%, 75% and 20% respectively. There was 100% mortality in control

chickens. The administration of two vectors expressing F and HN antigens induced good

immune response as compared to use separately. However, the groups immunized with

pcDNA3.1-F, pcDNA3.1-F+HN and inactivated vaccine resulted in lower amount of virulent

virus shed after challenge when compared to the group immunized with standard LaSota. In

summary, the co-administration of both NDV glycoprotein antigens increased protection than

used separately. DNA-based vaccine can be used safely to reduce mortality and most importantly

lower the risk of virus transmission due to decreased level of virulent virus shedding.

1

CHAPTER 1

INTRODUCTION

Newcastle disease is a common poultry disease worldwide (Alexander and Senne, 2013). In

developing countries, the low income families rely on the poultry solely to obtain inexpensive

and high quality protein. High mortality rate in poultry production facilities is due to ND

minimize the availability of eggs, meat and aggravate human consumption. The poultry industry

is one of the major agriculture industries in Pakistan, as a second largest after the cotton crop and

has an involvement of Rs.7 billion investment. Among the four provinces and Azad Jammu

Kashmir, the province of Punjab especially the North-Eastern region is very problematic. The

reason is the high density of poultry farms in close proximity and also an enormous contact with

backyard chickens and wild birds. A rigorous biosecurity policy, proper vaccination program and

construction of environmentally controlled sheds since late, 90’s did not stop the incidence of

disease outbreaks that cause prominent damage to the Industry (Rehmani et al. 2015).

NDV derives its name at a farm near Rani khet in India and Newcastle-upon-Tyne in England in

1927 (Miller et al. 2010), classified as an avian paramyxovirus type 1 (AMPV-1). The ND

viruses are from family paramyxoviridae, genus Avulavirus and order Mononegavirals (Mayo,

2002; Afonso et al. 2016). The ND virus has genome of negative sense RNA and is helical,

single stranded, enveloped and non-segmented in morphology (Miller et al. 2010). There are

three genomic sizes 15186, 15192, 15198 nucleotides) has encoded six transcriptional units

which include neucleoprotein (NP), phophoprotein (P), matrix protein (M), fusion protein (P),

hemagglutinin-neuraminidase protein (HN), and large protein (L) in 3’ to 5’ terminus (Miller et

al. 2010). However, due to the insertion of guanine nucleotide (Gn) during the post

transcriptional editing of the phosphate protein gene mRNA produce two further proteins V and

W respectively (Steward et al. 1993). On the basis of pathogenicity the ND viruses are classified

2

into five pathotypes asymptomatic enteric, lentogenic, masogenic and velogenic viruses. The

further types of velogenic include velogenic viscerotropic and velogenic neurotropic (Alexander

and Senne, 2013). The asymptomatic enteric viruses are usually described as without any sign or

symtoms of the disease like, Australian V4 and mild or sub-clinical respiratory infections are

witnessed in birds infected with lentogenic strains, mesogenic viruses cause respiratory signs, or

neurological signs but with low mortality in birds. Velogenic neurotropic strains induce

neutrological signs like tremor, torticollis and twisting of neck and usually cause high mortality

in birds, while in case of velogenic viscerotropic, hemorrhages in the intestine and lymphoid

tissues are frequently seen and cause mortality above 90%. The virulence of virus is calculated in

vivo through intracerebral pathogenicity index (ICPI) in day-old specific pathogenic free (SPF)

chickens, whereas the mean death time (MDT) is assessed in 9-10 day-old SPF chicken eggs.

According to OIE criteria, the NDV is considered virulent if there are three basic amino acids

between 112-116 amino acid residues at the fusion protein cleavage site with phenylalanine (F)

at 117 position (OIE, 2012). However, in low virulent ND viruses (loNDV) there are less than

three basic amino acid residues between 112-116 positions with leucine is present at position

117.

NDV is economically important virus of poultry affecting more than 240 domestic and wild

species of bird worldwide (Kaleta and Baldauf, 1988), among them the commercial poultry is

highly susceptible to the disease (Jindal et al. 2009). NDV may cause infection in human and

typical signs include redness, swelling and excessive lacrimation from eyelid and conjunctivitis

(OIE, 2012). Waterfowl, such as ducks and geese are commonly considered as a natural reservoir

without showing any clinical symptoms, however, transmission of these viruses into chickens

may cause clinical symptoms of NDV (Dai et a. 2014; Zhang et al. 2011). Sometimes certain

3

mutations change non-virulent strains into virulent one and they may cause infections in

domestic poultry. However, recent studies have been reported that the vNDV strains can capable

of causing clinical disease in waterfowls both in ducks and geese (Dai et al. 2014; Xu et al.

2016). Similar data was confirmed this hypothesis in the outbreak of NDV in Pakistan during the

year 2011.

The serotype is same in all strains of NDV, however, they are genetically diverse and several

genotypes and their sub-genotypes are recognized (Diel et al. 2012; Miller et al. 2016).

Historically, the ND viruses are classified into two main classes, class I and II, which are further

grouped into genotypes and sub-genotypes (Diel et al. 2012). Class I viruses (15,198 nucleotides

genomic size) are mainly isolated from waterfowl are usually avirulent in chickens and

distributed worldwide (Alexander et al. 1992; Kim et al 2007; Liu et al. 2009; Miller et al. 2009;

Miller et al. 2010; Afonso et al. 2013). Class II contains mostly of virulent NDV strains and also

non-virulent isolates are recovered from various species (Diel et al. 2012). Viruses from class I

possess a single genotype, while there are 18 different genotypes (I-XVIII) in viruses belonging

to class II (Diel et al. 2012).

ND control is based on strict hygiene, monitoring systems and stamping out or vaccination. All

NDV infected countries may have imposed national monitoring and vaccination policies

depending on the geographical areas and the trade situation. Several devastating ND outbreaks in

Pakistan have occurred since first time identified in 1963 in commercial as well as backyard

poultry. Recently, the most devastating outbreaks were occurred during 2011-12, was traced first

time in several wild life species including Pigeon, Peacocks, Pheasant and Parrots (Miller et al.

2015) were affected and died due to ND. Although virulent form of NDV have been circulating

in the field and they are periodically recovered from pet/wild birds and commercial poultry. A

4

continuity of the outbreaks in wild birds make question of biosecurity and control as these

incidence of vNDV become consistent threat for the Pakistan’s poultry industry. In Pakistan

numerous outbreaks of the disease have occurred recently, despite intense vaccination and

imposing the good biosecurity practices. A great demand for good quality meat, low in cost

production, easy to cook and no religious barrier for its consumption are the main reasons of

flourishing the poultry industry worldwide. The control of infectious disease in poultry has been

extremely instrumental to reach the targets that can be met through the development of

biosecurity and routine application of vaccines. Therefore, the utmost desired area of research is

to modify existing vaccines and vaccination practices and develop new strategies to limit viral

transmission and protect against the disease.

In Pakistan, rearing backyard poultry is very popular as people like to have their own fresh eggs

and meat for their families. Last few years the transmission/spread of ND from the backyard

poultry to commercial poultry led to high economic losses, due to inability to meet the target for

export, In addition, backyard poultry that are not properly vaccinated provide a place for vNDV

to replicate the feces/residues, these birds further contaminate the environment and act as a

reservoir to spread the vNDV (Rehmani et al. 2015). In the past, Newcastle Disease vaccines

have provided good protection against morbidity and mortality (Miller et al. 2010). However, an

increased number of outbreaks are reported in vaccinated animals in the globe, as well as in

Pakistan. It may suggest that currently available live attenuated and inactivated ND vaccines

neither produce enough clinical protection against new isolates, nor they prevent viral replication

and viral shedding in vaccinated birds (Rehmani et al. 2015). Limitation to use live ND vaccine

includes thermal sensitivity, residual pathogenicity, reversion into virulent form and

neutralization by homologous antibodies. Contrary to that an inability to distinguish between

5

vaccinated and non-infected chickens on the basis of serological test hindered the disease

eradication program. Moreover, there are some drawbacks with the presently available

commercial vaccines such as improper/over-inactivation of inactivated vaccines or reversion to

virulent form, cold chain maintenance and introduction of various strain of live vaccines

(Rehmani et al. 2016). However, it is considered that genetically engineered vaccines have some

expectation to overcome these problems. The recombinant vaccines have advantages over

conventional vaccines of providing immunity without possibility of reversion into virulent form

and minimize the accompanying safety concerns. Development of vaccine homologous to the

virulent field strain is considered to work better in case of minimizing viral replication and

shedding as compare to standard LaSota vaccine (Garcia et al. 2016; Firouzamandi et al. 2016;

Sawant et al. 2011). Few studies have been published on the efficacy of vaccine prepared against

virulent NDV on plasmid based expression of fusion (F) and hemagglutinin-neuraminidase (HN)

protein (Sakaguchi et al. 1996; Heckert et al. 2002; Loke et al. 2005; Rajawat et al. 2008;

Sawant et al. 2011; Cardenas-Garcia et al. 2016; Firouzamandi et al. 2016). Moreover, different

studies concluded variable protection efficacy in chicken immunized with F protein alone or

combined with HN protein. However, immunization with both NDV antigenic determinant

glycoprotein proteins could improve the immunogenicity of DNA vaccine against ND (Sawant et

al. 2011). Therefore, the present study was focused on the protection induce by plasmid

expressing F and HN gene protein separately and co-delivered comparing with homologous oil-

based-inactivated vaccine and commonly used LaSota vaccine. The immunized birds were

evaluated for morbidity, mortality, cellular and humoral immunity. Viral replication/load, viral

shedding and histopathology of various organs were also performed of the dead birds.

6

CHAPTER 2

REVIEW OF LITERATURE

2.1 Viruses

NDV also known as avian paramyxovirus type-1 (AMPV-1) is a common disease of various

avian species. The ND viruses belong to family paramyxoviridae, genus Avulavirus and in order

Mononegavirals Figure 2.1 (Moyo, 2002). The paramyxoviruses are divided into ten serotypes

designated as APMV-1 to 10 on the basis of serological testing. ND virus has pleomorphic shape

and it consists of negative sense RNA and has single stranded, enveloped, helical and non-

segmented morphology (Alexander and Senne, 2008). Depending on class and genotype, NDV

has at least three genome length 15186, 15192, 15198 nucleotides (nt) (Czegledi et al. 2006;

Alexander and Senne, 2008; Wajid et al. 2015). The six transcriptional units of NDV include 3’-

leader-NP-P-M-F-HN-L-trailer-5’ (Miller et al. 2010).

Figure 2.1: Taxonomic organization of the paramyxoviridae

2.2 Pathogenesis

7

The ND viruses pathogenicity depend on several factors, but most significant factor is the strain

of the infecting virus, other factors includes age of bird, immune status, host species, stress, the

amount of virus transmitted, environmental conditions, secondary infections and transmission

route (Alexander et al. 2004; Saif et al. 2008). However, mortality in birds most importantly

depends on host susceptibility and virulence of infecting ND strain (Alexander, 2001; 2003).

Chickens are more susceptible to ND than other species, other birds like ducks shows no or mild

clinical signs, however, water fowl and shore birds are most resistant to ND and concluded the

natural reservoir for low virulence to ND viruses.

There are five pathologic form of ND viruses based on the clinical signs present in the infected

birds: (1) Asymptomatic mostly enteric form cause no disease (2) lentogenic form creates mild

or sub-clinical respiratory signs, (3) mesogenic ND strains cause disease in birds with mild

respiratory signs and occasionally nervous signs but with low mortality, 4) velogenic form neuro

is highly pathogenic causing signs mostly neurotropic and respiratory then followed by mortality

5) velogenic viscerotropic cause short incubation period and severe signs like hemorrhages in

intestinal lesions, proventriculus, cecal tonsils and trachea and causes almost 100% mortality in

flocks with high susceptibility (Alexander, 1997; Alexander and Senne, 2008; Saif et al. 2008;

Miller et al. 2015) are divided into viscerotropic and neurotropic velogenic, (4) the viscerotrpic

velogenic NDV (vvNDV) strains causing hemorrhagic intestinal lesions, (5) velogenic

neurotropic NDV (nvNDV) form involves respiratory and neurological disease followed by high

mortality rate.

2.3 Clinical Signs

Different ND strains produce different clinical signs and symptoms in birds. The incubation

period of ND viruses 2-6 days, however, it can be 2-15 days (Alexander et al. 2004). Clinically

8

the ND viruses produce severe clinical signs of infection that mainly depend on the age and

species of host, viral strains, pre-existing immunity of the birds, environmental condition that

could increase the decrease the pathogenicity of viruses, length of incubation period and severity

of the disease (Jaganathan et al. 2015). Highly virulent ND viruses are producing high morbidity

and mortality in chickens, psittacines and other species. The clinical signs in chickens greatly

vary depending upon the virulent ND viruses responsible for infection. Velogenic viscerotropic

NDV (vvNDV) strains form has distinctive feature of acute lethal infections of the

gastrointestinal mucosa accompanied by hemorrhagic lesions and death. Clinical signs induced

by vvNDV include weakness, acute depression, fast breathing, greenish diarrhea, loss of appetite

and paralyzed wing and/or legs. Head become edematous and especially edema of tissue around

eye, particularly of the lower eyelid is commonly seen in chickens. The presence of hemorrhages

throughout the gastrointestinal tract and especially in the lining of proventriculus is strong

evidence in favor of vvND virus’s infection. Velogenic neurotropic NDV (vnNDV) forms are

dominated by acute respiratory distress soon followed by neurological signs predominate such as

torticollis, unilateral or bilateral wings and legs paralysis, muscular tremors. Drop in egg

production, sudden depression, and loss of appetite is also seen in birds infected with vnND

viruses.

2.4 Diagnostic Techniques

NDV is a notifiable transboundary animal disease and its diagnosis is indispensable to

understand the epidemiology of the ND viruses and to develop applicable control strategies. Both

virus isolation and laboratory characterization are indispensable for the conclusive diagnosis of

the disease.

9

2.5 Virus Isolation

The ND virus’s isolation can be easily isolated from the oropharyngeal or cloacal swabs of the

infected. The tissues from the visceral organs like cecal tonsil, trachea, spleen, bursa etc can be

used for the isolation of viruses. The intestinal and brain samples may be processed separately

while other samples may be collected as a pool. Virus isolated form pigeon (PPMV-1) are

replicates in brain, at laboratory it may be used for diagnosis purpose.

At laboratory, the field samples are processed in a separate place distant from vaccine production

unit to minimize the chance of contamination (OIE, 2012). For virus isolation, tissue samples or

swabs are placed in isotonic phosphate buffer saline (PBS) with pH ranging from 7.0 to 7.4 and

mixture of antibiotics such as pencillin (2000 units/ml), streptomycin (2 mg/ml), mycostatin

(1000 units/ml), and gentamycin (50 µg/ml). The bacterial contamination is completely

eliminated by incubating the samples with antibiotics for about fifty minutes. The antibiotic

concentration may be increased few fold for cloacal swabs. Other protein based media used for

transport of virus and tissue homogenization include tris-buffered tryptose broths (TBTB) or

brain-heart infusion (BHI).

The supernatant fluids obtained from swabs or tissues are clarified through centrifugation for 20

minutes at 2000 rpm and room temperature. Virus multiplication is carried out through

inoculation of 0.2 ml clear supernatant into the allantoic cavity of 9 to11-days-old specific

pathogen free (SPF) chicken eggs. The inoculated eggs are incubated for 72-96 hours at 37 ºC.

The eggs candling is performed every day post-inoculation, when the embryo is found dead

should be chill to 4 ºC overnight. The virus identification in allantoic fluids is performed through

routine laboratory technique hemagglutination (HA) activity.

10

2.6 Virus identification

Allantoic fluid collected from chilled eggs is tested for haemagglutination (HA) activity (OIE,

2012). It is routine practice of all ND laboratories globally. All the ten serotype of APMV

(APMV1-APMV10) including ND viruses could agglutinate the chicken red blood cells (RBCs).

The ability of haemagglutinin part of the haemagglutinin/ neuraminidase viral protein to bind

with receptors present on membrane of red blood cells, result in clumping which is also called

haemagglutination. Moreover, the bacterial contamination and 16 subtype of influenza A viruses

could give HA. Treatment of contamination involves incubation of samples with increased

concentrations of antibiotic for a period of 2-4 hours. Centrifugation of samples or incubation

with high concentration of antibiotic cannot help in case of heavy contamination. Filters of 0.45µ

and 0.2µ (micron) size can serve this purpose (OIE, 2012). However, the ND strains can be

confirmed through HI test using NDV specific antiserum.At present the increasingly common

used technique in viral diagnostic laboratories, quantitative real time-polymrase chain reaction

(qRT-PCR) test is quick and reliable assay for the detection and genotyping of NDV.

2.7 Serological Diagnosis

NDV- specific antibody detection is primarily performed to evaluate the immune status of

chicken against the infection (Alexander et al. 2004; Saif et al. 2008; Alexander and Senne,

2008). Among the several diagnostic tests commonly used at virology laboratories are

hemagglutinin-inhibition (HI) test and enzyme linked immunosorbant assay (ELISA) for

measuring theNDV-specific antibody titers. The other tests may be used for detections are plaque

neutralization, agar gel immunodiffusion (AGID), virus neutralization in chicks embryo. In the

presence of anti-NDV antibodies, it involves the inhibition of agglutination of RBCs by 4 units

11

NDV antigen. The NDV-specific antibody level are generally high in field samples after recent

infections (Alexander and Senne, 2008; OIE, 2012).

2.8 RR-PCR based Diagnosis

Molecular based identification of viruses is commonly used in diagnostic laboratories globally.

Until now, several laboratory procedures have been developed to detect the APMV-1 viruses

from the allantoic fluid of embryonated eggs and tissue homogenates. However, for the proper

diagnosis of viruses, it is critical to detect both the presence and pathogenicity of the virus. In

1991, first attempt was made for detecting of the ND viruses from infected embryonated eggs

allantoic fluid by qRT-PCR (Jestin and Jestin, 1991). Since then a variety of techniques

including gel-based conventional PCR (Jestin and Jestin, 1991; Seal et al. 1995; Kho et al. 2000;

), restriction enzyme based procedure, ligase chain reaction (LCR) (Collins et al. 2003), RT-

loop-mediated isothermal amplification assay (RT-LAMP) (Pham et al. 2005a; Li et al. 2009),

fluorescent dyes (SYBR green) (Pham et al. 2005b) and light-upon-extension (Antal et al. 2007),

fluorogenic probe-based real time PCR (RT-PCR) (Aldous et al. 2001; Khan et al. 2010) and

rapid sequencing is useful for the claasificiation and pathotyping of ND viruses are circulating

worldwide. The earlier procedures had some drawbacks to conveniently detect all the ND strains

and major obstacle of low sensitivity. The ideal concern was to discriminate between the low and

high virulent viruses, although those procedures could not potentially classify the viruses

(Nanthakumar et al. 2000).

The advent of real time PCR (RT-PCR) using fluorescently labeled TaqMan probe is highly

sensitive and rapid diagnostic test used to detect viruses and determined pathogenicity.

This technology integrates the mechanism of polymerase chain reaction (PCR) with utilization of

flourescent reporter molecules so that the amplification of products during each PCR reaction

12

cycle can be recorded. Set of attributes including exceptional specificity and sensitivity, lower

contamination risk, consistent data and reduced time duration give superiority to real time RT-

PCR over conventional PCR (Navarro et al. 2015). Molecular diagnostic assay serves to provide

specific, quick and instant procedure for quantification as well as detection of viral RNAs. These

features have made qRT-PCR is an obligatory laboratory tool for the diagnosis of predominant

animal and human viral pathogens (Hoffmann et al. 2009). The cleavage stie of F gene is a major

determinant for pathogenicity (Glickman et al 1988). So F is target gene for detection and

pathotyping of ND strains. In various laboratories, two types of USDA-validated RT-PCR assays

based on F and matrix (M) genes are extensively used for detection of APMV-1 viruses (Kim et

al. 2006; Kim et al. 2006, 2008; Farkas et al. 2009; Rue et al. 2010; Khan et al. 2010). The M

gene assay was designed mainly as a screening assay to detect most ND viruses, mainly class II,

regardless of pathotype (Miller et al. 2010). This assay can be used to detect low virulent NDV

(LoNDV), vNDV and pigeon paramyxovirus type-1 (PPMV-1). While the F gene assay can only

detect the vND strains by binding to cleavage site of F protein gene (Kim et al. 2006). However,

due to genetic variability in M gene probe binding site, the loND strains from class I isolated in

US were not detected by M gene probe (Kim et al. 2007, 2008). Lack of detection due to

genomic modification of ND strains that cause the loss of probe binding site. Recently, It has

been shown that F gene assay fail to detect PPMV-1 viruses (Kim et al. 2006). The sequence

analysis identified four mismatched nucleotides of the F probe binding site of few PPMV-1

strains apparently blamed for test failure (Miller et al. 2010). New designed probe was capable

of detecting the vPPMV-1 viruses from the dove (Kim et al. 2008).

13

2.9 Transmission

NDV is a contagious disease, primarily transmitted by shedding of viruses through bodily

secretions from the eye, nose and mouth of infected bird by direct contact with healthy birds.

Carrier birds are the main source of virus spreading through their feces that easily contaminated

the environment. Airborne vNDV transmission is also considered one of the substantial disease

spreading routes (Li et al. 2009). As reported in the ND epidemic in Northern Ireland (McFerran,

1989), and in England during 1970-71 (Hugh-Jpones et al. 1973). The environmental factors like

temperature, humidity, and stocking density could be considered over the transmission of NDV

through this route. The suitable climatic conditions are very important to establish this route (Li

et al. 2009). However, this could be a big threat to not only the commercial poultry, where the

farms are in close proximity, it could also affect the free-roaming backyard poultry. Movement

of infected birds and human among poultry flocks and contaminated equipment and materials are

the main source of virus transmission.

2.10 Newcastle disease virus classification

The two systems utilized for classification of NDV worldwide includes Aldous and Diel groups.

According to Aldous and his coworkers, ND viruses comprised of six lineages and further

divided into thirteen sub-lineages and also latterly included three more sub-linages (Aldous et al.

2003; Snoeck et al. 2009). The second system suggested by Diel groups based on the complete

fusion protein gene nucleotides diversity or full genome sequences, ND viruses are distributed

into two common classes, class I, II. Currently, there is a sinlge sub-genotype belongs to class I

and 18 genotypes in class II and some genotypes further divided into sub-genotypes (Diel et al.

2012; de Almeida et al. 2013; Courtney et al 2013; Snoeck et al. 2013; Miller et al. 2015; Wajid

et al. 2015). Basedon the new classification system, 10% (at nucleotide level) is needed on the

14

mean inter population evolutionary distance among group of ND viruses is used as a standard for

assigning a new genotypes and sub-genotypes. Second point of the criteria of the requirement at

least four viruses form distinct taxonomic group with phylogenetic bootstrap of the define node

>60 with the above cutoff value. Highly pathogenic influenza viruses were classified using the

bootstrap and value and mean inter-population evolutionary distance (WHO/OIE/FDA and

Evolution Working Group, 2008). Class I in chickens is mainly avirulent and has historically

been isolated from domestic and waterfowl (Kim et al. 2007; Diel et al. 2012). However, vast

majority of vNDV strains are belongs to class II in the globe.

2.11 Epidemiology

ND is considered pest of Asia, endemic in most part of Asia, Africa and some countries of South

and North America. Some countries are free of ND in poultry including Canada and America,

maintained their strict import of materials and eradication program of infected animals. After

discovered simutaneously in Java, Indonesia and Newcastle upon Tyne region in England during

1926 (Kraneveld, 1926; Doyle, 1927), the vNDV was spread throughout the world and causing

disease in birds (Seal et al. 2000; Alexander et al. 2004; Saif et al.2008). Some avian species are

commonly infected with vNDV e.g. pigeons, cormorants, and parrots also known as psittacine

species are considered the main source of infection in poultry. NDV strains with low virulence

are coomonly isolated from waterfowls that play an important role in spreading these viruses.

Virulent strains of NDV could infect animals other than birds, i.e. causing conjunctivitis in Man.

The vNDV infection is reported in more than 250 species belonging to 27 out of 50 orders of

class birds.

Several panzootic have occurred in birds in the world since 1926. The first panzootic was spread

very slowly and it took over twenty years to become the proper panzootic. In 1920s, the ND

15

viruses of genotypes II, III, and IV, class II were responsible for first ND panzootic (Ballagi-

Pordany et al. 1996). The second panzootic was caused by ND viruse mainly of genotype V

during 1970s and it was spread throughout the world within four years (Herczeg et al. 2001;

Czegledi et al. 2002; Cac et al. 2003). During 1970s, the viruses emerged for the very first time

in Central and South America; the similar viruses appeared and caused disease in Europe same

time. The genotype V viruses also caused disease in Florida during 1971 and 1993 and California

1971 to 2002, the similar viruses still circulating in Central America and Mexico where the

viruses isolated recently were designated as a new sub-genotype Vc (Perozo et al. 2008; Absalon

et al. 2012; Absalon et al. 2014). In Belize, the ND viruses isolated in 2008 were belonging to

sub-genotype Vb in genotype V (Susta et al. 2014). During late 1970s, genotype VI of virus was

originated from affected pigeons and resulted in the third ND panzootic (Czegledi et al. 2002).

These viruses were primarily reported in various regions of the Middle East and laterally were

spread into Europe (Biancifiori and Fioroni, 1983), where the similar viruses were isolated and

responsible for many outbreaks in avian species (Alexander et al. 1985). The emergence of

viruses is still unknown, however, multiple events occurred for transmission of PPMV-1 viruses

from chicken to pigeon (Ujvari et al 2003; Aldous et al. 2004). vND viruses of genotype VI

mostly associated with pigeon and dove, however are found in multiple species (Alexander,

2011). The fourth panzootic of ND was started in early 1990s, the vNDV strains from genotype

VII was responsible (Yu et al. 2001; Liang et al. 2002; Lien et al. 2007; Liu et al. 2007). Other

genotypes of NDV i.e. IX, X and XIII are isolated in few countries of Southern Africa (Herczeg

et al. 1999), China (Liu et al. 2003), and Taiwan (Tsai et al. 2004).

In 2011, virulent strains of NDV of new sub-genotype VIIi of genotype VII rapidly spread in

Middle East and Asia and caused outbreaks in many avian species suggesting the existence of 5th

16

panzootic of ND viruses (Rehmani et al. 2015; Wajid et al. 2015, 2016; Miller et al. 2015).

During the same time, the highly similar viruses were isolated mainly from many avian species

in Pakistan, Indonesia and Israel during 2011-12. The emergence of rapidly spreading of this

new sub-genotype VIIi represents a significant thread to the poultry industry. The higher similar

viruses have been detected in East European countries including Turkey, Georgia, Bulgaria

(Fuller et al. 2015) and also in Indian peafowl (Desingu et al. 2016). However it is unknown or

little has been to understand the evolution and maintenance of new genotype (Alexander et al.

2012).

2.12 Pakistan scenario

The ND is endemic in Pakistan, continues outbreaks of vND viruses have been reported from

commercial poultry flocks, domestic and wild birds during 2011-16 ( Rehmani et al. 2015; Wajid

et al. 2016a; Wajid et al. 2016b; Wajid et al. 2015; Rehmani et al. 2015; Miller et al. 2015).

NDV strains isolated from birds in Pakistan all are virulent in nature on the basis of ICPI, MDT

and fusion gene cleavage site. Interestingly, in our current studies spanning over six years of

disease monitoring no avirulent strains have been isolated from any investigated bird.

Virulent NDV in Pakistan has been reported since 1971 as the commercial poultry began in

Karachi, the southern coastal region of Pakistan. However, the mortality due to NDV outbreaks

remained as an endemic disease in the country though the annual growth rate in the commercial

poultry production has been ranged from 10% to 20% since 1975 to date. Due to unavailability

of the high technical skills and expertise in the field till late 1990’s, the LaSoat and ND clone are

commonly used vaccines in poultry sector. However, the Muktesware strain (mesogenic)

prepared by the local production units used for vaccinating backyard poultry. This strain was not

characterized on molecular basis up to 2008 (Khan et al. 2010). The ongoing research work on

17

ND in collaboration with SEPRL provides an opportunity to submit the epidemiological work on

the recent outbreak (from 2011 to date) emerged in the northern areas of Pakistan. The intensity

of the disease has slowed down after May, 2012; however, the reporting of cases with disease is

still continued from different parts of the country. This outbreak was peculiar in the sense that

for the first time the disease affected the wild birds like pheasants, peacocks and different breeds

of parrots reared in captivity and resulted in heavy mortality of 40% to 60% and morbidity in the

public and private zoos. Interestingly, the peacocks in Thar (Sindh), the southern region of

country, reported to be affected by the disease during late 2012 and early 2013. Virulent NDV is

widely distributed in different geographic environments, latitudes and production systems across

Pakistan. However, the mortality and morbidity greatly varied depending on the vaccination

using live attenuated vaccines either prior to the incubation period or during the early post

outbreak may cause uneven ( more or less) losses to the farm. Most notably, high mortality

>60% is in broiler production flocks, even with intensive vaccination practices. However, the

infection is occasionally observed in small poultry flcoks and in non-poultry avian species.

Moreover, the percentage mortality was higher and infection was more common in the flocks

under controlled environment than the opened houses in Punjab province. But no confirm data is

available on this issue except one factor that farmers try to keep the temperature of the house

warmer or higher in winter season, may cause the disturbances in cross ventilation and the birds

remain under stress. Most of the reported outbreaks (60-80%) occur during winter season, the

other optimum weather suitable for the onset of the disease is when there is a variation of 10 to15

°C in ambient temperatures during the day and night. ND is considered endemic in the country,

however the epidemiology of the vNDV is not well understood. The evidence supports the idea

18

that the viruses shed by vaccinated birds may act as virus reservoir of poultry (Rehmani et al.

2015).

2.13 Vaccine based on Biotechnology

The emphases are needed to learn more about the vaccine development that prevent infection,

and replication and shedding of virus. Numerous efforts have been made to developed the

genotype-matched vaccine (homologous to field virulent NDV strain), that reduced viral

shedding more efficiently than commercially used LaSota vaccine (Kim et al. 2013; Cardenas-

Garcia et al. 2015). Although, the classical live or inactivated vaccines may protect birds from

vNDV infection in adequate doses, but failed to completely prevent the viral replication and

shedding (Marangon et al. 1997; Alexander, 2001; Kapczynski et al. 2005; Cornax et al. 2012;

Dortmans et al. 2012). The current ND vaccines strains phylogenetically belong to genotype II

have been used for more than 60 years. The failure of vaccination to control ND in the field is

controversial, some studies argued the inadequate application (Dormans et al. 2012), however,

others studies have suggested genotype-matched (homologous) vaccine could significantly

reduse the challenge virus shedding when challenge with phylogenetically similar field ND strain

(Miller et al. 2009).

The approaches reverse genetics system has been widely used with the aim of generating

attenuated NDV, potentially applicable as vaccine. Attenuated mutant NDV generated by site

directed mutagenesis of nucleotide sequences encoding specific amino acid in NDV structural F

protein. Though and not quite unexpected the reversion into virulent form. Although,

engineering of safe live viral ND vaccines may require a number of attenuating mutations which

are distributed throughout the genome (Panda et al. 2004). NDV was rescued by reverse genetic,

which provide protection against infection. Chimeric viruses, with genomic region in challenge

19

strains replace by the corresponding ones of the vaccine strains, were shown to have no impact

on property of the virus.

Although, the alteration of cleavage site alone in F protein from lentogenic/avirulent strain to

that of virulent NDV strain didn’t convert the virulent strain into virulent after checked by a

natural route of infection (Panda et al. 2004). However, HN, W, V protein of NDV have reported

to be responsible for virulence of virus (Park et al. 2003). The viral infectivity is greatly

influenced by interaction of HN with the F protein (Takimoto et al. 2002). Recent studies have

concluded that the HN protein affects pathotype of virus and might also have a contribution in

the NDV virulence (Millar et al. 1988). However, the great sequence similarity has been reported

in the core neuraminidase (NA) domain of HN proteins taken from different paramyxoviruses.

The amino acids (aa) length of hemagglutinin-neuroaminidase (HN) protein of NDV strains

greatly vary and different strains have a length of 571, 577, 580, 581, 585 and 616 aa. The

sequence analysis of HN gene has revealed large open reading frame (ORF) (616 aa long) in low

virulent enteric strains of NDV and at its C-terminus have additional 45 aa in comparison with

virulent (571 aa) and less virulent (577 aa) NDV strains. In avirulent NDV strains (D26, Ulster

and Queensland), the precursor HN is of 616 aa residues and it is converted into biologically

active HN protein after post translational cleavage.

2.13.1 DNA vaccine

DNA vaccines are bacterial plasmid constructs which has been described as a third generation of

vaccines (Hasson et al. 2015). DNA vaccine has several advantages like ease of transport and

administration, reduced cost, works in the face of maternal antibodies, vaccinated and infected

animals can be differentiated from each other, reduce the risk of infection in animals, ability to

induce both cellular and humoral immunity (Cardenas-Garcia et al. 2016). In addition, several

20

plasmids have the ability to express different genes can be incorporated into a DNA vaccine. The

DNA vaccines exhibit the potential advantage of expressing a specific immunizing protein gene

of the infectious agent.

The ND viruses contain two surface functional glycoproteins F and HN play important role in

virus virulence and virus-cell interaction (Heiden et al. 2014). They form spike-like projections

on cell surface and are the NDV neutralizing antigens. The fusion protein alone or with HN

protein is the primary target of ND DNA vaccine development. The NDV glycoprotein, the

fusion (F), encoded by fusion gene and derived by inactive precursor F0 is glycosylated and

proteolytically cleaved by host proteases into disulfide-linked functionally avtive F1 and F2form.

Cleavage is major NDV virulence determinant and necessary to initiate infection. Cleavage of

virulent viruses is determined by uniquitous subtilisin like protease, whereas, in avirulent viruses

is occurs by trypsin like enzyme. The varying NDV pathogenicity (velogenic, mesogenic and

lentogenic) is attributed to difference inaa residues at cleavage site (Rehmani et al. 2015). Theaa

residues at F protein cleavage site of vNDV at position 112-R-K/R-Q-K/R-R↓F-117 (OIE 2012).

The fewer basic aa residues are present at those positions in less virulent viruses (loNDV) and

leucine at position 117.

The HN protein of NDV is glycoprotein with multiple functions and plays significant role in the

progression of infection including virus attachment to the host cells and also fusion promotion

activities. It recognizes the sialic acid containing host cell surface receptor followed by fusion

with host cell membrance (Connaris et al. 2002). The NDV-HN is type II homotetramateric

membrance protein and it contains transmembrane domain at N-terminal, stalk region and

neuroaminidase (NA) domain with enzymatic activation. Both proteins are the main target for

DNA immunization against NDV (Morgan et al. 1992). However, plasmid expressing F protein

21

alone or/with HN protein provide variable immunity in birds against vND viruses (Sakaguchi et

al. 1996; Loke et al. 2005; Rajawat et al. 2008; Arora et al. 2010; Sawant et al. 2011;

Firouzamandi et al. 2016; Cardenas-Garcia et al. 2016). Sawant et al (2011) demonstrated that

co-administered of both plasmids expressing NDV antigenic determinant proteins F and HN

have been described induces high protection in birds than alone. The previous results obtained by

Arora et al (2010) also concluded that the co-administration of NDV/F and NDV/HN proteins

induced 73% protection as compare to 66% and 20% by NDV/F and NDV/HN respectively

alone. Another study by Gowrakkal et al (2015), the birds immunized with F and HN alone

revealed 60% and 20% survival rate as compared to co-administration of both proteins was 80%.

Recently study by Cardenas-Gracia (2016) observed 83% protection when birds were immunized

with F protein alone after two vaccine application.

2.13.2 Mechanism of DNA vaccine

DNA immunization is a technique that used to efficiently induce the potent cellular and humoral

immunity to target antigen when injected into the host cells. It is well documented that the DNA

plasmid encoding a gene of interest when transfected into the host cell, it results in the

subsequent synthesis of encoded polypeptide that lead to the stimulation of humoral and cellular

immune response. When injecting the genetic material, very small amount of host cells receive

the antigen and produced its product. The desired gene within the plasmid DNA is typically

under the control of mammalian promoter i.e. SV40 or CMV for transcription. However, the

precise mechanisms that use the molecular and cellular pathways for processing of internalized

antigens and their presentation to T cells are not fully understood (Liu, 2003). There are several

factors that affects the immune response induced by plasmid DNA immunization are site of gene

delivery, method used for DNA vaccine transfer, dose of plasmid DNA and the administration of

22

booster vaccination. The plasmid can be directly administered into the resident somatic cells

(myocytes and keratinocytes) at the site of plasmid DNA injection or it can be directly injected

into antigen presenting cells (dendritic cells, DC). If plasmid DNA is directly delivered into DC

and processed in, then the encoded antigens are directly exposed on the cell surface by both

MHC class I and II to CD4+ and CD8+ T lymphocytes respectively. The APCs have a dominant

role in presenting the encoded antigen of interest on MHC molecules to induce cellular and

humoral immunity. Through the lymphatic vessels, the antigen loaded APCs travel to the

draining lymph node, where they presented the processed protein antigen to naïve T lymphocytes

through MHC pathways. This migration of class II MHC molecules rich APCs offer an effective

mechanism through which the protein antigens from the muscle, mucosa and skin to T helper

lymphocytes located in the lymph nodes. If the plasmid DNA is taken up by the stromal cells at

the immunization site, then the encoded protein antigens processed in and secreted from

transfected muscle cells and indirectly captured by the APC cells such as DC and then cross

presented on MHC II molecules to CD8+ T lymphocytes.

23

Figure 2.1: The scheme of antigen presentation to immune system and transfection into muscle

cells (myocytes) and direct transfection of Antigen presenting cells (APC).

2.13.3 Delivery Pathways

Several mechanisms have been described regarding the uptake of plasmid DNA into animal

cells. Among several approaches, one approach, through standard hypodermic needle injection

into various animal tissues is the most effective. Plasmid DNA has been introduced into the

animal cells by two most fundamentally various approaches, the saline injection (Chuang et al.

2013) and Gene gun delivery (Wahren ad Liu, 2014; Ault et al. 2012) of plasmid DNA. The

intramuscular delivery of plasmid DNA containing transgene is usually through in hind leg

quadriceps or tibialis anterior muscles of animals is commonly used since early 1990s (Chuang

et al. 2013). Another method the plasmid DNA vaccine containing F gene encapsulated in a 500

nanometer (nm) Ag@SiO2 hollow inorganic nanoparticles were used in mucosal immunity. The

nanoparticles based DNA delivery method expressed in vitro and sustainably released the

plasmid DNA after initial burst release. In vivo experiment revealed high titers serum antibody

after intranasal immunization of birds with Ag@SiO-NPs-pFDNA. This could be an efficient

and safe delivery method of plasmid DNA to induce mucosal immunity.

2.13.4 Components of a DNA Plasmid

The DNA vaccine which is also known as genetic vaccine requires some essential component for

the expression of desired gene. Optimizing plasmid is needed for the high expression of

immunogene in the transfected cells. The plasmid is composed of gene of interest is under the

control of strong viral promoter to get the optimal expression in the transfected cells, i.e. simian

virus 40 (SV40) or cytomegalovirus (CMV). Rabbit beta-globulin and bovine growth hormone

polyadenylation sequences are added into plasmid for transcriptional termination signal (Alarcon

24

et al. 1999; Robinson et al. 2000). Plasmid can also construct as multicistronic vector for the

expression of more than on gene of interest and sometime one desired gene and other

immunostimulatory protein i.e. cytokines and chemokine genes as adjuvant (Lewis and Babiuk,

1999; Sawant et al. 2011; Cardenas-Garcia et al. 2016). Second, the origin of replication

allowing plasmid to propagated within the transfected cell. For plasmid selection during bacterial

culture, it consists of a bacterial antibiotic resistant gene (selectable marker). A polylinker, where

gene of interest is clone, also called multiple cloning sites contain restriction enzymes site to

cleave.

2.13.5 Approved DNA Vaccine for Animal Use

DNA vaccines have made significant developments in veterinary practices where four DNA

vaccines have already been approved to treat some animal disease. One of them is used for gene

therapy application, one is available for cancer immunotherapy and two are prophylactic

vaccines against animal infectious diseases (Pereira et al. 2014). These veterinary DNA vaccines

were recently licensed in USA, Canada and Australia. In 2003, Center for Disease Control

(CDC) of United State developed an equine DNA vaccine, the purpose was to protect horses

against a zoonotic mosquito transmitted airborne West Nile Virus (WNV). In 2005, the US

Department of Agriculture (USDA) licensed this vaccine and manufactured by West Nile—

Innovator®/ Firt Dodge Animal Health Laboratories, Fort Dodge Lowa. This vaccine encoded

two WNV E glycoproteins, prM and E protein from the NY99 strain of were paste into VR-1012

expression vector with promoter CMV. In 2005, another DNA vaccine was licensed by Canadian

Food Inspection Agency (CFIA) against Infectious Hematopoitic Necrosis Virus (IHNV)-is

responsible for infectious diseases in Salmonid fish industry in Canada and USA. A portion of

IHNV-G proteins gene was encoded in expression vector under the control of CMV and with

25

rainbow trout interferon regulatory factor (IRF1A) promoter also disclosed, it was helped to

express the encoded gene in fish cells. Aqua Health Ltd (Canada) with affiliation of Novartis had

developed a DNA vaccine (Apex-IHN®) for IHNV against Salmon.

Another plasmid DNA-based hormone releasing hormone (GHRH) was constructed for gene

therapy for Swine by Australian Pesticides and Veterinary Medicines Authority approved and

licensed in 2008 (Draghia-Alki et al. 2003). The plasmid encoded GHRH was administered in

pig via electroporation for the expression of growth hormone. The first licensed therapeutic

plasmid based vaccine is commercially known as LifeTide® SW5 (VGX Animal Health). In

2010, US Department of Agriculture (USDA) approved and licensed commercially first

therapeutic DNA vaccine known as ONCEPTTM (Merial) against dog oral melanoma with

purpose to increase the survival time of dog with stage II and III of disease. The plasmid-based

DNA vaccine was developed with non-canine gene for tyrosinase was inserted in plasmid

backbone. The human melanocyte protein tyrosinase gene was encoded in plasmid; this type of

protein is present on melanoma cancer cells in dog and human. The plasmid with human

melanocyte protein tyrosinase gene was administered to dog, the dog immune system triggered

against the encoded gene in plasmid. Tyrosinase protein of human is very similar to dog, after

immunization it trigger an immune response against dog’s tumor (Bergman et al. 2003; Liao et

al. 2006).

Table 2.1: Approved DNA vaccine for Animal health

Type Vaccine target Species Product Name

Licensed

Country and

Date

Route Benefits

Prophylactic Vaccine

West Nile Virus (WNV)

Horses

West Nile—

Innovator®/ Firt Dodge Animal

Health

USA, 2005 Intramuscular

Protective antibodies

production in immunized

horses

Prophylactic

Vaccine

Infectious hematopoietic

necrosis virus

(IHNV)

Salmon Apex-IHN®) Canada, 2005 Intramuscular Improves animal welfare

Gene Therapy Melanoma Dogs ONCEPTTM Merial Australia, 2008

Intramuscular

followed by

electroporation

Treat oral tumor in canine

and improves survival time in

dogs

26

Immunotherpy of cancer

Growth hormone

releasing hormone

(GHRH)

pig

LifeTide® SW5

(VGX Animal

Health)

USA, 2010 Intradermal

Decrease morbidity and

mortality and increase

productivity

2.14 Live viral vector recombinant vaccine

Live attenuated recombinant vaccine contains virus in one or more than one inactivated or

deleted genes or a foreign gene from another disease causing agent, called as vaccine vector. The

infectious agents became attenuated and have no more potential to cause the disease. So the

vaccines will remain stable and the infectious agent cannot be reverted to its pathogenic form

(Uzzau et al. 2005). Live viral vectors are now proved to be effective vaccine against infectious

diseases including NDV in poultry. The successful licensing of viral vector vaccine for

prevention and immunization of infectious diseases of poultry proves that the technology can

work. Reverse genetic technology having question, is whether the issue of safety, efficacy,

vector immunity, genetic stability, ease of use and cost of manufacturing can be addressed

adequately and satisfactorily. Compared to the conventional vaccines, viral vector have some

advantages i.e. induction of both humoral and cellular immunity, more vigorous than inactivated

vaccines or subunit vaccines.

Live virus vector is most preferred way for expressing or replicating the said proteins in

vaccinated birds. Many live virus vectors like pox viruses, herpes viruses of turkey (HVT),

infectious bursal disease viruses (IBDV) and avian retroviruses harboring genes encoding fusion

(F) protein or hemagglutinin-neuroaminidase (HN) protein has been reported in the art. Pox

viruses which are species specific like, pox virus is vaccinia, fowl pox virus (PFV) and pigeon

27

pox virus (PPV) are considered suitable vectors harboring an immunogenic NDV gene (Ogawa

et al. 1990).

Recently, novel approaches have been introduced, Zhao and his colleagues (2014) made

NDV/ILTV (Infectious Laryngotracheitis virus) live attenuated vaccines based on LaSota

vaccine strain, with expression of glycoprotein D (gD) and B (gB) of ILTV using reverse genetic

technology. At the same time another study by Basavarajappa et al. (2014) using the strategy of

bivalent recombinant vaccine containing NDV/ILTV using NDV backbone by designing rNDV

gB, rNDV gC and rNDV gD which expressed ILTV glycoproteins gB, gC and gD respectively.

This novel bivalent recombinant vaccine was safe, stable, immunogenic and provided complete

protection against challenge with NDV and ILTV (Zhao et al. 2014).

2.14.1 Herpes virus of turkey (HVT)

Herpes of turkeys (HVT) is an alpha herpesvirus, nonpathogenic virus of domestic turkeys

(Witter and Solomon, 1972). It is widely used live vaccine against Marek’s diseases (MD), three

serotypes including virulent MDV-1 (etiological agent of MD), MDV-2 (Gallid herpesvirus 3)

(Cui et al. 2013), and MDV-3 (Herpes virus of turkey, HVT) (also known as Meleagrid

herpesvirus 1. MDV-1 is pathogenic in chicken and causes contagious neoplastic disease while

the other two types is nonpathogenic or of low pathogenicity in chickens (Calnek and Witter,

1991).

HVT has been used as vaccine vector for expression of protective antigens, typically the F and

HN glycoprotein (or both) of NDV (Morgan et al. 1992; Morgan et al. 1993; Palya et al. 2012);

HA gene of highly pathogenic avian influenza (HPAI) H5N1; highly pathogenic H7N1; NA gene

of H9N2 or of a cytokines to manipulate the cytokine’s immune response (Tarpey et al. 2007).

Currently many commercial vaccines are available in the market that comprises HVT as a vector

28

expressing a foreign gene, for example: for NDV, Vectormune® HVT/NDV F-antigen (Ceva),

Innovax® ND-SB (MSD Animal Health), for IBDV, Vectormune® HVT/IBD VP2-antigen

(Ceva), Vaxxitek® HVD/IBD (Merial), for infectious laryngotracheitis virus, Innovax® ILT

(MSD Animal Health).

HVT is commonly produced in vitro culture of chicken embryo fibroblast cells (CEFs) for large

scale production. In vitro and in vivo replication of HVT is carried out in monolayered CEF’s

and lymphoid cells peripheral blood lymphocytes (PBL’s). HVT induces an immune response of

long duration, typically intended at the cellular, not at the humoral immune response.

Recombinant HVT (rHVT) has been used as a vaccine vector expressed F or HN glycoprotein or

both of NDV (Morgan et al. 1992; Morgan et al. 1993; Sondermeijer et al. 1993; Heckert et al.

1996; Reddy et al. 1996). The rHVT vaccines are advantageous as they induce strong cell-

mediated immunity (CMI) and are safe for in ovo administration (Reddy et al. 1996). A vaccine

against any pathogenic disease in poultry, comprising HVT vector will generate an immune

response against the expressed heterologous gene, as well as against vector itself.

2.14.2 Infectious bursal disease virus (IBDV)

Different approaches of vaccination have been investigated to overcome NDV in the globe.

Numerous tactics have been applied to control the incidence of vNDV outbreaks in the countries

where the disease is endemic. Recent studies showed that the IBDV as a potential antigen

delivery system have been explored as a novel vaccine vector (Li et al. 2014). The virus belongs

to genus Avibirnavirus (family Birnaviridae) and has dsRNA genome (Delmas et al. 2004).

Recombinant IBDV (rIBDV) have been used to express epitope of foot and mouth disease

(FMDV) and human hepatitis C virus (HCV) (Upadhyay et al. 2011). Recently Li et al. (2014)

successfully recovered recombinant IBDVs expressing HN neutralizing epitopes of NDV in the

29

PBC and PHI loops of the VP2 and VP5 regions with the aim of developing safe and efficient

vaccine vector against NDV. The NDV epitopes were successfully recovered and were

neutralizing antibody against both NDV and IBDV in immunized chickens (Li et al. 2014).

IBDV involved in the destruction of B lymphoid cells thus lead to immunosuppression, the

major role of vaccine failures and susceptibility to other infectious agents (Lukert and Saif,

1991). Many characteristics build the avirulent IBDV stain as significant vaccine vectors. IBDV

provides a low cost vaccine with high efficacy, safety, natural heat stability, easy production,

easy to use through drinking water or spraying makes it widespread vaccine across the globe.

Viral vector such as pox virus and herpesvirus encode a large number of proteins, whereas the

genome of IBDV is very simple and encodes only few proteins. Hence, offers less competition

between foreign expressed antigen and the vector proteins to generate immune response (Li et al.

2014). The IBDV replicates in cytoplasm so integration into the host genome do not occur.

Using reverse genetic system, it was demonstrated that recombinant IBDV viruses have the

potential of serving as bivalent vaccines.

2.14.3 Fowl pox virus (FPV)

Recombinant fowl pox virus (rFPV) used as a vector to express immunogenic proteins from

NDV had licensed as the first commercial recombinant vectored vaccine (McMillen et al. 1994;

Yamanouchi et al. 1998). Fowl pox virus (FPV) and canary pox virus (CPV) belonging to the

genus Avipoxviruse and subfamily Chordopoxviridae of the Poxviridae family. The virus causes

disease in domestic, wild birds and poultry, however, in later mortality is usually low, can reach

up to 50% in flocks under stress (due to secondary infection). FPVs have been used as viral

vaccine vector against diseases in human and veterinary animals, its ability to endure multiple

30

genes inserts the most significant characteristic that make the FPVs as auspicious vaccine vector

(Weli and Tryland, 2011).

FPVs are oval shaped, large, enveloped dsDNA viruses and easily replicate in the infected avian

cell’s cytoplasm and on the chorioallantoic membrane of embryonated eggs. FPVs cause skin

lesion which vary greatly from papules to nodules in infected wild and domestic birds (Tripathy

et al. 2000). A recombinant fowl pox virus have been used against several poultry disease like

avian influenza (Taylor et al. 1988), NDV (Taylor et al. 1990) and IBD or Gumboro disease

(Bayliss et al. 1991), and confer protective immunity in chicken.

Genetic engineering of FPVs as a vaccine vectors have a significant application in the poultry

industry. Recombianant fowl pox virus (rFPV) was successfully constructed for the expression

of fusion and hemagglutinin-neuraminidase proteins from velogenic strains of NDV to protect

chicken against NDV (Taylor et al. 1996; Sun et al. 2008; Sun et al. 2006). A single inoculation

of rFPV expressing NDV-F and HN in SPF birds at one day of age protected commercial broiler

chickens by inducing significant level of hemagglutinin-inhibiting antibody for their life time

(maintained to 8 week post inoculation), even in the presence of maternal immunity against

NDV or its vector (Paoletti, 1996; Taylor et al. 1996). TROVAC vector derived from FPV

vaccine strains have been licensed by the USDA (TROVAC-NDV), has been used as a vector in

broiler chickens against NDV, replicating safe, efficacious, and economically feasible at typical

dose of 1X104 pfu given at day-of-age.

The FPV-NDV vaccine safety and efficacy has been evaluated both in vitro and in vivo and its

cell culture and chicken embryonated eggs passage genetic and phenotypic stability have been

demonstrated (McMillen et al. 1994). The FPV-NDV vaccine was administered intramuscular or

through eye drop, effectively immunized against vNDV and virulent FPV (vFPV) challenge. The

31

recombinant FPV-NDV vaccine has been found effective and safe vaccine for poultry as can be

witnessed through lack of shed and spread and failure to reversion into virulent form (McMillen

et al. 1994). The results of study have shown that FPV has potential to provide vector system for

the delivery of foreign epitopes (F or HN) of NDV. In term of protective immunity to NDV by

rFPV as concluded by Boursnell et al. (1990), the chickens tested were 100% protected against

challenge with vNDV strain.

2.14.4 Avian Adeno-Associated virus (AAAV)

The avian adeno-associated virus (family Parvoviridae) is a replication-defective non-pathogenic

virus and is a viral vector successfully used for delivery of foreign gene (Perozo et al. 2008a).

During the last decade, the parvoviruses established as a leading trend in human medicine, as 15

different adeno-associated viruses (AAV) vector in at least 20 clinical trials had been

accomplished (Snyder and Francis, 2005). They are nonpathogenic, can accommodate a long

DNA fragment and can infect wide range of cell types without interfering with the maternal

antibodies. Therefore, they can act as a suitable viral vector for transgenic expression of foreign

genes (Synder, 1999; Muzyczka, 2001). The avian AAAV, a parvoviruses family member, has

been characterized completely and is being used as reporter gene delivery in embryo cells of

chicken (Estevez and Villegas, 2004; Estevez and Villegas, 2006). Previous studies demonstrated

that AVVV can be a promising candidate used for the gene therapy in human, based on the lack

of pathogenicity and long lasting high level of trans-gene expression (Wright et al. 2003; Synder

and Francis, 2005). The generation of rAAAV for transgenic expression of HN protein of NDV

and their ability to generate protective immunity in chickens has been assessed by Perozo et al.

(2008a). When serum of birds vaccinated with rAAAV-HN (NDV) was tested through Enzyme

linked immunosorbent assay (ELIZA) and hemagglutinin inhibition (HI) test, revealed a

32

systemic immune response. The challenge study with virulent viscerotropic NDV (vvNDV)

strains in commercial broiler chickens provided up to 80% protection bird vaccinated primed

inovo. Long lasting high levels of transgenic expression and lack of pathogenicity represent a

rAAAV promising candidate for poultry vaccination (Wright et al. 2003).

The study objectives are:

1. Biological and genetic characterization of NDV circulating in Pakistan will be accomplished

through two different sub-objectives.

A) Nucleotide sequencing of 30 isolates through complete fusion (F) and hemagglutinin-

neuroaminidase (HN) gene.

B) Biological characterization of 30 isolates using pathogenicity assays to test the virulence,

mean death time (MDT) and intracerebral pathogenicity index (ICPI).

2. Phylogenetic analysis will accomplish to trace the evolution in circulating strains and store

the genetic information in GenBank for future studies.

3. Development of recombinant Newcastle disease vaccines homologous to circulating NDV

strains.

4. Comparative evaluation of homologous vs commercial vaccine induces protective immune

response.

References

Abolnik C, Horner RF, Bisschop SP, Parker ME, Romito M, Viljoen GJ. 2004. A

phylogenetic study of South African Newcastle disease virus strains isolated between

1990 and 2002 suggests epidemiological origins in the Far East. Arch Virol. 149(3): 603-

619.

33

Absalon AE, Mariano-Matias A, Garcia LJ, Morales-Garzon A, Toscano-Contreras A, Lucio-

Decanini E, Cortes-Espinosa DV. 2014. Complete genome analysis of velogenic

Newcastle disease virus reference strain “Chimalhuacan”: evolution of viral lineages in

Mexico. Virus genes. 49(2): 233-236.

Absalon AE, Mariano-Matias A, Vasquez-Marquez A, Morales-Garzon A, Cortes-Espinosa DV,

Ortega-Garcia R, Lucio-Decanini E. 2012. Complete genome sequence of a velogenic

Newcastle disease virus isolated in Mexico. Virus genes. 45(2): 304-310.

Afonso CL, Amarasinghe GK, Banyai K, Bao Y, Basler CF, Bavari S, Bejerman N, Blasdell KR,

Briand FX, Briese T, Bukreyev A, Calisher CH, Chandran K, Cheng J, Clawson AN,

Collins PL, Dietzgen RG, Dolnik O, Domier LL, Durrwald R, Dye JM, Easton AJ,

Ebihara H, Farkas SL, Freitas-Astua J, Formenty P, Fouchier RA, Fu Y, Ghedin E,

Goodin MM, Hewson R, Horie M, Hyndman TH, Jiang D, Kitajima EW, Kobinger GP,

Kondo H, Kurath G, Lamb RA, Lenardon S, Leroy EM, Li CX, Lin XD, Liu L, Longdon

B, Marton S, Maisner A, Muhlberger E, Netesov SV, Nowotny N, Patterson JL, Payne

SL, Paweska JT, Randall RE, Rima BK, Rota P, Rubbenstroth D, Schwemmle M, Shi M,

Smither SJ, Stenglein MD, Stone DM, Takada A, Terregino C, Tesh RB, Tian H,

Tomonaga K, Tordo N, Towner JS, Vasilakis N, Verbeek M, Volchkov VE, Wahl-Jensen

V, Walsh JA, Walker PJ, Wang D, Wang LF, Wetzel T, Whitfield AE, Xie JT, Yuen KY,

Zhang YZ, Kuhn JH. 2016. Taxonomy of the order Mononegavirales: update 2016. Arch

Virol. 161(8): 2351–2360.

Alarcon JB, Waine GW, McManus DP. 1999. DNA vaccines: technology and application as

anti-parasite and anti-microbial agents. Adv Parasitol. 42: 343–410.

34

Aldous EW, Collins MS, McGoldrick A, Alexander DJ. 2001. Rapid pathotyping of Newcastle

disease virus (NDV) using fluorogenic probes in a PCR assay. Vet Microbiol. 80(3):

201–212.

Aldous EW, Fuller CM, Mynn JK, Alexander DJ. 2004. A molecular epidemiological

investigation of isolates of the variant avian paramyxovirus type 1 virus (PPMV-1)

responsible for the 1978 to present panzootic in pigeons. Avian Pathol. 33(2): 258-269.

Aldous EW, Mynn JK, Banks J, Alexander DJ. 2003. A molecular epidemiological study of

avian paramyxovirus type 1 (Newcastle disease virus) isolates by phylogenetic analysis

of a partial nucleotide sequence of the fusion protein gene. Avian Pathol. 32(3): 239–256.

Alexander DJ, Aldous EW, Fuller CM. 2012. The long view: a selective review of 40 years of

Newcastle disease research. Avian Pathol. 41(4): 329–335.

Alexander DJ, Bell JG, Alders RG. 2004. A Technology Review: Newcastle Disease—with

Special Emphasis on Its Effects on Village Chickens. Chapter 1–3, Food and Agriculture

Organization of the United Nations, Rome, Italy.

Alexander DJ, Campbell G, Manvell RJ, Collins MS, Parsons G, McNulty MS.

1992.Characterisation of an antigenically unusual virus responsible for two outbreaks of

Newcastle disease in the Republic of Ireland in 1990. Vet Rec. 130(4): 65–68.

Alexander DJ, Senne DA. 2008. Newcastle disease virus and other avian paramyxoviruses. In:

Dufour-Zavala, Swayne DE, Glisson JR et al., editors. A Laboratory Manual for the

Isolation, Identification and Characterization of Avian Pathogens.5th ed. American

Association of Avian Pathologists, Jacksonville, Fla, USA. p. 135-141.

Alexander DJ, Senne DA. 2008. Newcastle Disease, other avian paramyxoviruses, and

pneumovirus infections. In: Saif YM, Fadly AM, Glisson JR, McDougald LR, Nolan LK,

35

Swayne DE, editors. Diseases of Poultry. 12th ed. Iowa State University Press, Ames. p.

75–116.

Alexander DJ, Wilson GW, Russell PH, Lister SA, Parsons G. 1985.Newcastle disease outbreaks

in fowl in Great Britain during 1984. Vet Rec. 117(17): 429-434.

Alexander DJ. 2001. Gordon memorial lecture. Newcastle disease. Br Poult Sci. 42(1): 5-22.

Alexander DJ. 2003. Newcastle disease, other avian paramyxoviruses, and pneumovirus

infections. In: Saif YM, Barnes HJ, Glisson IR, Fadly AM, McDougald JR, Swayne DE,

editors. Disease of Poultry.11th ed. Iowa State University Press Ames. p. 63–87.

Alexander DJ. 2011. Newcastle disease in the European Union 2000 to 2009. Avian Pathol.

40(6): 547-558.

Antal M, Farkas T, German P, Belak S, Kiss I. 2007.Real-time reverse transcription-polymerase

chain reaction detection of Newcastle disease virus using light upon extension

fluorogenic primers. J Vet Diagn Invest. 19(4): 400–404.

Arora P, Lakhchaura BD, Garg SK. 2010. Evaluaion of immunogenic potential of 75kDa and

56kDa proteins of newcastle disease virus (NDV). Indian J Exp Biol. 48(9): 889-895.

Ault A, Zajac AM, Kong WP, Gorres JP, Royals M, Wei CJ, Bao S, Yang ZY, Reedy SE,

Sturgill TL, Page AE, Donofrio-Newman J, Adams AA, Balasuriya UB, Horohov DW,

Chambers TM, Nabel GJ, Rao SS. 2012. Immunogenicity and clinical protection against

equine influenza by DNA vaccination of ponies.Vaccine.30(26): 3965-3974.

Ballagi-Pordany A, Wehmann E, Herczeg J, Belak S, Lomniczi B. 1996. Identification and

grouping of Newcastle disease virus strains by restriction site analysis of a region from

the F gene. Arch Virol. 141(2): 243-261.

36

Bayliss CD, Peters RW, Cook JK, Reece RL, Howes K, Binns MM, Boursnell ME. 1991. A

recombinant fowlpox virus that expresses the VP2 antigen of infectious bursal disease

virus induces protection against mortality caused by the virus. Arch Virol. 120(3-4): 193-

205.

Bergman PJ, McKnight J, Novosad A, Charney S, Farrelly J, Craft D, Wulderk M, Jeffers Y,

Sadelain M, Hohenhaus AE, Segal N, Gregor P, Engelhorn M, Riviere I, Houghton AN,

Wolchok JD. 2003. Long-term survival of dogs with advanced malignant melanoma after

DNA vaccination with xenogeneic human tyrosinase: a phase I trial. Clin Cancer Res.

9(4): 1284-1290.

Biancifiori F, Fioroni A. 1983. An occurrence of Newcastle disease in pigeons: virological and

serological studies on the isolates. Comp Immunol Microbiol Infect Dis. 6(3): 247-252.

Boursnell ME, Green PF, Samson AC, Campbell JI, Deuter A, Peters RW, Millar NS, Emmerson

PT, Binns MM. 1990. A recombinant fowlpox virus expressing the hemagglutinin-

neuraminidase gene of Newcastle disease virus (NDV) protects chickens against

challenge by NDV. Virology. 178(1): 297-300.

Calnek BW, Witter RL. 1991. Marek's disease. 9th ed. Iowa State University Press, Ames, Iowa.

Cardenas-Garcia S, Dunwoody RP, Marcano V, Diel DG, Williams RJ, Gogal RM Jr, Brown

CC, Miller PJ, Afonso CL. 2016. Effects of Chicken Interferon Gamma on Newcastle

Disease Virus Vaccine Immunogenicity.PLoS One. 11(7): e0159153.

doi:10.1371/journal. pone.0159153.

Cardenas-Garcia S, Navarro Lopez R, Morales R, Olvera MA, Marquez MA, Merino R, Miller

PJ, Afonso CL. 2013. Molecular epidemiology of Newcastle disease in Mexico and the

37

potential spillover of viruses from poultry into wild bird species. Appl Environ

Microbiol. 79(16): 4985-4992.

Chuang I, Sedegah M, Cicatelli S, Spring M, Polhemus M, Tamminga C, Patterson N, Guerrero

M, Bennett JW, McGrath S, Ganeshan H, Belmonte M, Farooq F, Abot E, Banania JG,

Huang J, Newcomer R, Rein L, Litilit D, Richie NO, Wood C, Murphy J, Sauerwein R,

Hermsen CC, McCoy AJ, Kamau E, Cummings J, Komisar J, Sutamihardja A, Shi M,

Epstein JE, Maiolatesi S, Tosh D, Limbach K, Angov E, Bergmann-Leither E, Bruder JT,

Doolan DL, King CR, Carucci D, Dutta S, Soisson L, Diggs C, Hollingdale MR,

Ockenhouse CF, Richie TL. 2013. DNA prime/Adenovirus boost malaria vaccine

encoding P. falciparum CSP and AMA1 induces sterile protection associated with cell-

mediated immunity. PLoS One.8(2): e55571. doi: 10.1371/journal.pone.0055571.

Connaris H, Takimoto T, Russell R, Crennell S, Moustafa I, Portner A, Taylor G. 2002. Probing

the sialic acid binding site of the hemagglutinin-neuraminidase of Newcastle disease

virus: Identification of key amino acids involved in cell binding, catalysis, and fusion.J

Virol. 76(4): 1816–1824.

Cornax I, Miller PJ, Afonso CL. 2012. Characterization of live LaSota vaccine strain-induced

protection in chickens upon early challenge with a virulent Newcastle disease virus of

heterologous genotype. Avian Dis. 56(3): 464-470.

Courtney SC, Susta L, Gomez D, Hines NL, Pedersen JC, Brown CC, Miller PJ, Afonso CL.

2013. Highly divergent virulent isolates of Newcastle disease virus from the Dominican

Republic are members of a new genotype that may have evolved unnoticed for over 2

decades. J Clin Microbiol. 51(2): 508–517.

38

Cui H, Gao H, Cui X, Zhao Y, Shi X, Li Q, Yan S, Gao M, Wang M, Liu C, Wang Y. 2013.

Avirulent Marek’s disease virus type 1 strain 814 vectored vaccine expressing avian

influenza (AI) virus H5 haemagglutinin induced better protection than turkey herpesvirus

vectored AI vaccine. PLoS One 8(1): e53340. doi:10.1371/journal.pone.0053340.

Czegledi A, Herczeg J, Hadjiev G, Doumanova L, Wehmann E, Lomniczi B. 2002. The

occurrence of five major Newcastle disease virus genotypes (II, IV, V, VI and VIIb) in

Bulgaria between 1959 and 1996. Epidemiol Infect. 129(3): 679-688.

Czegledi A, Ujvari D, Somogyi E, Wehmann E, Werner O, Lomniczi B. 2006. Third genome

size category of avian paramyxovirus serotype 1 (Newcastle disease virus) and

evolutionary implications. Virus Res. 120(1-2): 36–48.

de Almeida RS, Hammoumi S, Gil P, Briand F-X, Molia S, Gaidet N, Cappelle J, Chevalier V,

Balanca G, Traore A, Grillet C, Maminiaina OF, Guendouz S, Dakouo M, Samake K,

Bezeid Oel M, Diarra A, Chaka H, Goutard F, Thompson P, Martinez D, Jestin V, Albina

E. 2013. New avian paramyxoviruses type I strains identified in Africa provide new

outcomes for phylogeny reconstruction and genotype classification. PLoS

One.8(10):e76413. doi: 10.1371/journal.pone.0076413.

Delmas B et al. 2004. Birnaviridae. In Facquet CM, Mayo MA, Maniloff J, Desselberger U, Ball

AL, editors. Virus taxonomy.Academic Press, London, United Kingdom. p. 561-569.

Desingu PA, Singh SD, Dhama K, Karthik K, Vinodh Kumar OR, Malik YS. 2016. Phylogenetic

analysis of Newcastle disease virus isolates occurring in India during 1989–2013.

Virusdisease. 27(2): 203-206.

39

Diel DG, da Silva LH, Liu H, Wang Z, Miller PJ, Afonso CL. 2012. Genetic diversity of avian

paramyxovirus type 1: proposal for a unified nomenclature and classification system of

Newcastle disease virus genotypes. Infect Genet Evol. 12(8): 1770–1779.

Dortmans JC, Peeters BP, Koch G. 2012. Newcastle disease virus outbreaks: vaccine mismatch

or inadequate application? Vet Microbiol. 160(1-2): 17-22.

Doyle TM. 1927. A hitherto unrecorded disease of fowls due to a filter-passing virus. J Comp

Pathol Ther. 40: 144-169.

Draghia-Akli R, Ellis KM, Hill LA, Malone PB, Fiorotto ML. 2003. High-efficiency growth

hormone-releasing hormone plasmid vector administration into skeletal muscle mediated

by electroporation in pigs. FASEB J. 17(3): 526–528.

Estevez C, Villegas P. 2004. Sequence analysis, viral rescue from infectious clones and

generation of recombinant virions of the avian adeno-associated virus. Virus Res. 105(2):

195–208.

Estevez C, Villegas P. 2006. Recombinant avian adeno-associated virus: transgene expression in

vivo and enhancement of expression in vitro. Avian Dis. 50(2): 216–221.

Farkas T, Szekely E, Belak S, Kiss I. 2009. Real-time PCR-based pathotyping of Newcastle

disease virus by use of TaqMan minor groove binder probes. J Clin Microbiol. 47(7):

2114–2123.

Firouzamandi M, Moeini H, Hosseini D, Bejo MH, Omar AR, Mehrbod P, Ideris A. 2016.

Improved immunogenicity of Newcastle disease virus inactivated vaccine following

DNA vaccination using Newcastle disease virus hemagglutinin-neuraminidase and fusion

protein genes. J Vet Sci. 17(1): 21-26.

40

Fuller C, Löndt B, Dimitrov KM, Lewis N, van Boheemen S, Fouchier R, Coven F, Goujgoulova

G, Haddas R, Brown I. 2015. An Epizootiological Report of the Re-emergence and

Spread of a Lineage of Virulent Newcastle Disease Virus into Eastern

Europe.Transbound Emerg Dis. doi:10.1111/tbed.12455.

Glickman RL, Syddall RJ, Iorio RM, Sheehan JP, Bratt MA. 1988. Quantitative basic residue

requirements in the cleavage-activation site of the fusion glycoprotein as a determinant of

virulence for Newcastle disease virus. J Virol. 62(1): 354–356.

Hasson SSAA, Al-Busaidia JKZ, Sallam TA. 2015. The past, current and future trends in DNA

vaccine immunisations. Asian Pac J Trop Biomed. 5(5): 344–353.

Heckert RA, Elankumaran S, Oshop GL, Vakharia VN. 2002. A novel transcutaneous plasmid-

dimethylsulfoxide delivery technique for avian nucleic acid immunization. Vet Immunol

Immunopathol. 89(1-2): 67–81.

Heckert RA, Riva J, Cook S, McMillen J, Schwartz RD. 1996. Onset of protective immunity in

chicks after vaccination with a recombinant herpesvirus of turkeys vaccine expressing

Newcastle disease virus fusion and hemagglutinin-neuraminidase antigens. Avian Dis.

40(4): 770-777.

Heiden S, Grund C, Röder A, Granzow H, Kühnel D, Mettenleiter TC, Romer-Oberdorfer A.

2014. Different regions of the newcastle disease virus fusion protein modulate

pathogenicity. PLoS One. 9(12): e113344. doi:10.1371/journal.pone.0113344.

Herczeg J, Pascucci S, Massi P, Luini M, Selli L, Capua I, and Lomniczi B. 2001. A longitudinal

study of velogenic Newcastle disease virus genotypes isolated in Italy between 1960 and

2000.Avian Pathol. 30(2): 163-168.

41

Herczeg J, Wehmann E, Bragg RR, Travassos Dias PM, Hadjiev G, Werner O, Lomniczi B.

1999. Two novel genetic groups (VIIb and VIII) responsible for recent Newcastle disease

outbreaks in Southern Africa, one (VIIb) of which reached Southern Europe.Arch Virol.

144(11): 2087-2099.

Hugh-Jones M, Allan WH, Dark FA, Harper GJ. 1973. The evidence for the airborne spread of

Newcastle disease. J Hyg (Lond). 71(2): 325–339.

Jestin V, Jestin A. 1991. Detection of Newcastle disease virus RNA in infected allantoic fluids

by in vitro enzymatic amplification (PCR). Arch Virol. 118(3-4): 151–161.

Jindal N, Chander Y, Chockalingam AK, de Abin M, Redig PT, Goyal SM. 2009. Phylogenetic

analysis of Newcastle disease viruses isolated from waterfowl in the upper midwest

region of the United States. Virol J. 6: 191 doi: 10.1186/1743-422X-6-191.

Kaleta EF, Baldeuf C. 1988. Newcastle disease in free-living and pet birds. In: Alexander DJ,

editor. Newcastle Disease.Kluwer Academic Publishers, Boston. p. 197–246.

Kanabaqatte Basavarajappa KM, Kumar S, Khattar SK, Gebreluul GT, Paldurai A, Samal SK.

2014. A recombinant Newcastle disease virus (NDV) expressing infectious

laryngotracheitis virus (ILTV) surface glycoprotein D protects against highly virulent

ILTV and NDV challenges in chickens. Vaccine. 32(28): 3555-3563.

Kapczynski DR, King DJ. 2005. Protection of chickens against overt clinical disease and

determination of viral shedding following vaccination with commercially available

Newcastle disease virus vaccines upon challenge with highly virulent virus from the

California 2002 exotic Newcastle disease outbreak. Vaccine. 23(26): 3424-3433.

42

Khan TA, Rue CA, Rehmani SF, Ahmed A, Wasilenko JL, Miller PJ, Afonso CL. 2010.

Phylogenetic and biological characterization of Newcastle disease virus isolates from

Pakistan. J Clin Microbiol. 48(5): 1892–1894.

Kho CL, Mohd-Azmi ML, Arshad SS, Yusoff K. 2000.Performance of an RT-nested PCR

ELISA for detection of Newcastle disease virus.J Virol Methods.86(1): 71–83.

Kim LM, Afonso CL, Suarez DL. 2006. Effect of probe-site mismatches on detection of virulent

Newcastle disease viruses using a fusion-gene real-time reverse transcription polymerase

chain reaction test. J Vet Diagn Invest. 18(6): 519–528.

Kim LM, King DJ, Curry PE, Suarez D, Swayne DE, Stallknecht DE, Slemons RD, Pedersen JC,

Senne DA, Winker K, Afonso CL. 2007. Phylogenetic diversity among low-virulence

Newcastle disease viruses from waterfowl and shorebirds and comparison of genotype

distributions to those of poultry-origin isolates. J Virol. 81(22): 12641–12653.

Kim LM, King DJ, Guzman H, Tesh RB, Travassos da Rossa AP, Bueno R Jr, Dennet JA,

Afonso CL. 2008a. Biological and phylogenetic characterization of pigeon

paramyxovirus serotype 1 circulating in wild North American pigeons and doves. J Clin

Microbiol. 46(10): 3303–3310.

Kim LM, King DJ, Suarez DL, Wong CW, Afonso CL. 2007. Characterization of class I

Newcastle disease virus isolates from Hong Kong live bird markets and detection using

real-time reverse transcription-PCR. J Clin Microbiol. 45(4): 1310–1314.

Kraneveld FC. 1926. A poultry disease in the Dutch East Indies. Nederlands-Indische Bladen

voor Diergeneeskunde 8: 448-450.

Lewis PJ, Babiuk LA. 1999. DNA vaccines: a review. Adv Virus Res. 54: 129–188.

43

Li K, Gao L, Gao H, Qi X, Gao Y, Qin L, Wang Y, Wang X. 2014. Recombinant infectious

bursal disease virus expressing Newcastle disease virus (NDV) neutralizing epitope

confers partial protection against virulent NDV challenge in chickens. Antiviral Res.

101:1–11.

Li Q, Xue C, Qin J, Zhou Q, Chen F, Bi Y, Cao Y. 2009. An improved reverse transcription

loop-mediated isothermal amplification assay for sensitive and specific detection of

Newcastle disease virus.Arch Virol. 154(9): 1433–1440.

Li X, Chai T, Wang Z, Song C, Cao H, Liu J, Zhang X, Wang W, Yao M, Miao Z. 2009.

Occurrence and transmission of Newcastle disease virus aerosol originating from infected

chickens under experimental conditions. Vet Microbiol. 136(3-4): 226–232.

Liang R, Cao DJ, Li JQ, Chen J, Guo X, Zhuang FF, Duan MX. 2002. Newcastle disease

outbreaks in western China were caused by the genotypes VIIa and VIII. Vet Microbiol.

87(3): 193-203.

Liao JC, Gregor P, Wolchok JD, Orlandi F, Craft D, Leung C, Houghton AN, Bergman PJ. 2006.

vaccination with human tyrosinase DNA induces antibody responses in dogs with

advanced melanoma. Cancer Immun. 6: 8.

Lien YY, Lee JW, Su HY, Tsai HJ, Tsai MC, Hsieh CY, Tsai SS. 2007. Phylogenetic

characterization of Newcastle disease viruses isolated in Taiwan during 2003-2006. Vet

Microbiol. 123(1-3): 194-202.

Liu H, Wang Z, Wu Y, Zheng D, Sun C, Bi D, Zuo Y, Xu T. 2007. Molecular epidemiological

analysis of Newcastle disease virus isolated in China in 2005.J Virol Methods. 140(1-2):

206-211.

Liu MA. 2003. DNA vaccines: a review. J Intern Med. 253(4): 402-410.

44

Liu XF, Wan HQ, Ni XX, Wu YT, Liu WB. 2003. Pathotypical and genotypical characterization

of strains of Newcastle disease virus isolated from outbreaks in chicken and goose flocks

in some regions of China during 1985-2001. Arch Virol. 148(7):1387-1403.

Loke CF, Omar AR, Raha AR, Yusoff K. 2005.Improved protection from velogenic Newcastle

disease virus challenge following multiple immunizations with plasmid DNA encoding

for F and HN genes. Vet Immunol Immunopathol. 106(3-4): 259–267.

Lomniczi B, Wehmann E, Herczeg J, Ballagi-Pordany A, Kaleta EF, Werner O, Meulemans G,

Jorgensen PH, Mante AP, Gielkens AL, Capua I, Damoser J. 1998. Newcastle disease

outbreaks in recent years in western Europe were caused by an old (VI) and a novel

genotype (VII). Arch Virol. 143(1): 49-64.

Lukert PD, Saif YM. 1991. Infectious bursal disease. In: Calnek BW, Barnes HJ, Beard CW,

Reid WM, Yoder Jr. HW, editors. Diseases of poultry. Iowa State University Press,

Ames. p. 648-663.

Marangon S, Busani L. 2007. The use of vaccination in poultry production. Rev Sci Tech. 26(1):

265-274.

Mayo MA. 2002. A summary of taxonomic changes recently approved by ICTV. Arch Virol.

147(8): 1655– 1663.

Mayo MA. 2002. Virus taxonomy—Houston 2002. Arch Virol. 147(5): 1071–1076.

McFerran. 1989. Control of Newcastle disease in Northern Ireland. In: Proceedings of the Avian

Exotic Disease Control Seminar. Animal Health Report 2, NSW Agriculture and

Fisheries, Glenfield, NSW, Australia. p. 16–21.

McMillen JK, Cochran MD, Junker DE, Reddy DN, Valencia DM. 1994.The safe and effective

use of fowlpox virus as a vector for poultry vaccines.Dev biol Stand.82: 137-145.

45

Mia Kim L, Suarez DL, Afonso CL. 2008. Detection of a broad range of class I and II Newcastle

disease viruses using a multiplex real-time reverse transcription polymerase chain

reaction assay. J Vet Diagn Invest. 20(4): 414–425.

Miller PJ, Decanini EL, Afonso CL. 2010. Newcastle disease: evolution of genotypes and the

related diagnostic challenges. Infect Genet Evol. 10(1): 26–35.

Miller PJ, Estevez C, Yu Q, Suarez DL, King DJ. 2009. Comparison of viral shedding following

vaccination with inactivated and live Newcastle disease vaccines formulated with wild-

type and recombinant viruses. Avian Dis. 53(1): 39–49.

Miller PJ, Haddas R, Simanov L, Lublin A, Rehmani SF, Wajid A, Bibi T, Khan TA, Yaqub T,

Setiyaningsih S, Afonso CL. 2015. Identification of new sub-genotypes of virulent

Newcastle disease virus with potential panzootic features. Infect Genet Evol. 29: 216 –

229.

Miller PJ, Kim LM, Ip HS, Afonso CL. 2009.Evolutionary dynamics of Newcastle disease

virus.Virology. 391(1): 64–72.

Miller PJ, King DJ, Afonso CL, Suarez DL. 2007. Antigenic differences among Newcastle

disease virus strains of different genotypes used in vaccine formulation affect viral

shedding after a virulent challenge. Vaccine. 25(41): 7238–7246.

MORGAN et al. 1992. Avian Dis. 36: 858 – 870.

MORGAN et al. 1993. Avian Dis. 37: 1032 – 1040.

Muzyczka NAKB. 2001. Parvoviridae: the viruses and their replication. In: Field’s virology

Knipe DAHPE, editor. Lippincott-Raven, Philadelphia, PA. p. 2327–2379.

46

Nanthakumar T, Kataria RS, Tiwari AK, Butchaiah G, Kataria JM. 2000. Pathotyping of

Newcastle disease viruses by RT-PCR and restriction enzyme analysis. Vet Res

Commun. 24(4): 275–286.

Ogawa R, Yanagida N, Saeki S, Saito S, Ohkawa S, Gotoh H, Kodama K, Kamogawa K,

Sawaguchi K, Iritani Y. 1990. Recombinant fowlpox viruses inducing protective

immunity against Newcastle disease and fowlpox viruses. Vaccine. 8(5): 486–490.

OIE. 2012. Manual of diagnostic tests and vaccines for terrestrial animals: mammals, birds and

bees. In: Biological Standards Commission. World Organization for Animal Health,

Paris. p. 1–19.

Palya V, Kiss I, Tatár-Kis T, Mató T, Felföldi B, Gardin Y. 2012. Advancement in vaccination

against Newcastle disease: recombinant HVT NDV provides high clinical protection and

reduces challenge virus shedding with the absence of vaccine reactions. Avian Dis. 56(2):

282–287.

Paoletti E. 1996. Applications of pox virus vectors to vaccination: an update. Proc Natl Acad Sci

U S A. 93(21): 11349-11353.

Pereira VB, Zurita-Turk M, Saraiva TDL, De Castro CP, Souza BM, Agresti PM, Lima FA,

Pfeiffer VN, Azevedo MSP, Rocha CS, Pontes DS, Azevedo V, Miyoshi A. 2014. DNA

Vaccines Approach: From Concepts to Applications. WJV. 4: 50-71.

Perozo F, Merino R, Afonso CL, Villegas P, Calderon N. 2008. Biological and phylogenetic

characterization of virulent Newcastle disease virus circulating in Mexico. Avian Dis.

52(3): 472-479.

47

Perozo F, Villegas P, Estevez C, Alvarado IR, Purvis LB, Saume E. 2008. Avian adeno-

associated virus-based expression of Newcastle disease virus hemagglutinin-

neuraminidase protein for poultry vaccination. Avian Dis. 52(2): 253–259.

Pham HMa, Nakajima C, Ohashi K, Onuma M. 2005. Loop-mediated isothermal amplification

for rapid detection of Newcastle disease virus.J Clin Microbiol. 43(4): 1646–1650.

Pham HMb, Konnai S, Usui T, Chang KS, Murata S, Mase M, Ohashi K, Onuma M. 2005. Rapid

detection and differentiation of Newcastle disease virus by real-time PCR with melting-

curve analysis.Arch Virol. 150(12): 2429–2438.

Rajawat YS, Sundaresan NR, Ravindra PV, Kantaraja C, Ratta B, Sudhagar M, Rai A, Saxena

VK, Palia SK, Tiwari AK. 2008. Immune responses induced by DNA vaccines encoding

Newcastle virus haemagglutinin and/or fusion proteins in maternal antibody-positive

commercial broiler chicken. Br Poul Sci. 49(2): 111—117.

Reddy SK, Sharma JM, Ahmad J, Reddy DN, McMillen JK, Cook SM, Wild MA, Schwartz RD.

1996. Protective efficacy of a recombinant herpesvirus of turkeys as an in ovo vaccine

against Newcastle and Marek’s diseases in specific-pathogen-free chickens.Vaccine.

14(6): 469–477.

Rehmani SF, Wajid A, Bibi T, Nazir B, Mukhtar N, Hussain A, Lone NA, Yaqub T, Afonso CL.

2015. Presence of virulent Newcastle disease virus in vaccinated chickens in farms in

Pakistan.J Clin Microbiol. 53(5): 1715–1718.

Robinson HL, Pertmer TM. 2000. DNA vaccines for viral infections: basic studies and

applications. Adv Virus Res. 55: 1–74.

Rue CA, Susta L, Brown CC, Pasick JM, Swafford SR, Wolf PC, Killian ML, Pedersen JC,

Miller PJ, Afonso CL. 2010. Evolutionary changes affecting rapid identification of 2008

48

Newcastle disease viruses isolated from double-crested cormorants.J Clin Microbiol.

48(7): 2440–2448.

Saif YM, Fadly AM, Glisson JR, McDougald LR. 2008. Newcastle disease, other avian

paramyxoviruses, and pneumovirus infections. In: Diseases of Poultry. 12th ed. Blackwell

Publishing Professional, Ames, Iowa, USA. p. 75-93.

Sakaguchi M, Nakamura H, Sonoda K, Hamada F, Hirai K. 1996. Protection of chickens from

Newcastle disease by vaccination with a linear plasmid DNA expressing the F protein of

Newcastle disease virus.Vaccine. 14(8): 747–752.

Sawant PM, Verma PC, Subudhi PK, Chaturvedi U, Singh M, Kumar R, Tiwari AK. 2011.

Immunomodulation of bivalent Newcastle disease DNA vaccine induced immune

response by co-delivery of chicken IFN-Ƴ and IL-4 genes. Vet Immunol Immunopathol.

144(1-2): 36-44.

Seal BS, King DJ, Bennett JD. 1995. Characterization of Newcastle-disease virus isolates by

reverse transcription PCR coupled to direct nucleotide sequencing and development of

sequence database for pathotype prediction and molecular epidemiological analysis. J

Clin Microbiol. 33(10): 2624–2630.

Seal BS, King DJ, Sellers HS. 2000. The avian response to Newcastle disease virus. Dev Comp

Immunol. 24(2-3): 257–268.

Snoeck CJ, Ducatez MF, Owoade AA, Faleke OO, Alkali BR, Tahita MC, Tarnagda Z,

Ouedraogo JB, Maikano I, Mbah PO, Kremer JR, Muller CP. 2009. Newcastle disease

virus in West Africa: new virulent strains identified in non-commercial farms. Arch

Virol. 154(1): 47–54.

49

Snoeck CJ, Owoade AA, Couacy-Hymann E, Alkali BR, Okwen MP, Adeyanju AT, Komoyo

GF, Nakouné E, Le Faou A, Muller CP. 2013. High genetic diversity of Newcastle

disease virus in poultry in West and Central Africa: cocirculation of genotype XIV and

newly defined genotypes XVII and XVIII. J Clin Microbiol. 51(7): 2250–2260.

Snyder RO, Francis J. 2005. Adeno-associated viral vectors for clinical gene transfer studies.

Curr Gene Ther. 5(3): 311–321.

Snyder RO. 1999. Adeno-associated virus-mediated gene delivery. J Gene Med. 1: 166–175.

Sondermeijer PJ, Claessens JA, Jenniskens PE, Mockett AP, Thijssen RA, Willemse MJ,

Morgan RW. 1993. Avian herpesvirus as a live viral vector for the expression of

heterologous antigens. Vaccine. 11(3): 349-358.

Steward M, Vipond IB, Millar NS, Emmerson PT. 1993. RNA editing in Newcastle disease

virus.J Gen Virol. 74(Pt 12): 2539–2547.

Sun HL, Wang YF, Miao DY, Zhang PJ, Zhi HD, Xu LL, Wang M, Tong GZ, Wang M. 2006.

Construction and characterization of a recombinant fowlpox virus co-expressing F, HN

genes of Newcastle disease virus and gB gene of infectious larygnotracheitis virus. Sheng

Wu Gong Cheng Xue Bao. 22(6): 931–939.

Sun HL, Wang YF, Tong GZ, Zhang PJ, Miao DY, Zhi HD, Wang M, Wang M. 2008.

Protection of chickens from Newcastle disease and infectious laryngotracheitis with a

recombinant fowlpox virus co-expressing the F, HN genes of Newcastle disease virus and

gB gene of infectious laryngotracheitis virus. Avian Dis. 52(1): 111–117.

Susta L, Hamal KR, Miller PJ, Cardenas-Garcia S, Brown CC, Pedersen JC, Gongora V, Afonso

CL. 2014. Separate evolution of virulent newcastle disease viruses from Mexico and

Central America. J Clin Microbiol. 52(5): 1382-1390.

50

Tarpey I, van Loon AA, de Haas N, Davis PJ, Orbell S, Cavanagh D, Britton P, Casais R,

Sondermeijer P, Sundick R. 2007. A recombinant turkey herpesvirus expressing chicken

interleukin-2 increases the protection provided by in ovo vaccination with infectious

bursal disease and infectious bronchitis virus. Vaccine. 25(51): 8529-8535.

Taylor J, Christensen L, Gettig R, Goebel J, Bouquet JF, Mickle TR, Paoletti E. 1996. Efficacy

of a recombinant fowl pox-based Newcastle disease virus vaccine candidate against

velogenic and repiratory challenge. Avian Dis. 40(1): 173–180.

Taylor J, Edbauer CE, Rey-Senelonge A, Bouquet JF, Noroton E, Goebel S, Desmettre P,

Paoletti E. 1990. Newcastle disease virus fusion protein expressed in a fowlpox virus

recombinant confers protection in chickens. J Virol. 64(4): 1441-1450.

Taylor J, Weinberg R, Kawaoka Y, Webster RG, Paoletti E. 1988. Protective immunity against

avian influenza induced by a fowlpox virus recombinant.Vaccine. 6(6): 504-508.

Tripathy DN, Schnitzlein WM, Morris PJ, Janssen DL, Zuba JK, Massey G, Atkinson CT. 2000.

Characterization of poxviruses from forest birds in Hawaii. J Wildl Dis. 36(2): 225-230.

Tsai HJ, Chang KH, Tseng CH, Frost KM, Manvell RJ, Alexander DJ. 2004. Antigenic and

genotypical characterization of Newcastle disease viruses isolated in Taiwan between

1969 and 1996. Vet Microbiol. 104(1-2): 19-30.

Ujvari D, Wehmann E, Kaleta EF, Werner O, Savic V, Nagy E, Czifra G, Lomniczi B. 2003.

Phylogenetic analysis reveals extensive evolution of avian paramyxovirus type 1 strains

of pigeons (Columba livia) and suggests multiple species transmission. Virus Res. 96(1-

2): 63-73.

Upadhyay C, Ammayappan A, Patel D, Kovesdi I, Vakharia VN. 2011. Recombinant infectious

bursal disease virus carrying hepatitis C virus epitopes. J Virol. 85(3): 1408–1414.

51

Uzzau S, Marogna G, Leori GS, Curtiss R 3rd, Schianchi G, Stocker BA, Rubino S. 2005.

Virulence attenuation and live vaccine potential of aroA, crp cdt cya, and plasmid-cured

mutants of Salmonella enterica serovar Abortusovis in mice and sheep. Infect Immun.

73(7): 4302-4308.

Wahren B, Liu MA. 2014. DNA Vaccines: recent developments and the future. Vaccines. 2(4):

785-796.

Wajid A, Wasim M, Rehmani SF, Bibi T, Ahmed N, Afonso CL. 2015. Complete genome

sequence of a recent panzootic virulent Newcastle disease virus from Pakistan. Genome

Announc.3(3).pii: e00658-15. doi: 10.1128/genomeA.00658-15.

Wajid Aa, Rehmani SF, Wasim M, Basharat A, Bibi T, Arif S, Dimitrov KM, Afonso CL. 2016.

Complete genome sequence of a virulent Newcastle disease virus strain isolated from a

clinically healthy duck (Anas platyrhynchos domesticus) in Pakistan. Genome

Announc.4(4).pii: e00730-16. doi:10.1128/genomeA.00730-16.

Wajid Ab, Rehmani SF, Sharma P, Goraichuk IV, Dimitrov KM, Afonso CL. 2016. Complete

genome sequence of genotype VI Newcastle disease viruses isolated from pigeons in

Pakistan. Genome Announc.4(4).pii: e00845-16. doi:10.1128/genomeA.00845-16.

Wehmann E, Ujvari D, Mazija H, Velhner M, Ciglar-Grozdanic I, Savic V, Jermolenko G, Cac

Z, Prukner-Radovcic E, Lomniczi B. 2003. Genetic analysis of Newcastle disease virus

strains isolated in Bosnia-Herzegovina, Croatia, Slovenia and Yugoslavia, reveals the

presence of only a single genotype, V, between 1979 and 2002. Vet Microbiol. 94(4):

269-281.

Weli SC, Tryland M. 2011. Avipoxviruses: infection biology and their use as vaccine vectors.

Virol J. 8:49.

52

Witter RL, Solomon JJ. 1972. Experimental infection of turkeys and chickens with a herpesvirus

of turkeys (HVT). Avian Dis. 16(1): 34–44.

World Organization for Animal Health (OIE). 2012. Newcastle disease. In Manual of diagnostic

tests and vaccines for terrestrial animals.7th ed. World Organization for Animal Health,

Paris, France. p. 1-19.

Wright JF, Qu G, Tang C, Sommer JM. 2003. Recombinant adeno-associated virus: formulation

challenges and strategies for a gene therapy vector. Curr Opin Drug Discov Devel. 6(2):

174–178.

Yu L, Wang Z, Jiang Y, Chang L, Kwang J. 2001. Characterization of newly emerging

Newcastle disease virus isolates from the People's Republic of China and Taiwan. J Clin

Microbiol. 39(10): 3512-3519.

Zhao W, Spatz S, Zhang Z, Wen G, Garcia M, Zsak L, Yu Q. 2014. Newcastle disease virus

(NDV) recombinants expressing infectious laryngotracheitis virus (ILTV) glycoproteins

gB and gD protect chickens against ILTV and NDV challenges. J Virol. 88(15): 8397-

8406.

53

CHAPTER 3

EXPERIMENT 1

Repeated isolation of virulent Newcastle disease viruses in poultry and captive non-poultry

avian species in Pakistan from 2011 to 2016

Abdul Wajida,b, Kiril M. Dimitrovc, Muhammad Wasima, Shafqat Fatima Rehmanib, Asma

Basharatb, Tasra Bibib, Saima Arifb, Tahir Yaqubd, Muhammad Tayyaba, Mustafa Ababnehe,

Poonam Sharmac, Patti J. Millerc, Claudio L. Afonsoc*

aInstitute of Biochemistry and Biotechnology (IBBt), University of Veterinary and Animal

Sciences, Lahore, Pakistan

bQuality Operations Laboratory (QOL), University of Veterinary and Animal Sciences, Lahore,

Pakistan

cExotic and Emerging Avian Viral Disease Research Unit, Southeast Poultry Research

Laboratory, US National Poultry Research Laboratory, ARS, USDA, Athens, Georgia, USA

dDepartment of Microbiology, University of Veterinary and Animal Sciences, Lahore, Pakistan

eFaculty of Veterinary Medicine, Jordan University of Science and Technology, Irbid, Jordan

Running head: Virulent NDV in Pakistani poultry and captive pet birds

*Corresponding author E-mail address: Claudio.Afonso@ars.usda.gov

Telephone: (706) 546-3642; Fax: (706) 546-3161

Published in: Preventive Veterinary Medicine 142 (2017) 1–6

54

Abstract

Virulent viruses of the panzootic Newcastle disease virus of sub-genotype VIIi were repeatedly

isolated (2011-2016) from commercial chickens and from multiple non-poultry avian species in

Pakistan. These findings provide evidence for the existence of epidemiological links between

Newcastle disease outbreaks in commercial poultry and infections with virulent NDV strains in

other avian species kept in proximity to poultry. Our results suggest that the endemicity of

Newcastle disease in Pakistan involves multiple hosts and environments.

Keywords

Newcastle disease virus; NDV; APMV-1; Pakistan; captive birds; epidemiology; endemicity

Introduction

Newcastle disease (NDi) is a highly contagious and fatal disease affecting poultry and a wide

range of wild birds worldwide that is caused by infections with virulent strains of Newcastle

disease virus (NDVii) (Miller et al. 2010)(Miller et al. 2010; Dimitrov et al. 2016c). Despite

intensive vaccination, endemicity of ND is a significant problem across Asia, Africa, and Central

America. Recent reports have documented that some of the newly identified viruses of sub-

genotype VIIi are rapidly spreading from Southeast Asia, into the Middle East, to Eastern Europe

and North Africa and can cause mortality in poorly vaccinated poultry(Miller et al. 2015b;

Rehmani et al. 2015; Dimitrov et al. 2016c). The presence of virulent viruses in vaccinated birds

in commercial farms (Rehmani et al. 2015) and their constant evolution over time (Miller et al.

2009) suggest the existence of a high environmental viral load with continuous replication of

these virulent NDV strains in endemic countries. However, the nature of the endemicity and the

mechanisms of panzootic viral spread for NDV are largely unknown.

55

For the successful control of ND it is important to identify the factors that contribute to its

endemicity. The spillover (in the current paper the term “spillover” is used as the bi-directional

transmission of closely related NDV) of NDV between poultry and wild bird species has been

reported previously (Vidanovic et al. 2011; Cardenas Garcia et al. 2013; Ayala et al. 2016).

Exotic birds kept in captivity and pet birds have also been infected with virulent NDV strains

(Nolen, 2002; Pedersen et al., 2004) and are considered a biosecurity threat to domestic and

commercial chickens. Avian influenza studies have identified wild bird species that could be

considered “bridge hosts” for the transmission of viruses between poultry and wild birds (Caron

et al. 2014; Caron et al. 2015). We have recently shown that backyard chickens are an important

component in the circulation of genotype VII virulent NDVs in Bulgaria and Ukraine (Dimitrov

et al. 2016b).

Pakistan presents a unique opportunity to study mechanisms of viral maintenance and spread in

endemic countries. In Pakistan, ND was first detected in 1963 (Khan and Huq, 1963) and since

then outbreaks have been observed repeatedly in both commercial and backyard poultry flocks.

There is a wide variety of non-poultry birds (both free-living and kept in captivity) in Pakistan;

however, limited information is available concerning the potential role of these avian species in

the dissemination of NDV. To understand the relationship among the circulating viruses and to

identify the avian species and the husbandry systems that might contribute to ND endemicity, we

have isolated and characterized NDV from different avian species and production systems in

Pakistan over a five year period. Here, we describe the repeated isolation of highly related

virulent NDV strains from poultry, non-poultry species kept in captivity, and wild birds

(chickens, pheasants, peafowls, pigeons, exotic parakeets [Australian parakeets locally known as

56

Bajri], and Black Swan) at multiple locations and in different types and sizes of flocks in

Pakistan between 2011 and 2016.

Materials and methods

Sample collection, clinical observation and pathogenicity tests

Samples from sick or dead birds from broiler and layer commercial poultry farms, along with

additional information, were collected from flocks experiencing either above average mortality

or appearance of clinical signs ND-like disease. The samples from non-poultry species were

collected from birds kept in captivity in zoo or farm exhibitions, as family pets, or as racing

birds, except for one free-living pigeon. The samples from the Zoo Park were collected during

routine visits by the Veterinary Officer from zoo birds with clinical signs of ND under

quarantine at the zoo. Backyard samples were collected across different neighborhood

experiencing increased poultry mortality.

In total, between 2011 and 2016, 52 NDV were isolated; 21 from non-poultry species and 31

from poultry. The latter were isolated from either vaccinated commercial flocks or non-

vaccinated backyard chickens. Detailed information on the isolates is presented in Supplemental

Table S3.1. Twenty one of the isolates (marked with asterisks in Supplemental Table S3.1) were

submitted to the Southeast Poultry Research Laboratory (SEPRL) of the USDA in Athens, GA

and 20 of them underwent evaluation to establish intracerebral pathogenicity index (ICPIiii)

values following routine procedures (OIE, 2012). Following the same procedure, the

pathogenicity of eight additional viruses was assessed by intracerebral inoculation of NDV- and

AIViv-free 1-day-old chickens at University of Veterinary and Animal Sciences, Lahore,

Pakistan (UVASv) (marked with # in Supplemental Table S4.1).

57

Figure 3.1: Locations in Pakistan where the studied Newcastle disease viruses were isolated.

The provided scale bar is not valid for the general map of Pakistan in the top left corner of the

figure.

RNA extraction and sequencing

For the samples analyzed at SEPRL viral RNA was isolated from the allantoic fluid using TRIzol

LS reagent (Invitrogen, USA) and the QIAamp RNA viral mini kit (Qiagen, USA) and further

processed by next-generation sequencingas reported by Shittuet al.(Shittu et al. 2016). Thirty

one samples were analyzed at UVAS and viral RNA was extracted from infected allantoic fluid

using the TRIzol LS reagent (Invitrogen, USA) following the manufacturer's instructions.

58

Sequencing of the complete coding region of the fusion (F) protein gene was performed as

described previously (Munir et al. 2010; Miller et al. 2015a; Miller et al. 2015b).

Phylogenetic analyses

All available complete F-gene coding sequences of class II NDV (n=1542) were downloaded

from GenBank(Benson et al. 2015) as of September 2016 and analyzed together with the

sequences obtained in the current study. A smaller dataset of closely related previously

characterized NDV (n=19) and the isolates sequenced here (n=52), were further analyzed

phylogenetically using MEGA6 (Tamura et al. 2013). For comparison purposes, five additional

sequences of more distant genotype VII viruses were also added. The evolutionary history was

inferred by using the Maximum Likelihood method based on the Tamura-3 model, selected by

corrected Akaike Information Criterion, with 1000 bootstrap replicates as implemented in

MEGA6 (Tamura, 1992). Evolutionary analyses were conducted in MEGA6 (Tamura et al.,

2013).

Results

Clinical signs and in vivo characterization

Number of dead birds and clinical signs varied widely in different flocks and species with some

large vaccinated chicken flocks and non-vaccinated pet birds showing high numbers of survivors

(Supplemental Table S3.1). Infected birds of different species were of different ages and isolated

at different locations (Figure 3.1). Infected birds presented with respiratory, neurological and/or

enteric clinical signs typical for ND. In pheasants respiratory signs and greenish diarrhea were

observed. Diseased peafowls showed nervous signs with torticollis, tremors, disorientation and

weakness and a few birds also had wing and leg paralysis. Upon post mortem examination

hyperemic and hemorrhagic spleens were found. In parakeets no clinical signs except sudden

59

death were observed. Infected pigeons had tremor and torticollis that are typical for the disease in

this species (Vindevogel and Duchatel, 1988). The infected Black Swan had depression and

greenish watery diarrhea along with nervous signs including circular movements of the neck and

head 4 to 5 hours prior to death. Birds in vaccinated poultry flocks showed clinical signs typical

for ND (Miller and Koch, 2013).

In pathogenicity studies performed with SPF chickens (Supplemental Table S3.1) 20 selected

viruses presented ICPI assay values between 1.75 and 1.96, typical for velogenic NDV

(Alexander and Swayne, 1998) and demonstrating that there was no increase in virulence of the

NDV strains obtained from the non-poultry species. Host-related patterns relating to the ICPI

values were not observed. All of the viruses whose pathogenicity was tested in NDV- and AIV-

free 1-day-old chickens caused severe clinical signs and death within 2-3 days post inoculation

for all inoculated birds, also suggesting the presence of virulent NDV.

Molecular characterization and epidemiology

The amino acid sequence at the cleavage site of the fusion protein of all studied viruses was

found to be typical for virulent NDV strains with three basic amino acids between position 113

and 116 and a phenylalanine at position 117 (113RQKR↓F117) (OIE, 2012) and consistent with the

determined ICPI values. The distance and phylogenetic analyses compared the complete F-gene

of these and other viruses that circulated previously in Pakistan. The nucleotide distance between

most of the viruses from captive non-poultry species and those from poultry varied between

0.1% and 0.9% with some of the viruses being almost identical (0.1% to 0.3%). Based on

specific criteria set by Dielet al.(Diel et al. 2012) all of the studied isolates (bold font in the

phylogenetic tree) were classified as members of sub-genotype VIIi (Fig. 2). The constructed

phylogenetic tree demonstrates the very close phylogenetic relationship between virulent NDV

60

from poultry and viruses from pet or other non-avian species kept in captivity during a period of

five years. Most of the NDV isolates from captive birds grouped in monophyletic branches

together with the viruses from chickens. In addition, two clearly distinct branches (1.4%

nucleotide distance) of viruses from different species were identified and highlighted in boxes in

the phylogenetic tree (Fig. 2). While the first branch contained viruses isolated between 2011 and

2016 predominantly from pigeons and chickens, the second branch consisted of viruses mainly

from peafowl and chickens from 2013 to 2015.

61

62

Figure 3.2. Maximum likelihood phylogenetic tree of the fusion protein gene complete coding

sequences of the Newcastle disease viruses isolated in Pakistan between 2011 and 2016 from

poultry and non-poultry avian species.The tree with the highest log likelihood (-7775.3243) is

shown. The Roman numerals presented in the taxa names in the phylogenetic tree represent the

respective genotype for each isolate, followed by the GenBankaccession number, host name (if

available), year of isolation, strain designation and country of isolation. Embolden taxa were

sequenced in the present study. Taxa enclosed in highlighted boxes have higher genetic distance

between them (1.4% nucleotide distance).

Accession numbers

The complete F-gene sequences (n=52) of virulent NDV obtained in this study were submitted to

GenBank and are available under the accession numbers KU862283 to KU862296, KX496962 to

KX496967, KX791183 and KY076030 to KY076044.

Discussion

Infection with virulent NDV in captive non-poultry species of birds has been previously reported

in Pakistan and other countries; however, most studies have reported outbreaks that occurred

over short period of time and were considered to be caused by accidental spillover from a poultry

outbreak (Seal et al. 1998; Vijayarani et al. 2010; Shabbir et al. 2012; Cardenas Garcia et al.

2013; Kumar et al. 2013; Dimitrov et al. 2016c). Here, over a five year period, we demonstrated

the repeated isolation of genetically very closely related virulent NDV strains from domestic and

commercial poultry and captive non-poultry birds. These viruses were mostly isolated from

samples taken from locations with increased mortality of poultry or clinical signs of ND-like

disease, but in a few instances were from farms and zoos with lower numbers of dead poultry

63

(Supplemental Table S3.1). Interestingly, phylogenetic evaluation of the viruses isolated during

this period demonstrates the existence of clades of highly related viruses infecting different

species and different types of production systems (see highlighted boxes in phylogenetic tree,

Fig. 3.2).

These new data point to a significant role of non-poultry species kept in captivity in the same

vicinity as poultry in the circulation of NDV in Pakistan.It is unclear if each one of these cases

corresponds to a specific spillover event from poultry farms or from other unknown reservoirs.

However, the high similarity of sequences (above 99.7 %) and the close distances separating

some poultry farms to sites of isolation in pet birds and backyard birds point to the existence of

epidemiological connections (Figure 3.1). The continuous circulation of NDV in non-poultry

species suggests the need to develop additional control strategies that would include active

surveillance in pet rearing sites and or sites in which exhibition birds and wild birds are kept in

captivity (e.g. zoos and parks). Recently, wild birds species that are more likely to be in contact

with poultry (“bridge hosts”) have been identified in avian influenza transmission studies (Caron

et al. 2014). A similar type of study would be needed to better understand the dynamics of

transmission of Newcastle disease viruses. The grouping of peafowl with poultry isolates during

2013-2015 suggests the interaction of these two groups of birds and is an example of an area

where increased knowledge and biosecurity parameters could be enacted to prevent the

transmission of NDV between the two groups of birds. The demonstration of clinical signs and

the first isolation of virulent NDV in a Black Swan suggest that the range of possible hosts may

be extending.

The epidemiological situation observed in Pakistan is likely to be similar to that of many

countries in the developing world. Asia, Africa and Latin America are currently undergoing

64

extensive transformation on their protein production systems toward intensive poultry farming.

Large farms without adequate biosecurity are often surrounded by existing rudimentary

production systems such as backyard flocks or non-poultry avian species kept for other reasons.

Among these, backyard poultry has played and still does play a significant role in the economy

of the villagers in rural areas where it is primarily kept for the production of meat and eggs. The

majority of backyard poultry farming in Pakistan consists of small scale (10-15 birds) units. As

they are predominantly free-ranging, generally there is complete deficiency of biosecurity and

good husbandry practices that could prevent spread of NDV. In addition, traditions such as

keeping exotic pet birds as status symbol, cock fighting, and for hobbies (pigeon racing) may

facilitate the movement of infected pet birds. Although presently uncommon, similar strategies

as those used in poultry, such as vaccination, may contribute to the better control of ND.

Vaccination is not likely to prevent viral replication; however, most existing vaccines are shown

to reduce virus replication and shedding up to 2 logs in comparison to naïve birds, which would

help decrease the amount of NDV shed into the environment (Dimitrov et al. 2016a).

Acknowledgements

We would like to acknowledge Tim Olivier and Dawn Williams-Coplin for their technical

assistance. This work was supported by the Department of State Biosecurity Engagement

Program (BEP, NDV 31063), the Defense Threat Reduction Agency Cooperative Biological

Engagement Program, USDA/ARS #685/FRCALL 12-6-2-0005, USDA CRIS 6040-32000-064-

00D.

References

Alexander DJ, Swayne DE. 1998. Newcastle disease virus and other avian paramyxoviruses. In:

Swayne DE, Glisson JR, Jackwood, MW, Pearson JE, Reed WM (Eds.), A Laboratory

65

Manual for the Isolation and Identification of Avian Pathogens. The American

Association of Avian Pathologists, Kennett Square, PA, 156-163.

Ayala AJ, Dimitrov KM, Becker CR, Goraichuk IV, Arns CW, Bolotin VI, Ferreira HL,

Gerilovych AP, Goujgoulova GV, Martini MC, Muzyka DV, Orsi MA, Scagion GP,

Silva RK, Solodiankin OS, Stegniy BT, Miller PJ, Afonso CL. 2016. Presence of

vaccine-derived Newcastle disease viruses in wild birds. PLOS One.11: e0162484.

Benson DA, ClarkK, Karsch-Mizrachi I, Lipman DJ, Ostell J, Sayers EW. 2015. GenBank.

Nucleic Acids Res.43: D30.

Cardenas Garcia S, Lopez RN, Morales R, Olvera MA, Marquez MA, Merino R, Miller PJ,

Afonso CL. 2013. Molecular epidemiology of Newcastle disease in Mexico and the

potential spillover of viruses from poultry into wild bird species. Appl Environ

Microbiol.79: 4985-4992.

Caron A, Cappelle J, Cumming GS, de Garine-Wichatitsky M, Gaidet N. 2015. Bridge hosts, a

missing link for disease ecology in multi-host systems. Vet Res.46: 83.

Caron A, Grosbois V, Etter E, Gaidet N, de Garine-Wichatitsky M. 2014. Bridge hosts for avian

influenza viruses at the wildlife/domestic interface: an eco-epidemiological framework

implemented in southern Africa. Prev Vet Med.117: 590-600.

Diel DG, da Silva LH, Liu H, Wang Z, Miller PJ, Afonso CL. 2012. Genetic diversity of avian

paramyxovirus type 1: proposal for a unified nomenclature and classification system of

Newcastle disease virus genotypes. Infect Genet Evol.12: 1770-1779.

Dimitrov KM, Afonso CL, Yu Q, Miller PJ. 2016a. Newcastle disease vaccines - a solved

problem or a continuous challenge? Vet Microbiol.In

press.http://dx.doi.org/10.1016/j.vetmic.2016.12.019.

66

Dimitrov KM, Bolotin V, Muzyka D, Goraichuk I, Solodiankin O, Gerilovych A, Stegniy B,

Goujgoulova GV, Silko NY, Pantin-Jackwood MJ, Miller PJ, Afonso CL. 2016b.

Repeated Isolation of Virulent Newcastle Disease Viruses of Sub-genotype VIId from

Backyard Chickens in Bulgaria and Ukraine Between 2002 and 2013. Arch

Virol.161(12):3345-3353

Dimitrov KM, Ramey AM, Qiu X, Bahl J, Afonso CL. 2016c. Temporal, geographic, and host

distribution of avian paramyxovirus 1 (Newcastle disease virus). Infect Genet Evol.39,

22-34.

Khan MZ, Huq MM. 1963. Infectious respiratory diseases of poultry in Pakistan. Bulletin Office

International Epizootics60: 983-987.

Kumar A, Maan S, Mahajan NK, Rana VP, Jindal N, BatraK, Ghosh A, Mishra SK, Kapoor S,

Maan NS. 2013. Detection and molecular characterization of Newcastle disease virus in

peafowl (Pavo cristatus) in Haryana State, India. Indian J Virol.24: 380-385.

Miller PJ, Decanini EL, Afonso CL. 2010. Newcastle disease: Evolution of genotypes and the

related diagnostic challenges. Infect Genet Evol.10: 26-35.

Miller PJ, Dimitrov KM, Williams-Coplin D, Peterson MP, Pantin-Jackwood MJ, Swayne DE,

Suarez DL, Afonso CL. 2015a. International biological engagement programs facilitate

Newcastle disease epidemiological studies. Front Public Health.3: 235.

Miller PJ, Haddas R, Simanov L, Lublin A, Rehmani SF, Wajid A, Bibi T, Khan TA, Yaqub T,

Setiyaningsih S, Afonso CL. 2015b. Identification of new sub-genotypes of virulent

Newcastle disease virus with potential panzootic features. Infect Genet Evol.29: 216-229.

Miller PJ, Kim LM, Ip HS, Afonso CL. 2009. Evolutionary dynamics of Newcastle disease virus.

Virol.391: 64-72.

67

Miller PJ, Koch G. 2013. Newcastle disease. In: Swayne, D.E., Glisson, J.R., McDougald, L.R.,

Nolan, L.K., Suarez, D.L., Nair, V. (Eds.), Diseases of Poultry. Wiley-Blackwell,

Hoboken, New Jersey, 89-138.

Munir M, Linde AM, Zohari S, Stahl K, Baule C, Holm K, Engstrom B, Berg M. 2010.

Complete genome analysis of an avian paramyxovirus type 1 strain isolated in 1994 from

an asymptomatic black-headed gull (Larus ridibundus) in southern Sweden. Avian

Dis.54: 923-930.

Nolen RS. 2002. Exotic Newcastle disease strikes game birds in California. J Am Vet Med

Assoc.221: 1369-1370.

OIE. 2012. Newcastle disease. Manual of diagnostic tests and vaccines for terrestrial animals:

mammals, birds and bees., Biological Standards Commission. World Organization for

Animal Health, Paris, France, 555-574.

Pedersen JC, Senne DA, Woolcock PR, Kinde H, King DJ, Wise MG, Panigrahy B, Seal BS.

2004. Phylogenetic relationships among virulent Newcastle disease virus isolates from

the 2002-2003 outbreak in California and other recent outbreaks in North America. J Clin

Microbiol.42: 2329-2334.

Rehmani SF, Wajid A, Bibi T, Nazir B, Mukhtar N, Hussain A, Lone NA, Yaqub T, Afonso CL.

2015. Presence of virulent Newcastle disease virus in vaccinated chickens in farms in

Pakistan. J Clin Microbiol.53: 1715-1718.

Seal BS, King DJ, Locke DP, Senne DA, Jackwood MW. 1998. Phylogenetic relationships

among highly virulent Newcastle disease virus isolates obtained from exotic birds and

poultry from 1989 to 1996. J Clin Microbiol.36: 1141-1145.

68

Shabbir MZ, Goraya MU, Abbas M, Yaqub T, Shabbir MA, Ahmad A, Anees M, Munir M.

2012. Complete genome sequencing of a velogenic viscerotropic avian paramyxovirus 1

isolated from pheasants (Pucrasia macrolopha) in Lahore, Pakistan. J. Virol.86, 13828-

13829.

Shittu I, Sharma P, Joannis TM, Volkening JD, Odaibo GN, Olaleye DO, Williams-Coplin D,

Solomon P, Abolnik C, Miller PJ. 2016. Complete Genome Sequence of a Genotype

XVII Newcastle Disease Virus, Isolated from an Apparently Healthy Domestic Duck in

Nigeria. Genome Announc.4: e01716-01715.

Tamura K. 1992. Estimation of the number of nucleotide substitutions when there are strong

transition-transversion and G+C-content biases. Mol Biol Evol.9: 678-687.

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: molecular evolutionary

genetics analysis version 6.0. Mol Biol Evol.30: 2725-2729.

Vidanovic D, Šekler M, Ašanin R, Milic N, Nišavic J, Petrovic T, Savic V. 2011.

Characterization of velogenic Newcastle disease viruses isolated from dead wild birds in

Serbia during 2007. J Wildl Dis.47: 433-441.

Vijayarani K, Muthusamy S, Tirumurugaan KG, Sakthivelan SM, Kumanan K. 2010.

Pathotyping of a Newcastle disease virus isolated from peacock (Pavo cristatus). Trop

Anim Health Prod.42: 415-419.

Vindevogel H, Duchatel JP. 1988. Panzootic Newcastle disease virus in pigeons. In: Alexander,

D.J. (Ed.), Newcastle disease. Kluwer Academic Publishers, Boston 184-196.

69

Supplemental Table 3.1.Background information of Newcastle disease virus isolates used in

this study.

No. GenBank

acc.# Isolate name

Host name Isolation

date Location Husbandry

ICP

I

Flock

size

Number of

dead birds§ Common Scientific

1. KR676389 Kohat/122 Chicken Gallus

gallusdomesticus

December

2011 Kohat, KPK

Broiler

farm NP 900 180

2. KY076032* Kasur/998/26A Chicken Gallus

gallusdomesticus

December

2011 Kasur, KPK

Broiler

farm 1.96 30000 300

3. KU862286 Lahore/AW-175 Peafowl Pavo

cristatus

January

2012 Safari Park, Lahore Zoo/Park NP 300 60

4. KU862285 Lahore/AW-145 Peafowl Pavo

cristatus

January

2012 Safari Park, Lahore Zoo/Park NP 300 60

5. KR676390 Peshawar/121 Chicken Gallus

gallusdomesticus

January

2012 Peshawar, KPK

Broiler

farm NP 600 120

6. KU862283# Lahore/AW-130 Pheasant Phasianus

colchicus

February

2012 Safari Park, Lahore Zoo/Park NP 800 640

7. KR676391 Narowal/329 Chicken Gallus

gallusdomesticus August 2012 Narowal, Punjab

Broiler

farm NP 27500 4125

8. KR676392 Waziabbad/431 Chicken Gallus

gallusdomesticus

December

2012

Waziabbad,

Gujranwala

Broiler

farm NP 30000 6000

9. KR676393 Attock/437 Chicken Gallus

gallusdomesticus

December

2012 Attock, Punjab Layer farm NP 3000 600

10. KR676394 Lahore/AP Chicken Gallus

gallusdomesticus March 2013 Lahore, Punjab

Broiler

farm NP 100 10

11. KU862287 Lahore/AW-7 Peacock Pavo

cristatus July 2013 Faisal Town Lahore Pet NP 02 02

12. KR676400 Sheikhpura/MNA Chicken Gallus

gallusdomesticus

January

2014 Sheikhpura, Punjab

Broiler

farm NP 30000 15000

13. KR676401 Lahore/821 Chicken Gallus

gallusdomesticus

January

2014 Lahore, Punjab Backyard NP 06 06

14. KR676395 Lahore/649 Chicken Gallus

gallusdomesticus

February

2014 Lahore, Punjab

Broiler

farm NP 2200 1210

15. KR676396 Lahore/736 Chicken Gallus

gallusdomesticus March 2014 Lahore, Punjab

Broiler

farm NP 6500 3250

16. KR676397 Attock/7-411 Chicken Gallus

gallusdomesticus March 2014 Attock, Pujab Layer farm NP 42000 61800

17. KR676398 Multan/5-125 Chicken Gallus

gallusdomesticus March 2014 Multan, Punjab Layer farm NP 1500 1200

18. KR676399 Gujranwala/2-101 Chicken Gallus

gallusdomesticus March 2014 Gujranwala, Punjab

Broiler

farm NP 29000 23200

19. KU862284# Lahore/AW-NF Pheasant Phasianus

colchicus April 2014 Raiwind, Lahore Pet NP 450 135

20. KU862288# Lahore/AW-3 Peacock Pavo

cristatus April 2014 Raiwind, Lahore Pet NP 600 150

70

21. KU862289# Lahore/AW-4 Peacock Pavo

cristatus April 2014 Raiwind, Lahore Pet NP 600 150

22. KU862290# Lahore/AW-5 Peacock Pavo

cristatus April 2014 Raiwind, Lahore Pet NP 600 150

23. KU862293 Karachi/AW-1 Exotic

Parakeet

Melopsittacus

undulatus August 2014 Korangi, Karachi Pet NP 30 05

24. KU862294# Sheikh Pura/AW-

2

Exotic

Parakeet

Melopsittacus

undulatus

September

2014

MirajPura,SheikhPu

ra Pet NP 80 80

25. KR676404 Gujranwala/FB/2 Chicken Gallus

gallusdomesticus

January

2015 Gujranwala, Punjab

Broiler

farm NP 4000 1200

26. KU862292# Kamoki/AW-2 Peacock Pavo

cristatus

February

2015

Kamoki,

Gujranwala Pet NP 09 04

27. KR676402 Lahore/12 Chicken Gallus

gallusdomesticus

February

2015 Lahore, Punjab Backyard NP 10 02

28. KX496965* Lahore/1084 Racing

pigeon

Columba

livia

February

2015 GhariShahu Lahore Pet 1.88 150 60

29. KY076035* Pattoki/1002/1A Chicken Gallus

gallusdomesticus

February

2015 Pattoki, Kasur Layer farm 1.88 19000 100

30. KY076036* Buner/KPK/1003/

2A Chicken

Gallus

gallusdomesticus

February

2015 Buner, KPK

Broiler

farm 1.88 2000 400

31. KY076040* Buner/KPK/1078/

3A Chicken

Gallus

gallusdomesticus

February

2015 Buner, KPK

Broiler

farm 1.88 1600 280

32. KY076041* Buner/KPK/1079/

4A Chicken

Gallus

gallusdomesticus

February

2015 Buner, KPK

Broiler

farm 1.88 2200 600

33. KY076037* Buner/KPK/1004/

5A Chicken

Gallus

gallusdomesticus

February

2015 Buner, KPK

Broiler

farm 1.88 2700 50

34. KU862295 Karachi/AW-3 Exotic

Parakeet

Melopsittacus

undulatus March 2015 Karongi, Karachi Pet NP 08 04

35. KR676403 Lahore/GM/24 Chicken Gallus

gallusdomesticus March 2015 Lahore, Punjab Backyard NP 100 30

36. KU862296 Lahore/AW-1 Black

Swan

Cygnus

atratus April 2015 Johar Town, Lahore Pet NP 22 02

37. KX496964* Lahore/997 Racing

pigeon

Columba

livia April 2015

Lahore Cantt,

Punjab Racing 1.88 200 125

38. KX496963* Lahore/1001 Racing

pigeon

Columba

livia April 2015

BadamiBagh,

Lahore Pet 1.88 30 02

39. KY076038* BhaiPhairu/1007/6

A Chicken

Gallus

gallusdomesticus April 2015 BhaiPhairu, Kasur

Broiler

farm 1.88 30000 200/day

40. KY076042* Lahore/1080/8A Chicken Gallus

gallusdomesticus April 2015 Lahore, Punjab

Broiler

farm 1.89 60 60

41. KX496967* Lahore/1085 Racing

pigeon

Columba

livia May 2015

Gulshane Ravi,

Lahore Pet 1.75 250 50

42. KX496966* Islamabad/1087 Exotic

Parakeet

Melopsittacus

undulatus May 2015 Charah, Islamabad

Broiler

Farm 1.88 250 02

43. KY076043* NarangMandi/100

5/10A Chicken

Gallus

gallusdomesticus May 2015

NarangMandi,

Gujranwala

Broiler

farm NP 20000 10/day

71

44. KY076030* Sheikhupura/994/1

2A Chicken

Gallus

gallusdomesticus May 2015

Sheikhupura,

Punjab

Broiler

farm 1.89 50000 60

45. KY076039* Gujranwala/1009/

13A Chicken

Gallus

gallusdomesticus May 2015 Gujranwala, Punjab Layer farm 1.76 23000 3500

46. KY076033* Badhana/999/27A Chicken Gallus

gallusdomesticus May 2015 Badhana, Islamabad Layer farm 1.89 3300 10/day

47. KY076044* Badhana/1086/28

A Chicken

Gallus

gallusdomesticus May 2015 Badhana, Islamabad Layer farm 1.88 1200 2/day

48. KY076034* ChakShahzad/100

0/30A Chicken

Gallus

gallusdomesticus May 2015

ChakShahzad,

Islamabad

Broiler

farm 1.88 30000 10/day

49. KU862291# Patoki/AW-1 Peacock Pavo

cristatus June 2015 Patoki, Kasur Pet NP 07 02

50. KX496962* Lahore/996 Rock

Pigeon

Columba

livia June 2015 UVAS, Lahore Wildlife# 1.93 NA NA

51. KY076031* Wazirabad/995/15

A Chicken

Gallus

gallusdomesticus June 2015

Wazirabad,

Gujranwala Layer farm 1.89 8000 900

52. KX791183 R-Pindi/SFR-16 Exotic

Parakeet

Melopsittacus

undulatus May 2016 Rawalpindi, Punjab Pet NP NA NA

NA = data not available; NP = not performed; #=found dead; *=characterized at SEPRL;

#=pathogenicity test was performed in non-specific-pathogen-free birds; §=not all dead birds

were sampled and it has not been shown that all birds died of Newcastle disease

Supplemental Table 3.2.Class II complete fusion protein gene sequences used for constructing

ML phylogenetic tree in this study.

Genotype GenBank acc.# Host Country Isolate Year

VII i KF113339 chicken Pakistan Lahore/30 2011

VII i KF113341 chicken Pakistan Lahore/43 2011

VII i KF113342 chicken Pakistan Lahore/50 2011

VII i KF113343 chicken Pakistan Gujranwala/56 2011

VII i KF113344 chicken Pakistan Okara/103 2011

VII i KF113345 chicken Pakistan KhyberPukhtunKhawa/117 2011

VII i KF113347 chicken Pakistan KhyberPukhtunKhawa/119 2012

VII i KF113348 chicken Pakistan KhyberPukhtunKhawa/162 2012

VII i KF113349 chicken Pakistan Kasure/191 2012

VII i KF113350 chicken Pakistan Lahore/200 2012

VII i HQ697254 chicken Indonesia Banjarmasin/10 2010

VII i KF792019 chicken Israel KY/50/826 2012

VII i KF792020 parrot Israel 84/824 2012

VII i KP776462 chicken Pakistan AW/14 2014

72

VII i KM670337 chicken Pakistan SFR/611/13 2013

VII i KR676389 chicken Pakistan Kohat/122 2011

VII i KR676390 chicken Pakistan Peshawar/121 2012

VII i KR676391 chicken Pakistan Narowal/329 2012

VII i KR676392 chicken Pakistan Waziabbad/431 2012

VII i KR676393 chicken Pakistan Attock/437 2012

VII i KR676394 chicken Pakistan AP/2013 2013

VII i KR676395 chicken Pakistan Lahore/649 2014

VII i KR676396 chicken Pakistan Lahore/736 2014

VII i KR676397 chicken Pakistan Attock/7/411 2014

VII i KR676398 chicken Pakistan Multan/5/125 2014

VII i KR676399 chicken Pakistan Gujranwala/2/101 2014

VII i KR676400 chicken Pakistan Sheikhpura/MNA 2014

VII i KR676401 chicken Pakistan Lahore/821 2014

VII i KR676402 chicken Pakistan Lahore/12 2015

VII i KR676403 chicken Pakistan Lahore/GM/24 2015

VII i KR676404 chicken Pakistan Gujranwala/FB/2 2015

VII i KP780878 chicken Pakistan Gujranwala/649 2013

VII i KP780879 chicken Pakistan Gakkhar/609 2013

VII i KU845252 duck Pakistan AW/123 2015

VII i KY076030 chicken Pakistan Sheikhupura/994/12A 2015

VII i KY076031 chicken Pakistan Wazirabad/995/15A 2015

VII i KY076032 chicken Pakistan Kasur/998/26A 2011

VII i KY076033 chicken Pakistan Badhana/999/27A 2015

VII i KY076034 chicken Pakistan ChakShahzad/1000/30A 2015

VII i KY076035 chicken Pakistan Pattoki/1002/1A 2015

VII i KY076036 chicken Pakistan Buner/KPK/1003/2A 2015

VII i KY076037 chicken Pakistan Buner/KPK/1004/5A 2015

VII i KY076038 chicken Pakistan BhaiPhairu/1007/6A 2015

73

CHAPTER 4

EXPERIMENT 2

Complete genomic analysis of Newcastle Disease Virus of a recent panzootic isolated from

vaccinated poultry flock in 2014 in Pakistan

Abdul Wajid1,2, Muhammad Wasim2, Andleeb Batool3, Haleema Sadia2, Asma Basharat1,

TasraBibi1, Saba Manzoor2, Tahir Yaqub4, Muhammad Tayyab2, Shafqat Fatima Rehmani1*

1Quality Operations Lab, University of Veterinary and Animal Sciences, Lahore, Pakistan

2Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences,

Lahore, Pakistan

3Department of zoology, Government College University, Lahore, Pakistan

4Department of Microbiology, University of Veterinary and Animal Sciences, Lahore, Pakistan

Corresponding author: Shafqat Fatima Rehmani

Address: Quality Operations Lab, University of Veterinary and Animal Sciences, Lahore,

Pakistan

Contact: +92-334-4075315

Email: rehmani.shafqat@uvas.edu.pk

Published in: Journal of Plant and Animal Sciences 27 (5): 2017

74

ABSTRACT

Newcastle disease (ND) is one of the most important OIE listed disease that causes a huge

economic losses in the poultry sector worldwide. The disease is endemic in Pakistan and

recurrent outbreaks are being reported in vaccinated and non-vaccinated commercial poultry

flocks. Sequence analysis shows several amino acid substitutions at the functional domains of F

and HN protein. The current study proposed that the vaccination is leading to pressure on the

NDV to mutate into more virulent strains. We noticed that the host range of NDV is extending to

pet and other species and suggest it could be due more virulent strains emerging. The NDV strain

Chicken/NDV/Pak/AW-14 was isolated from the vaccinated chicken from a poultry farm located

near Lahore, Punjab. The isolate was biologically analyzed using intra-cerebral pathogenicity

index (ICPI) and genetically characterized by the real-time PCR. To better understand the

epidemiology of ND outbreak, the full genome was sequenced and phylogenetic analysis was

performed on the basis of full F and genome sequencing. AW-14 isolate was categorized as a

velogenic strain assessed biologically by the intracerebral pathogenicity index (ICPI), and the

polybasic amino acid sequence at the fusion protein cleavage site. The complete genome is

15,192 nucleotides (nt) long, consisting of six genes in the order of 3’-NP-P-M-F-HN-L-5’.

Several mutations were identified in the functional domain of F and HN proteins, including

signal peptide, transmembrane domain, heptad repeat region and N-glycosylation site,

transmembrane domain, neutralizing epitope respectively. Phylogenetic analysis showed that the

AW-14 belongs to sub-genotype VIIi, the newly emerging NDV strain has been implicated in the

recent outbreaks in Pakistan, Indonesia and Israel and becoming established in poultry sector

through Asia and Middle East. Here, we provide a summary of the genetic evolution and

molecular epidemiology of the vNDV strain suggesting responsible of a fifth panzootic.

75

Keywords: Newcastle disease virus, complete genome, vaccinated commercial chickens,

phylogenetic analysis and Pakistan

Introduction

Newcastle disease (ND) a highly contagious disease worldwide and has enormous adverse

impact in the poultry industry. ND remains to be one of the major threats to the poultry

producers in the developed and under developed countries including Pakistan. The disease is

endemic associated with huge economical losses for the national poultry sector due to concurrent

outbreaks in the country. Apart from the fact that much advancement has been made in the field

of diagnosis and vaccinology. The damage to the commercial poultry due to NDV is enormous.

Newcastle disease (ND) has the ability to infect more than 250 species of birds and can spread

easily via various routes. The virus is non-segmented enveloped, single stranded with negative

sense RNA genome. The genome has at least three genomic lengths, 15186 (Paldurai et al.

2010), 15189 (Yurchenko et al. 2015), 15192 (Wajid et al. 2015, Umali et al. 2014) and 15198

(Kim et al. 2012) and encodes for six proteins, nucleocaspid (NP), phosphoprotein (P), matrix

protein (M), fusion protein (F), haemagglutinin-neuraminidase (HN) and RNA polymerase

(Miller et al. 2010). The HN and F are enveloped glycoproteins, earlier mediates attachment to

the host cell sialic acid receptor and later one is responsible for virus penetration and virus-

induced cell fusion and haemolysis (McGinnes et al. 2006). The virulence of the virus may be

related to the amino acid sequence at the proteolytic cleavage site of the F0, the precursor of F

glycoprotein, cleft by enzyme like trypsin/subtilisin and the ability of the cellular protease to

cleave protein of different viral pathogens.

76

At present the NDV isolates are grouped into class I and class II, and into one genotype for class

I and there are eighteen genotypes for class II NDV isolates (Diel et al. 2012, Snoeck et al. 2013,

Courting et al. 2013). The genotypes I, II, VI and VII are further divided into sub-genotypes, I

into Ia and Ib; genotype II into IIaandIIb; genotype VI into VIa to VIf and genotype VII into

VIIa to VIIi (Wajid et al. 2015, Miller et al. 2010, Yu et al. 2001, Kim et al. 2007, Miller et al.

2015). Since first detection in 1926, there are four different panzootics were occurred worldwide.

Different NDV genotypes and sub-genotypes are responsible for these panzootics (Alexander,

2001, 2003; Miller and Koch, 2013; Perozo et al. 2012).

The novel sub-genotype VIIi in genotype VII, class II viruses are rapidly spreading through

Middle East and Asia to Easter Europe coutries causing severs ND outbreaks suggesting the

existence of 5thpanzootic(Miller et al. 2015). The particular concern of these viruses has

demonstrated causing severe illness in vaccinated flocks (Wajid et al. 2015, Rehmani et al.

2015). However, ND is endemic in Pakistan, the epidemiology, the mechanism of maintenance

and evolution of the new genotypes are not well understood. Despite the vigorous vaccination in

the region, ND outbreaks have been reported from all areas of Pakistan since 1963 (Khan and

Huq, 1963), affecting not only the commercial poultry but also wild birds in zoos and backyards.

The epidemiological and clinical findings demonstrated that the birds affected during the

outbreaks occurred in 2011-12, is still causing disease to susceptible birds either vaccinated or

non-vaccinated. A continuous outbreak of ND in Pakistan needs nonstop research work to find

the various reasons either the usage of un-matched vaccine strain, or any immunological stress

using various vaccines with short span or selection of breeds, highly susceptible to NDV. This

study would assist us to compare the NDV full genome described during the period of outbreak

and the changes after two years period its effect on the economy of poultry industry.

77

Material and Method

Isolate

The chicken/NDV/Pak/AW-14, was isolated from the vaccinated chicken in 2014 in Punjab. The

isolate was propagated in 9-11-day old embryonated SPF (33 incubated at 37 °C and monitored

for viability up to 72 hours. The allantoic fluid was extracted and screened for hemagglutination

assay (HA). The HI was performed as described previously (OIE, 2008). All the positive fluids

were collected and stored at -80 °C till further use.

Characterization

Intracerebral pathogenicity index (ICPI) as described ealrlier(OIE, 2008) was used to evaluate

the pathogenicity. For this test, day-chicks were injected intracerebraly with 50 µl of a 10 fold

dilution in PBS. At the same time, 50 uL of PBS was inoculated to 1 day old chickens as control.

The chickens were monitored every 24 h for 8 days, scoring 0, 1, 2 for normal, sick and dead

respectively.

RNA extraction and sequencing

Nucleic acid was extracted from infected allantoic fluids using TriZol reagent (Invitrogen, USA)

as per manufacturer’s protocol. Reverse transcription was carried out using the Thermo

Scientific cDNA synthesis kit (Thermo Scientific, USA). Oligonucleotide primers were designed

for amplifying the complete genome of isolate as overlapping fragments (Sequences of primers

are upon requested). The complete genome sequence of chicken/NDV/Pak/AW-14 isolate was

determined using high fidelity Platinum ®supermix PCR kit (Invitrogen, Carlsbad, CA,USA).The

PCR ampliconswere run on 1% agarsoe gel and were purified by using the QIAquick clean gel

extraction kit (Qiagen, Valencia, CA). The purified products were cloned into TOPO TA

vactorand sequenced using ABI 3130 automated sequencer.

78

Nucleotide sequencing and Phylogenetic Analysis

Assembly and editing of sequencing of chicken/NDV/Pak/AW-14 isolate was performed using

the BioEdit software v 7.2.5 (Hall, 1999) and compared to the published strains by using the

software Clustalw 2.2.Alignment and phylogenetic analysis were performed using MEGA

software (MEGA, version 6), inferred by the Maximum Likelihood method with standard error

being calculated based on 1000 bootstrap replicates (Tamura et al. 2013). The

chicken/NDV/Pak/AW-14 genome sequence was compared against 64 complete genome

sequences of class I and II (genotypes I-XVIII) available at GenBank. In order to construct the

complete fusion gene based phylogenetic tree, the F gene of chicken/NDV/Pak/AW-14 was

analyzed with 96 sequence of viruses belong to class I and II (genotypes I-XVIII).

Nucleotide Sequence Accession Number

The complete genome sequence of NDV isolate chicken/NDV/Pak/AW-14 is available in

GenBank under accession numberKP776462.

Results

Biological characteristics

The strain chicken/NDV/Pak/AW-14 was found pathogenic as assessed by the standard ICPI test

and sequencing of the fusion (F) protein cleavage site. Intracerebral inoculation of the AW-14

isolate in day old chicks free of NDV antibodies resulted in an ICPI value 1.8. Moreover,

sequencing of the F protein cleavage site showed the presence of three basic aa residues at

positions 113, 115 and 116 and a phenylalanine at position 117 (112-R-R-Q-K-R-F117), which is

typical of vNDV strain (Miller et al. 2015, Rehmani et al. 2015).

Genomic analysis and deduced protein

79

A summary of the complete genomic feature of NDV strain chicken/NDV/Pak/AW-14 is

presented in Table 4.1. The isolate have the similar characteristics to those presented by other

virulent APMV-1. The nucleotide (nt) and amino acid (aa) sequences comparisons between

chicken/NDV/Pak/AW-14 isolate and selected class II reference strains representing genotypes I-

XIII, XVI and XVIII of NDV are presented in Table 4.2. Nucleotide sequences comparison of

this newly emerging strain (chicken/NDV/Pak/AW-14) has 99% homology with Indonesian

NDV strains chicken/Banjarmasin/010/2010 (genotype VIIi). Contrary to that,

chicken/NDV/Pak/AW-14showed lowest nucleotide homology with LaSota vaccine strain (83%;

genotype II).

Analysis of the functional domain of cleavage site was contained three basic aa residues with

phenylalanine at position 117, (112-R-R-Q-K-R-F-117), this motif is considered as highly

virulent strain of NDV in chicken. Comparisons with consensus sequence the seven neutralizing

epitopes (D72, E74, A75, K78, A79, L343, 151ILRLKESIAATNEAVHEVTDG171), believed to be

critical for structure and function of F protein, and were conserved in chicken/NDV/Pak/AW-14

strain. The Signal and fusion peptides almost conserved in chicken/NDV/Pak/AW-14 isolate

except a single substitution at position C25→Yin signal peptide. Analysis of heptad repeat

regions (HR; HRa, HRb, HRc) revealed a total of four substitutions in HRa (143-185 aa) with

change A176→S; HRb (268-299 aa) with change N272→Y and HRc (471-500 aa) with two

changes E482→T; K494→R.Analysis of chicken/NDV/Pak/AW-14 strain’s transmembrane

domain showed four substitutions at positions V506→A; V513→F; A516→V and V520→G.

The HN gene of NDV strain chicken/NDV/Pak/AW-14 is 1716 nt in length and encode for 571

aa, characteristics of the vNDV strain. Twelve aa (174, 175, 198, 236, 258, 299, 317, 401,

416,498, 526, and 547) constituting the sialic acid binding site of HN protein were completely

80

conserved (Table 4.3). Cysteine residues (123, 172, 186, 196, 238, 247, 251, 344, 455, 461, 465,

531, and 542) and N-glycosylation sites (119, 341, 433, 481, 508, and 538) were almost

conserved except for the loss of N-glycosylation at position 508 in chicken/NDV/Pak/AW-14

isolate. There were two substitutions at position V34→I and T36→I in transmembrane domain of

HN protein of chicken/NDV/Pak/AW-14 strain, in comparison with the consensus aa sequences.

Analysis of the ten neutralizing epitopes in the HN protein identified a single aa change at

position E347→K, have been observed in region 14 of seven antigenic sites (1, 2, 3, 4, 12, 14, and

23) within HN protein of chicken/NDV/Pak/AW-14 isolate (Table 4.4).

Table 4.1: Genome features and protein characteristics of NDV strain chicken/NDV/Pak/AW-14

Genomic Characteristics Deduced protein

Protein Intergenic sequence

(IS)

Nucleotide length

(nt) 5UTR ORF length (nt) 3UTR %G+C Size (aa) MW (kDa)

NP 2 1752 66 1470 216 50.81 489 53.2

P 1 1451 83 1188 180 55.05 395 42.3

M 1 1241 34 1095 112 48.58 364 39.6

F 31 1792 46 1662 84 45.42 553 59.0

HN 47 2002 91 1716 195 45.86 571 67.6

L - 6703 11 6615 77 44.47 2204 248.6

Genome - 15,192 - - - 47.07 - -

81

Table 4.2: Nucleotide and amino acid comparison between the vNDV isolate

chicken/NDV/Pak/AW-14 and viruses representing other genotypes within class II

Genotype I II III IV V VI VII VIII IX X XI XII XIII XVI XVIII

Strain Ulster LaSota Muktaswar Herts/33 Largo/71 Fontana/72

Banjarmas

in/010/10

QH4 JS/1/2/Du

Mullard/

US/4-

411/04

MG-1992

Poultry/P

eru

1918-

03/08

Sterna/As

tr

2755/200

1

D-

Republic/

4993/200

8

NDV/chi

ck/

Tog/Ak0

18

Access

No

AY562991 AY845400 EF201805 AY741404 AY562990 AY562988

HQ69725

4

FJ751919 FJ436306

GQ28837

7

HQ26660

3

JN800306

AY86565

2

JX119193

JX39060

9

% % % % % % % % % % % % % % %

nt aa Nt Aa nt aa nt aa nt aa nt aa nt aa nt aa nt aa nt aa nt aa nt aa nt aa nt aa nt aa

NP 88 94 85 92 87 95 89 97 89 96 91 97 99 99 89 96 88 94 86 93 86 95 90 97 90 97 86 95 90 96

P 84 83 83 82 84 86 86 84 87 85 88 88 99 99 86 84 84 83 82 81 84 81 89 86 89 86 83 82 88 88

M 85 90 84 88 86 90 88 93 88 95 92 96 99 99 88 93 85 90 83 91 85 92 91 96 91 97 86 93 89 95

F 87 91 84 89 87 92 89 94 88 93 92 96 99 99 89 94 87 92 86 92 84 88 87 95 91 95 85 91 90 95

HN 85 90 82 87 85 89 87 90 89 91 90 94 99 99 86 92 84 89 83 90 84 88 89 92 90 92 84 92 89 93

L 87 95 85 92 86 94 89 95 90 96 92 96 99 99 89 95 88 94 86 95 85 94 90 96 91 96 87 94 90 95

Genome 85

83

86

87

88

90

99

87

85

84

84

89

89

84

89

Table 4.3: Amino acid substitution in the functional domain of HN protein

Genotype

Trans membrane domain

25-45

Receptor recognition

174, 175, 198, 236, 258,

299, 317, 401, 416,498,

526, 547

N-linked

glycosylation sites

119, 341, 433, 481,

508, 538

Cysteine residues

123, 172, 186, 196, 238,

247, 251, 344, 455, 461,

465, 531, 542

Consensus F R I A V L L L I V M T L A I S A A A L V

R I D K E Y Y E

R R Y E

Lost at 508

-

I (AY562991) - - - - I - - - T - V - - - - - - - - - A - -

II AY845400 - - - - I - F - T - V - - - - - V - S - L - -

III EF201805 - - - - A - - - M - I - - - V - - V - - A - -

IV AY741404 - - - - I - - - - - I - - - - - - - - - - - -

V AY562990 - - - - - - S - - - M - - - - - V - - - - - -

VI AY562988 - - - - - - - - - - M - - T - - - - - - - - -

VII chicken/NDV

/Pak/AW-14

- - - - - - - - M I M I - - - - - - -

A - -

82

Table 4.4: Amino acid constituting the neutralizing epitopes of the HN protein

Sites 23 3 4 14 4 12 2 and 12 2

Genotype 193-201 263 287 321 332-333 346-353 356 494 513-521 569

Consensus L S G C R D H S H N D K G K D E Q D Y Q I R K G/D R I T R V S S S S D

I (AY562991) - - - - - - - - - - - - - - - - - - - - - - - D - - - - - - - - - -

II (AY845400) - - - - - - - - - - - - - - - - - - - - - - R G - - - - - - - - - -

III (EF201805) - - - - - - - - - K - - - R - - - - - - - - - D - - - - - - - - - -

IV (AY741404) - - - - - - - - - S - - - - - - - - - - - - - D - - - - - - - - - -

V (AY562990) - - - - - - - - - K - R - - - - - - - - V - - N - - - - - - - - - N

VI (AY562988) - - - - - - - - - - - - - - - - - - - - - - - N - V - - - - - - - D

VII(chicken/NDV

/Pak/AW-14)

- - - - - - - - - N - - - - - K - - - - - - - D - I - - - - - - - -

Phylogenetic analysis

The phylogenetic analysis of the chicken/NDV/Pak/AW-14 isolate is presented in Figure 4.1,

4.2. On the basis of complete coding sequence of F gene and full genome, the AW-14 strain

belonging to newly emerged panzootic virus’s sub-genotype VIIi in genotype VII. The AW-14

strain was clustered together with recently isolated NDV viruses from poultry production

facilities and pet birds throughout Pakistan, Indonesia and Israel. This newly emerged sub-

genotype VIIi was recently described by our group (Wajid et al. 2015, Miller et al. 2015,

Rehmani et al. 2015). The genotype VIIi become the predominant sub-genotype causing ND

outbreaks in vaccinated and non-vaccinated poultry farming, backyards flock and pet birds since

a severe outbreak occurred in 2011-12. The VIIi strains are highly virulent in all type of species

and have replaced the NDV isolates of genotype XIII, which were commonly isolated in 2009-

11. The NDV isolates previously characterized in the country were also included in the

phylogenetic analysis to ascertain the genetic diversity with the isolate characterized in the

current study. The phylogenetic analysis of complete genome sequence of strain

chicken/NDV/Pak/AW-14 with other NDV strains available from GenBank were used revealed

the same topology of the tree as constructed with full coding sequences (1662 nt) for the F gene

83

analysis. The degree of nucleic acid variation between the AW-14 strain and NDV strains in

genotype VIIiwas 0.3-1.6% for the F gene (0.0-1.4% for protein). On the basis of complete

genome the chicken/NDV/Pak/AW-14 strain was closely related to (>99% homology)

Indonesian strain chicken/Banjarmasin/010/10 (HQ697254).

84

Figure 4.1: The phylogenetic analysis based on the complete fusion gene sequences of 96

isolates from class I and II available in GenBank. The new vNDV isolate

(chicken/Pak/NDV/AW-2014) is denoted with a Black circle in the tree.

Figure 4.2: Molecular phylogenetic analysis of selected full genome isolates was inferred by

using the maximum likelihood method based on the General Reversible model (38). A total of 64

nucleotide sequences of various genotypes were involved in the analysis. There are a total of

~15192 positions in the final data set.

Discussion

ND remains one of the most economically significant burdens on poultry production globally

despite stringent vaccination by most poultry producers. In Pakistan occasional outbreaks have

been reported in poultry production facilities as well as the backyard and wild birds. The

85

presence of vNDV with similar fusion protein cleavage site are commonly isolated from the

infected birds, however, few viruses are highly virulent under experimental conditions. Due to

non-availability of data regarding the pre-immune status, it remains uncertain whether the

clinical signs in infected birds by vND viruses results either due to failure of vaccination

program or due to latent infection of NDV in the birds. The second assumption in the current

situation is that the viruses currently circulating in Pakistan belong to a new sub-genotype VIIi,

where vaccine from genotype II used in the industry since a long time that could raise a question

the efficacy of vaccine used in Pakistan. Notably, the evolutionary distance between

chicken/NDV/Pak/AW-14and vaccine viruses of genotype II is the largest distance (17%

divergence) observed between all genotypes.

Newcastle disease is associated with seasonal outbreaks in vaccinated and non-vaccinated

chickens either from commercial or backyards farming. High prevalence of ND has been noted

during winter season and moderate mortality during spring, however the occasional outbreaks

continue for the whole years both in commercial, backyard production facilities as well as in

wild and pet birds. Stress associated with harsh conditions/environment has been suggested to

exacerbate the outbreaks of NDV (Abdu et al. 1992). Frequent fluctuation in ambient

temperature, humidity and high virus load act as stress factors, caused the immune status of the

birds worse; make the room for vNDV infection. Due to booster dose of live attenuated

vaccination against IB, IBD and NDV at the age of the chickens 2 to 3 weeks, they are not

immuno competent to resist the viruses load and may lead to the reason of outbreaks of vNDV.

No doubt, that in Pakistan the chickens from the hatchery irrespective of the immune status, the

vaccination schedule followed by the farmers as subscribed by the veterinary officer, who are

hired by the owners of the farms. Little is known about whether these outbreaks are associated

86

with a single or multiple viral genotypes and whether the quick changes/mutation in the genome

evolves new genotypes during disease transmission.

Epidemiological and sequencing analysis reveals that five distinct genotypes (II, III, VI, VII,

&XIII) circulated among the birds in Pakistan since mid1990’s, where VII are present in

chickens with novel sub-genotype VIIi and have replaced genotype XIII, which were commonly

isolated in 2009-11 (Wajid et al. 2015, Miller et al. 2015, Rehmani et al. 2015). The previous

study conducted on NDV, isolated genotype VI from Karachi, Sindh (Khan et al. 2010), and

genotype II and III are vaccine strains. Genotype II commonly used in commercial poultry and

the route of vaccination is drinking water whereas, genotype III is manufactured locally and

economical to purchase for the backyard farming. Furthermore, the extensive use of vaccines of

different origin makes the situation further auspicious for genetic modification in virulent strains.

We report here the full genome sequencing of circulating field NDV isolate from recent outbreak

in Pakistan. The virus belongs to genotype VII, always thought to be endemic in many Asian

countries (Munir et al. 2012). However, a distinct sub-genotype VIIi has been circulating since a

severe outbreak reported during 2011-12 suggesting a novel viral origin. The data present here

provide evidence that a genetically distinct virus, most closely related to Indonesian and Israeli

strains caused the concurrent outbreaks in the region.

The F and HN glycoproteins are the critical virus neutralizing antigen and thus the major

protective antigens (Taylor et al. 1990). Comparison of functional domains of F and HN proteins

with consensus sequences derived from NDV strains of different genotypes recognized several

amino acid substitutions. F gene has been mostly considered for the genetic characterization of

NDV strains, major determinant of virulence and particular emphasis given on the variable

region (47-421 nt), because it codes for a functionally significant structure such as signal peptide

87

(aa 1-31), cleavage activation sequence (aa 112-116), and fusion inducing hydrophobic region

(aa 117-142) (Umali et al. 2013). A standard criterion for NDV genotyping is also using the

variable region (nt 47-420) of F gene (Qin et al. 2008). The F protein cleavage activation

sequence (aa 112-116) at the C-terminus of the F2 protein and L (leucine) or F (phenylalnine) at

the N-terminus of F1 protein (aa 117) are major determinants of NDV virulence (Alexander,

2008, Alexander, 2009). The cleavage site motif 112-R-R-Q-K-R-F117 was present in Aw-14

strain, which is typical of vNDV strain (Miller et al. 2015, Rehmani et al. 2015). Seven major

neutralizing epitopes at position D, E, A, K, A, and L, and a stretch of aa from residues 151-171

believed to be critical for structure and function of F protein (Neyt et al. 1989, Yusoff et al.

1989), and all were conserved in AW-14 strain. Comparison of functional domain of F protein

with consensus sequences identified several amino acid substitutions in signal peptide with a

single substitution, total of four substitutions in heptad repeat regions (HRa,HRb,HRc) and

transmembrane domain had four substitutions.

The HN gene sequence of the chicken/NDV/Pak/AW-14 strain was 571 aa, characteristics of the

vNDV strain (Tsai et al. 2004, Habib et al. 2015, Maminiaina et al. 2010). The sialic acid

binding site and cysteine residues of HN protein were completely conserved as compared to

consensus sequences, however loss of N-glycosylation at position 508 was observed in AW-14

strain (Table 4.3).Analysis of the ten neutralizing epitopes in the HN protein identified a single

aa change at position 347 (E→K), observed in region 14 of seven antigenic sites within HN

protein, useful marker of antigenic variant and enables the field virus to evade neutralizing by a

specific MAbs (Gotoh et al. 1988) (Table 4.4).The earlier studies have demonstrated that the

amino acid substitutions in neutralizing epitopes play a significant role in formation of antigenic

epitope and could result in neutralizing escape variants (Cho et al. 2007, Cho et al. 2008, Hu et

88

al. 2010). Though the poultry industry has revolution during the last two decades in Pakistan, but

the selection of vaccine strain and route of vaccination still remained the same. There are

chances that a continuous use of LaSota strain (genotype II) unable to protect the chickens got

stricken by the newly emerging virulent form of genotype VIIi. The reason might be the

variation at the antigenic sites of newly emerging NDV strains. As compared to the vaccine

strain used in the field and the past pandemic NDV viruses in Pakistan, recently identified

viruses reveal amino acids substitutions at neutralizing epitopes, which in previous studies have

been suggested that these variations may lead to antigenic change and have effect on viral

attachment to the receptor on host cells (Iorio et al. 1989, Iorio et al. 1991). In such case, the

antibody recognition its neutralizing activity may be altered, resulted the escaping of specific

antigen and the release of virus as a virulent strains in the systemic circulation and developed as

an outbreak.

The full genome of AW-14 strain was compared with the viruses from genotype 1-XVIII, the

highest nucleotide identity (>99%) was found with chicken/Banjarmasin/010/2010 and

chicken/Pak/Quality Operations Lab/SFR-611/13(genotype VIIi; GenBank accession number

HQ697254 and KM670337 respectively) and the lowest similarity with LaSota strain (genotype

II; GenBank accession number AY845400) (Table 4.2). Although the full fusion of AW-14

strain has highest nucleotide similarities (99%-100%) with NDV isolates from Middle East,

Indonesian and previously characterized Pakistani NDV strains (genotype VIIi). These close

identities were also figured out by phylogenetic analysis (Figure 4.1, 4.2). Over-all, the data

confirmed that the commercial poultry production facilities and pet birds in Pakistan, Indonesia

and Middle East were affected by identical vNDV strains since 2011-12, leading to fifth

panzootic.

89

In summary, whole genome sequencing of NDV has enable us to study the dynamics of NDV

transmission and evolution during a localized outbreak in Pakistan in 2014. Furthermore, whole

genomic study is not only important for diagnosis and pathogenicity assessment but also

important in vaccine strain selection as a master seed virus for the region.

Acknowledgment

We are thankful to the Pakistan Agriculture Research Board (PARB) for their technical

assistance for the research project. We are also thankful to AbidHussain and his team, Poultry

Disease Diagnostic Lab, Gakkhar, Gujranwala for his assistance in collection of samples.

References

Abdu PA, Mera UM, Saidu L. 1992.A study on chicken mortality in Zaria, Nigeria.In

Proceedings. 19th World Poultry Congress, Amsterdam, the Netherlands, 20-24

September 1992. 2: 151.

Alexander DJ. 2001. Ecology and epidemiology of Newcastle disease. In Avian influenza and

Newcastle disease.Edited by Capua I, Alexander DJ. Milan: Springer; 2009:19-26.

Alexander DJ. Gordon Memorial Lecture. Newcastle disease. Br Poult Sci. 42(1): 5–22.

Alexander DJ. 2003. Newcastle disease, 64–87. In Saif YM, et al. (ed), Disease of poultry. Iowa

State Press, Ames, IA.

Alexander DJ. 2008. Newcastle disease, other avian paramyxoviruses and pneumovirus

infection. In Diseases of poultry.12th edition.Edited by Saif YM. Iowa: Blackwell

Publishing; 2008:75-93.

Cho SH, Kwon HJ, Kim TE, Kim JH, Yoo HS, Kim SJ. 2008. Variation of a Newcastle disease

virus hemagglutinin-neuraminidase linear epitope. J ClinMicrobiol. 46(4): 1541–1544.

90

Cho SH, SJ Kim, HJ Kwon 2007.Genomic sequence of an antigenic variant Newcastle disease

virus isolated in Korea. Virus Genes, 35(2): 293–302.

Courtney SC, L Susta, D Gomez, NL Hines, JC Pedersen, CC Brown, PJ Miller, CL Afonso

2013. Highly divergent virulent isolates of Newcastle disease virus from the Dominican

Republic are members of a new genotype that may have evolved unnoticed for over 2

decades. J ClinMicrobiol. 51(2): 508–517.

Diel DG, da Silva LH, Liu H, Wang Z, Miller PJ, Afonso CL. 2012. Genetic diversity of avian

paramyxovirus type 1: proposal for a unified nomenclature and classification system of

Newcastle disease virus genotypes. Infect Genet Evol. 12(8): 1770–1779.

Gotoh B, Sakaguchi T, Nishikawa K, Inocencio NM, Hamaguchi M, Toyoda T, Nagai Y. 1988.

Structural features unique to each of the three antigenic sites on the hemagglutinin-

neuraminidase protein of Newcastle disease virus.Virol. 163(1):174-182.

Habib H, Rehmani SF, Mukhtar N, Bibi T, Wajid A. 2015. Biological and molecular

characterization of Newcastle disease virus through haemagglutinin-neuraminidase gene

isolated from Lahore district. J InfMol Biol. 3(2): 28-33.

Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis

program for Windows 95/98/NT. Nucl Acid S., 41: 95- 98.

Hu S, Wang T, Liu Y, Meng C, Wang X, Wu Y, Liu X. 2010. Identification of a variable epitope

on the Newcastle disease virus hemagglutinin-neuraminidase protein. Vet Microbiol.

140(1-2): 92–97.

Iorio RM, Syddall RJ, Sheehan JP, Bratt MA, Glickman RL, Riel AM. 1991. Neutralization map

of the hemagglutinin-neuraminidase glycoprotein of Newcastle disease virus: domains

91

recognized by monoclonal antibodies that prevent receptor recognition. J Virol. 65:4999–

5006.

Iorio RM, Glickman RL, Riel AM, Sheehan JP, Bratt MA. 1989. Functional and neutralization

profile of seven overlapping antigenic sites on the HN glycoprotein of Newcastle disease

virus: monoclonal antibodies to some sites prevent viral attachment. Virus Res. 13(3):

245–261.

Kaleta EF, Alexander DJ, Russell PH. 1985. The first isolation of the avian PMV-1 virus

responsible for the current panzootic in pigeons?Avian Pathol. 14(4): 553-557.

Khan MZ, Huq MM. 1963. Infectious respiratory diseases of poultry in Pakistan.Bulletin Office

International des Epizooties. 60:983-987.

Khan TA, Rue CA, Rehmani SF, Ahmed A, Wasilenko JL, Miller PJ, Afonso CL. 2010.

Phylogenetic and biological characterization of Newcastle disease virus isolates from

Pakistan. J ClinMicrobiol. 48(5):1892– 1894.

Kim LM, King DJ, Curry PE, Suarez DL, Swayne D, Stallknecht DE, Slemons RD, Pedersen JC,

Senne DA, Winker K, Afonso CL. 2007. Phylogenetic diversity among low-virulence

Newcastle disease viruses from waterfowl and shorebirds and comparison of genotype

distributions to those of poultry-origin isolates. J Virol. 81(22): 12641–12653.

Kim, SH, Nayak S, Paldurai A, Nayak B, Samuel A, Aplogan GL, Awoume KA, Webby RJ,

Ducatez MF, Collins PL, Samal SK. 2012. Complete genome sequence of a novel

Newcastle disease virus strain isolated from a chicken in West Africa. J Virol.86(20):

11394-11395.

92

Maminiaina OF, Gil P, Briand FX, Albina E, Keita D, Andriamanivo HR, Chevalier V, Lancelot

R, Martinez D, Rakotondravao R, Rajaonarison JJ, Koko M, Andriantsimahavandy AA,

Jestin V, Servan de Almeida R. 2010. Newcastle disease virus in Madagascar:

identification of an original genotype possibly deriving from a died out ancestor of

genotype IV. PLoS One. 5(11): 1-12.

McGinnes LW, Morrison TG. 2006. Inhibition of Receptor Binding Stabilizes Newcastle

Disease Virus HN and F Protein-Containing Complexes. J Virol. 80(6): 2894-2903.

Miller PJ, Koch G. 2013. Newcastle disease, other avian paramyxoviruses, and avian

metapneumovirus infections; Newcastle disease. In: Swayne DE, Glisson JR, McDougald

LR, Nolan LK, Suarez DL, Nair V (Eds.), Diseases of Poultry 13 ed. Wiley-Blackwell,

Hoboken, New Jersey, 89–138.

Miller PJ, EL Decanini, CL Afonso 2010. Newcastle disease: evolution of genotypes and the

related diagnostic challenges. Infect. Genet.Evol., 10(1): 26-35.

Miller PJ, Haddas R, Simanov L, Lublin A, Rehmani SF, Wajid A, Bibi T, Khan TA, Yaqub T,

Setiyaningsih S, Afonso CL. 2015. Identification of new sub-genotypes of virulent

Newcastle disease virus with potential panzootic features. Infect Genet Evol. 29:216–

229.

Munir M, Abbas M, Khan MT, Zohari S, Berg M. 2012. Genomic and biological

characterization of a velogenic Newcastle disease virus isolated from a healthy backyard

poultry flock in 2010. Virol J. 9:46.

Nei M, Kumar S. 2000. Molecular evolution and phylogenetics. Oxford University Press, New

York (333pp).

93

Neyt C, Geliebter J, Slaoui M, Morales D, Meulemans G, Burny A. 1989. Mutations located on

both F1 and F2 subunits of the Newcastle disease virus fusion protein confer resistance to

neutralization with monoclonal antibodies. J. Virol., 63(2): 952-954.

OIE 2008.Manual of Diagnostic Tests and Vaccinesfor Terrestrial Animals.Office International

des Epizooties, Paris, France, 1092-1106.

Paldurai A, Kumar S, Nayak B, Samal SK. 2010. Complete genome sequence of highly virulent

neurotropic Newcastle disease virus strain Texas GB. Virus Gen. 41:67–72.

Perozo F, Marcano R, Afonso CL. 2012. Biological and phylogenetic characterization of a

genotype VII Newcastle disease virus from Venezuela: efficacy of field vaccination. J

ClinMicrobiol. 50(4): 1204–1208.

Qin ZM, Tan LT, Xu HY, Ma BC, Wang YL, Yuan XY, Liu WJ. 2008. Pathotypical

characterization and molecular epidemiology of Newcastle disease virus isolates from

different hosts in China from 1996 to 2005. J ClinMicrobiol. 46(2): 601-611.

Rehmani SF, Wajid A, Bibi T, Nazir B, Mukhtar N, Hussain A, Lone NA, Yaqub T, Afonso CL.

2015. Presence of Virulent Newcastle Disease Virus in Vaccinated Chickens in Farms in

Pakistan.J ClinMicrobiol. 53(5): 1715-1718.

Snoeck CJ, Owoade AA, Couacy-Hymann E, Alkali BR, Okwen MP, Adeyanju AT, Komoyo

GF, Nakoune E, Le Faou A, Muller CP. 2013. High genetic diversity of Newcastle

disease virus in poultry in West and Central Africa: cocirculation of genotype XIV and

newly defined genotypes XVII and XVIII. J ClinMicrobiol. 51(7): 2250–2260.

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: Molecular evolutionary

genetics analysis version 6.0. MolBiolEvol. 30(12): 2725–2729.

94

Tamura K, Nei M, Kumar S. 2004. Prospects for inferring very large phylogenies by using the

neighbor-joining method. Proc. NatlAcad Sci. 101(30):11030-11035.

Taylor J, Edbauer C, Rey-Senelonge A, Bouquet J, Norton E, Goebel S, Desmettre P, Paoletti E.

1990. Newcastle disease virus fusion protein expressed in a fowlpox virus recombinant

confers protection in chickens. J Virol. 64(4):1441-1450.

Tsai HJ, Chang KH, Tseng CH, Frost KM, Manvell RJ, Alexander DJ. 2004. Antigenic and

genotypical characterization of Newcastle disease viruses isolated in Taiwan between

1969 and 1996. Vet Microbiol. 104(1-2): 19–30.

Umali DV, Ito H, Shirota K, Katoh H, Ito T. 2014. Characterization of complete genome

sequence of genotype VI and VII velogenic Newcastle disease virus from Japan. Virus

Gen. 49(1): 89-99.

Umali DV, Ito H, Suzuki T, Shirota K, Katoh H, Ito T. 2013. Molecular epidemiology of

Newcastle disease virus isolates from vaccinated commercial poultry farms in non-

epidemic areas of Japan. Virol J. 10:330.

Wajid A, Wasim M, Rehmani SF, Bibi T, Ahmed N, Afonso CL. 2015. Complete genome

sequence of a recent panzootic virulent Newcastle disease virus from Pakistan. Genome

Announc. 3(3): 1-2.

Yu L, Wang Z, Jiang Y, Chang L, Kwang J. 2001. Characterization of newly emerging

Newcastle disease virus isolates from the People’s Republic of China and Taiwan. J

ClinMicrobiol. 39(10): 3512–3519.

Yurchenko KS, Sivay MV, Glushchenko AV, Alkhovsky SV, Shchetinin AM, Shchelkanov MY,

Shestopalov AM. 2015. Complete Genome Sequence of a Newcastle Disease Virus

95

Isolated from a Rock Dove (Columba livia) in the Russian Federation. Genome Announc.

3: 1514-14.

Yusoff K, Nesbit M, McCartney H, Meulemans G, Alexander DJ, Collins MS, Emmerson PT,

Samson AC. 1989. Location of neutralizing epitopes on the fusion protein of Newcastle

disease virus strain Beaudette C. J Gen Virol. 70: 3105-3109.

96

CHAPTER 5

EXPERIMENT 3

Continuous circulation of panzootic strains of Newcastle disease virus in domestic and wild

birds in Pakistan, shows potential epidemic trends

Abdul Wajid1,2, Muhammad Wasim1, Asma Basharat2, Haleema Sadia3, Muhammad Farooq

Tahir4, Saba Manzoor1,Taseer Ahmed Khan5, Nazir Ahmed Lone6, Tahir Yaqub2, Muhammad

Tayyab1, Shafqat Fatima Rehmani2#

1Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Science,

Lahore, Pakistan

2Quality Operation Laboratory, University of Veterinary and Animal Science, Lahore, Pakistan

3Center for Applied Molecular Biology, University of Punjab, Lahore, Pakistan

4Disease diagnostic center, Poultry Research Institute, Rawalpindi, Pakistan

5Department of Physiology, University of Karachi, Sindh, Pakistan

6Shantou University Medical College, Shantou, Guangdong- 515041, PR-China

#Corresponding Author:

Shafqat Fatima Rehmani: rehmani.shafqat@uvas.edu.pk

Submitted in Pakistan Veterinary Journal: PVJ-16-340

97

Abstract

Newcastle disease (ND) is considered as a highly infectious disease of poultry worldwide. The

commercial broiler industry is highly susceptible to virulent NDV, the data indicating heavy

losses and documentary proof is available on NDV surveillance program. However, a little is

known regarding the maintenance and enzootic trends of vNDV infection level in domestic and

wild birds. Poor vaccination strategy as well as the existence of virulent form of NDV in the

domestic birds indicates a root cause of the occurrence of disease eruption in the developing

countries. Here, we report the eleven complete genome sequences of NDV from lovebird parrot

(n=1) and exotic parakeets (n=3), backyard chickens (n=5), peacock (n=1) and pheasant (n=1).

The complete genome lengths of all isolates were 15,192 nucleotides (nt) with same virulence-

associated cleavage site (112-RRQKRF-117) and selected ones have intracerebral pathogenicity

index (ICPI) values ranging from 1.50 to 1.86, which is typical of vNDV. The deduced amino

acid residues analyses have shown a number of substitution mutations in the functional domains

of fusion and hemagglutinin-neuraminidase proteins. Phylogenetic analysis showed all NDV

isolates belong to sub-genotypes VIIi within the genotype VII of class II. The isolation of highly

similar viruses (98-99%) during 2011-16 provides the evidence of an epidemiological links

between poultry, domestic and wild birds. Our results also support the existence of fifth

panzootic as these viruses primarily isolated from South Asia, Middle East and Indonesia and

recently spread into Eastern Europe. Active surveillance of these newly emerging viruses to

determine their evolution is one of the most realistic strategies for preventing and controlling

NDV outbreaks.

Key words: Newcastle disease, birds, complete genome, Phylogenetic analysis, Pakistan

98

Introduction

Newcastle disease (ND) is a highly significant disease of poultry caused by virulent strains of

avian paramyxovirus type -1 (AMPV-1) also known as Newcastle disease virus (NDV). APMV-

1 is a member of paramyxoviridae family, Avulavirus genus under the order Mononegaviral.

APMV-1 is enveloped, single stranded negative sense RNA genome with at least three genomic

lengths 15186, 15192, 15198 nucleotides (nt) (Czegledi et al. 2006; Wajid et al. 2015). The

genome is consist of six encoding genes in order 3’-NP-P-M-F-HN-L-5’. Historically, there are

two genetically divergent classes, I and II, classified on the bases of complete fusion gene and

complete genome sequences. There is single genotype of class I and 18 genotypes in class II,

some of genotype in class II have sub-genotypes (Diel et al. 2012).

Disease eruption mostly vNDV adversely affect the commercial poultry sector, however, loses of

domestic birds/backyard usually not documented though contributed a major production sector

and always suffer due to vNDV outbreaks in the developing countries (Alexander, 2011). During

the major outbreak in 2012, the ND had spread from Northern region to Southern part of the

country in a short period of time affected various species of birds. Moreover, the prevalence of

the same genotype was confirmed by the isolation of virus from the occasional outbreaks during

the year 2013-2016.

The studies carried out during the last six years at our laboratory (Quality Operations

Laboratory) not only characterized the virulent strains of NDV from commercial poultry flocks

were isolated, the samples from other avian species like, pigeon, ducks, peacock, pheasant,

parrots and exotic parakeets were also tested and characterized (Wajid et al. 2015; Miller et al.

2015; Rehmani et al. 2015; Wajid et al. 2016a, 2016b; 2016c). However, in this study NDV

isolates from three species, the lovebird parrot, exotic parakeet and backyards chicken confirmed

99

having vNDV. The main idea was to investigate the possibility of the route of inter-transmission

of domestic pet birds with scavenger chicken population at the backyards. As the vNDV strains

established in the backyard chicken population may easily cause the epidemic situation in the

commercial chicken population in Pakistan as reported in 2011-12. This study emphasized the

need for better understand the distribution tracks as well as the disease epidemiology in domestic

and wild birds in the region.

Material and Method

Sample collection and virus isolation

The detailed information of different species collected during 2015-16 is mentioned in Table 5.1.

Tracheal tissue suspensions (10% w/v) and Oropharyngeal/cloacal swabs were prepared using

phosphate buffered saline (PBS) containing antibiotic, penicillin (1000 IU/ml) and streptomycin

(1000µg/ml). Each sample was inoculated into the allantoic cavity of 9-10-day-old chicken

embryonated eggs (Specific NDV antibody free) according to the standard procedure (OIE,

2012). The allantoic fluid was harvested and presence of NDV was identified by

hemagglutination (HA) assay. All the viruses were confirmed by hemagglutination inhibition

(HI) assay to be APMV-1.

Intracerebral pathogenicity index (ICPI) assay

The virulency of nine isolates was determined from allantoic fluid by ICPI test using day-old

chickens (Specific NDV antibody free) as previously described (OIE, 2012).

RNA extraction, Detection, PCR amplification and Sequencing

The genomic RNA was extracted through TRIzol LS reagent (Invitrogen, USA). The detection

and pathotyping of clinical samples using protocol of USDA-validated RT-PCR assays as

described previously (Khan et al. 2010). Complementary DNA (cDNA) was synthesized using

100

random hexamer (Themro Scientific, USA) according to the manufacturer’s recommendations.

For complete genome of the isolates, 22 overlapping primers were used as previously used by

Wajid et al. (2015) using Platinum PCR Super Mix high-fidelity polymerase (Invitrogen, USA)

in Bio-Rad thermocycler. Gene JET gel extraction kit was used for purification of amplified PCR

products as per manufacturer’s instructions and cloned into the TOPOTA vector (Invitrogen,

USA) according to the manufacturer’s instructions. The amplified products were sequenced by

ABI 3130 XL genetic analyzer (ABI, Inc., CA. USA).

Evolutionary and Phylogenetic analysis

Phylogenetic analysis was performed by MEGA6 software (Tumara et al. 2013). Initial

phylogenetic analysis was done with complete coding sequence of fusion protein gene with 1558

nucleotide (nt). We performed phylogenetic analysis with complete genome sequences of strains

obtained in the current study and available sequences downloaded from GenBank (data not

shown). The final datasets of complete genome (n=83) and complete fusion protein gene coding

sequences (n=82) were generated.

Accession number

The complete genome sequences of virulent NDV isolates obtained in this study were submitted

into GenBank under accession number parrot/parakeets from KX268688 to KX268691, backyard

chicken KX791184 –KX791188, pheasant (KY290561), and peacock (KY290560 ).

Result

Epidemiological description of the current NDV isolates

The oropharyngeal and cloacal swabs were collected from backyard chickens after the

appearance of typical NDV signs and symptoms, i.e. depression with greenish white diarrhea,

torticollis and tremor with a mortality rate of almost 90%. Necropsy indicates typical lesions like

101

hemorrhages on Proventriculus, cecal tonsils and trachea. They were kept as non-vaccinated and

free-ranging birds in houses. It is important to note that usually these birds were kept as free

ranging and non-vaccinated. As the birds reared as scavenging birds, they remained in closed

contact with other pet and domestic birds and using food and water in common sources. The

close contact of the susceptible birds makes them more vulnerable to transmit the ND virus to

other host but for themselves and succumbed to death by the virulent ND virus.

The NDV isolate namely parakeet/Pak/Rawalpindi/SFR-RP15/2015 was isolated from clinically

healthy parakeet; the farm was operated on commercial basis and located at distance of 100 feet

near to the commercial poultry sheds. The parakeets were vaccinated with live attenuated LaSota

vaccine, and the HI antibody titre was assessed and found almost 5 log2. The titre indicating the

presence of specific antibodies against NDV; however it is difficult to assess that the HI antibody

titre was either due to LaSota ND vaccine or the persistence of the ND virus for long time. Other

three NDV strains parakeet/Pak/Lahore/SFR-148A/2015, parakeet/Pak/Lahore/SFR-148B/2015,

parrot/Pak/Lahore/SFR-129/2015 were isolated from dead birds from different premises reported

to our laboratory. The information gathered from the farmers indicates no illness; however the

mortality was 100% within 48-72 hours without any noteable symptoms. However, the laziness

and loss of appetite was the most common signs prior to mortality. The NDV strains

pheasant/Pak/Lahore/AW-pht/2015, peacock/Pak/Lahore/AW-pck/2015 were isolated from a

public zoo died within 48 hours after showing typical signs of vvNDV signs.

Initial characterization and pathogenicity assessment of isolates

Haemagglutination assay i.e HA titre of allantoic fluid was determined and recorded as 1:256

(log2 7). The initial detection of all clinical isolates was targeted by using protocol of USDA-

validated matrix gene RT-PCR assay. The result showed that all the isolates had Ct value ≤ 20.

102

Furthermore fusion gene RT-PCR assay was used for pathotyping of current isolates, all had Ct

value range from 25 to 28. To evaluate the pathogenic nature of the isolates, the standard assay

was used to determine the intracerebral pathogenicity index (ICPI) in day old NDV-specific free

antibodies chicks. The values varied from 1.50 to 1.86, indicating that all isolates were

velogenic.

Genomic organization of the complete genome sequences

In the current study, we obtained the complete genome of eleven isolates and genome

arrangement is summarized in Table 5.2. All eleven strains had genome length of 15,192 nt with

six transcriptional units in the order of 3’-NP-P-M-F-HN-L-5’. The genome length of earlier

genotype I, II, III, IV had 15,186 nt, comparatively the eleven APMV-1 strains had a six nt

insertion (1648CCCCGC1653, the similar sequences detected in all eleven isolates) at 5’ end of the

non-coding region of NP gene. The G + C content of complete genome of all isolates were range

from 46.2 to 46.5.

Characterization of the non-coding region

The leader and trailer sequences located at the 3 and 5 end of the genome play a significant role

in virus replication, transcription, packaging of the genome and anti-genomic RNA were

composed of 55 and 114 nt respectively. Start gene (GS) of the NP, P, M, F, HN genes was

identical (ACGGGTAGAA), except the GS of the L gene was different (ACGGGTAGGA) in all

isolates. The gene end (GE) of the NP gene was TTAGAAAAAAA identical in all isolates, the

GE of the M and L gene was identical (TTAGAAAAAA) also similar in all strains, however, the

GE of F and HN gene (TTAAGAAAAAA) was identical in all isolates. The length of Intergenic

spaces (IGS) of the N-P, P-M, and M-F was found 1 nucleotide, F-HN IGS was 31 nucleotides

and HN-L IGS was 47 nucleotides were observed in all isolates.

103

Gene identities and protein analysis

The deduced amino acid sequences of the F2/F1 cleavage site of fusion protein revealed that all

eleven isolates had typical virulent motifs 112RRQKRF117 with multiple basic amino acids and

phenylalanine residue at position 117, which is a characteristic of velogenic NDV. All eleven

isolates was found to have fusion gene coding sequence (CDS) comprising of 1662 nt coding for

553 amino acids (aa). Major functional domains of F protein was analyzed here, several deduced

amino acid substitutions were identified when compared with consensus sequences (Umali et al.

2014). The neutralizing (D72, E74, A75, K78, A79, and L343) believed to be critical for

structure and function of F protein, and were conserved in all isolates. The signal peptide (1-31

aa) had total of three aa substitutions, C25Y change was common in all four different species,

T17P substitution was only observed in parrots, while I26T was found in pheasant, peacock and

parrots sequences. Analysis of three heptad regions revealed several aa substitutions, HRa region

had single aa changed A176S common in all obtained isolates, HRb had three aa substitutions

(N272Y, I282L, T288N) in all isolates however, only N296K was specific to all five isolates

obtained from backyard chickens, moreover, SFR-144B (backyard) showed 3 (Y276D; Q281P;

I285T) additional aa substitutions in the same region. HRc region had two aa substitutions

(A482T, K494R) common in all isolates, however, except one additional substitution (I474D)

was observed in parakeet/Pak/Rawalpindi/SFR-RP15/2015. Transmembrane domain reveals four

aa substitutions at position V506A, V513F, I516V, and V520G observed in all isolates obtained

in the study. The HN gene length of all isolates had 1716 nt encodes for 571 aa characteristics

feature of virulent NDV. The neutralizing epitopes in HN protein is critically evolved and

revealed four aa substitutions (N199H, N263K, I514V, D569N) observed in all studied isolates.

The HN protein had six potential glycosylation sites at position 119, 341, 433, 481, 508, 538,

104

which were all conserved except at position 508 (N508D) observed in all strains.

Transmembrane domain of HN protein had four aa substitutions (I33M; V34I; T36I; V45A)

(Table 5.3).

Phylogenetic analysis

The phylogenetic analysis of eleven ND isolates obtained in this study and available sequences

from GenBank were carried out on the bases of complete coding sequences of F gene and

complete genome sequences. Utilizing established criteria, all the eleven isolates from different

species were classified as member of sub-genotype VIIi within the genotype VII of class II. Fig

5.1 and Fig 5.2 illustrate that the NDV isolates obtained in this study were clustered together

with the closely related viruses isolated previously from the commercial poultry flocks in Middle

East, Indonesia and Pakistan during 2011-12. The highly similar viruses (98.2-99.7% on the

basis of F gene protein) have been detected in Eastern European countries like Turkey, Georgia

and Bulgaria and Indian peafowl support the existence of fifth panzootic.

Discussion

Northern region of Pakistan may be considered to be a virus epicenter, though for the last two

decades 1970-1990 the southern region of the country was the hub of the poultry industry.

However, the shifting of the industry up North was due to political and law and order situation of

the region. The shifting also change the practice of poultry management as the small size and

open poultry houses vanished and large poultry sheds build as environmentally controlled with a

capacity of half million birds. Moreover, the change of big farming capacity does not affect the

multitude of small backyard farms. The farming includes ducks, geese, parrots and pigeons and

marketed in live birds markets on daily basis. The close proximity of poultry farms and to the

populated areas plays a major role in the transmission and easy access for its multiplication to

105

erupt the NDV. Therefore, the study was designed and proposed to conduct routine surveillance

of ND viruses in the area in different species to prevent the intra- and interspecies vNDV

transmission.

Here, we primarily report the molecular characterization of eleven complete genome of ND

viruses from backyard chickens (n=5), rosy-faced lovebird parrot (n=1), Australian type exotic

parakeets (n=3), pheasant (n=1) and peacock (n=1). Whole genome sequences of field strains of

APMV-1 viruses and later phylogenetic analysis confirmed belonging to potential panzootic

strains of sub-genotype VIIi within genotype VII. These viruses likely originated from Middle

East, Pakistan and Indonesia during 2011-12 (Miller et al. 2015; Wajid et al. 2015) and recently

have been identified in Eastern Europe. The eleven ND viruses in the study revealed high level

of genetic similarity among them (98.2-99.4%) indicating strong epidemiological connection and

suggested introduction from a common source. These isolates are genetically resembled with the

viruses isolated during 2011-2014 from non-poultry species (ducks, peacock and pheasant) and

commercial poultry. Maintenance of the same genotype viruses in the environment up to six

years is puzzling. Wild birds constitute a reservoir of virulent ND viruses of other genotype is

disputable and there is less evidence for its support (Dimitrov et al. 2016). However, it has been

suggested that the vNDV may be maintained in vaccinated poultry (Rehmani et al. 2015).

Peacock and pheasant in this study collected from a public zoo in Lahore city were died due to

vNDV. The same zoo was affected first time in 2011-12 showing the mortality 40-60% (Miller et

al. 2015). Since then application of proper vaccination program minimized the eruption of ND

cases during 2013 to early 2015, however mini-outbreaks could not be stopped during the

investigation period. The immune status assessed by measuring the mean hemagglutinin

inhibition (HI) titers from serum during the study (log2) showed high values ranging from 4.5 to

106

6.7. It has been suggested that antibody titers of log2 HI>4 should protect against the disease

(Van-Boven et al. 2008). The data showed that despite a high level of anti-NDV antibodies titers

of log2 HI>5 in birds, minimized the number of outbreaks but could not stopped the viral

replication.

The repeated isolation of vNDV from these birds suggesting the possibility of urban cycle of

maintenance of vNDV and may be involved in spill-over into other susceptible species. Exotic

parakeets are free ranging birds and have continuious contact with other birds in houses. In the

current study, the NDV isolate parakeet/Pak/Rawalpindi/SFR-RP15/2015 was isolated from

clinically healthy and vaccinated exotic parakeet; the farm was located at vicinity of 100 feet to

the commercial poultry sheds. Interestingly, the virus isolated from the parakeets farm was

genetically closed to the chicken virus that was causing 15% mortality at the poultry farm but not

in the parakeets. The data clearly indicated the interspecies transmission of vNDV from poultry

to parakeet and vice versa, however, genetically closed viruses (99.9%) isolated from both

species indicated that the virus had been transmitted previously. Three NDV isolates from dead

parakeets but from other premises were reported to our laboratory. The farmers who kept these

birds reported no illness, however the mortality was 100% within 48-72 hours with mild signs

and symptoms.

The current scenario of the fifth panzootic is alarming as non-poultry species like pheasants,

peacocks, and parrots; those have never been reported before with such a high incidence rate and

mortality. To the safety of these precious species a strict implementation of the biosecurity rules

and regulations and awareness to the farmers and caretakers is important to minimize the

exposure of vNDV at the farms. The management should hire well trained workers to manage

107

the shed by imposing the strict rules to minimize the virus circulation of virulent NDV in the

enviornment.

Acknowledgment

We thank to Dr. Claudio L Afonso (Newcastle Disease Lead Scientist: SEPRL, Athens, GA,

USA) for his guidance and generous support in active surveillance program for Newcastle

Disease in Pakistan. This is part of collaborative research between South East Poultry Research

Laboratory (SEPRL), Athens, GA and Quality Operations Lab (QOL), University of Veterinary

and Animal Sciences, Lahore, Pakistan.

FUNDING INFORMATION:

The funding for this work was supported by the U.S. Department of Agriculture (agreement 58-

0210-3-009) to Dr. Shafqat Fatima Rehmani and Abdul Wajid for Quality Operation Lab of the

University of Veterinary and Animal Sciences, Lahore, Pakistan.

Authors Contribution

SFR, AW, AB conceived and designed the study. AW, AS, SB, TAK, MFT involved in samples

collection. AW, AB executed the experiment and analyzed the data. All authors interpreted the

data, critically revised the manuscript for important intellectual contents and approved the final

version.

References

Alexander DJ. 2011. Newcastle disease in the European Union 2000 to 2009. Avian Pathol.

40:547-58.

Czeglédi A, Ujvári D, Somogyi E, Wehmann E, Werner O, Lomniczi B. 2006. Third genome

size category of avian paramyxovirus serotype 1 (Newcastle disease virus) and

evolutionary implications. Virus Res. 120: 36–48.

108

Diel DG, da Silva LH, Liu H, Wang Z, Miller PJ, Afonso CL, 2012a. Genetic diversity of avian

paramyxovirus type 1: proposal for a unified nomenclature and classification system of

Newcastle disease virus genotypes. Infect Genet Evol. 12:1770–79.

Khan TA, Rue CA, Rehmani SF, Ahmed A, Wasilenko JL, Miller PJ and Afonso CL. 2010.

Phylogenetic and biological characterization of Newcastle disease virus isolates from

Pakistan. J ClinMicrobiol. 48:1892–94.

Dimitrov KM, Bolotin V, Muzyka D, Goraichuk IV, Solodiankin O, Gerilovych A, Stegniy B,

Goujgoulova GV, Silko NY, Pantin-Jackwood MJ, Miller PJ and Afonso CL. 2016.

Repeated Isolation of Virulent Newcastle Disease Viruses of Sub-Genotype VIId From

Backyard Chickens in Bulgaria and Ukraine Between 2002 and 2013.Arch Virol.

161:3345-53.

Miller PJ, Haddas R, Simanov L, Lublin A, Rehmani SF, Wajid A, Bibi T, Khan TA, Yaqub T,

Setiyaningsih S, Afonso CL. 2015. Identification of new sub-genotypes of virulent

Newcastle disease virus with potential panzootic features. Infect Genet Evol. 29:216 –29.

OIE, 2012.Manual of diagnostic tests and vaccines for terrestrial animals, 7th ed. Office

International des epizooties, Paris, France.

Rehmani SF, Wajid A, Bibi T, Nazir B, Mukhtar N, Hussain A, Lone NA, Yaqub T and Afonso

CL. 2015. Presence of virulent Newcastle disease virus in vaccinated chickens in farms in

Pakistan.J ClinMicrobiol. 53:1715–18.

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: molecular evolutionary

genetics analysis version 6.0. MolBiolEvol. 30:2725–2729.

109

Umali DV, Ito H, Shirota K, Katoh H, Ito T. 2014. Characterization of complete genome

sequence of genotype VI and VII velogenic Newcastle disease virus from Japan.Virus

Gen. 49:89–99.

van-Boven M, Bouma A, Fabri TH, Katsma E, Hartog L, Koch G. 2008. Herd immunity to

Newcastle disease virus in poultry by vaccination. Avian Pathol. 37:1–5.

Wajid A, Wasim M, Rehmani SF, Bibi T, Ahmed N, Afonso CL. 2015. Complete genome

sequence of a recent panzootic virulent Newcastle disease virus from Pakistan. Genome

Announc. 3:e00658-15.

Wajid A, Basharat A, Khan TA, Wasim M, Rehmani SF. 2016b. Complete Genome Sequence of

a Velogenic Newcastle Disease Virus isolated from Clinically Healthy Exotic Parakeet

(Melopsittacusundulatus) in Pakistan. Re: genome Announc. A01581-16

Wajid A, Rehmani SF, Sharma P, Goraichuk IV, Dimitrov KM, Afonso CL. 2016c. Complete

genome sequence of genotype VI Newcastle disease viruses isolated from pigeons in

Pakistan. Genome Announc. 4:e00845-16.

Wajid A, Rehmani SF, Wasim M, Basharat A, Bibi T, Arif S, Dimitrov KM, Afonso CL. 2016a.

Complete genome sequence of a virulent Newcastle disease virus strain isolated from a

clinically healthy duck (Anasplatyrhynchosdomesticus) in Pakistan. Genome Announc.

4(4):e00730-16.

Table 5.1: Description of virulent isolates recovered from domestic and zoo birds in 2015-16

Species Ecotype Scientific

Name Isolate

Year of

Isolation

Sample

type

aClinical

signs

Vaccination

history

Cleavage site

(aa 112–117) bICPI

Accession

number

Chicken Domestic

Gallus

gallusdomesti

cus

BY/Pakistan/Lahore/

SFR-144A/2016 2016 cOS, dCS Yes eNA f112-RRQKRF-117 176 KX791184

Chicken Domestic

Gallus

gallusdomesti

cus

BY/Pakistan/Lahore/

SFR-144B/2016 2016 OS, CS Yes NA 112-RRQKRF-117 179 KX791185

Chicken Domestic

Gallus

gallusdomesti

cus

BY/Pakistan/Lahore/

SFR-144C/2016 2016 OS, CS Yes NA 112-RRQKRF-117 171 KX791186

Chicken Domestic Gallus BY/Pakistan/Lahore/ 2016 OS, CS Yes NA 112-RRQKRF-117 171 KX791187

110

gallusdomesti

cus

SFR-144D/2016

Chicken Domestic

Gallus

gallusdomesti

cus

BY/Pakistan/Lahore/

SFR-144E/2016 2016 OS, CS Yes NA 112-RRQKRF-117 1.86 KX791188

Pheasant Zoo Phasianus

colchicus

Pheasant/Pakistan/Lahore/

AW-Pht/2015 2015 gTra Yes Yes 112-RRQKRF-117 NA KY290561

Peacock Zoo Pavo

cristatus

Peacock/Pakistan/Lahore/

AW-Pck/2015 2015 Tra Yes Yes 112-RRQKRF-117 NA KY290560

Lovebird-parrot Pet Agapornis

roseicollis

Parrot/Pak/Lahore/SFR-129

/2015 2015 Tra NA NA 112-RRQKRF-117 1.70 KX268691

Exotic-Parakeet Pet Melopsittacus

undulates

Parakeet/Pak/Rawalpindi/

SFR-RP15/2015 2015 OS, CS No Yes 112-RRQKRF-117 1.63 KX268688

Exotic-parakeet Pet Melopsittacus

undulates

Parakeet/Pak/Lahore/

SFR-148A/ 2015 2015 Tra Yes NA 112-RRQKRF-117 1.50 KX268689

Exotic-parakeet Pet Melopsittacus

undulates

Parakeet/Pak/Lahore/

SFR-148B/ 2015 2015 Tra Yes NA 112-RRQKRF-117 1.52 KX268690

aClinical signs: Neurological, respiratory and digestive signs were observed with different severity bICPI: Intracerebral pathogenicity index cOS: Oropharyngeal swab dCS: Cloacal swab eNA: Not Applicable fAmino acid symbols: R = arginine, Q = glutamine, K= lysine, F= phenylalanine. gTra: Trachea

Table 5.2: Genome length characteristics of ND viruses isolated from backyard, pet and wild

birds

Table 5.3: Amino acid substitutions in the functional domains of HN and F proteins HN F

23 3 4 14 4 12 2&12 2 Transm. Domain

Signal peptide HRa HRb HRc Transmission

Domain

193-

201 263 287 321

332-

333

346-

353 356 494

513-

521 569 25-45

1-31 143-185 268-299 471-500 501-521

aConsensus LSG

CRD

HSH

N D K GK

DEQ

DYQ

IR

K G/D

RITR

VSSS

S

D

FRIAVLL

LIVMTLA

ISAAALV

MGSKPSTRIPVP

LMLITRIMLILSC

ICLTSS

QANQNAANILRL

KESIAATNEAVHEVTDGLSQLAVA

VGKMQQF

LITGNPILYDSQTQL

LGIQVNLPSVGNLN

NMR

NNSISNALDK

LAESNSKLDKVN

VKLTSTSA

LITYIVLTVISLVFGALSLVL

Lahore/144A - K - - - - - - I514V N I33M;V34I;

T36I;V45A C25Y A176S N272Y;N296K A482T;K494R

V506A;V513F;

A516V;V520G

Lahore/144B - K - - - - - - I514V N I33M;V34I;

T36I;V45A C25Y A176S

N272Y;Y276D;Q281P

;I285TN296K A482T;K494R

V506A;V513F;

A516V;V520G

Lahore/144C - K - - - - - - I514V N I33M;V34I;

T36I;V45A C25Y A176S N272Y;N296K A482T;K494R

V506A;V513F;

A516V;V520G

Lahore/144D - K - - - - - - I514V N I33M;V34I;

T36I;V45A C25Y A176S N272Y;N296K A482T;K494R

V506A;V513F;

A516V;V520G

Lahore/144E - K - - - - - - I514V N I33M;V34I;

T36I;V45A C25Y A176S N272Y;N296K A482T;K494R

V506A;V513F;

A516V;V520G

Lahore/AW-Pht - K - - - - - - I514V N I33M;V34I;

T36I;V45A C25Y A176S N272Y A482T;K494R

V506A;V513F;

A516V;V520G

Lahore/AW-Pck - K - - - - - - I514V N I33M;V34I;

T36I;V45A C25Y A176S N272Y A482T;K494R

V506A;V513F;

A516V;V520G

Lahore/SFR-129 - K - - - - - - I514V N I33M;V34I;

T36I;V45A T17P;C25Y;I26T A176S N272Y A482T;K494R

V506A;V513F;

A516V;V520G

Region Gene start Length of

3′ UTR

Coding

sequence

positions

Coding

Sequence

Length

Length of

5′ UTR Gene end

Intergenic

regions

Length of

complete

gene

Amino acid

length

Leader 1–55 bNA NA NA NA NA NA 55 NA

NP 56-65 56 122-1591 1470 206 1798-1808 1 1753 489

P 1810-1819 73 1893-3080 1188 169 3250-3260 1 1451 395

M 3262-3271 24 3296-4390 1095 102 4493-4502 1 1241 364

F 4504-4513 36 4550-6211 1662 73 6285-6295 31 1792 553

HN 6327-6336 81 6418-8133 1716 185 8319-8328 47 2002 571

L 8376-8385 1 8387-14001 6615 67 15069-15078 NA 6703 2204

Trailer 15079-15192 NA NA NA NA NA NA 114 NA

Complete

Genome 15192

111

R. Pindi/SFR-RP15 - K - - - - - - I514V N I33M;V34I;

T36I;V45A T17P;C25Y;I26T A176S N272Y

I474D;A482T;

K494R

V506A;V513F;

A516V;V520G

Lahore/SFR-148A - K - - - - - - I514V N I33M;V34I;

T36I;V45A T17P;C25Y;I26T A176S N272Y A482T;K494R

V506A;V513F;

A516V;V520G

Lahore/SFR-148B - K - - - - - - I514V N I33M;V34I;

T36I;V45A T17P;C25Y;I26T A176S N272Y A482T;K494R

V506A;V513F;

A516V;V520G

aConsensus: The consensus sequences are copied from the Umali et al. 2014

Figure 5.1:Phylogenetic analysis of NDV isolates was based on complete fusion gene sequence

(1662 nt). The viruses isolated in this study are indicated as Black Square.

KX268689-parrot/Pak/Lahore/SFR-148A/2015 KX268690-parrot/Pak/Lahore/SFR-148B/2015 KX268691parrot/Pak/Lahore/SFR-129/2015 KX268688-parrot/Pak/Rawalpindi/SFR-RP15/2015

KF113339-chicken/Pakistan/Lahore/30/2011 KF113340-chicken/Pakistan/Lahore/32/2011 KF792018-hiken/Israel/2011/1115 818 HQ697254-chicken/Banjarmasin/010/10 KF792020-parrot/Israel/2012/841 824 KF792019-hicken/KY-Israel/2012/50 826 KF113350-chicken/Pak/Lahore/200/2012

KF113346-chicken/Pakistan/Khyber PK/118/2011 KF113348-chicken/Pakistan/Khyber PK/162/2012 KF113350-chicken/Pakistan/Khyber PK/200/2012 HQ697260-chicken/Kudus/018/2010 HQ697259-chicken/Kudus/017/2010 HQ697258-chicken/Sragen/014/2010 HQ697257-chicken/Gianyar/013/2010 KF113343-chicken/Pakistan/Gujranwala/56/2011

KX791184-backyard/Pakistan/Lahore/SFR-144A/2016 KX791185-backyard/Pakistan/Lahore/SFR-144B/2016

KX791187-backyard/Pakistan/Lahore/SFR-144D/2016 KX791186-backyard/Pakistan/Lahore/SFR-144C/2016 KX791188-backyard/Pakistan/Lahore/SFR-144E/2016

KP776462-chicken/Pakistan/Lahore/AW-14/2014 KY290561-pheaant/Pak/Lahore/AW-pht/2015 KY290560-peacock/Pak/Lahore/AW-pck/2015

KF113353-pheasant/Pakistan/Lahore/136/2012

VIIi

AY288998-cockatoo/Indonesia/14698/90 Ancestral JN986837-APMV-1/chicken/NL/152608/93 Ancestral

KF767105-Lory/indonesia/1988/88-08989-523 Ancestral AB605247-chicken/NDV/Bali-1/2007 JX193074-egret/China/Guangxi/2011

HQ697256-chicken/Makassar/003/2009 HQ697261-chicken/bali/020/2010

VIIh

KF767104-cockatoo/Indonesia/1988/87-36724-524 Ancestral KF767106parrot/Indonesia/1976/C300(19625)-520 Ancestral

VIIf-AY028995-chicken/China/A7/1996 VIIf-AF140343-chicken/ND/03/018/2009 VIIf-GQ338310-chicken/China/NDV/03/044/2010 VIIf-DQ858357-chicken/China/YG03/2006

VIIg-FJ608347-chicken/China/XD/Shandong/2008 VIIg-GQ994433-chicken/China/XD/Shandong/2008

VIIg-Q417112-chicken/China/SRZ/2003 VIIg-FJ608337-chicken/China/QG/Hebei/2007

VIIe-DQ485256-chicken/China/Guangxi2/2000 VIIe-DQ485258-chicken/China/Guangxi4/2000

VIIe-EF589134-fowl/China/Guizhou/H2/2000 VIIe-DQ363537-chicken/China/Jinan/2004

VIIb-EF592501-mallard/China/HLJ/34/2005 VIIb-FJ480779-accipiter gularis/China/HLJ070/2006 VIIb- FJ480774-buzzard/China/HLJ009/2006 VIIb-FJ480805-chicken/China/JL/2/2003 VIId-GQ245792-chicken/China/SY-17/2007

VIId-DQ363536-chicken/China/TJ/2005 VIId-FJ480803-chicken/China/JL/2/2003

VIId-DQ363534-chicken/China/SF/2002

VIIb, VIId, VIIe, VIIf, VIIg

XIII-|FJ772494-chicken/Burundi/4132-20/2008 XIII-GU585905-chicken/Sweden/1997 XIII

XII-KC152048-goose/China/GD/450/2011 XII-KC152049-goose/China/GD/1003/2010 XII

Class I: DQ097393 DE-R49/1999

112

Figure 5.2: Phylogenetic analysis of NDV isolates was based on complete genome sequence

(15192 nt). The viruses isolated in this study are indicated as Black Square.

JQ015296 Chicken/China/SD04/2011 JQ015295 Chicken/China/SDWF07/2011

JQ015297 Chicken/China/SDYT03/2011 KJ607170 qu/CH/LJS/101107

JN400895 Duck/China/SD03/2009 JN400897 Chichen/China/SDLY01/2010

JN631747 JS-5-05-Go JN618349 JS-3-05-Ch DQ485231 chicken/China/Guangxi11/2003

JF343539 chicken/China/Guangxi9/2003 DQ485230 chicken/China/Guangxi9/2003

DQ485229 chicken/China/Guangxi7/2002

VIIb

JN986838 APMV-1/chicken/ZA/AL495/04 F473851 Goose paramyxovirus SF02

FJ872531 Muscovy duck/China(Fujian)/FP1/02 JN400896 Chichen/China/SDSG01/2011

JX867334 YZCQ/Liaoning/08 KC461214 chicken/TC/9/2011

KJ600785 Ch/CH/SD/2008/128 GU143550 Go/CH/HLJ/LL01/08

VIId

VIIe KJ607169 go/CH/LHLJ/1/06 JN618348 XJ-2/97 Ancestral

GQ338310 ND/03/044 JF343538 ND/03/018

GQ338309 ND/03/018VIIf

JN986837 APMV-1/chicken/NL/152608/93 HQ697255 chicken/Sukorejo/019/10 VIIh

AY562985 cockatoo/Indonesia/14698/90 Ancestral JX854452 Pheasant/MM20/Pakistan/2011

JX532092 MM19 KY290561-peacock/Pakistan/Lahore/AW-pck/2015 KY290560-pheasant/Pakistan/Lahore/AW-pht/2015

chicken/NDV/Pak/P-14/2014 HQ697254 chicken/Banjarmasin/010/10

KX268689-parakeet/Pakistan/Lahore/SFR-148A/2015 KX268690-parakeet/Pakistan/Lahore/SFR-148B/2015 KX268691-parrot/Pakistan/Lahore/SFR-129/2015

KX268688-parakeet/Pak/AW-RP/2015 KX791184-backyard/Pakistan/Lahore/SFR-144A/2016 KX791187-backyard/Pakistan/Lahore/SFR-144D/2016 KX791185-backyard/Pakistan/Lahore/SFR-144B/2016 KX791186-backyard/Pakistan/Lahore/SFR-144C/2016 KX791188-backyard/Pakistan/Lahore/SFR-144E/2016

VIIi

AB853926 APMV1/chicken/Japan/Osaka/2440/1969 FJ766529 ZhJ-3/97

FJ410147 PPMV-1/Maryland/1984 FJ410145 PPMV-1/New York/1984

AY562988 chicken/U.S.(CA)/1083(Fontana)/72 AY562990 mixed species/U.S./Largo/71

KJ577585 NDV/Chicken/Bareilly/01/10 KF727980 Bareilly KF740478 NDV2K35/CH/TN/2003

KC152048 GD450/2011 KC152049 GD1003/2010 KC551967goose/Guangdong/2010

VI, XII, XIII

113

CHAPTER 6

EXPERIMENT 4

Complete genome sequence of a virulent Newcastle disease virus strain isolated from

clinicallyhealthy duck (Anasplatyrhynchosdomesticus) in Pakistan

Abdul Wajid,a,bShafqat F Rehmani,a Muhammad Wasim,bAsmaBasharat,aTasraBibi,aSaima

Arif,aKiril M Dimitrov,c Claudio L Afonsoc#

Quality Operations Lab, University of Veterinary and Animal Sciences Lahore 54000, Pakistana;

Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences

Lahore 54000, Pakistanb; Exotic and Emerging Avian Viral Disease Research Unit, Southeast

Poultry Research Laboratory, US National Poultry Research Center, ARS, USDA, Athens,

Georgia, USAc

#Address correspondence to Claudio L. Afonso,

Claudio.Afonso@ars.usda.gov

Southeast Poultry Research Laboratory

934 College Station Road

Athens, GA 30605

Phone: (706) 546-3642

FAX: (706) 546-3161

Published in: Genome Announcement 4(4): e00730-16

114

Here we report the complete genome sequence of a virulent Newcastle disease virus

(vNDV)strain, duck/Pakistan/Lahore/AW-123/2015, isolated from apparently healthy laying

ducks (Anasplatyrhynchosdomesticus) from the province of Punjab, Pakistan. The virus has a

genome lengthof 15,192 nucleotides and is classified as member of sub-genotype VIIi, class II.

Newcastle disease (ND) is a highly contagious viral disease in birds caused by virulent strains

ofavian paramyxovirus serotype 1 (APMV-1), also known as Newcastle disease virus (NDV)

(Dimitrov et al. 2016).NDV has a single-stranded negative-sense RNA genome with six

transcriptional units (3ˊ-NP-P-M-F-HN-L-5ˊ). Multiple avirulent and virulent ND viruses have

been isolated from domestic andwild bird species and wild waterfowl are considered to be

natural reservoir of NDVs of lowvirulence (Kim et al. 2007). Although there are some

exceptions (Liu et al. 2003; Wan et al. 2004), generally ducks show no clinical signsof ND when

infected with highly virulent NDV isolates (Miller and Koch, 2013).

As a result of ND surveillance program in different avian species in Pakistan, we isolatedvirulent

NDV strains classified as members of a recently identified sub-genotype VIIi circulatingin

poultry and pet birds in Pakistan (Wajid et al. 2015; Rehmani et al. 2015; Miller et al. 2015).

These viruses are already spread through Asia, theMiddle East and East Europe causing

outbreaks of Newcastle disease with significant illness andhigh mortality in poultry, suggesting

the existence of a fifth panzootic (Dimitrov et al. 2016; Miller et al. 2015). Here we report

thelack of significant genetic changes in the complete genome of viruses previously reported

inchickens that apparently spilled over into ducks. Swabs samples collected from

apparentlyhealthy domestic ducks reared inside a poultry farm were inoculated in 9-to-11-day

115

oldembryonating chicken eggs (NDV specific antibody free). A hemagglutinating sample

wasconfirmed as APMV-1 by hemagglutination inhibition (HI) assay (OIE, 2012). Viral RNA

was extractedfrom the allantoic fluid using TRIzol LS as per manufacturer’s recommendations

(Invitrogen, USA). Reverse transcription was performed using random hexamers and Revert Aid

Premium RT following manufacturer’s protocol (Thermo Scientific, USA). Complete genome

was sequenced as described previously (Wajid et al. 2015) and BioEdit software was used for

sequence assembly and editing (Hall, 1999).The complete genome length of the isolated virus

(designated as duck/Pakistan/Lahore/AW-123/2015) was 15,192 nucleotides. The sequence

analysis of duck/Pakistan/Lahore/AW-123/2015 revealed polybasic amino acid residues between

positions 113 and 116 of the fusion protein cleavage sites and a phenylalanine at position 117

(113RRQKR↓F117). Such amino acid motif of the fusion protein cleavage site is considered typical

for virulent NDV (OIE, 2012). Phylogenetic and comparative analysis revealed high genetic

identity (99.11 and 99.11%) to recently isolated and characterized sub-genotype VIIi strains from

chickens in Pakistan (GenBank accession numbers KM670337 and KP776462, respectively), and

Indonesia - 99.18 % (GenBank accession number HQ697254). Detection of subgenotypeVIIi

viruses in ducks indicates the possibility of transmission of the virus into waterfowl. Current

scenario highlights the importance of a vigilant surveillance program in this region where ND is

endemic.

Nucleotide sequence accession number: The complete genome sequence of NDV strain

duck/Pakistan/Lahore/AW-123/2015 has been deposited inGenBank under the accession

number KU845252.

AKCNOWLEDGEMENTS: Mention of trade names or commercial products in this

publication is solely for the purpose ofproviding specific information and does not imply

116

recommendation or endorsement by the U.S.Department of Agriculture. USDA is an equal

opportunity provider and employer.

FUNDING INFORMATION

USDA| Agricultural Research Service (ARS) provided funding to Claudio L. Afonso under ARS

CRIS project 6040-32000-064. This work was supported by the U.S. Department of State

(USDA/ARS/BEP/CRDF) grants NDV 31063 31063.

REFERENCES

Dimitrov KM, Ramey AM, Qiu X, Bahl J, Afonso CL. 2016. Temporal, geographic, and host

distribution of avian paramyxovirus 1 (Newcastle disease virus). Infect Genet Evol.

39:22-34.

Kim LM, King DJ, Curry PE, Suarez DL, Swayne DE, Stallknecht DE, Slemons RD, Pedersen

JC, Senne DA, Winker K, Afonso CL. 2007. Phylogenetic Diversity among Low

Virulence Newcastle Disease Viruses from Waterfowl and Shorebirds and Comparison of

Genotype Distributions to Poultry-Origin Isolates.J Virol. 81:12641-12653.

Liu XF, Wan HQ, Ni XX, Wu YT, Liu WB. 2003. Pathotypical and genotypical characterization

of strains of Newcastle disease virus isolated from outbreaks in chicken and goose flocks

in some regions of China during 1985-2001. Arch Virol. 148:1387-1403.

Wan HQ, Chen LG, Wu LL, Liu XF. 2004. Newcastle disease in geese: natural occurrence and

experimental infection. Avian Pathol.33: 216 221.

Miller PJ, Koch G. 2013. Newcastle disease, p 89-138.In Swayne DE, Glisson JR, McDougald

LR, Nolan LK, Suarez DL, Nair V (ed), Diseases of Poultry, 13th ed. Wiley-Blackwell,

Hoboken, New Jersey.

117

Miller PJ, Haddas R, Simanov L, Lublin A, Rehmani SF, Wajid A, Bibi T, KhanTA, Yaqub T,

Setiyaningsih S, Afonso CL. 2015. Identification of new sub-genotypesof virulent

Newcastle disease virus with potential panzootic features. Infect Genet Evol.29:216-229.

Rehmani SF, Wajid A, Bibi T, Nazir B, Mukhtar N, Hussain A, Lone NA, Yaqub T,Afonso CL.

2015. Presence of virulent Newcastle disease virus in vaccinated chickens infarms in

Pakistan.J ClinMicrobiol. 53:1715-1718.

Wajid A, Wasim M, Rehmani SF, Bibi T, Ahmed N, Afonso CL. 2015. CompleteGenome

Sequence of a Recent Panzootic Virulent Newcastle Disease Virus from Pakistan.

Genome announcements.3. http://dx.doi.org/10.1128/genomeA.00658-15.

World Organization for Animal Health (OIE). 2012. Newcastle disease. Manual ofdiagnostic

tests and vaccines for terrestrial animals: mammals, birds and bees., Volume 1,Part 2,

Chapter 2.3.14:p 555-574. Biological Standards Commission.World Organizationfor

Animal Health, Paris, France.

Hall TA 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis

program for Windows 95/98/NT. Nucleic Acids SympSer 41:95–98.

118

CHAPTER 7

EXPERIMENT 5

Development and evaluation of plasmid DNA vaccine against Newcastle disease virus: A

comparative study with inactivated and classical vaccines after a virulent challenge

Abdul Wajid1,2, Asma Basharat2, Saima Arif2,3, Abdul Basit3, Javed Muhammad4, Muhammad

Tayyab1, Tahir Yaqub4, Muhammad Wasim1, Shafqat Fatima Rehmani2#

1Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences,

Lahore Pakistan

2Quality Operations Lab, University of Veterinary and Animal Sciences, Lahore Pakistan

3School of Biological Sciences, University of Punjab, Pakistan

4Department of Microbiology, University of Veterinary and Animal Sciences, Lahore Pakistan

Corresponding Author: Shafqat Fatima Rehmani

Quality Operations Lab, University of Veterinary and Animal Sciences, Lahore

119

Abstract

To ful fill the need of an effective vaccine to control the disease outbreak, DNA vaccine was

developed using the local field strain from the recent outbreak of ND, namely Chicken/

SFR/55/NDV/Thokar/Lahore/2012. In the present study, DNA vaccine was developed using the

SFR-55 NDV strain antigens, fusion (F) and hemagglutinin-neuraminidase (HN), namely

pcDNA3.1-F and pcDNA3.1-HN. In vitro expression of both genes construct was assessed by

reverse-transcriptase-PCR (RT-PCR) and western blotting. An inactivated vaccine using the

above mentioned strain (SFR-55) and compare with a commercial NDV LaSota starain for

comparative study. One hundred twenty (120) chcikens were divided into six groups, the first

two groups were immunized with pcDNA3.1-F and pcDNA3.1-HN, respectively, third group

was co-administered with both antigens pcDNA3.1-F and HN. The remaining two groups were

immunized with inactivated (wvSFR-55), through subcutaneously and live attenuated LaSota

vaccines through Eye drop method. The last group was injected with a vector alone. Results

showed that the inactivated and LaSota vaccines provided higher protection (>80%), as

compared to pcDNA3.1-F, pcDNA3.1-HN, pcDNA3.1-Fand HN gave 70%, 75% and 20%

respectively. The co-administration of vector expressing F and HN antigens induced high

immune response, when used alone. No doubt that the protective efficacy of the F construce

based was lower than the conventional LaSota vaccine in commercial poultry. However, the

virus shedding after challenge was low in groups immunized with pcDNA3.1-F, pcDNA3.1-

F+HN when compared with third group immunized with standard LaSota. In summary, the co-

administration of both NDV glycoprotein antigens increased protection than used alone. DNA-

based vaccine can be used safely to reduce mortality and most importantly lower the risk of virus

transmission due to low level of virulent virus shedding.

120

Key words: Newcastle disease, DNA vaccine, fusion protein, hemagglutinin-neuraminidase

protein, inactivated vaccine, LaSota vaccine

Introduction

ND is one of the most devastating diseases of birds in the globe can lead to 100% mortality in

birds susceptible to NDV (Rehmani et al. 2015). Recently, it has been concluded that the

circulating ND virus not only can cause disease in vaccinated birds but can shed the infected

virus in the environment and those birds may act as a reservoir (Rehmani et al. 2015). The

causative agent is avian paramyxovirus type 1 (AMPV-1) is also known as Newcastle disease

virus (NDV) (Wajid et al 2015; Miller et al 2015). All the strains of NDV belongs to a single

serotype in family Paramyxoviridae, genus Avulavirus of the order Mononegavirales(Afonso et

al. 2016). The AMPV-1 viruses are enveloped, non-segmented, negative sense-single stranded

RNA genome of approx. 15.2 kb in length. The genome is containing six protein coding genes

for 3’ leader-NP, P, M, F, HN, L-trailer-5’. NDV has two surface trans-membrane glycoproteins

are F and HN, which form spike like projections. The HN protein is a multifunctional protein is

not only requires for fusion promotion activity (Morrison et al. 1991), also host cell surface sialic

acid-containing receptors attachment. The neuraminidase activity (HA) of HN protein helps in

releasing progeny from the viral infected cells by cleavage the sialic acid-containing cellular

receptors from sugar-side chains (Lamb and Parks, 2007).

The F protein is the main determinant of ND viruses’ pathogenicity. It is synthesized primarily as

a precursor F0 and later activated by the host proteases into disulfide-linked subunits F1 and F2

by recognizing the mono and multi-basic amino acids at F protein cleavage site (Klenk and

Garten, 1994). The fusion protein cleavage site of ND viruses is major determinant of virulence.

121

The ND viruses are divided into three clinicopathologic form, lentogenic (viruses of low

pathogenicity), mesogenic (moderate pathogenicity), the velogenic strains are highly pathogenic

causing severe signs in birds with high mortality up to 100% in fully susceptible flocks (Saif et

al. 2008; Alexander and Senne, 2008). The velogenic strains are further divided into

viscerotropic and neurotropic forms, the viscerotrpic velogenic NDV (vvNDV) strains causing

hemorrhages in the enteric region like Proventriculus, caecal tonsils intestinal lesions, velogenic

neurotropic NDV (nvNDV) form involves respiratory and neurological disorder like tremor and

twisting of neck then followed by moderate mortality rate (Diel et al. 2012). All the strains of

NDV are belongs to a single serotype. The genetic and antigenic diversity is existing in AMPV-1

viruses, historically, there are two major classes, I and II (Diel et al. 2012). Class I contains a

single genotype and class II contains 18 genotypes and some genotypes further divided into sub-

genotypes (Diel et al 2012; Miller et al 2015). Different sub-genotypes in genotype VII, class II

are pre-dominantly found in Asian countries, where it causing high mortalities in susceptible

animals. In Pakistan, since a severe outbreak occurred in Northern regions in 2011-12, a novel

sub-genotype VIIi in genotype VII was identified and now spread and spill-over into pet and

wild birds. The similar viruses were also identified in Indonesia and Middle East and spreading

into East European countries, causing outbreaks of ND with high mortality and support the

existence of fifth panzootic.

The Newcastle disease is endemic in Pakistan, the development of an effective ND vaccine is a

top priority for the country. For decades, Pakistani poultry industry is under threats of ND not

only in commercial poultry production facilities also causing high mortalities in domestic and

wild animals (Wajid et al. 2015; Miller et al. 2015; Wajid et al 2016a, 2016b, 2016c). The recent

severe outbreak of ND during 2011-12, the disease was re-emerged with high severity and

122

caused the loss of 7 M USD. Using the intensive vaccination strategy in the field the incidence of

disease was not low (Rehmani et al. 2016). Since long time, ND LaSota vaccine is commonly

used in the field, several studies have concluded that the currently available ND live attenuated

vaccine formulated from the ND viruses of genotype II, when injected into clinically healthy

animals in adequate vaccine doses offered substantial protection but didn’t prevent viral

replication and shedding (Alexander, 2001; Kapczysnki and King, 2005; Marangon and Busani,

2007; Miller et al 2007, 2013; Cornax et al 2012; Rehmani et al 2015). The failure of standard

vaccines is controversial, as some previous studies suggested the inadequate application of

current vaccines (Dortmans et al. 2012), other studies concluded that the classical vaccine used

in the field genetically divergent from the ND strains causing disease in the field (Miller et al.

2007, 2013; Rehmani et al. 2017). Studies suggested the most reliable avian vaccine is needed

that prevent infection, viral shedding and replication of viruses (Cardenas-Garcia et al. 2016).

Plasmid based DNA vaccine is new-generation vaccines that may overcome the deficits the

traditional antigen-based vaccines. Like live attenuated vaccines, the DNA vaccine has ability to

induce both humoral and cellular immune responses, may act as suitable alternative (Gurunathan

et al. 2000). Several attempts have been made to formulated and evaluated the potential of

plasmid DNA vaccine against challenge ND viruses targeting surface glycoprotein F protein only

or in combination with HN protein (Arora et al. 2010; Sawant et al. 2011; Gowrakkal et al 2015;

; Cardenas-Garcia et al. 2016). Various protection efficacy of plasmid DNA vaccine was

obtained using varied doses, intramuscular route and mostly with two applications (primary and

booster) (Arora et al. 2010; Sawant et al. 2011; Gowrakkal et al 2015; ; Cardenas-Garcia et al.

2016). In the present study, DNA vaccine was developed expressing two surface glycoproteins F

and HN separately in expression vector. The inactivated vaccine was prepared from the NDV

123

strain (SFR-55; sub-genotype VIIi) causing disease in the field. The objective of the current

study was to compare the protection induced by DNA vaccines (in different formulation),

inactivated vaccine and a live attenuated LaSota by assessing viral shedding and post-challenge

morbidity and mortality. Two applications were performed for each group except control

(injected empty vector) and challenged them with live vNDV strain SFR-55.

Material and Method

Viruses

Virulent NDV strain (chicken/Pak/Lahore/SFR-55/2012) shortly designed as SFR-55 was used in

this study as source of fusion (F) and hemagglutinin-neuraminidase (HN) genes to prepare

plasmid DNA vaccine. The SFR-55 virus was isolated from ND outbreak occurred in 2011-12 in

Northern region of Pakistan (Wajid et al 2017), has been classified into a new panzootic sub-

genotype VIIi of genotype VII into class II. The same virus (SFR-55) was used for the

preparation of inactivated oil-based emulsion vaccine and also used as a challenge virus in the

vaccination trials. The intracerebral pathogenicity index (ICPI) in day-old specific NDV-

antibody free chicks of this ND strain was 1.89. The LaSota vaccine, genotype II: company

Medivac LaSota origin Indonesia is used worldwide as a live vaccine and thus is used as a group

of live vaccine in the trial.

Chicken and cells

Two weeks (14 day old) specific NDV-antibody free chickens were used to immunize and

challenge in the said experiment. All chickens in various groups were kept separately. Vero cells

(Extracted from the epithelial cells of African Green Monkey cell) were grown and maintained in

high glucose Dulbecco’s modified Eagle’s media (DMEM) supplemented with 10% fetal bovine

serum (FB Life Technologies/Gibco to Sigma Products), 400 ug/ml geneticin and passage the

124

cells 2 to 4 times to prepare a sufficient number of cell culture and incubated at 37 ˚C under 5%

CO2 incubator. This cell line was used for in vivo experiments and protein expression assay. To

prepare a batch of vaccine working seed for preparing the vaccine batch was prepared. A

sufficient volume according to the required period was prepared in aliquot of master seed.

RNA extraction and Amplification of genes

Total RNA from the HA positive allantoic fluid was extracted using TriZol LS reagent

(Invitrogen, USA). First strand complementary DNA (cDNA) was synthesized using random

hexamer primers through RT-PCR kit (Themro Scientific, USA) as per manufacturer’s protocol.

The NDV F and HN genes were amplified using SuperScript III with Platinum Taq High Fidelity

kit (Invitrogen, USA). The primer sets used for the amplification of targeted F and HN genes

were designed from the published sequences with accession number KM670337 are shown in

Table 1. Both sets of primer specific for F and HN genes were flanked by the same restriction

sites HindIII and XhoI (Table 1). The PCR condition was optimized contain initial denaturation

temperature of 94 ̊C for 5 mints followed by 30 cycles, denaturation at 94 ̊C for one mint,

annealing at 62 ̊C for F gene and 58 ̊C for HN gene and for one mint, polymerization at 68 ̊C for

2 mints and followed by final extension step at 68 ̊C for 10 mints and 4 ̊C as storage step.

Construction of plasmid expressing NDV F and HN genes

NDV F and HN genes were amplified from cDNA of SFR-55 strain and amplicons of both genes

were then subjected to electrophoresis in 1% agarose gel and purified by QIAquick clean

extraction kit (Qiagen, Valencia, CA). The eukaryotic expression vector, the pcDNA™3.1(+)

(cat # V790-20, Invitrogen, USA) was used as back bone for plasmid DNA vaccine. The plasmid

was propagated in DH5α cells and were extracted using GeneJET Plasmid Miniprep Kit

(Thermos scientific). The amplicons of both genes digested with XhoI and HindIII restriction

125

enzymes and then ligated them into the cloning site of pcDNA™3.1(+) was digested with the

similar enzymes. The formulated vector containing SFR-55 F and HN protein genes were named

pcDNA3.1-F and pcDNA3.1-HN. The resulted recombinant plasmids were then transformed into

DH5α cells. Subsequently, single colonies of both genes were grown in LB broth supplemented

with 100 µg/ml ampicillin antibiotic for overnight. The orientation of inserted genes was

confirmed through enzymes as described above and subsequently by sequencing. The

recombinant plasmids were purified using Qiagen Endotoxin Free Plasmid Mega Prep Kit (cat #

12381) as per manufacturer’s recommendations, re-suspended in low TE buffer and quantified

by Nano drop (Thermo Scientific, USA). The purified recombinant plasmids were used in

protein expression and vaccination experiments.

The recombinant plasmids pcDNA3.1-F and pcDNA3.1-HN, while empty pcDNA3.1 vector was

used as negative control were individually transferred 4 μg/well of 6 well plate into 70-80%%

confluent monolayer of Vero cells using lipofectamine 2000 reagent as per manufacturer’s

instructions for transient expression. After 72 hours post transfection, the total RNA of each

replicate of both genes was extracted using TriZol reagent. Primarily, the NDV F and HN genes

expression in the transfected vero cells were tested by RT-PCR via genes specific primer set. The

translated protein expression and production was tested via western blotting using anti-NDV

polyclonal antibodies raised in chickens and anti-Newcastle disease virus antibody, clone HN14f

(cat # MAB80118, Merck Millipore) as primary antibody for F and HN proteins respectively.

Goat anti-chicken Ig Y conjugated to alkaline phosphatase (Abcam, USA) as secondary

antibody.

DNA immunization and challenge experiments

126

Plasmid containing F and HN protein genes used as vaccines and were prepared by diluting into

TE buffer. One vaccine dose of each protein contained 100µg of recombinant plasmid in 200 μl

of TE buffer when immunized separately, while 70µg of each recombinant plasmid in 200 μl of

TE buffer when injected co-administered. Two weeks old 120 NDV-specific antibody free

chickens were divided into six groups, containing 20 birds in each group. Group I was

immunized with pcDNA3.1-F (100 μg/200 μl), group 2 with pcDNA3.1-HN (100 μg/200 μl),

group 3 was co-administered with pcDNA3.1-F (70 μg/100 μl) + pcDNA3.1-HN (70 μg/100 μl),

group 4 with oil-based inactivated vaccine whole virus (wvSFR-55) group 5 with live attenuated

LaSota vaccine and group 6 was kept as control (injected with empty vector alone).

Chickens were immunized through DNA vaccine intramuscularly in the right pectoral muscles.

The inactivated oil-based vaccine was injected subcutaneously, whereas live LaSota vaccine was

used through eye drop method. Two weeks after primary vaccination, all groups were boosted

except control group using the same dose. On 5th day after primary and boosted vaccination 1ml

of blood was drawn from all birds through brachial vein without anticoagulant for serum

collection. Two weeks after booster vaccination, all groups were challenge with virulent NDV

strain SFR-55 (106 EID50/bird) by ocular route. Oropharyngeal and cloacal swabs were collected

from all birds and all groups at 3rd day post-challenge (dpc) for measurement of viral shedding

through quantitative real time PCR (qRT-PCR). Birds were monitored for twelve dpc for clinical

NDV symptoms, morbidity and mortality. At the end of experiment all survived birds were bled

for serology.

Assessment of humoral immune response by HI and ELISA

All the birds from all groups were bled at 5th day after primary and boosted vaccinations. The

hemagglutinin inhibition (HI) test was used as previously defined by OIE (2012). Serial 2-fold

127

dilutions of serum samples were prepared in micro-titer V- shaped plates (Corning, USA). An

equal volume of ND virus containing 4HA units/25 µl was used prior to adding 1% r b c’s

suspension in each well. The HI titer has been expressed as log2, the serum samples highly

immune to NDV causing the complete inhibition of hem agglutination of 1% RBCs up to 7-9

log2. NDV specific antibodies were also assessed by commercially available IDEXX ELISA kit

(IDEXX Laboratories) according to the manufacturer’s recommendation

Statistical analysis

All the experimental data obtained was analyzed using analysis of variance (ANOVA) and

statistical difference was considered at P<0.05. Long Rank test was used to analyze the survival

curve. Two-tailed Z test was performed for evaluation of morbidity results. The significant

differences among groups were denoted by different letters.

Result

Identity of pcDNA3.1-NDVF and pcDNA3.1-NDVHN

The identity of the pcDNA3.1 vector containing NDV F and HN genes were confirmed by DNA

sequencing using a BigDye Terminator v1.1 cycle sequencing kit, yielded 1662 and 1716

nucleotides respectively, which is similar with other ND viruses. Vector and gene-specific

primers were used to sequence full SFR55-F and SFR55-HN genes were found in right region

and orientation in pcDNA 3.1+ vectors.

In vitro expression

The 70% to 80% vero cells in 6 well plates were transfected with pcDNA3.1-F and pcDNA3.1-

HN constructs through lipofectamine reagent as well as empty pcDNA3.1+ vector as a negative

control. At 72 hours post transfection total RNA was isolated through TriZol reagent (Invitrogen,

USA) from the culture cells and were subject to confirmation by RT-PCR using gene-specific

128

primers. Further, we tested the translated recombinant F and HN proteins in cultured cells by

western blotting analysis. The pcDNA3.1-SFR55-F and pcDNA3.1-SFR55-HN recombinant

proteins were detected in supernatants of cell culture were assayed using polyclonal antibodies

specific for F protein and Anti-Newcastle disease virus antibody, clone HN14f (cat #

MAB80118, Merck Millipore) for HN protein. The supernatant of cell culture transfected with

empty pcDNA 3.1 vector was detected with no protein (Fig 1A, 1B).

Assessment of humoral immune response by HI and ELISA test

All birds were bled before vaccination, and the HI titer of all birds was zero to 1, they were

monitored till 14th day pre-vaccination, showed zero titer. On 5th day after primary and boosted

vaccination, all birds were bled from each group and serums were tested for NDV-specific

antibodies by HI and ELISA tests to determine the differences level of immune response among

among pcDNA-F, pcDNA-HN, pcDNA-F+HN, wvSFR55 and LaSota groups (Fig 2A). The non-

vaccinated birds (control group) showed no anti-NDV immune response. After primary

vaccination wvSFR55 (oil-based emulsion) and LaSota groups showed highest HI titer as

compared to any DNA-based vaccine groups. The booster vaccination was done one week after

primary vaccination revealed the same pattern of HI antibody titers. However, in both

applications, the pcDNA3.1-HN vaccinate group showed significantly lower HI antibody titer as

compared to pcDNA3.1-F and pcDNA3.1-F+HN groups (p<0.009). Through ELISA was

evaluated at a serum dilution of 1:500 using an IDEXX ELISA kit (IDEXX Laboratories), Anti-

NDV specific antibodies were detected in all vaccinated groups except pcDNA3.1+ (control

group) and were showed the same pattern as achieved via HI (Fig 2B). All the vaccinated groups

after primary and booster vaccination, the anti-NDV specific antibodies were detected and were

significantly higher as compared to control group (p<0.0001).

129

Assessment of protection by DNA vaccine against challenge by vNDV SFR-55

The groups immunized with different vaccines were observed for morbidity and mortality after

challenge with vNDV strain SFR-55. The mortality in non-vaccinated group was started sharp

after 48 hours, birds showed typical ND signs such as dizziness, floppy wings and stretched legs,

coughing and sneezing accompanied with nasal discharge, greenish diarrhea, the most commonly

signs caused by viscerotropic NDV strains. During observation, 100% of birds injected with

pcDNA3.1 vector were died by 3 dpc with SFR-55. It suggests that the challenge strain was

highly virulent to control birds. The group immunized with pcDNA3.1-HN was led to

significantly higher morbidity (85%) upon challenge than the administration of pcDNA3.1-F,

pcDNA3.1-F+HN, wvSFR55, LaSota vaccines that showed no significance difference in

percentage of morbidity (Fig 1D). The vaccinated group pcDNA3.1-HN revealed only 20%

survival rate against the challenge vNDV, very low as compare to survival rate of LaSota

vaccine (85%) was high as compare to pcDNA3.1-F, pcDNA3.1-F-HN, oil-based emulsion

wvSFR55 with 70%, 75%, 80% respectively (Fig 1C).

Assessment of oral and cloacal viral shedding after post-challenge

Oral and cloacal swabs from all animals at 3 dpc were collected to compare the challenge virus

shed from vaccinated and non-vaccinated birds. The birds in groups vaccinated with pcDNA3.1-

F, pcDNA3.1-F+HN and oil-based emulsion wvSFR-55 were shed the challenge virus

significantly low as compare to control group at 3 dpc. Most importantly, the groups vaccinated

with plasmid DNA either pcDNA3.1-F alone or co-administered with pcDNA3.1-HN shed less

virus than the LaSota group and pcDNA3.1-HN vaccinated group (Fig 3A, 3B). However, there

was no significant difference was observed between groups vaccinated with pcDNA3.1-F,

130

pcDNA3.1-F+HN and oil-based emulsion wvSFR-55 in term of oral and cloacal viral shedding

at 3 dpc.

Discussion

In the present study, we focused on the efficacy of different vaccines including the DNA

vaccines, prepared from the circulating ND virus, an oil based inactivated vaccine and

commercially available LaSota vaccine. The study was aimed to determine the antibody titers

induce by DNA vaccine formulated with two surface glycoprotein genes of SFR-55 NDV strain,

co-administered or injected separately. Second objective was to determine the amount of virus

shed by various vaccinated groups after challenge with live virulent ND strain SFR-55 and study

the effect of these vaccines on immune status and protection against challenge virus in chickens.

A rapid growth in the poultry industry during the last three decades the challenges faced by the

industry also became ambigious. Newcastle disease is endemic in this region, a common man

who kept the chickens is familiar with the sign and symptoms of the disease. However, the

scenario is changed when the chiken farming became a second largest industry in the country.

The investment of more than Rs.10 billion shook the industry due to a severe outbreaks of ND in

the Northern region of the country in 2011-12, The outbreak causing losses in the broiler

industry, pet and wild birds (Miller et al 2015) and lossese were more tha US $ 6,00 M. The

incidence of disease has continued in poultry production facilities despite the intensive

vaccination program,

The currently available classical live attenuated vaccine is able to induce sufficient antibodies

level (log2 >4) and protect the birds from morbidity and mortality but could not stop the disease

incidence (Rehmani et al 2015). The current incidence of ND in all production facilities is the

proof of classical vaccine failure. The ND strains belong to these classic live vaccine is from

131

genotype II isolated in 1940s (Goldhaft, 1980). The classical vaccine strain is genetically distant

from the virulent ND viruses currently circulating in the field in most region of the world (V, VI,

VII, XIII) (Miller et al 2015; Wajid et al 2016b). Several studies concluded that the currently

available ND live vaccine when administered into healthy birds, offer substantial protection but

do not stop viral replication and shedding (Miller et al 2009).

In this study, we developed plasmid DNA vaccine expressing NDV fusion (F), hemagglutinin-

neuraminidase (HN) protein genes identical to the circulating NDV strains (SFR-55, belongs to

sub-genotype VIIi, genotype VII). The results in case of morbidity, mortality, anti-NDV

antibody titer and viral shedding were compared with an oil emulsion inactivated vaccine of

(sub-genotype VIIi) and commercial live LaSota ND vaccine. The survival rate of birds

vaccinated with pcDNA3.1-F, pcDNA3.1-F+HN, whole virus SFR55 (wvSFR55) and LaSota

strain was varied as 70%, 75%, 80% and 85% respectively after two doses of vaccines. However,

the group vaccinated with the plasmid expressed pcDNA3.1-HN group showed only 20%

protection. Our resulst are more or less similar to the findings of Sawant et al (2011). The results

indicate that co-administeration of both plasmids expressing NDV antig enic determinant

proteins F and HN induced high protection in birds than alone. The present research work also

showed the similar result as obtained previously by Arora et al (2010), co-administration of

NDV/F and NDV/HN proteins induced 73% protection as compare to 66% and 20% by NDV/F

and NDV/HN respectively alone. Another study by Gowrakkal et al (2015), the birds immunized

with F and HN alone revealed 60% and 20% survival rate as compared to co-administration of

both proteins was 80%. Recently study by Cardenas-Gracia (2016) observed 83% protection

when birds were immunized with F protein alone after two vaccine application.

132

The birds were bled at 5th day after first and second application for serum antibody level by

hemagglutination-inhibition (HI) and ELISA assays. The birds after having two applications,

inactivated vaccine and LaSota groups showed highest serum NDV-specific antibody titer as

compared to any DNA-based vaccine groups. However, in both applications, the pcDNA3.1-HN

vaccinate group showed significantly lower antibody titer as compared to pcDNA3.1-F and

pcDNA3.1-F+HN groups (p<0.009). Most interestingly, the group vaccinated with only the

vector expressing the F protein showed low serum antibody titer as compared to when co-

administered with pcDNA3.1-HN, it may be due to broader spectrum of epitopes contained in

two immunizing antigens (Sawant et al 2011). However, there was no significant difference in

the geometric mean antibody titer between these two groups. Previous studies also indicate that

two applications with plasmid encoding both NDV glycoproteins F and HN required to induce

higher serum antibody level and could protect the birds when challenged with virulent NDV

strain (Loke et al 2005; Sawant et al 2011).

The trial for the viral shedding, via the oral secretions and fecal samples collected from all

groups of birds, at 3 dpc to examine and compare the virus load from vaccinated and non-

vaccinated birds. The viral shedding was quantified by RT-PCR using gene specific primers and

probe-based for F gene from extracted mRNA. Vaccination with pcDNA3.1-F, pcDNA3.1-

F+HN and oil-based emulsion wvSFR-55 groups had significantly reduced the viral shedding

from oral and cloacal swabs as compared to the control group at 3 dpc (Fig 3A, 3B). Most

importantly, the groups vaccinated with plasmid DNA either pcDNA3.1-F alone or co-

administered with pcDNA3.1-HN shed less virus than the LaSota group and pcDNA3.1-HN

vaccinated group, the later may be due to low NDV-specific antibodytitres/protection level (Fig

3A, 3B). However, there was no significant difference was observed between groups vaccinated

133

with pcDNA3.1-F, pcDNA3.1-F+HN and oil-based emulsion wvSFR-55 in term of oral and

cloacal viral shedding at 3 dpc. However, high oral and cloacal viral shed while using

commercial LaSota vaccine may be due to antigenic distance of the vaccine strain as compared

to field virus as defined by the genetic distance and phylogenetic analysis (Miller et al 2007). It

can influence the amount of virus shed when challenged with NDV strain isolated from the field.

So the vaccinated birds with LaSota may be protected from morbidity and mortality, they can

transmit the challenge NDV to unvaccinated birds and cause outbreak.

In conclusion, the co-administration of both NDV glycoprotein antigens enhanced the protection

than a singled one. DNA-based vaccine can be used safely to reduce mortality and most

importantly lower the risk of virus transmission through virus shedding as well as the reversion

of vaccine strain into virulent form of NDV to challenge the susceptible poultry population in the

field.

Funding

All this work was done under the grant 58-0210-3-009 supported by U.S. Department of

Agriculture to Dr. Shafqat Fatima Rehmani, Abdul Wajid and Asma Basharat for Quality

Operation Laboratories, UVAS, Lahore

Acknowledgment

The authors would like to thank to Dr. Claudio L Afonso (Newcastle Disease lead Scientist,

SEPRL, Athens, GA, USA) for his plentiful support, ideas and guidance in disease control

program in Pakistan. We also thank to Mr. Mudassar Hussain for his technical assistance and

help in animal care.

References

134

Afonso CL, Amarasinghe GK, Banyai K, Bao Y, Basler CF, Bavari S, Bejerman N, Blasdell KR,

Briand FX, Briese T, Bukreyev A, Calisher CH, Chandran K, Cheng J, Clawson AN,

Collins PL, Dietzgen RG, Dolnik O, Domier LL, Durrwald R, Dye JM, Easton AJ,

Ebihara H, Farkas SL, Freitas-Astua J, Formenty P, Fouchier RA, Fu Y, Ghedin E,

Goodin MM, Hewson R, Horie M, Hyndman TH, Jiang D, Kitajima EW, Kobinger GP,

Kondo H, Kurath G, Lamb RA, Lenardon S, Leroy EM, Li CX, Lin XD, Liu L,

Longdon B, Marton S, Maisner A, Muhlberger E, Netesov SV, Nowotny N, Patterson

JL, Payne SL, Paweska JT, Randall RE, Rima BK, Rota P, Rubbenstroth D, Schwemmle

M, Shi M, Smither SJ, Stenglein MD, Stone DM, Takada A, Terregino C, Tesh RB,

Tian H, Tomonaga K, Tordo N, Towner JS, Vasilakis N, Verbeek M, Volchkov VE,

Wahl-Jensen V, Walsh JA, Walker PJ, Wang D, Wang LF, Wetzel T, Whitfield AE, Xie

JT, Yuen KY, Zhang YZ, Kuhn JH. 2016. Taxonomy of the order Mononegavirales:

update 2016. Arch Virol. 161(8): 2351–2360.

Alexander DJ, Senne DA. 2008. Newcastle disease virus and other avian paramyxoviruses. In:

Dufour-Zavala, Swayne DE, Glisson JR et al., editors. A Laboratory Manual for the

Isolation, Identification and Characterization of Avian Pathogens.5th ed. American

Association of Avian Pathologists, Jacksonville, Fla, USA. p. 135-141.

Alexander DJ. 2001. Gordon memorial lecture. Newcastle disease. Br Poult Sci. 42(1): 5-22.

Arora P, Lakhchaura BD, Garg SK. 2010. Evaluaion of immunogenic potential of 75kDa and

56kDa proteins of newcastle disease virus (NDV). Indian J Exp Biol. 48(9): 889-895.

Cardenas-Garcia S, Dunwoody RP, Marcano V, Diel DG, Williams RJ, Gogal RM Jr, Brown

CC, Miller PJ, Afonso CL. 2016. Effects of Chicken Interferon Gamma on Newcastle

135

Disease Virus Vaccine Immunogenicity. PLoS One. 11(7): e0159153.

doi:10.1371/journal. pone.0159153.

Cornax I, Miller PJ, Afonso CL. 2012. Characterization of live LaSota vaccine strain-induced

protection in chickens upon early challenge with a virulent Newcastle disease virus of

heterologous genotype. Avian Dis. 56(3): 464-470.

Diel DG, da Silva LH, Liu H, Wang Z, Miller PJ, Afonso CL. 2012. Genetic diversity of avian

paramyxovirus type 1: proposal for a unified nomenclature and classification system of

Newcastle disease virus genotypes. Infect Genet Evol. 12(8): 1770–1779.

Goldhaft TM. 1980. Historical note on the origin of the La Sota strain if Newcastle disease virus

Avian Dis. 24: 297–30.

Gowrakka M, Vijayarani K, Kumanan K, Uttarkumar A. 2015. Determination of immune

potentials of recombinant fusion and recombinant haemagglutinin-neuraminidase

antigens of Newcastle Disease virus (NDV). 4 (1): 575-588.

Kapczynski DR, King DJ. 2005. Protection of chickens against overt clinical disease and

determination of viral shedding following vaccination with commercially available

Newcastle disease virus vaccines upon challenge with highly virulent virus from the

California 2002 exotic Newcastle disease outbreak. Vaccine. 23(26): 3424-3433.

Klenk HD, Garten W. 1994. Host cell proteases controlling virus pathogenicity.Trends

Microbiol. 2: 39-43.

Lamb RA, Parks GD. 2007. Paramyxoviridae: The viruses and Their Replication. In:

KnipeDM,Howley PM, editors. Fields Virology. Philadelphia: Lippincott Williams&

Wilkins, a Wolters Kluwer Business. pp. 1449–1496

136

Loke CF, Omar AR, Raha AR, Yusoff K. 2005.Improved protection from velogenic Newcastle

disease virus challenge following multiple immunizations with plasmid DNA encoding

for F and HN genes. Vet Immunol Immuno pathol. 106(3-4): 259–267.

Marangon S, Busani L. 2007. The use of vaccination in poultry production. Rev Sci Tech. 26(1):

265-274.

Miller PJ, Afonso CL, Attrache JE, Dorsey KM, Courtneya SC, Guoc Z, Kapczynski DR. 2013.

Effects of Newcastle disease virus vaccine antibodies on the shedding and transmission

of challenge viruses. Devel Comp Immun. 41(4): 505–513

Miller PJ, Estevez C, Yu Q, Suarez DL, King DJ. 2009. Comparison of viral shedding following

vaccination with inactivated and live Newcastle disease vaccines formulated with wild-

type and recombinant viruses. Avian Dis. 53(1): 39–49.

Miller PJ, Haddas R, Simanov L, Lublin A, Rehmani SF, Wajid A, Bibi T, Khan TA, Yaqub T,

Setiyaningsih S, Afonso CL. 2015. Identification of new sub-genotypes of virulent

Newcastle disease virus with potential panzootic features. Infect Genet Evol. 29: 216 –

229.

Miller PJ, King DJ, Afonso CL, Suarez DL. 2007. Antigenic differences among Newcastle

disease virus strains of different genotypes used in vaccine formulation affect viral

shedding after a virulent challenge. Vaccine. 25(41): 7238–7246.

Morrison T, McQuain C, McGinnes L. 1991. Complementation between avirulent Newcastle

disease virus and a fusion protein gene expressed from a retrovirus vector: requirements

for membrane fusion. J. Virol. 65:813–822

137

Rehmani SF, Wajid A, Bibi T, Nazir B, Mukhtar N, Hussain A, Lone NA, Yaqub T, Afonso CL.

2015. Presence of virulent Newcastle disease virus in vaccinated chickens in farms in

Pakistan. J ClinMicrobiol. 53(5): 1715–1718.

RehmaniSF, AWajid, T Bibi, TA Khan, NA Lone, H Habib, S Naureen 2017. Effect and

preparation of Newcastle disease vaccine from different genotypes to evaluate their

efficacy and viral shedding after a virulent challenge.Accepted in J Anim Plant Sci.

Saif YM, FadlyAM, Glisson JR, McDougald LR. 2008. Newcastle disease, other avian

paramyxoviruses, and pneumovirus infections. In: Diseases of Poultry. 12th ed.

Blackwell Publishing Professional, Ames, Iowa, USA. p. 75-93.

Sawant PM, Verma PC, Subudhi PK, Chaturvedi U, Singh M, Kumar R, Tiwari AK. 2011.

Immunomodulation of bivalent Newcastle disease DNA vaccine induced immune

response by co-delivery of chicken IFN-Ƴ and IL-4 genes. Vet ImmunolImmunopathol.

144(1-2): 36-44.

Wajid A, Dimitrov KM, Wasim M, Rehmani SF, Basharat A, Bibi T, Arif S, Yaqub T, Tayyab

M, Ababneh M, Sharma P, Miller PJ, Afonso CL. 2017. Repeated isolation of virulent

Newcastle disease viruses in poultry and captive non-poultry avian species in Pakistan

from 2011 to 2016.Prev Vet Med.In press.

Wajid A, Wasim M, Rehmani SF, Bibi T, Ahmed N, Afonso CL. 2015. Complete genome

sequence of a recent panzootic virulent Newcastle disease virus from Pakistan. Genome

Announc.3(3).pii: e00658-15. doi: 10.1128/genomeA.00658-15.

WajidAa, Rehmani SF, Wasim M, Basharat A, Bibi T, Arif S, Dimitrov KM, Afonso CL. 2016.

Complete genome sequence of a virulent Newcastle disease virus strain isolated from a

138

clinically healthy duck (Anasplatyrhynchosdomesticus) in Pakistan. Genome

Announc.4(4).pii: e00730-16. doi:10.1128/genomeA.00730-16.

Wajid Ab, Rehmani SF, Sharma P, Goraichuk IV, Dimitrov KM, Afonso CL. 2016. Complete

genome sequence of genotype VI Newcastle disease viruses isolated from pigeons in

Pakistan. Genome Announc.4(4).pii: e00845-16. doi:10.1128/genomeA.00845-16.

Wajid Ac, Basharat A, Khan TA, Wasim M, Rehmani SF. 2017. Complete genome sequence of a

velogenic Newcastle disease virus strain isolated from clinically healthy exotic parakeet

(Melopsittacus undulatus) in Pakistan. Genome Announc. 0(999):e01581-16.

Table 1: Sequence of Primers used in the study

Primers Sequences (5’-3’)

Flanked by

restriction enzyme

Accession number &

Reference

NDV-F-F AGGAAGCTTATGGGCTCCAAACCTTCTAC HindIII KM670337, this study

NDV-F-R GCGCTCGAGTCACGCTCTTGTGGTGGCTC XhoI KM670337, this study

NDV-HN-F AGGAAGCTTATGAGCCGCGCGGTCAA HindIII KM670337, this study

NDV-HN-R GCGCTCGAGTTAAGCCCTATTATCCTTGAGGA XhoI KM670337, this study

139

Figure 1: Characterization and evolution of DNA vaccination system. Vero cell culture

supernatants were tested by western blotting for the presence of F (A), and HN protein (B).

Mortality curve (C) and morbidity (D) were evaluated of different vaccinated groups. The

statistical difference was considered with a p<0.05.

Figure 2: NDV-specific mean HI antibody titer in the pre-chalnege serum samples of all

immunized groups (A), and ELISA was also performed (B). The statistical difference was

considered with a p<0.05.

Figure 3: Oropharyngeal (A) and Cloacal (B) swabs samples were collected 3dpc to measure the

amount of challenge viru shed. The statistical difference was considered with a p<0.05.

140

CHAPTER 8

SUMMARY

Newcastle disease (ND) is one of the most contagious diseases of poultry worldwide. The

disease is endemic in Pakistan and recurrent outbreaks have been reported in commercial poultry

flocks, domestic pet and migratory birds since 1963 an inception of commercial poultry farming

in the country. Disease surveillance is necessary to determine the incidence of the disease as well

as to identify the etiological agent of the disease status in the region. The analysis of the field

data provides a clue for the higher authorities to take steps for the remedy of the devastating

outbreak. A virulent form of Newcastle disease virus caused an outbreak in the northern region

of Pakistan during the mid of 2011. The virus was identified as a virulent viscerotropic vvNDV

and characterize, belonging to the sub genotype VIIi. However, the virus of this genotype is still

circulating in the field though the intensity of the strain to succumb the chickens to cause

mortality does not exist. The particular thing in this genotype was its susceptibility to other avian

species like pheasants, peafowls, ducks turkeys, peacocks, sparrows and parakeets. As this

genotype is circulating since 2011 2016 and still spill over in these avian species. Thus for the

last five years (2011-16), 3500 healthy, diseased and dead chickens, pheasants, peacocks,

turkeys, peafowls, ducks, sparrows, exotic parakeets, rosy-faced parrots, pigeons, and partridges

from 750 different locations s were monitored. Samples were collected from the Northern region

of the country Punjab, Khyber Pakhtoonkhawa, Azad Kashmir, including Gilgit,Baltitssan and

from Southern region, Karachi, Hyderabad , Mirpursakro and other small cities where the poultry

farms are located. The samples were collected by the local veterinarians, poultry Assistants and

Animal health practitioners who assist during the surveillance program. Samples were also

collected from the farmers who brought their birds for inspection in the lab with the details of the

141

farm. Mostly sampling was done where there was reports of NDV outbreak, tissues were

collected usually the trachea, spleen and brain, moreover, the pharyngeal and cloacal swabs not

only from the infected birds but also from the healthy birds were collected to assess the virus

shedding in the flock. Blood samples were also collected (1% of the birds at farm), for serum

collection to assess the immune status of the flock using Haemagglutination Inhibition (HI) test

and Enzyme linked immunosorbant assay (ELISA). The Survey Form meet the international

standard was filled for each farm for recording the information required to find the diagnostic

clue as well as the molecular characterization of the isolates. Pool of five pharyngeal swabs were

processed after the passage into 9-day old chicken embryonated eggs and confirming the positive

HA test and then confirmed by real time PCR (RT-PCR). In addition, sera were tested against

NDV by HI and ELISA tests. The targeted samples were sequenced by complete fusion gene and

whole genome using 22 pairs of overlapping primers. The observations indicated that the

commercial broiler industry is highly susceptible to virulent NDV and confirmed by data

available in the laboratory in the survey form. Contrary to that a little is known regarding the

maintenance and enzootic trends of vNDV infection level in domestic and wild birds. Poor

strategy of the use of vaccines and vaccination as well as the existence of virulent form of NDV

in the domestic and pet birds indicate a possibility of the root cause of the ND eruption in the

developing countries. A continuous isolation of virulent viruses of the panzootic Newcastle

disease virus of sub-genotype VIIi since (2011-2016 from commercial chickens and from various

other avian species in the country provide evidence for the existence of epidemiological links

intermingling of the strain among them. Therefore, to avoid the huge economical losses in the

commercial poultry the second largest industry in Pakistan, their close proximity should be

strictly avoided. The mass vaccination of the poultry flocks is in practice in all commercial

142

poultry farms in Pakistan. However, the use and availability of a reliable and standard vaccine, as

well as the correct usage of vaccine dose of the live attenuated LaSota vaccine are the key factors

to improve their efficacy in the field. Minor outbreaks have been occurring in the field even

though a severe outbreak was occurred in 2011-12 collapsed the poultry industry with other pet

and wild birds. To minimize the continuity of these minor outbreaks in the field for long time

there is a need for more effective vaccine to control the particular genotype of the ND virus. In

the present study, DNA vaccine was developed using the SFR-55 NDV strain antigens, in the

form of fusion (F) and hemagglutinin-neuroaminidase (HN), namely pcDNA3.1-F and

pcDNA3.1-HN. In vitro expression of both genes construct was assessed by reverse-

transcriptase-PCR (RT-PCR) and western blotting. In the trial an inactivated oil-based emulsion

vaccine was prepared using the field strain SFR-55 and compare with the commercial vaccine

LaSota strain commonly used by the poultry industry. Birds were divided into six groups, the

first two groups were immunized with pcDNA3.1-F and pcDNA3.1-HN alone respectively and

third group with was vaccinated with both antigens pcDNA3.1-F+HN. The other two groups

were immunized with inactivated (wvSFR-55) and LaSota vaccines as described above, the last

group was injected with empty vector as control. The birds were immunized twice at 14 and 21

days of age intramuscularly (DNA vaccine), subcutaneous and eye-drop by inactivated and

LaSota vaccines respectively. The birds were challenged with live virulent NDV strain using a

dose of 10,000 ELD50/0.1ml per chicken. Results indicate that Inactivated and LaSota vaccines

provided high protection (>80%), as compared to pcDNA3.1-F, pcDNA3.1-HN, pcDNA3.1-

F+HN gave 70%, 75% and 20% respectively. There was 100% mortality in control chickens.

The administration of two vectors expressing F and HN antigens induced high immune response,

and provide protection than when used separately. However, the groups immunized with

143

pcDNA3.1-F, pcDNA3.1-F+HN and inactivated vaccine resulted in lower amount of virulent

virus shed after challenge when compared to the group immunized with standard LaSota. In

summary, the co-administration of both NDV glycoprotein antigens increased protection than

use separately. DNA-based vaccine can be used safely to reduce mortality and most importantly

lower the risk of virus transmission due to decreased level of virulent virus shedding.

144

APPENDICES