View
28
Download
1
Category
Tags:
Preview:
DESCRIPTION
Gene Technology. Human manipulation of the DNA code of an organism in order to: Make transgenic organisms (done using recombinant DNA) Clone an organism Perform Gene therapy. Genetic Engineering. Organisms which express a gene from another organism. Transgenic Organisms. - PowerPoint PPT Presentation
Citation preview
Human manipulation of the DNA code of an organism in order to:
Make transgenic organisms (done using recombinant DNA)
Clone an organism
Perform Gene therapy
Organisms which express a gene from another organism
Insert gene of interest into another organism, receiving organism now makes the protein from that gene
EXAMPLE:
DNA alteration is done in plants to develop seeds which are resistant to herbicides the farmer sprays to destroy weeds.
Plants with “resistance” genes or “insecticide genes”
Cows with extra copies of growth hormones
Insulin making bacteria
Cool glow in the dark mice (or worms)!
Diabetes: mutated insulin gene which creates a dysfunctional insulin protein;
RESULT: no or low amounts of insulin protein made
QUESTION: How can we get insulin that is of “consistent strength”, high purity and easy to make in large quantities (low cost).
Bacteria have circular pieces of DNA called Plasmids
They can replicate, transcribe and translate any genes on the plasmid
We can actually take out the plasmid, add genes and reinsert the plasmid into the bacteria
In plasmids there are specific sequences called restriction sites. Restriction sites are locations on a DNA molecule containing specific sequences of nucleotides
restriction site
Restriction enzymes recognize the sites and cut the DNA at that site
Each restriction enzyme recognizes and cuts a different sequence
Examples: Restriction Enzyme Restriction Site
EcoRI GAATTC
Hind III AAGCTT
BamH1 GGATCC
Restriction enzymes recognize the sites and cut one strand of the DNA at that site
CACCTAGCTAG AATTCGACTAGCGAT
GTGGATCGATCTTAA GCTGATCGCTA
CACCTAGCTAG AATTCGACTAGCGAT
GTGGATCGATCTTAA GCTGATCGCTA
CACCTAGCTAGAATTCGACTAGCGAT
GTGGATCGATCTTAAGCTGATCGCTA
CACCTAGCTAG AATTCGACTAGCGAT
GTGGATCGATCTTAA GCTGATCGCTA
–Want to bind to complementary bases
We can take advantage of this and insert any gene we want into the breaks
Insulin
What enzyme can we use to “seal the gaps” between plasmid DNA and insulin DNA?
Insulin
Ligase
Put plasmid back into bacteria (a process called transformation)
Bacteria will transcribe and translate our insulin gene even though the insulin protein doesn’t do anything for a bacterial cell.
Then we can take out the insulin protein and use it to treat diabetics.
Step 1. ____Isolate_________ the plasmid DNA and human (or other ) gene of interest
Step 2 Use ___restriction___ enzymes to cut both the __plasmid__ and the gene DNA you wish to insert
Step 3. Seal the sticky ends using ____DNA Ligase___________
The recombinant DNA plasmids are then reinserted and reincorporated into the bacteria.
Recombinant DNA (rDNA) is DNA that has been created artificially. DNA from two or more sources is incorporated into a single recombinant molecule.
Better Crops (drought & insect resistance) Larger livestock (cows, chickens, hogs) Recombinant Vaccines (ie. Hepatitis B) Prevention and cure of sickle cell anemia Prevention and cure of cystic fibrosis Production of clotting factors Production of insulin Plants that produce their own insecticides Germ line and somatic gene therapy
An organism that is genetically identical toits parent
Mammals usually fuse info from two parents (sexual reproduction)
Cloning takes all the chromosomes from 1 parent, (but does use “different cells”)
Sheep 1 Take 1 body cell (udder)
Extract Nucleus
Sheep 2 Take 1 egg cell Remove nucleus
Inject nucleus into Egg
Zap to stimulate cell division
Implant embryo into surrogate sheep
(sheep 3)
Which sheep is Dolly identical to??
Why?
Which sheep have to be female?
Somatic cell (2N chromosomes) was used from one animal (this is who we are cloning).
We extract and keep the nucleus (get rid of the rest)
Egg cell from a second animal (nucleus contains only 1n chromosomes)
Extract and get rid of nucleus and keep the cell
Fuse the two together zygote put into a 3rd sheep to gestate.
Scientific experimentation
Maintain a genetic line (good sire or dam)
Two mini clone pigs, nine days after they were born. Their internal organs are quite similar with those of human beings and are used for organ transplant experiments.
Coming next?????
What it did do: Tell us each an every nucleotide of the human genome (all 3.2 billion) GOALS WERE: identify all the approximately 20,000-25,000 genes in human DNA, determine the sequences of the 3 billion chemical base pairs that make up human
DNA, store this information in databases, improve tools for data analysis, transfer related technologies to the private sector, and address the ethical, legal, and social issues (ELSI) that may arise from the project.
What it did not do: Tell us what it all means!!!
Now we have to break it down and determine:
- which pieces are genes - which pieces are junk - what info the genes hold.
Bioinformatics
The application of computer science to the field of molecular biology.
Bioinformatics now includes the creation and advancement of databases, algorithms, computational and statistical techniques, and theory to solve formal and practical problems arising from the management and analysis of biological data.
BLAST finds regions of similarity between biological sequences.
You can use a sequence of nucleotides (nucleotide BLAST) or amino acids (protein BLAST)
For example, following the discovery of a previously unknown gene in the mouse, a scientist will typically perform a BLAST search of the human genome to see if humans carry a similar gene;.
Each of you has similar genes, but within the genes are unique sequences that identify “you”
You receive some sequences from your mother, and some from your father.
In most offspring, some can be seen from each parent. We can establish paternity, guilt, etc.
Used to compare two people’s DNA Used in paternity cases Used for crime scene analysis
Based on the idea that EVERYONE’s DNA is unique, like a fingerprint
BUT related individuals will have more similarities
HOW IS A FINGERPRINT DONE?
Get a sample of DNA and digest it with restriction enzymes
If everyone’s DNA is unique, the enzyme will cut each persons DNA differently
Example: TCATGAATTCATTGCCGAATTCCGTGAATCCAGAATTCGGA
CTA
TCATGAAGTCATTGCCGAATTCCGTGAATCCAGACTTCGGACTA
Run cut up DNA on through electrophoresis Click here for animation
Small pieces travel fast and move further down the gel slab.
Large pieces move slower and stay closer to the injection point.
A DNA ladder is a solution of DNA molecules of different lengths used in agarose gel electrophoresis. It is applied to an agarose gel as a reference to estimate the size of unknown DNA molecules.
Although 99.9% of human DNA sequences are the same in every person, enough of the DNA is different to distinguish one individual from another, unless they are monozygotic twins.[2]
DNA profiling uses repetitive ("repeat") sequences that are highly variable,[2] called variable number tandem repeats (VNTRs), VNTR locations on a gene (loci) are very similar between closely related humans, but so variable that unrelated individuals are extremely unlikely to have the same VNTRs.
While DNA in all humans is similar there are differences
DNA fingerprinting can be used to identify a child’s parents.
In this example (next page) , a family consists of a mom and dad, two daughters and two sons. The parents have one daughter and one son together, one daughter is from the mother’s previous marriage, and one son is adopted, sharing no genetic material with either parent. After amplifying the VNTR DNA from each member of the family, it is cut with a restriction enzyme and run on an agarose gel. Here are the results:
Which child is adopted? Who arethe children of this Mom and Dad
In this example, a family consists of a mom and dad, two daughters and two sons. The parents have one daughter and one son together, one daughter is from the mother’s previous marriage, and one son is adopted, sharing no genetic material with either parent. After amplifying the VNTR DNA from each member of the family, it is cut with a restriction enzyme and run on an agarose gel. Here are the results:
Anthropologists can trace human origins and migrations
Environmental conservationists track migratory patterns and movements of endangered species
Paternity Testing Forensics testing
To find a target gene mutation (like a gene we think causes a disease) in a sample of DNA, scientists use a DNA probe - a length of single-stranded DNA that matches part of the gene and is linked to a radioactive atom. The single-stranded probe seeks and binds to the gene. Radioactive signals from the probe are then made visible on x-ray film, showing where the probe and gene matched.
Taking genetic testing one step further Gene therapy tries to FIX the genetic
problem
Take a virus that naturally infects the type of cells that are defective.
Remove all the virus’s DNA.
Replace it with correct copy of defective gene
Infect “disease cells with the “correct gene”
1. Cystic fibrosis2. Hemophilia3. Cancer
Used a virus to carry normal CFTR gene to affected lung cells
Only temporary
Good candidate since the the disease is caused by a single known genetic defect.
Has been successful in dogs, but not humans
Latest approach is using nanotechnology (nanoparticles containing the gene coupled with a genetic element that helps with insertion of the gene (no longer use a virus).
Still experimental
Researchers are trying to improve the body's natural ability to fight the disease or to make the cancer cells more sensitive to other kinds of therapy (chemotherapy or radiation).
http://www.ornl.gov/sci/techresources/Human_Genome/medicine/genetherapy.shtml
Predominantly found in A. Agriculture (transgenics and cloning)
DISEASE RESISTANT PLANTS PLANTS WITH HIGHER YIELD (MORE FOOD PER ACRE) PEST RESISTANT PLANTS (CONTAIN A GENE WITH AN
INSECTICIDE). CLONING high producing animals (high milk, meat, etc)
B. Medicine (gene therapy, cloning, transgenics) Gene Therapy Cloning animals for organ transplants Cloning Production of the oncomouse (a mouse used to study
cancer)
Are we blurring the lines between species by creating transgenic combinations?
What are the known health risks associated with transgenics?
What are the long-term effects on the environment when transgenics are released in the field?
Are we inflicting pain and suffering on animals when we create certain types of chimeras (multiple species animals)?
Will transgenic interventions in humans create physical or behavioral traits that may or may not be readily distinguished from what is usually perceived to be “human”?
Recommended