Expt. 10-1 : P-elements and Enhancer Trapping

Expt. 10-1: P-elements and Enhancer Trapping

Expt. 10: P-elements and Enhancer Trapping

-Naturally occurring P-elements: Transposase gene between two inverted repeats

Transposase

Organization of the P Element

2.9 kb P Element

Transposase ORF

31 bp InvertedRepeat

Tnp BindingSite

9 or 21 bp Spacer

NNNNNNNNNCATGATGAAATAACATAAGGTGGNNNNNNNNNGTACTACTTTATTGTATTCCACC

3’ Cleavage Site

5’ Cleavage Site

NNNNNNNNNCATGATGAAATAACATANNNNNNNNN

AGGTGGGTACTACTTTATTGTATTCCACC

3’-OH

P -5’

5’-P

HO-3’

Transposase catalyzes a 17bp staggered cleavage event

P Element

+

P Element

8 bp target siteduplication

P element integration generates an 8 bp target site duplication

Taking Advantage of P-elements

-Mutagenesis

Taking Advantage of P-elements

-Mutagenesis-Insertional mutations easy

to clone.

Taking Advantage of P-elements-MutagenesisInsertional mutations (easy to clone).

-Imprecise excisions lead to frameshifts -and deletions.

Taking Advantage of P-elements

-Germline transformation

Taking Advantage of P-elements

-Mutagenesis-Germline transformation

1.Design transgene with inverted repeats.

Taking Advantage of P-elements

-Mutagenesis-Germline transformation

1.Design transgene with inverted repeats.

2.Mix with transposase gene

Taking Advantage of P-elements

-Mutagenesis-Germline transformation

1.Design transgene with inverted repeats.

2.Mix with transposase gene3.Inject into germline of embryo

Taking Advantage of P-elements

Germline transformation1.Design transgene with

inverted repeats.

2.Mix with source of transposase3.Inject into germline of embryo4.Look for transformants in F1.

YFG

Taking Advantage of P-elements

-Mutagenesis-Germline transformation-Enhancer trapping

Use regulatory informationfrom nearby genes to drive expression of a transgene

Mechanics of Enhancer Trapping:-Modified P-element contains:

-Inverted repeats-Basic promoter sequences-Molecular marker gene (e.g. -galactosidase)-Phenotypic marker (e.g. w+, ry+)

-Mobilize using transposase-Confirm hopping in F1 (phenotype)-Look for interesting/desired expression pattern in F2 with lacZ staining

lacZP w+

Mechanics of Enhancer Trapping:-Modified P-element contains:

-Inverted repeats-Basic promoter sequences-Molecular marker gene (e.g. -galactosidase)-Phenotypic marker (e.g. w+, ry+)

-Mobilize using transposase-Confirm hopping in F1 (phenotype)-Look for interesting/desired expression pattern in F2 with lacZ staining

P w+GAL4ey enhancer

lacZUAS InR(DN)UAS

Attached X females

XY X XXY^

Attached X females

XY X XXY

XXX Sterile

XXY Female

XY Male

YY Dead

^

^

^

+ P[lacZ, ry+], Cy ry + + Ki ry+

+ Sco ry Y + +X

+ P[lacZ, ry+], Cy ry + + Ki ry+

+ Sco ry Y + +X

+ P[lacZ, ry+], Cy Ki ry+ XX + ryY + ry Y + ry (phenotype=Cy, Ki, ry+)

+ P[lacZ, ry+], Cy ry + + Ki ry+

+ Sco ry Y + +X

+ P[lacZ, ry+], Cy Ki ry+ XX + ryY + ry Y + ry (phenotype Cy, Ki, ry+)

X

^

^

+ P[lacZ, ry+], Cy ry + + Ki ry+

+ Sco ry Y + +X

+ P[lacZ, ry+], Cy Ki ry+ XX + ryY + ry Y + ry (Cy, Ki, ry+)

X

+P? +P? ryP? XX + ry Y + ry Y + ry (not Cy, not Ki. If carrying a jumped P, will be ry+)

^

^

+ P[lacZ, ry+], Cy ry + + Ki ry+

+ Sco ry Y + +X

+ P[lacZ, ry+], Cy Ki ry+ XX + ryY + ry Y + ry (Cy, Ki, ry+)

X

+P? +P? ryP? XX + ry Y + ry Y + ry (not Cy, not Ki. If carrying

a jumped P, will be ry+)

X

Stain F2 for lacZLook for desired expression pattern

^

^

We want to look at enhancer traps that express in the ovaries.

The Ovariole

GermariumGermarium

The Ovariole

The Egg Chamber

Nurse Cells

Oocyte,follicle cells

Staining OvariesSchematic Summary

-Dissect ovaries out of abdomen in NaPO4 buffer (movie!).-Devitallinize with heptane-Fix ovaries and wash-Add X-GAL, the substrate for -galactosidase.-Wash when dark enough, and observe.

-We are using enhancer traps that express in-Follicle cells-Nurse cells and oocyte