View
218
Download
0
Category
Preview:
Citation preview
7/30/2019 cs-49-3-913
http://slidepdf.com/reader/full/cs-49-3-913 1/10
CROP SCIENCE, VOL. 49, MAY–JUNE 2009 913
RESEARCH
Canada wildrye (CWR, Elymus canadensis L.) Vg
(VWR, E . virginicus L.) coo-sso gsss tv
to Noth Amc (Htchcock Chs, 1971). Both spcs
g shot-v ps, hgh s-pot (Js t
., 1990), ttpo (2n = 4x = 28) th gomc costtu-
to o SSHH (D, 1982). Th S H goms Elymus
v om Pseudoroegneria Critesion (om Hordeum) spcs
spctv, bs o ctogtc (D, 1984), gomc DNA
(Su t ., 1997) choopst DNA vc (McM Su, 2004). Th s tst usg CWR VWR o o-
g poucto (Schust Lo Gc, 1973; Sso t
., 2004,b), cosvto puposs (Bush, 2002; USDA–NRCS
2003; Lo-R t ., 2003), cmto ptgs (Po
1979; No t ., 1996), s souc o gs o mpovmt
o oth spcs (Dh, 1996; Dh Jopp, 1992; Kum
Wto, 1992; Pk Wto, 1989).
Bg fots th CWR VWR hv b v m-
t. Th o ko cutv o CWR, ‘M’, s
1946 b th USDA th Noth Dkot Agcutu Exp-
mt Stto, s ct scto o cocto om Noth
Dkot (Aso Shp, 1994). I to, th VWR cutv
Genetic Variation within and among
Wildrye (Elymus canadensis and E . virginicus)Populations from the Southern Great Plains
M C. Sh, Co A. Youg, A A. Hopks*
ABSTRACT
There is interest in Canada wildrye (CWR, Ely-
mus canadensis L.) and Virginia wildrye (VWR,
E . virginicus L.) or conservation and orage
uses. Our objectives were to identiy a set o
molecular markers to assess genetic struc-
ture within and diversity among populations o
CWR and VWR rom the Southern Great Plains
and to determine i these populations had an
associated ungal endophyte. Nine CWR and
fve VWR populations and two barley ( Hor-
deum vulgare L.) cultivars were genotyped
using simple sequence repeat (SSR) markers
isolated rom tall escue [Lolium arundinaceum
(Schreb.) Darbysh.] expressed sequence tags
(TF ESTs). Scorable ragments were produced
by 31% o TF EST-SSRs tested, thus identiy-ing a set o SSR markers or wildrye. Popula-
tions grouped into three clusters consisting o
(i) three wild populations, one plant introduc-
tion, and two commercial sources o CWR;
(ii) all VWR populations and three CWR plant
introductions; and (iii) barley cultivars. Cluster-
ing indicated possible gene ow between CWR
and VWR. Genetic variation within popula-
tions was minimal and comparable to that o
the barley cultivars. Thus, unlike many ances-
tral cultivars and landraces o sel-pollinated
crops, CWR and VWR populations consisted
o essentially pure lines and can be handled assuch in a breeding program. Potentially sexual
and asexual epichloë endophytes were ound
in several populations, indicating the need to
account or endophytes in breeding and germ-
plasm conservation eorts o wildrye.
Fog Impovmt Dvso, Smu Robts Nob Fouto
Ic., Amo, OK 73401. Rcv 8 M 2008. *Cospog
utho (hopks@ob.og).
Abbreviations: CWR, C ; PCR, poms ch
cto; SSR, smp squc pt; TF EST, t scu xpsssquc tg; UPGMA, ught p goup mtho th thm-
tc m; VWR, Vg .
Pubsh Cop Sc. 49:913–922 (2009).o: 10.2135/copsc2008.04.0239© Cop Scc Soct o Amc677 S. Sgo R., Mso, WI 53711 USA
F vb o though th utho-suppot op ccss opto.
A ghts sv. No pt o ths poc m b pouc o tsmt t om o b ms, ctoc o mchc, cug photocopg, cog,o omto stog tv sstm, thout pmsso tg omth pubsh. Pmsso o ptg o ptg th mt cot hhs b obt b th pubsh.
7/30/2019 cs-49-3-913
http://slidepdf.com/reader/full/cs-49-3-913 2/10
914 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, MAY–JUNE 2009
Omh s mkt b Stock S Fms o Muock,
NE. Rct, th USDA–ARS gss bg pogm
Lco, NE, s th CWR cutv Hom-
st (K.P. Vog, pso commuctos, 2008). Sv
“souc t” o “sct” gmpsm coptps
o CWR VWR om th Mst (USDA–NRCS,
2000; Buckhof, 2002; Dug t ., 2006) Txs
(USDA–NRCS, ..) hv b s th pst c
b th USDA–NRCS. Um, osct gmpsmo CWR, to ths pot s “commc souc
poputos,” vb th s t.
Th ppcbt o t scu [Lolium arundinaceum
(Schb.) Dbsh.] xpss squc tg (TF EST)
smp squc pts (SSRs) spcs hs ot
b tm. Poms ch cto (PCR)–bs
mk sstms such s om mp pomophc
DNA SSR mks hv b pp to Elymus sp-
cs, cug CWR (Su t ., 1997), though ss
o gtc vto th mog popu-
tos bs o DNA pps to b ckg. Tscb
gos ot cosv coss spcs g, soSSR mks v om xpss squc tgs (EST-
SSRs) hv tc to b tsb. Tsbt
o SSR oc coss spcs (>50%) th gus (Th
t ., 2003) bt g (Euj t ., 2004; Sh
t ., 2004) hv b pot, suggstg tht TF EST-
SSRs cou b ppcb to CWR VWR.
Gtc stuctu s mpott tmg ho to
h poputos bg pogm. Fo stc,
cs o s-potg spcs such s ht (Triticum
aestivum L.) qut cosst o mxtu o gotps
(.g., Rbo-Cvho t ., 2004). As cosquc,
cutv vopmt fots ot succssut sotg supo s om sg c (A,
1987). Sm xmps xst oth s-pot cops
such s ot ( Avena sativa L.) (Bo Pttso, 1992)
sob [Glycine max (L.) M.] (Loz Sho-
mk, 1996; Fh, 1987). Bs o sozm o ozm
t, vto th poputos pps to b
mm m (Cgg t ., 1976; Ss t ., 1979;
Díz t ., 1998) though ot (Ss Hmck,
1980) css. It- tspcc vto o CWR
VWR poputos s v b ss o cho-
opst DNA mks (McM Su, 2004); v
mo fcs obsv bt th o th
ou CWR poputos xm.
Eophts c hv umb o mpctos h
vopg mpov gss cutvs. I Festuca Lolium
spp., Neotyphodium ophts c mpt toc to
botc (Pop Boos, 2005) botc (Mosk
t ., 2005) stsss, but th m so hv tm-
t fcts o gzg vstock (Thompso t ., 2001;
Ov, 2005). Nov, otoxc sts hv ct b
po og cutvs to mt m hth
pobms ssoct th ophts (Bouto t ., 2002;
Esto Tpp, 2005). Sxu spcs o ophts,
cug Epichloë spp., c pouc stom o th host,
hch sts vopmt o th pouctv cum,
coto ko s chok ss, thus gt ucg
s s (P Am, 2006). Th sxu
ug opht Epichloë elymi s commo ou
CWR (Wht Butm, 1987) VWR (Lucht-
m C, 1993), mo ct sxu Neo-typhodium spp. hv b ou poputos o
CWR (Vto t ., 2001; Bu t ., 2007) VWR
(Moo t ., 2004). Athough th mpcts o opht
cto CWR VWR o host tss gz-
g m hth ot ko, ogc sttg pot
cutv vopmt s to tm ophts
pst th pt gmpsm so, hth th
m b pott chok-omg sxu spcs.
Th gss bg pogm t th Nob Fouto
(Amo, OK) hs bgu fot to vop mpov
cutvs o CWR o th U.S. South Gt Ps o
og poucto cosvto uss. Coctos o CWR m om th South Ps vut
o psstc u hv gzg, th poputo
98CWR8 s t s pomsg o uth v-
opmt (Hopks Wst, 2002). W utook ths
sch pt to tm hth 98CWR8 oth
poputos cosst o sg pu s o um-
b o vs gotps. To o so, st out to t
st o TF EST-SSRs tht cou b us to chctz
gtc vto th mog sv possb gm-
psm soucs (.g., PIs, coctos om th , comm-
c vb s, Vg ) tht mght b us
th CWR bg pogm. F, bcus o th mp-ctos o th bg pogm, to tm
hth ths vous gmpsm soucs host o-
pht. Thus, th objctvs o ths sch to t
st o TF EST-SSRs to ssss gtc stuctu th
vst mog poputos o CWR VWR om th
South Gt Ps to tm ths poputos
h ssoct epichloë opht.
MATERIALS AND METHODS
Plant Materials
A tot o 70 gotps smp, cug vvus om ch o CWR v VWR popu-
tos. To gotps om ch o to b (Hordeum vulgare
L.) cutvs (Tb 1) cu s cotos o compso.
W poputos coct b A Hopks Txs
Okhom om oss o tv g sts; PIs, p-
sttv o pubc vb CWR VWR gmpsm
ogtg om th South Gt Ps, cv om
th USDA Nto Pt Gtc Sstm; th commc
souc poputos puchs om Stock S Fms, Ic.
(Muock, NE) Shp Boths S Co. (H, KS). Eght
gotps, o ch om t scu b th ch
7/30/2019 cs-49-3-913
http://slidepdf.com/reader/full/cs-49-3-913 3/10
CROP SCIENCE, VOL. 49, MAY–JUNE 2009 WWW.CROPS.ORG 915
DNs potoco s us th mo mocto: st o
to-stp DNA uto, oo o-stp DNA uto th
90 μ o AE buf ch tub. Th DNA cocttos
qut usg Ho D Qut 200 (Amshm Bosc-
cs, Psct, NJ) DNA uoomt. Tt ogms o
DNA us s tmpt o ch PCR cto. Th PCRctos u u st cotos o pms; PCR
poucts sov o 6% pocm tug gs
vsuz b sv stg, s scb Sh t . (2004).
SSR Amplification, Fragment Scoring,
and Evaluation of PolymorphismA tot o 157 pm ps obt om TF EST-SSRs
st sc th subst o pts (ght gotps) to stb-
sh pm sts tht ou pouc mpcto poucts cos
spcs. Sct pms th ss th th compt
om CWR VWR, us o th t scg o
th SSR pms. Th t scu gotp HD28-56 s us
s coto to v mpctos suts. Ss pt
to 5- b 5- b 5-cm pots th commc pottg
mx (SB 100 bg mx; SuGo Hotcutu, Bvu,
WA). A soub t z souto (Th Scotts Co., Msv,OH) s us s to mt vgoous goth. Pts
ts to 4-L pots o to go u st-
ghous cotos.
DNA Isolation and PCR AmplificationPt DNA s xtct usg Qg DNs Pt M Kt
(Qg, Vc, CA). Appoxmt 200 mg o oug
b om ch pt s coct 2.0-mL mcoctug
tubs. Fsh oz tssu s gou to po usg
Mx M Tp MM 300 (RETSCH, H, Gm). Th
Table 1. Wildrye populations, barley cultivars, and genotypes (in parenthesis), along with their origins and seed sources exam
ined for genetic diversity. Endophyte status of populations was determined using immunoblot and polymerase chain reaction
(PCR) techniques.
Population
(genotypes)Status
Origin
Seed source †‡
Endophyte status§
Species
Closestnonhybrid
ancestor ¶ImmunoblotPCRseed
PCRblade
Canada wildrye
Sharp’s (Sh 143, 145,
147, 149, 150)
Commercial
source population
Missouri Sharp Bros. Seed Co. – + + Epichloë amarillans Eam
Stock’s (St 154, 155,
156, 157, 159)
Commercial
source population
Iowa Stock Seed Farms -/+ + + ND
98CWR8 (CW 1, 2, 3,
5, 7)
Wild population North-central
Texas
NF collection + + + Neotyphodium sp. Eam × Eel
99CWR6 (CW 11, 12,
14, 16, 18)
Wild population Central Texas NF collection + + + Neotyphodium sp. Eam × Eel
99CWR7 (CW 21, 24,
25, 27, 29)
Wild population Central Texas NF collection -/+ + + Epichloë amarillans Eam
PI 436918 (CW 31, 33,
34, 36, 38)
PI West Texas NPGS – – –
PI 436933 (CW 41, 43,
45, 47, 49)
PI Central Texas NPGS – – –
PI 613134 (CW 51, 52,
54, 55, 56)
PI Southeast Texas NPGS + + – Epichloë elymi Eel
PI 436924 (CW 62, 63,65, 67, 70) PI North-centralOklahoma NPGS – ? –
Virginia wildrye
03VWR2 (VW 71, 73,
74, 76, 78)
Wild population South-central
Oklahoma
NF collection – ND# + Epichloë elymi Eel
PI 436945 (VW 83, 84,
85, 89, 90)
PI Northeast Texas NPGS – – –
PI 436955 (VW 93, 94,
96, 99, 100)
PI Central Texas NPGS -/+ – –
PI 436962 (VW 102,
103, 104, 105, 106)
PI East-central
Texas
NPGS – – –
PI 436968 (VW 113,
114, 115, 117, 118)
PI Southeast Texas NPGS – ND –
Barley
Steptoe (S 122, 123) Cultivar Washington NPGS – ND –
Morex (M 132, 133) Cultivar Minnesota NPGS – ND –
†NPGS = USDA National Plant Germplasm System.‡NF = Noble Foundation.§+ = endophyte infected; − = endophyte free.¶Eam = Epichloë amarillans; Eel = Epichloë elymi .#ND, not determined.
7/30/2019 cs-49-3-913
http://slidepdf.com/reader/full/cs-49-3-913 4/10
916 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, MAY–JUNE 2009
smp st o gotps. Th SSR bs sco s pst
o bst, o c, poucb bs sco. Pm-
s tht pouc m t, cut-to-sco bs co-
s ospcc mpctos. Th b sz s pot
o th most ts mp b o ch SSR o th vg
o th stutt th tst s th sm, usg 10-bp DNA
(Ivtog L Tchoogs, Csb, CA) s th -
c pot. Nu s, h gv pouct s ot mp-
, ssg to gotps oc com.
Determination of Genetic RelationshipMks obt om TF EST-SSRs z to co-
stuct smt mtcs mog th gotps usg
NTSYS-PC 2.10 (App Bosttstcs, Stukt, NY). Gtc
smt mog gotps s ccut usg th DICE
smt co ct (Dc, 1945) oog th SIMQUAL
pocu. Th squt ggomtv hchc
st custg gothm s us to costuct ogms
usg th smt co cts. Th ‘TM’ opto s st to
‘FIND’ to tct possb ts usg th ught p
goup mtho th thmtc m (UPGMA) mtho. Th
TREE pocu o th NTSYS pogm s us to ct
th ogm. Th PAUP* 4.0 pogm s us o boot-stp ss. Th ss s pom usg th bt po-
gm th 1000 pctos oog th ghbo jog
gothm (Sofo, 2002). Mmum t tto cto
s st t 50%.
Endophyte DetectionTh psc o epichloë ophts (th th sxu Epichloë
sp. o sxu Neotyphodium sp.) s tct ct pt
mt usg th Neotyphodium mmuobot tcto kt
(Htt t ., 1997; Htt t ., 1999) o PCR mtho th
pms spcc to epichloë ophts s scb bo.
Th mmuobot pocu (Agostcs, Ic., Wtks-
v, GA) s pom oog th muctu’s stuc-
tos th stm coss-sctos om ch gotp coct t
gou v. Th stm sctos sh th oub s-
t stz t bo th ss. Dvopmt o pk
coo o th mmuobot mmb s cos ctv
o opht psc.
Eophts cutu om suc-stz stm
sctos o to go out o potto xtos g m
(Dco Lbotos, Dtot, MI). Gomc DNA s sot
om pu cutu oog th potoco o Moo t . (1999)
th mo moctos: tht s, s t (1 M NC) pucto
stp o th mov o to poscchs s omt-
t. Eopht DNA s tst th th TF EST-SSR pmsto mk su o poucb bs pouc th ths
pt pms.
To xm th opht sttus o th s stocks,
gomc DNA s sot om 12 vu ss o ch
vb poputo usg th Mgttct 96 DNA pt co
kt (Qg) s p th muctu’s stuctos. Poms
ch cto s us to tct opht gomc DNA
squcs th tot DNA xtct om gss ss
om oug bs. Th PCR s bs o pms tht
to th opht tsto ogto cto 1-α (tef1)
(t1-xo1, GGGTAAGGACGAAAAGACTCA t1-
xo6u-1, CGGCAGCGATAATCAGGATAG) (Cv t .,
2001). Poms ch ctos pom th 25-
o 50-μL cto voums cotg 5 to 100 g o DNA, 1x
g cto buf (Pomg, Mso, WI), 200 M ch
NTPs, 200 M o ch pm, 1 U GoTq (Pomg). Th
PCR pogm cosst o 94°C o 2 m oo b 35 ccs
o 94°C o 15 s, 58°C o 30 s, 72°C o 1 m. Th PCR
poucts spt o 2% gos 1X Ts-bot-th-
mttctc c (Ivtog), st th thum
bom vsuz u UV ght. Eopht pscs tm bs o th psc o spcc PCR b.
To tm th epichloë opht spcs, th mp
PCR gmts obt om th s smps co
to pGEM-Ts (Pomg) us to tsom Escherichia
coli XL1 bu cs. DNA s sot (QIApp Sp Mpp
Kt, Qg) om 12 to 24 pt coos cotg
th tef1 gmt om ch pt–opht ssocto
squc. I th cs o 99CWR7 03VWR2, pts
obt om th og cocto st us to sot
pu cutus o opht om hch DNA s xtct
o phogtc ss. Th squc t t usg
Squch 4.8 (G Cos) to obt cossus squcs.
Th squcs comp to GBk o tcto, phogtc ss s pom s p Cv t .
(2001) usg mxmum psmo tht utz th bch
bou sch (Sofo, 2002).
RESULTS AND DISCUSSION
Microsatellite Profiling
I ou pm vutos o TF EST-SSR pms o
CWR VWR poputos, 49 (31%) o th pm ps
sho c scob SSR-tp bs. A tot o 235 g-
mts t 74 b gotps
usg 38 TF EST-SSR pm ps tht omsct om th 49 pm ps shog c mpc-
tos. Numb o gmts p pm p g om
2 (NFFA015) to 14 (NFFA092) th vg o 6.2
gmts p pm p (t ot sho). Tot um-
b o gmts ch gotp o ft poputos
g om 45 to 81 (Tb 2). Avg umb o g-
mts both th spcs (CWR 71.3 VWR
68.3) s much hgh th b (49.5). A gotp o
th CWR commc souc poputo Shp’s h th
gtst umb o gmts (81), hs gotp o
th VWR poputo 03VWR2 h th st (60).
Th v o mcostt pomophsm ou o CWR
VWR pts s compb to tht pot o oth
gss spcs (Vsh t ., 2005). Th pst -
gs suppot pvous suts tht TF EST-SSR mks
usu coss ft gss spcs (Sh t ., 2004).
Th mcostt mks thus vop o CWR
VWR (Suppmt Tb 1) ch th mt
SSR mk soucs vb ths spcs.
Dt omto o ths pms cug pm
squcs s pot b Sh t . (2004).
7/30/2019 cs-49-3-913
http://slidepdf.com/reader/full/cs-49-3-913 5/10
CROP SCIENCE, VOL. 49, MAY–JUNE 2009 WWW.CROPS.ORG 917
Genetic Variability
Th UPGMA ss bs o SSR mks ct
tht th b cutvs stct ft om -
th o 20% smt (t ot sho). Th -
ogm cust th gotps to to stct
goups t 64% smt. Th outmost goup cosst
o CWR gotps om th poputos, o PI,
to commc souc poputos. Th m goup
cot gotps om th CWR PIs VWRpoputos. Th suts om bootstp ss (Fg. 1)
g suppot th phogtc toshp uc
om UPGMA. I ths ss, custs suppot b ss
th 50% o bootstps cops to potoms.
Th b custs suppot b 100% o bootstps.
Custg o th poputos, o PI, to com-
mc souc poputos o CWR s suppot b hgh
bootstp vus (92%), hs custg o th CWR
PIs VWR poputos s ot s stog (58%). Th
to commc souc poputos o CWR om s-
tct os th th CWR cust, ctg th gtc
stctss o mts ogtg om Okhom Txs. Ovp bt som o th CWR VWR
poputos s phps ot supsg. Vog t . (2006)
pot compb ms gs o goomc tts
mog Mst poputos css s VWR CWR.
Mophoogc t, om poputos south Ok-
hom (Nso T, 1978), coup th to
ctoogc ozm t om Txs poputos
(Dvs, 1977) ct tht g o togsso
occus th bt CWR VWR poputos.
Gotps th poputo g cust o
o o. Esst tc gotps ou
th PI 436933 (pts CW 47 49) PI 436955(pts VW94 99). Such hgh g o smt
th poputos o s-pot Ttc gsss th
s ot ucommo (Nvo t ., 1982; Hg t .,
2000). Ou suts cotst th tht o Kpp Rc
(1996), ho ou substt vto, bs o sozm
ss, th poputos om th st Ut
Stts o bu (Elymus glaucus Buck), s-po-
tg, p ttpo th th sm gom costtu-
to s CWR VWR. A hgh pctg o smt
xst th CWR comp to VWR poputos (Fg.
1). Ths suts ct tht tu, coss-poto
hs occu mo qut VWR th CWR pop-
utos. Hov, gv tht vto th CWR
most VWR poputos s sm to tht th th b-
cutvs, poputos cou b h s pu
s bg pogm. Ths s cotst to s-po-
t cops h o cutvs cs hv b
ou to commo cot umous gotps (Russ
t ., 2003; Zhg t ., 2006). O cou spcut tht
m pctcs, such s s tg, scto, t-
to s mxg (Tshom t ., 2001), hv sut
cs o s-pot cops cosstg o vs
gotps th cutvt , hs th
tu scto t gv st hs to popu-
tos cosstg o tc gotps.
Sequence Variation
At hgh txoomc vs, SSR s tc b sz ot css tc b sct (Do t ., 1998)
A mcostt gmt, obt om th pm ps
NFFA113, hch s moomophc bs o gth cos
th b gotps, s om sct
o squcg to tm th s squc v-
to th . Th o th CGG pt
pst squcs o poputos b
cutvs (Fg. 2), cotst to sx pts th t s-
cu squc (t ot sho) om hch th pm
vop. Ov th 190 bp o squc t ths gmt
sx sg ucot substtutos spcc to b
o hch th s th CWR poputo
99CWR6 (Fg. 2). Most o ths pomophsms occu
kg squcs cos to th mcostt go
Dstct squc vto bt CWR VWR
poputos s ot vt coss th 190-bp squc
t ths mcostt ocus. Th gotp o 99CWR6
sho gt vto th sx bs substtutos, th
o hch sh th b (Fg. 2). Th
gotps cosst o SSHH goms o hch H gom
so ou Hordeum spcs. Ctogtc (D
Table 2. Number of microsatellite fragments obtained in gen
otypes of Canada wildrye and Virginia wildrye populations
and barley cultivars from 38 tall fescue expressed sequence
tag–simple sequence repeats.
Population Min. Max. Avg.
98CWR8 68 76 71.8
99CWR6 73 79 76.4
99CWR7 70 73 70.8
PI 613134 64 75 70.6
Sharp’s 74 81 77.2
Stock’s 66 75 70.7
PI 436918 63 70 67.2
PI 436924 65 71 68.4
PI 436933 66 72 68.8
CWR 63 81 71.3
03VWR2 60 71 68.0
PI 436945 64 72 66.8
PI 436955 60 75 67.4
PI 436962 68 71 69.0
PI 436968 66 75 70.4
VWR 60 75 68.3
Steptoe 45 50 47.5
Morex 51 52 51.5
Barley 45 52 49.5
SE 0.86 0.98 0.90
7/30/2019 cs-49-3-913
http://slidepdf.com/reader/full/cs-49-3-913 6/10
918 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, MAY–JUNE 2009
1984), gomc DNA (Su t ., 1997), choopst
DNA (McM Su, 2004) ss suppot ths cs-
scto, s os th squc vto t pst
h. Squcg o SSR poucts o spcc tst
b usu tg to SNPs.
Endophyte AnalysisImmuobot ss o ts th Neotyphodium-sp-
cc tbo s cut to tpt s t s om Ely-
mus pts ot th opht os ot ct
to th tbo. Tho, epichloë
opht cto s uth ch-
ctz usg sstv PCR-bs
sc to tm o th pt
mt s opht ct. Ass
o th s stocks b PCR ct tht
sv CWR poputos (98CWR8,
99CWR6, 99CWR7, PI 613164, Shp’s,
Stock’s) ct th Epichloë opht (Tb 1; Fg. 3). Ths ss
s ub to tm th opht
s vb ug gmto b to
b tsmtt to th sg, but PCR
o smps om oug b sho
tht som o th pts us ths stu
opht ct (Fg. 3). A-
ss o th ss om th VWR PIs -
ct th ot ct o ct
t v o pctg. Hov, PCR
ss o b DNA smps om
03VWR2 ct opht c-to t st to pts (Fg. 3); s
o ths poputo s ot vb o
PCR ss. Shp’s, Stock’s, o
th ct coctos o CWR om th
h ug ophts, hs PI
613134 s th o PI ou to b o-
pht ct.
To tm th phogtc o-
gs o th epichloë opht, th mp-
tef1 g s squc om
scto o opht-postv ss
comp to ko Epichloë spcs. Atst th ft epichloë ophts
ou th ths s stocks bs
o th sutg squc t (Tb
1). Epichloë elymi, ou PI 613134, s
commo s CWR (Wht
Butm, 1987) s ot uxpct.
Rct, VWR pt s ou
ct th sxu E. amarillans
(EVTG-1) (Moo t ., 2004). Ext-
sv squcg o th tef1 g mp
om th Shp’s s th opht
sot om 99CWR7 ct th psc o E.
amarillans –k squc, but ot tm th
opht s sxu. Th epichloë opht cot
98CWR8 s pvous chctz s hb o
E. amarillans E. elymi (Bu t ., 2007) sm to
sot ou Hordeum bogdanii HboTG-1 (Moo t
., 2004). 99CWR6 so pp to cot hb o
E. amarillans E. elymi . Th opht sot om
03VWR2 s chctz s E. elymi, but t s uko
th sot s stomt poucg. Th squc ss
Figure 1. An unrooted plot of consensus trees with a frequency greater than 50%
after bootstrap analysis with 1000 replications. Bootstrap values are indicated on the
trees. Genotypes represent 46 Canada wildrye (CW), 25 Virginia wildrye (VW), and
four barley genotypes. PAUP* 4.0 beta was used to run the Neighbor joining algorithm.
Genotypes correspond to the following populations: SH 143–150 = Sharp’s; ST 154–
159 = Stock’s; CW 1–7 = 98CWR8; CW 11–18 = 99CWR6; CW 21–29 = 99CWR7; CW 31–
38 = PI 436918; CW 41–49 = PI 436933; CW 51–56 = PI 613134; CW 62–70 = PI 436924;
VW 71–78 = 03VWR2; VW 83–90 = PI 436945; VW 93–100 = PI 436955; VW 102–
106 = PI 436962; VW 113–118 = PI 436968; S 122–123 = ‘Steptoe’ barley; M 132–
133 = ‘Morex’ barley. E+ indicates populations that were endophyte infected based on
polymerase chain reaction analysis.
7/30/2019 cs-49-3-913
http://slidepdf.com/reader/full/cs-49-3-913 7/10
CROP SCIENCE, VOL. 49, MAY–JUNE 2009 WWW.CROPS.ORG 919
o th tef1 g mp om th Stock’s
s cocusv but s ko to b
epichloë opht u to th spcct
th th tef1 pms. Uotut,
ub to cutu th ophts
om th s stock, hch m ct
th ophts o og vb.
Mk ss o th CWR
VWR poputos ct tht opht-ct mt, xcpt
03VWR2, cust togth (Fg. 1),
thus sg th qusto o hth som
SSR mks m hv b mp
om opht DNA, thus mpctg
subsqut cust ss. Ths ou
b hgh uk u to th v o
opht bomss th th b
tssu tht s smp (Youg t .,
2005; Pcco t ., 2001). DNA s
sot om pu opht sts
mp th TF EST-SSRs. O ghto th pm ps mp poucts th
opht DNA, ths k to
b ospcc poucts. Th opht
DNA gmts qut ft om
th pt bs ot vsb h
PCR s us to z DNA xtct
om opht-ct pts. Thus,
th ogm obt om th g-
mt ss s u to gtc vto
th mcostt oc o th
poputos s ot uc b
th opht DNA th smp.W hv stbsh tht v-
st o epichloë ophts s ssoc-
t th th poputos
sc, but hv t to tm
th mpct ths ophts hv
o th host gsss. Th ko pot-
t o ths ophts ou qu
xmto to tm tmm-
m compous such s got k-
os otms pouc
ths opht-ct pts. Mt-
ct th sxu sot hs th
pott to cus oss o s pouc-
to u to vopmt o stomt tht
stct (.., chok) mgg os-
ccs. Hov, th psc o hb
ophts, tho psumb
sxu Neotyphodium spcs, t st som CWR
gmpsm suggsts tht ths sots ou ot h-
s poucto. Futh ss b qu
to tm ths ophts pov th host
oth goomc quts, such s ought toc
psstc, s hs b ocumt th Neoty
phodium coenophialum –ct t scu (Bouto t .
1993; Mosk t ., 1997; Wst t ., 1993).
Figure 2. Sequences of fragments amplified by tall fescue expressed sequence tag–simple sequence repeat primer NFFA113 in barley cultivars and Canada wildrye and
Virginia wildrye populations. Primer sequences are italicized, base substitutions are
bold faced, and repeat sequences are in bold italics. The sequences represent a single
genotype from each of the cultivars/populations.
7/30/2019 cs-49-3-913
http://slidepdf.com/reader/full/cs-49-3-913 8/10
920 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, MAY–JUNE 2009
CONCLUSIONS
Sv TF EST-SSRs pov usu ssssg gtc
vto CWR VWR, thus tg uc-to st o mcostt mks o ths sp-
cs. Usg ths SSRs, mm gtc vto s
tct th CWR , to ss g, VWR
poputos om th South Gt Ps, ctg
tht gmpsm coct ct om th , PIs,
commc souc poputos o ths spcs commo
cosst o pu s. Pg, sg-s sct,
buk, oth bg mthos us o s-pot
spcs ou b ppopt o vopg mpov s
cutvs o CWR VWR. Bs to
b cogzt o th possb psc o pott sx-
u sxu ophts CWR VWR bg
gmpsm. Futh sch b to tm
th mpct o opht cto CWR VWR o
pt stss toc gzg m hth.
AcknowledgmentsTh uthos v thku to J Bck, Kostt
Chkhovsk, Shp Mtt o th tchc ssstc
ths sch. W gtu to Ds. Mk Sos, K Cv,
M Motos o ctc vg ths muscpt.
ReferencesAso, J., W.C. Shp. 1994. Gss vts th Ut Stts.
2 . USDA So Cosvto Svc, Wshgto, DC.
A, R.E. 1987. Wht. p. 699–748. In W.R. Fh (.) Pc-
ps o cutv vopmt. Vo. 2. Mcm, N Yok.
Bouto, J.H., R.N. Gts, D.P. Bsk, M. Os. 1993.
Y psstc o t scu th southst cost
p t mov o ts opht. Ago. J. 85:52–55.
Bouto, J.H., G.C.M. Ltch, N.S. H, C.S. Hov, M.A.
McC, R.H. Wtso, J.A. Psh, L.L. Hks, F.N.
Thompso. 2002. Rcto o t scu cutvs th o-got ko–poucg ophts. Ago. J. 94:567–574.
Bo, C.M., F.L. Pttso. 1992. Covto ot b-
g. p. 613–656. In H.G. Msh M.E. Sos (.) Ot
scc tchoog. Ago. Moog. 33. ASA, CSSA,
SSSA, Mso, WI.
Buckhof, S.B. 2002. Notc o s o ‘Cuv Rv gm-
psm’ Vg sct css o tu gmpsm.
Avb t http://pt-mts.cs.us.gov/pubs/mop-
mcv3cu .p (v 25 Fb 2009). USDA–NRCS
Mssou Dp. o Cosvto, Jfso Ct, MO.
Bu, K., S. Mtt, A. Hopks, C. Youg. 2007. Chcts-
to o ug ophts pst Elymus Canadensis (C
). In A.J. Pop E.R. Thom (.) Poc. o th 6thIt. Smp. o Fug Eophts o Gsss. Gss Rs.
Pctc Ss 13. N Z Gss Assoc., Du.
Bush, T. 2002. Pt ct sht: C . Avb t
http://pts.us.gov/ctsht/p/s_c4.p (v 25
Fb. 2009). USDA–NRCS, Wshgto, DC.
Cgg, M.T., C.R. Hoch, G.L. Chuch. 1976. Extm
gtc smt mog othst spcs o .
Gtcs 83:s15–s16.
Cv, K.D., P.T.W. Hsu, A. Luchtm, W. Ho, C.L.
Sch. 2001. Mutg phog o pchoë spcs, u-
g smbots o gsss. A. Ms. Bot. G. 88:14–34.
Dh, L.S. 1996. Mocu mk s s o hpopo g-
ts om cutus o b × C . Gom39:367–372.
Dh, L.S., L.R. Jopp. 1992. Hbzto tssu cutu
o Hordeum vulgare × Elymus canadensis. Gom 35:1045–1049.
Dvs, R.S. 1977. Evc o togssv hb zto Txs
poputos o , Elymus virginicus E. canadensis.
Gtcs 86:s15.
D, D.R. 1982. Gomc phogtc toshps
mog Noth Amc p Ttc. p. 51–88. In J.R.
Ests t . (.) Gsss gsss. Uv. o Okhom
Pss, Nom.
D, D.R. 1984. Th gomc sstm o c sscto s gu
to tgc hbzto th th p Ttc. p.
209–279. In J.P. Gustso (.) G mputo pt
mpovmt. 16th St Gtcs Smp., Coumb, MO.
Pum Pss, N Yok.
Díz, O., B. Somo, R. vo Bothm. 1998. Dscpto
o sozm pomophsms Elymus spcs usg stch g
ctophoss. p. 199–208 In A.A. Jt (.) Ttc III.
It. Ttc Smp., 3, Appo, S. 4–8 M 1997. Sc-
c Pubshs, E, NH.
Dc, L.R. 1945. Msus o th mout o coogc ssocto
bt spcs. Ecoog 26:297–302.
Do, J.J., M. Mogt, S.V. Tg, W. Po. 1998. Sz
homops choopst mcostts o p
Figure 3. Endophyte detection in seeds and leaf blades of Canada
wildrye and Virginia wildrye populations. Twelve individual seeds
from each population and DNA from leaf blades of each plant were
screened for the presence of the tef1 gene from epichloë endophytes
using endophyte-specific polymerase chain reaction primers.
7/30/2019 cs-49-3-913
http://slidepdf.com/reader/full/cs-49-3-913 9/10
CROP SCIENCE, VOL. 49, MAY–JUNE 2009 WWW.CROPS.ORG 921
tvs o sob (Glycine subgus Glycine ). Mo. Bo.
Evo. 15:215–218.
Dug, J.C., J.W. L, D.W. Bugo. 2006. Rgstto o
Ic Bu C gmp sm. Cop Sc. 46:2330–2331
[tum: 46:2736].
Esto, S., B. Tpp. 2005. Neotyphodium sch pp-
cto N Z. p. 35–42. In C.A. Robts t . (.)
Neotyphodium coo-sso gsss. Bck, Ams, IA.
Euj, I., M.K. Sg, L. Wg, G.D. M, K. Chkhovsk, J.C.
Zotz, M.A.R. M. 2004. Medicago truncatula EST-
SSRs v coss-spcs gtc mks o Medicago spp.Tho. App. Gt. 108:414–422.
Fh, W.R. 1987. Sob. p. 533–576. In W.R. Fh (.) P-
cps o cutv vopmt. Mcm , N Yok.
Hg, S.G., J. Vkou, J.G. Ws. 2000. Gtc vst
hts got gss. Tho. App. Gt. 101:309–316.
Htt, E.E., III, N.S. H, J.H. Bouto, C.W. Mms. 1997.
Mooco tbos o tcto o Neotyphodium coeno-
phialum. Cop Sc. 37:1265–1269.
Htt, E.E., III, N.S. H, J.H. Bouto, J.A. Stum.
1999. T scu opht tcto: Commc mmu-
obot tst kt comp th mcoscop ss. Cop Sc.
39:796–799.
Htchcock, A.S., A. Chs. 1971. Mu o th gsss o thUt Stts. 2 . Dov, N Yok.
Hopks, A.A., C.P. Wst. 2002. Psstc, gzg to-
c, cov o coo sso p gss ccssos
go th South Gt Ps. p. 4–8. In A.A. Hopks
(.) Gss Bs’ Wok Pg Co., 36th, Amo,
OK. 23–24 M 2000. Nob Fouto, Amo, OK.
Js, K.B., Y.F. Zhg, D.R. D. 1990. Mo o po-
to o p spcs o th Ttc to to
gomc g. C. J. Pt Sc. 70:215–225.
Kpp, E.E., K.J. Rc. 1996. Gtc stuctu g o
bu (Elymus glaucus): Impctos o tv gss-
stoto. Rsto. Eco. 4:1–10.
Kum, P.S., P.D. Wto. 1992. Itogsso o gs omC to s htgss: Ctoog tt
o bckcoss pog. Gom 35:894–896.
Luchtm, A., K. C. 1993. Nocpoc comptb-
t bt Epichloë typhina ou host gsss. Mcoog
85:157–163.
Lo-R, J., E. K, S.D. Mh. 2003. Pt ct
sht: Vg . Avb t http://pts.us.gov/
ctsht/oc/s_v3.oc (v 25 Fb. 2009). USDA–
NRCS, Wshgto, DC.
Loz, L.L., R.C. Shomk. 1996. Gtc toshps
th o U.S. sob cutv goups. Cop Sc. 36:743–752.
Mosk, D., A. Luchtm, D. Schmt, J. Nosbg.
1997. Goth t sttus mo scu s fct
b Neotyphodium Phialophora spcs ophts. Ago. J. 89:673–678.
Mosk, D.P., D.P. Bsk, G.C. Ls. 2005. Abotc
stsss ophtc gsss. p. 187–199. In C.A. Robts t .
(.) Neotyphodium coo-sso gsss. Bck, Ams, IA.
McM, E., G. Su. 2004. Gtc toshps o tt-
po Elymus spcs th gomc oo spcs
om poms ch cto-stcto gth pomo-
phsm ss o choopst g gos. Tho. App.
Gt. 108:535–542.
Moo, C.D., K.D. Cv, A. Luchtm, S.L. Cmt,
C.L. Sch. 2004. Pvc o tspcc hbs
mogst sxu ug ophts o gsss. Mo. Eco
13:1455–1467.
Moo, C.D., B.A. Tpp, B. Scott. 1999. Itcto o
pchoë ophts pt b mcostt-bs PCR
gptg ss th utomt ss. App. Evo
Mcobo. 65:1268–1279.
Nso, E.N., R.J. T. 1978. Hbzto togs-
so bt Elymus canadensis Elymus virginicus (Poc)
Poc. Ok. Ac. Sc. 58:32–34.
Nvo, E., E. Gobg, A. Bs, A.D.H. Bo, D. Zoh
1982. Gtc vst vomt ssoctos o ht Triticum dicoccoides Is. Tho. App. Gt
78:260–264.
No, R.K., F.L. Pg, M.R. No. 1996. F spos
to ogc mtt, buscu mcohz ug,
tz cmto o tcot o o tg. Pt So
179:89–97.
Ov, J.W. 2005. Pthophsoogc spos to opht toxs
p. 291–304. In C.A. Robts t . (.) Neotyphodium coo-
sso gsss. Bck, Ams, IA.
Pcco, D.G., J. Wg, C.A. Youg, C.L. Sch, B. Scott,
P. Dmogkoo. 2001. Emto o gov om gss–
Neotyphodium opht smboss b gtc mocto o
th opht. Poc. Nt. Ac. Sc. USA 98:12820–12825.Pk, C.H., P.D. Wto. 1989. Embo-cus-gt
hbs th cohchc-uc mphpos bt
Elymus canadensis Secale cereale . Tho. App. Gt
78:721–727.
P, W.F., S.C. Am. 2006. Rgo vopmt
o ochgss chok stmto o s oss. P
Ds. 90:240–244.
Po, F., J. 1979. Psc o omcohz ug ct
g co m spo. J. So Wt Cosv. 34:186–187.
Pop, A.J., S.A. Boos. 2005. Botc sposs ophtc
gsss. p. 163–185. In C.A. Robts t . (.) Neotyphodium
coo-sso gsss. Bck, Ams, IA.
Rbo-Cvho, C., H. Gus-Pto, G. Igjs, P. St-phso, T. Schzch, J.S. Hsop-H so. 2004
Hgh vs o gtc vst thoughout th g o
th Potugus ht c ‘Bb’. A. Bot. (Lo.
94:699–705.
Russ, J.R., A. Booth, J.D. Fu, M. Bum, S. Ccc, S
Go, W. Po. 2003. Ptts o pomophsm
tct th choopst uc goms o b -
cs smp om S Jo. Tho. App. Gt
107:413–421.
Sh, M.C., M.A.R. M, I. Euj, J.C. Zotz, L. Wg
G.D. M. 2004. T scu EST-SSR mks th
tsb t coss sv gss spcs. Tho. App. Gt
109:783–791.
Ss, T.B., J.L. Hmck. 1980. Vto th bgsstm o Elymus canadensis. Evouto 34:117–122.
Ss, T.B., J.L. Hmck, L.R. Ho. 1979. Aozm
vto Elymus canadensis om th tgss p go
Gogphc v to. Am. M. Nt. 101:1–12.
Sso, M.A., R.H. Sk, J. Kujsk, M. v
Gt. 2004. Vg vut s pott
tv coo-sso og th othst USA. Cop Sc
44:1379–1384.
Sso, M.A., R.H. Sk, M. v Gt, J. Kujsk
2004b. Nuttv vu o Vg , coo-sso gs
tv to th othst USA. Cop Sc. 44:1385–1390.
7/30/2019 cs-49-3-913
http://slidepdf.com/reader/full/cs-49-3-913 10/10
922 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, MAY–JUNE 2009
Schust, J.L., R.C. Lo Gc. 1973. Phoog o-
g poucto o coo sso gsss th South Ps.
J. Rg Mg. 26:336–339.
Su, G., B. Somo, R. vo Bothm. 1997. Ass o tt-
po Elymus spcs usg ht mcostt mks
RAPD mks. Gom 40:806–814.
Sofo, D.L. 2002. PAUP*: Phogtc ss usg p-
smo ( oth mthos) 4.0 Bt [CD-ROM]. Su
Assoc., Su, MA.
Tshom, A., A.H.D. Bo, T. Hogk. 2001. Dvst
cs o c gum cops. p. 221–261. In J. Jck(.) Pt bg vs. Vo. 21. AVI, Wstpot, CT.
Th, T., W. Mchk, R.K. Vsh, A. G. 2003.
Expotg EST tbss o th vopmt chc-
tzto o g-v SSR-mks b (Hordeum
vulgare L.). Tho. App. Gt. 106:411–422.
Thompso, F.N., J.A. Stum, N.S. H. 2001. At-
qut ctos ssoct th kos st tmpt
pstu. J. Rg Mg. 54:474–489.
USDA–NRCS. 2000. Io gmpsm C . Avb
t http://.pt-mt s.cs.us.gov/pubs/mopmcb-
c4gm.p, (v 25 Fb. 2009). USDA–NRCS, Wsh-
gto, DC.
USDA–NRCS. 2003. Wt ptgs o . Avb thttp://..cs.us.gov/tt/TchcNots/I-
_Tch_ot_3.p (v 25 Fb. 2009). I Bo-
og Tch. Not 3. USDA–NRCS, Wshg to, DC.
USDA–NRCS. .. Notc o s o Lvc C -
. Avb t http://pt-mts.cs.us.gov/pubs/
stpmc1373.p (v 5 M. 2009). USDA–NRCS,
Wshgto, DC.
Vsh, R.K., R. Sgmu, A. Bo, V. Kozu, N. St,
M.E. Sos, P. Lgg, A. G. 2005. Itsp-
cc tsbt comptv mppg o b EST-
SSR mks ht, c. Pt Sc. 168:195–202.
Vto, M.A., E.S. Ktho, K.P. Vog, A.A. Hopks. 2001.
Eophtc ug C tu gsss. J.
Rg Mg. 54:390–395.
Vog, K.P., A.A. Hopks, K.J. Moo, K.D. Johso, I.T.
Cso. 2006. Gtc vto mog C ccssos om Mst USA mt ps o bomss
oth t ts. Cop Sc. 46:2348–2353.
Wst, C.P., E. Izko, K.E. Tu, A.A. Em. 1993. Eo-
pht fcts o goth psstc o t scu og
t-supp gt. Ago. J. 85:264–270.
Wht, J.F., J., T.L. Butm. 1987. Eopht-host ssoc-
tos og gsss: VIII. Htothsm Epichloë typh-
ina. Am. J. Bot. 74:1716–1721.
Youg, C.A., M.K. Bt, M.J. Chsts, B.A. Tpp, G.T.
B, B. Scott. 2005. Mocu cog gtc
ss o smbos s-xpss g cust o otm bo-
sthss om mutustc opht o p gss.
Mo. Gt. Gomcs 274:13–29.Zhg, P., S. Dsgck, A. Bukt, S. Akhj, A.E. Mch-
g, M.L. Wbuto. 2006. Gtc vst -
toshps o ht cs om Om vstgt th
SSR mks. Gt. Rsou. Cop Evo. 53:1351–1360.
Recommended